>Feature sequence01 <1 819 gene locus_tag LOCUS_00010 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389325.1:monovalent cation/H+ antiporter subunit D family protein 816 2282 gene locus_tag LOCUS_00020 816 2282 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 protein_id gnl|my_center|LOCUS_00020 2284 2538 gene locus_tag LOCUS_00030 2284 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2531 4225 gene locus_tag LOCUS_00040 2531 4225 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_00040 4364 6169 gene locus_tag LOCUS_00050 4364 6169 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_00050 6305 7492 gene locus_tag LOCUS_00060 6305 7492 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_00060 7493 8308 gene locus_tag LOCUS_00070 gene rhdA 7493 8308 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_00070 8308 9192 gene locus_tag LOCUS_00080 8308 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9613 9203 gene locus_tag LOCUS_00090 9613 9203 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073357.1 protein_id gnl|my_center|LOCUS_00090 13797 10018 gene locus_tag LOCUS_00100 gene pilY1 13797 10018 CDS product type 4a pilus biogenesis protein PilY1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115287.1 protein_id gnl|my_center|LOCUS_00100 14521 13832 gene locus_tag LOCUS_00110 14521 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15531 14518 gene locus_tag LOCUS_00120 15531 14518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16052 15528 gene locus_tag LOCUS_00130 16052 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16554 16045 gene locus_tag LOCUS_00140 16554 16045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17629 16637 gene locus_tag LOCUS_00150 gene epmA 17629 16637 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770152.1 protein_id gnl|my_center|LOCUS_00150 18208 17639 gene locus_tag LOCUS_00160 gene efp 18208 17639 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_00160 18294 19253 gene locus_tag LOCUS_00170 gene epmB 18294 19253 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958496.1 protein_id gnl|my_center|LOCUS_00170 19568 21274 gene locus_tag LOCUS_00180 19568 21274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21452 23581 gene locus_tag LOCUS_00190 gene fimX 21452 23581 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_00190 24574 23666 gene locus_tag LOCUS_00200 24574 23666 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_00200 25805 24579 gene locus_tag LOCUS_00210 25805 24579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26675 25812 gene locus_tag LOCUS_00220 26675 25812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26994 27518 gene locus_tag LOCUS_00230 26994 27518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27560 28615 gene locus_tag LOCUS_00240 gene nadA 27560 28615 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185886.1 protein_id gnl|my_center|LOCUS_00240 28698 30164 gene locus_tag LOCUS_00250 gene nhaD 28698 30164 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_00250 30237 30324 gene locus_tag LOCUS_t00010 30237 30324 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 30825 32114 gene locus_tag LOCUS_00260 30825 32114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32123 32701 gene locus_tag LOCUS_00270 32123 32701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32698 33480 gene locus_tag LOCUS_00280 32698 33480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444655.1 protein_id gnl|my_center|LOCUS_00280 35060 33543 gene locus_tag LOCUS_00290 gene glgA 35060 33543 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_00290 35198 36838 gene locus_tag LOCUS_00300 gene pgi 35198 36838 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_00300 37608 37012 gene locus_tag LOCUS_00310 gene lexA 37608 37012 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392634.1 protein_id gnl|my_center|LOCUS_00310 37822 39663 gene locus_tag LOCUS_00320 37822 39663 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_00320 40891 39605 gene locus_tag LOCUS_00330 40891 39605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_00330 41040 41513 gene locus_tag LOCUS_00340 41040 41513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41541 41840 gene locus_tag LOCUS_00350 41541 41840 CDS product DUF5062 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 protein_id gnl|my_center|LOCUS_00350 42477 41860 gene locus_tag LOCUS_00360 42477 41860 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 protein_id gnl|my_center|LOCUS_00360 43354 42647 gene locus_tag LOCUS_00370 43354 42647 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_00370 44317 43355 gene locus_tag LOCUS_00380 gene arsS 44317 43355 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_00380 44487 44563 gene locus_tag LOCUS_t00020 44487 44563 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45419 45000 gene locus_tag LOCUS_00390 45419 45000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45966 45484 gene locus_tag LOCUS_00400 45966 45484 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 protein_id gnl|my_center|LOCUS_00400 46767 46033 gene locus_tag LOCUS_00410 46767 46033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 47564 46764 gene locus_tag LOCUS_00420 47564 46764 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 protein_id gnl|my_center|LOCUS_00420 48451 47561 gene locus_tag LOCUS_00430 gene motD 48451 47561 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 protein_id gnl|my_center|LOCUS_00430 49201 48461 gene locus_tag LOCUS_00440 49201 48461 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_00440 50232 49201 gene locus_tag LOCUS_00450 50232 49201 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895569.1 protein_id gnl|my_center|LOCUS_00450 52324 50330 gene locus_tag LOCUS_00460 52324 50330 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073093.1 protein_id gnl|my_center|LOCUS_00460 53055 52327 gene locus_tag LOCUS_00470 53055 52327 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262351.1 protein_id gnl|my_center|LOCUS_00470 53457 53071 gene locus_tag LOCUS_00480 gene cheY 53457 53071 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_00480 54204 53491 gene locus_tag LOCUS_00490 gene fliA 54204 53491 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_00490 54950 54228 gene locus_tag LOCUS_00500 gene fleN 54950 54228 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412391.1 protein_id gnl|my_center|LOCUS_00500 54873 55082 gene locus_tag LOCUS_00510 54873 55082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 56343 55102 gene locus_tag LOCUS_00520 gene flhF 56343 55102 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114281.1 protein_id gnl|my_center|LOCUS_00520 58521 56434 gene locus_tag LOCUS_00530 gene flhA 58521 56434 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_00530 59718 58585 gene locus_tag LOCUS_00540 gene flhB 59718 58585 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_00540 60501 59722 gene locus_tag LOCUS_00550 gene fliR 60501 59722 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_00550 60788 60519 gene locus_tag LOCUS_00560 gene fliQ 60788 60519 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947514.1 protein_id gnl|my_center|LOCUS_00560 61591 60863 gene locus_tag LOCUS_00570 gene fliP 61591 60863 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083052.1 protein_id gnl|my_center|LOCUS_00570 62013 61588 gene locus_tag LOCUS_00580 62013 61588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 62441 62010 gene locus_tag LOCUS_00590 gene fliN 62441 62010 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316817.1 protein_id gnl|my_center|LOCUS_00590 63469 62465 gene locus_tag LOCUS_00600 gene fliM 63469 62465 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037085.1 protein_id gnl|my_center|LOCUS_00600 64061 63474 gene locus_tag LOCUS_00610 64061 63474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 64531 65691 gene locus_tag LOCUS_00620 64531 65691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 65688 66413 gene locus_tag LOCUS_00630 65688 66413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 66427 67227 gene locus_tag LOCUS_00640 66427 67227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 67288 68241 gene locus_tag LOCUS_00650 67288 68241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 68241 69212 gene locus_tag LOCUS_00660 68241 69212 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 protein_id gnl|my_center|LOCUS_00660 69320 72226 gene locus_tag LOCUS_00670 69320 72226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 72248 72706 gene locus_tag LOCUS_00680 72248 72706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 72992 74182 gene locus_tag LOCUS_00690 gene sat 72992 74182 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_00690 74261 74857 gene locus_tag LOCUS_00700 74261 74857 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_00700 75976 74837 gene locus_tag LOCUS_00710 gene dapE 75976 74837 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457682.1 protein_id gnl|my_center|LOCUS_00710 76868 76047 gene locus_tag LOCUS_00720 gene dapD 76868 76047 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212128.1 protein_id gnl|my_center|LOCUS_00720 78088 76892 gene locus_tag LOCUS_00730 gene dapC 78088 76892 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_00730 78974 78213 gene locus_tag LOCUS_00740 gene lpxH 78974 78213 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113585.1 protein_id gnl|my_center|LOCUS_00740 79413 78925 gene locus_tag LOCUS_00750 79413 78925 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_00750 80008 79427 gene locus_tag LOCUS_00760 80008 79427 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943932.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00760 80213 81595 gene locus_tag LOCUS_00770 gene cysS 80213 81595 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 protein_id gnl|my_center|LOCUS_00770 81735 84113 gene locus_tag LOCUS_00780 gene ppsA 81735 84113 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098065.1 protein_id gnl|my_center|LOCUS_00780 84228 85895 gene locus_tag LOCUS_00790 gene ettA 84228 85895 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_00790 87028 86480 gene locus_tag LOCUS_00800 87028 86480 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989088.1 protein_id gnl|my_center|LOCUS_00800 87129 87725 gene locus_tag LOCUS_00810 87129 87725 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943859.1 protein_id gnl|my_center|LOCUS_00810 87792 88313 gene locus_tag LOCUS_00820 87792 88313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 88671 88300 gene locus_tag LOCUS_00830 88671 88300 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036887.1 protein_id gnl|my_center|LOCUS_00830 88834 90042 gene locus_tag LOCUS_00840 gene alaC 88834 90042 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947188.1 protein_id gnl|my_center|LOCUS_00840 90076 91389 gene locus_tag LOCUS_00850 90076 91389 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_00850 91434 92516 gene locus_tag LOCUS_00860 gene thrC 91434 92516 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048893.1 protein_id gnl|my_center|LOCUS_00860 92666 93646 gene locus_tag LOCUS_00870 92666 93646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 94423 93632 gene locus_tag LOCUS_00880 94423 93632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 94914 94603 gene locus_tag LOCUS_00890 94914 94603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 94807 95061 gene locus_tag LOCUS_00900 94807 95061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 95061 95759 gene locus_tag LOCUS_00910 gene tsaA 95061 95759 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 protein_id gnl|my_center|LOCUS_00910 96462 95752 gene locus_tag LOCUS_00920 96462 95752 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_00920 97037 96459 gene locus_tag LOCUS_00930 97037 96459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 97876 97034 gene locus_tag LOCUS_00940 97876 97034 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_00940 98659 99618 gene locus_tag LOCUS_00950 gene rluC 98659 99618 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157930.1 protein_id gnl|my_center|LOCUS_00950 99620 100282 gene locus_tag LOCUS_00960 99620 100282 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_00960 100377 101321 gene locus_tag LOCUS_00970 gene sppA 100377 101321 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_00970 102227 102151 gene locus_tag LOCUS_t00030 102227 102151 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 102665 102315 gene locus_tag LOCUS_00980 102665 102315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 102757 102847 gene locus_tag LOCUS_t00040 102757 102847 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 104660 103107 gene locus_tag LOCUS_00990 104660 103107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 105170 106582 gene locus_tag LOCUS_01000 105170 106582 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_01000 106582 108588 gene locus_tag LOCUS_01010 106582 108588 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_01010 108601 109332 gene locus_tag LOCUS_01020 108601 109332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 109345 109803 gene locus_tag LOCUS_01030 109345 109803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 109809 110609 gene locus_tag LOCUS_01040 109809 110609 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922304.1 protein_id gnl|my_center|LOCUS_01040 110616 111215 gene locus_tag LOCUS_01050 110616 111215 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002258733.1 protein_id gnl|my_center|LOCUS_01050 111242 112096 gene locus_tag LOCUS_01060 111242 112096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 >Feature sequence02 1877 231 gene locus_tag LOCUS_01070 1877 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 2131 2553 gene locus_tag LOCUS_01080 2131 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 2578 4386 gene locus_tag LOCUS_01090 2578 4386 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763446.1 protein_id gnl|my_center|LOCUS_01090 4452 6137 gene locus_tag LOCUS_01100 4452 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 6143 6649 gene locus_tag LOCUS_01110 6143 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 6660 7547 gene locus_tag LOCUS_01120 6660 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 7812 7555 gene locus_tag LOCUS_01130 7812 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 8111 7809 gene locus_tag LOCUS_01140 8111 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 8269 8970 gene locus_tag LOCUS_01150 8269 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 9153 10283 gene locus_tag LOCUS_01160 9153 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 10268 11242 gene locus_tag LOCUS_01170 10268 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 11307 12242 gene locus_tag LOCUS_01180 11307 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 12239 15925 gene locus_tag LOCUS_01190 12239 15925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 16069 18012 gene locus_tag LOCUS_01200 16069 18012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 18602 17991 gene locus_tag LOCUS_01210 gene slmA 18602 17991 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073926.1 protein_id gnl|my_center|LOCUS_01210 19498 18602 gene locus_tag LOCUS_01220 gene argB 19498 18602 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_01220 22106 19518 gene locus_tag LOCUS_01230 22106 19518 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114359.1 protein_id gnl|my_center|LOCUS_01230 22564 22106 gene locus_tag LOCUS_01240 gene dut 22564 22106 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098293.1 protein_id gnl|my_center|LOCUS_01240 23753 22533 gene locus_tag LOCUS_01250 gene coaBC 23753 22533 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_01250 24008 24682 gene locus_tag LOCUS_01260 gene radC 24008 24682 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_01260 24800 25036 gene locus_tag LOCUS_01270 gene rpmB 24800 25036 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096556.1 protein_id gnl|my_center|LOCUS_01270 25049 25204 gene locus_tag LOCUS_01280 gene rpmG 25049 25204 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205031.1 protein_id gnl|my_center|LOCUS_01280 25921 26325 gene locus_tag LOCUS_01290 25921 26325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 27712 26306 gene locus_tag LOCUS_01300 27712 26306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 28741 27830 gene locus_tag LOCUS_01310 gene xerC 28741 27830 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246535.1 protein_id gnl|my_center|LOCUS_01310 29451 28753 gene locus_tag LOCUS_01320 29451 28753 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_01320 30278 29448 gene locus_tag LOCUS_01330 gene dapF 30278 29448 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073967.1 protein_id gnl|my_center|LOCUS_01330 30404 33223 gene locus_tag LOCUS_01340 30404 33223 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_01340 33854 33339 gene locus_tag LOCUS_01350 gene def 33854 33339 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_01350 34611 34099 gene locus_tag LOCUS_01360 34611 34099 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_01360 35473 34658 gene locus_tag LOCUS_01370 35473 34658 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_01370 36266 35511 gene locus_tag LOCUS_01380 gene pgeF 36266 35511 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112833.1 protein_id gnl|my_center|LOCUS_01380 37219 36266 gene locus_tag LOCUS_01390 gene rluD 37219 36266 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079112.1 protein_id gnl|my_center|LOCUS_01390 37341 38174 gene locus_tag LOCUS_01400 37341 38174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 38648 38310 gene locus_tag LOCUS_01410 gene glnB 38648 38310 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308848.1 protein_id gnl|my_center|LOCUS_01410 40309 38705 gene locus_tag LOCUS_01420 40309 38705 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704658.1 protein_id gnl|my_center|LOCUS_01420 40411 42081 gene locus_tag LOCUS_01430 gene pilS 40411 42081 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_01430 42078 43424 gene locus_tag LOCUS_01440 gene pilR 42078 43424 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_01440 43509 44693 gene locus_tag LOCUS_01450 43509 44693 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_01450 45122 45535 gene locus_tag LOCUS_01460 45122 45535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 45637 46011 gene locus_tag LOCUS_01470 45637 46011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 46203 47915 gene locus_tag LOCUS_01480 gene pilB 46203 47915 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_01480 47921 49171 gene locus_tag LOCUS_01490 47921 49171 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_01490 49211 50086 gene locus_tag LOCUS_01500 49211 50086 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266634.1 protein_id gnl|my_center|LOCUS_01500 50086 51816 gene locus_tag LOCUS_01510 50086 51816 CDS product PglL family O-oligosaccharyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261143.1 protein_id gnl|my_center|LOCUS_01510 51855 52457 gene locus_tag LOCUS_01520 gene coaE 51855 52457 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070773.1 protein_id gnl|my_center|LOCUS_01520 52474 53241 gene locus_tag LOCUS_01530 gene zapD 52474 53241 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_01530 54045 53254 gene locus_tag LOCUS_01540 54045 53254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 54409 55230 gene locus_tag LOCUS_01550 54409 55230 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_01550 55304 56455 gene locus_tag LOCUS_01560 55304 56455 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958109.1 protein_id gnl|my_center|LOCUS_01560 56443 57312 gene locus_tag LOCUS_01570 56443 57312 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_01570 57309 57584 gene locus_tag LOCUS_01580 57309 57584 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237935.1 protein_id gnl|my_center|LOCUS_01580 57596 58210 gene locus_tag LOCUS_01590 gene lipB 57596 58210 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 protein_id gnl|my_center|LOCUS_01590 58207 59181 gene locus_tag LOCUS_01600 gene lipA 58207 59181 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958112.1 protein_id gnl|my_center|LOCUS_01600 59178 59936 gene locus_tag LOCUS_01610 59178 59936 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 protein_id gnl|my_center|LOCUS_01610 60079 60279 gene locus_tag LOCUS_01620 60079 60279 CDS product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941661.1 protein_id gnl|my_center|LOCUS_01620 60698 60498 gene locus_tag LOCUS_01630 gene rpmE 60698 60498 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768737.1 protein_id gnl|my_center|LOCUS_01630 61167 60793 gene locus_tag LOCUS_01640 61167 60793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 62877 61468 gene locus_tag LOCUS_01650 62877 61468 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948529.1 protein_id gnl|my_center|LOCUS_01650 63425 62886 gene locus_tag LOCUS_01660 63425 62886 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_01660 63627 64502 gene locus_tag LOCUS_01670 gene dapA 63627 64502 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_01670 64611 65732 gene locus_tag LOCUS_01680 gene bamC 64611 65732 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930437.1 protein_id gnl|my_center|LOCUS_01680 65768 66538 gene locus_tag LOCUS_01690 65768 66538 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_01690 66514 66945 gene locus_tag LOCUS_01700 66514 66945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071246.1 protein_id gnl|my_center|LOCUS_01700 67422 70253 gene locus_tag LOCUS_01710 67422 70253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 71217 72434 gene locus_tag LOCUS_01720 71217 72434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 72431 73198 gene locus_tag LOCUS_01730 gene ccsA 72431 73198 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943519.1 protein_id gnl|my_center|LOCUS_01730 73332 73730 gene locus_tag LOCUS_01740 73332 73730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 73867 76650 gene locus_tag LOCUS_01750 gene rapA 73867 76650 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119658.1 protein_id gnl|my_center|LOCUS_01750 76775 76850 gene locus_tag LOCUS_t00050 76775 76850 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 77334 78371 gene locus_tag LOCUS_01760 77334 78371 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963388.1 protein_id gnl|my_center|LOCUS_01760 78373 79515 gene locus_tag LOCUS_01770 gene neuC 78373 79515 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963387.1 protein_id gnl|my_center|LOCUS_01770 79516 80274 gene locus_tag LOCUS_01780 gene wbuZ 79516 80274 CDS product glycosyl amidation-associated protein WbuZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213307.1 protein_id gnl|my_center|LOCUS_01780 80271 80915 gene locus_tag LOCUS_01790 gene hisH 80271 80915 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946487.1 protein_id gnl|my_center|LOCUS_01790 80926 82155 gene locus_tag LOCUS_01800 80926 82155 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014841181.1 protein_id gnl|my_center|LOCUS_01800 82148 82852 gene locus_tag LOCUS_01810 82148 82852 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403384.1 protein_id gnl|my_center|LOCUS_01810 82839 83993 gene locus_tag LOCUS_01820 82839 83993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 86111 84048 gene locus_tag LOCUS_01830 86111 84048 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819987.1 protein_id gnl|my_center|LOCUS_01830 86866 86585 gene locus_tag LOCUS_01840 86866 86585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 87368 86928 gene locus_tag LOCUS_01850 gene fliS 87368 86928 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_01850 88732 87380 gene locus_tag LOCUS_01860 gene fliD 88732 87380 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146764.1 protein_id gnl|my_center|LOCUS_01860 89301 88885 gene locus_tag LOCUS_01870 gene flaG 89301 88885 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481049.1 protein_id gnl|my_center|LOCUS_01870 90891 89377 gene locus_tag LOCUS_01880 90891 89377 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_01880 92590 91124 gene locus_tag LOCUS_01890 92590 91124 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268453.1 protein_id gnl|my_center|LOCUS_01890 94626 92593 gene locus_tag LOCUS_01900 gene flgK 94626 92593 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 protein_id gnl|my_center|LOCUS_01900 95642 94692 gene locus_tag LOCUS_01910 gene flgJ 95642 94692 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065604908.1 protein_id gnl|my_center|LOCUS_01910 96694 95642 gene locus_tag LOCUS_01920 96694 95642 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_01920 97512 96805 gene locus_tag LOCUS_01930 gene flgH 97512 96805 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082166.1 protein_id gnl|my_center|LOCUS_01930 98326 97541 gene locus_tag LOCUS_01940 gene flgG 98326 97541 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625837.1 protein_id gnl|my_center|LOCUS_01940 99259 98522 gene locus_tag LOCUS_01950 99259 98522 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767027.1 protein_id gnl|my_center|LOCUS_01950 100669 99278 gene locus_tag LOCUS_01960 gene flgE 100669 99278 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 protein_id gnl|my_center|LOCUS_01960 101374 100694 gene locus_tag LOCUS_01970 gene flgD 101374 100694 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946950.1 protein_id gnl|my_center|LOCUS_01970 101801 101388 gene locus_tag LOCUS_01980 gene flgC 101801 101388 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 protein_id gnl|my_center|LOCUS_01980 102193 101804 gene locus_tag LOCUS_01990 gene flgB 102193 101804 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 protein_id gnl|my_center|LOCUS_01990 103214 102369 gene locus_tag LOCUS_02000 gene cheR 103214 102369 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382687.1 protein_id gnl|my_center|LOCUS_02000 104177 103236 gene locus_tag LOCUS_02010 104177 103236 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_02010 104364 105089 gene locus_tag LOCUS_02020 104364 105089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 105241 105561 gene locus_tag LOCUS_02030 105241 105561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 105564 106043 gene locus_tag LOCUS_02040 105564 106043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence03 390 626 gene locus_tag LOCUS_02050 390 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 1987 623 gene locus_tag LOCUS_02060 gene degQ 1987 623 CDS product Do family serine endopeptidase DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073684.1 protein_id gnl|my_center|LOCUS_02060 2960 2067 gene locus_tag LOCUS_02070 gene znuA 2960 2067 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971688.1 protein_id gnl|my_center|LOCUS_02070 3141 3905 gene locus_tag LOCUS_02080 gene znuC 3141 3905 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768460.1 protein_id gnl|my_center|LOCUS_02080 3898 4680 gene locus_tag LOCUS_02090 gene znuB 3898 4680 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240526.1 protein_id gnl|my_center|LOCUS_02090 4677 5474 gene locus_tag LOCUS_02100 gene mazG 4677 5474 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703306.1 protein_id gnl|my_center|LOCUS_02100 6463 5537 gene locus_tag LOCUS_02110 6463 5537 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267361.1 protein_id gnl|my_center|LOCUS_02110 6626 7795 gene locus_tag LOCUS_02120 6626 7795 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038595.1 protein_id gnl|my_center|LOCUS_02120 8520 7789 gene locus_tag LOCUS_02130 gene cysZ 8520 7789 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115194.1 protein_id gnl|my_center|LOCUS_02130 8963 9535 gene locus_tag LOCUS_02140 8963 9535 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_02140 9586 11274 gene locus_tag LOCUS_02150 9586 11274 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_02150 11287 12309 gene locus_tag LOCUS_02160 11287 12309 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390867.1 protein_id gnl|my_center|LOCUS_02160 12257 13726 gene locus_tag LOCUS_02170 12257 13726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 13734 14759 gene locus_tag LOCUS_02180 13734 14759 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_02180 14818 15903 gene locus_tag LOCUS_02190 gene wecB 14818 15903 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_02190 15906 16775 gene locus_tag LOCUS_02200 15906 16775 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_02200 16782 17813 gene locus_tag LOCUS_02210 16782 17813 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_02210 17827 19059 gene locus_tag LOCUS_02220 17827 19059 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_02220 19031 20605 gene locus_tag LOCUS_02230 gene xrtA 19031 20605 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_02230 20602 21765 gene locus_tag LOCUS_02240 20602 21765 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483418.1 protein_id gnl|my_center|LOCUS_02240 21837 22112 gene locus_tag LOCUS_02250 21837 22112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_02250 22112 22393 gene locus_tag LOCUS_02260 22112 22393 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_02260 22603 22343 gene locus_tag LOCUS_02270 22603 22343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 22538 24451 gene locus_tag LOCUS_02280 22538 24451 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_02280 24457 25662 gene locus_tag LOCUS_02290 24457 25662 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942493.1 protein_id gnl|my_center|LOCUS_02290 25669 26772 gene locus_tag LOCUS_02300 25669 26772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 26769 28121 gene locus_tag LOCUS_02310 26769 28121 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_02310 28356 29672 gene locus_tag LOCUS_02320 28356 29672 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_02320 29663 30706 gene locus_tag LOCUS_02330 29663 30706 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_02330 31202 31624 gene locus_tag LOCUS_02340 31202 31624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 32117 33283 gene locus_tag LOCUS_02350 32117 33283 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626578.1 protein_id gnl|my_center|LOCUS_02350 33322 34026 gene locus_tag LOCUS_02360 33322 34026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 34548 35315 gene locus_tag LOCUS_02370 34548 35315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 35447 36157 gene locus_tag LOCUS_02380 35447 36157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 36270 36464 gene locus_tag LOCUS_02390 36270 36464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 37041 36634 gene locus_tag LOCUS_02400 37041 36634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 37280 37038 gene locus_tag LOCUS_02410 37280 37038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 38070 38234 gene locus_tag LOCUS_02420 38070 38234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 38760 39905 gene locus_tag LOCUS_02430 38760 39905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 39914 40918 gene locus_tag LOCUS_02440 39914 40918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 40991 41662 gene locus_tag LOCUS_02450 40991 41662 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_02450 41769 42047 gene locus_tag LOCUS_02460 41769 42047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 43595 42180 gene locus_tag LOCUS_02470 43595 42180 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_02470 44818 43592 gene locus_tag LOCUS_02480 44818 43592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 45648 46370 gene locus_tag LOCUS_02490 45648 46370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 46395 46646 gene locus_tag LOCUS_02500 46395 46646 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_02500 47387 47566 gene locus_tag LOCUS_02510 47387 47566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 47567 48412 gene locus_tag LOCUS_02520 47567 48412 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_02520 48394 49662 gene locus_tag LOCUS_02530 48394 49662 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_02530 51067 49712 gene locus_tag LOCUS_02540 51067 49712 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_02540 51257 53089 gene locus_tag LOCUS_02550 gene asnB 51257 53089 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_02550 54286 53099 gene locus_tag LOCUS_02560 54286 53099 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_02560 55921 54347 gene locus_tag LOCUS_02570 55921 54347 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_02570 59684 58788 gene locus_tag LOCUS_02580 59684 58788 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_02580 61408 59852 gene locus_tag LOCUS_02590 61408 59852 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942718.1 protein_id gnl|my_center|LOCUS_02590 61781 62146 gene locus_tag LOCUS_02600 61781 62146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 62825 62163 gene locus_tag LOCUS_02610 gene purN 62825 62163 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_02610 63886 62825 gene locus_tag LOCUS_02620 gene purM 63886 62825 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112583.1 protein_id gnl|my_center|LOCUS_02620 64039 65211 gene locus_tag LOCUS_02630 64039 65211 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958404.1 protein_id gnl|my_center|LOCUS_02630 65239 65793 gene locus_tag LOCUS_02640 65239 65793 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_02640 66452 65742 gene locus_tag LOCUS_02650 gene hda 66452 65742 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369632.1 protein_id gnl|my_center|LOCUS_02650 66640 67158 gene locus_tag LOCUS_02660 66640 67158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 67509 67198 gene locus_tag LOCUS_02670 gene pspE 67509 67198 CDS product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473113.1 protein_id gnl|my_center|LOCUS_02670 67624 67436 gene locus_tag LOCUS_02680 67624 67436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 67777 69438 gene locus_tag LOCUS_02690 67777 69438 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103766.1 protein_id gnl|my_center|LOCUS_02690 69450 70166 gene locus_tag LOCUS_02700 69450 70166 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 protein_id gnl|my_center|LOCUS_02700 70393 70941 gene locus_tag LOCUS_02710 gene tpx 70393 70941 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880278.1 protein_id gnl|my_center|LOCUS_02710 71020 72213 gene locus_tag LOCUS_02720 71020 72213 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 protein_id gnl|my_center|LOCUS_02720 74339 72216 gene locus_tag LOCUS_02730 74339 72216 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_02730 74677 74492 gene locus_tag LOCUS_02740 74677 74492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 74688 75716 gene locus_tag LOCUS_02750 74688 75716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 75721 76935 gene locus_tag LOCUS_02760 75721 76935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 77171 78133 gene locus_tag LOCUS_02770 77171 78133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 79405 78173 gene locus_tag LOCUS_02780 79405 78173 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880067.1 protein_id gnl|my_center|LOCUS_02780 80415 79402 gene locus_tag LOCUS_02790 80415 79402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 80667 81326 gene locus_tag LOCUS_02800 80667 81326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 82597 81509 gene locus_tag LOCUS_02810 82597 81509 CDS product peptidoglycan binding protein CsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825630.1 protein_id gnl|my_center|LOCUS_02810 86084 82608 gene locus_tag LOCUS_02820 gene mfd 86084 82608 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024299434.1 protein_id gnl|my_center|LOCUS_02820 86281 86700 gene locus_tag LOCUS_02830 86281 86700 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192175.1 protein_id gnl|my_center|LOCUS_02830 86735 87184 gene locus_tag LOCUS_02840 86735 87184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 87254 88381 gene locus_tag LOCUS_02850 87254 88381 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707495.1 protein_id gnl|my_center|LOCUS_02850 88374 88604 gene locus_tag LOCUS_02860 gene tusA 88374 88604 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_02860 89859 88606 gene locus_tag LOCUS_02870 89859 88606 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880611.1 protein_id gnl|my_center|LOCUS_02870 90039 91097 gene locus_tag LOCUS_02880 90039 91097 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_02880 91136 93310 gene locus_tag LOCUS_02890 91136 93310 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_02890 93451 94389 gene locus_tag LOCUS_02900 gene mutY 93451 94389 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703459.1 protein_id gnl|my_center|LOCUS_02900 94376 94654 gene locus_tag LOCUS_02910 94376 94654 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947644.1 protein_id gnl|my_center|LOCUS_02910 94725 94800 gene locus_tag LOCUS_t00060 94725 94800 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 95285 95503 gene locus_tag LOCUS_02920 95285 95503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 95481 95759 gene locus_tag LOCUS_02930 95481 95759 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_02930 95769 96056 gene locus_tag LOCUS_02940 95769 96056 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_02940 97039 96506 gene locus_tag LOCUS_02950 97039 96506 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707712.1 protein_id gnl|my_center|LOCUS_02950 >Feature sequence04 791 243 gene locus_tag LOCUS_02960 791 243 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350817.1 protein_id gnl|my_center|LOCUS_02960 1036 791 gene locus_tag LOCUS_02970 1036 791 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172220.1 protein_id gnl|my_center|LOCUS_02970 2374 1043 gene locus_tag LOCUS_02980 2374 1043 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 protein_id gnl|my_center|LOCUS_02980 2530 2973 gene locus_tag LOCUS_02990 2530 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 3514 2984 gene locus_tag LOCUS_03000 3514 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 4216 3560 gene locus_tag LOCUS_03010 4216 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 5007 4309 gene locus_tag LOCUS_03020 5007 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_03020 7200 5044 gene locus_tag LOCUS_03030 7200 5044 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704810.1 protein_id gnl|my_center|LOCUS_03030 8662 7706 gene locus_tag LOCUS_03040 gene cysK 8662 7706 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036918.1 protein_id gnl|my_center|LOCUS_03040 9973 8741 gene locus_tag LOCUS_03050 gene yegQ 9973 8741 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_03050 10308 10757 gene locus_tag LOCUS_03060 10308 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 10773 11315 gene locus_tag LOCUS_03070 10773 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 11312 11743 gene locus_tag LOCUS_03080 11312 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 11897 12739 gene locus_tag LOCUS_03090 gene nei 11897 12739 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097546.1 protein_id gnl|my_center|LOCUS_03090 13169 12720 gene locus_tag LOCUS_03100 13169 12720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 13757 13425 gene locus_tag LOCUS_03110 13757 13425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 13975 13826 gene locus_tag LOCUS_03120 13975 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 14252 13929 gene locus_tag LOCUS_03130 14252 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 15553 14588 gene locus_tag LOCUS_03140 15553 14588 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369312.1 protein_id gnl|my_center|LOCUS_03140 15545 16009 gene locus_tag LOCUS_03150 gene trmL 15545 16009 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703791.1 protein_id gnl|my_center|LOCUS_03150 17007 16006 gene locus_tag LOCUS_03160 gene gpsA 17007 16006 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 protein_id gnl|my_center|LOCUS_03160 17502 17011 gene locus_tag LOCUS_03170 gene secB 17502 17011 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772050.1 protein_id gnl|my_center|LOCUS_03170 18012 17533 gene locus_tag LOCUS_03180 18012 17533 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_03180 18533 18054 gene locus_tag LOCUS_03190 18533 18054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 18614 20137 gene locus_tag LOCUS_03200 gene gpmI 18614 20137 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_03200 20162 21355 gene locus_tag LOCUS_03210 20162 21355 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_03210 21379 22758 gene locus_tag LOCUS_03220 gene cptA 21379 22758 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_03220 22766 23623 gene locus_tag LOCUS_03230 22766 23623 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407320.1 protein_id gnl|my_center|LOCUS_03230 24320 23664 gene locus_tag LOCUS_03240 gene rpiA 24320 23664 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071382.1 protein_id gnl|my_center|LOCUS_03240 24476 26029 gene locus_tag LOCUS_03250 gene ilvA 24476 26029 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_03250 26587 26111 gene locus_tag LOCUS_03260 26587 26111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 27000 27263 gene locus_tag LOCUS_03270 gene xanC 27000 27263 CDS product xanthomonadin biosynthesis acyl carrier protein XanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039083.1 protein_id gnl|my_center|LOCUS_03270 27574 28470 gene locus_tag LOCUS_03280 27574 28470 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 protein_id gnl|my_center|LOCUS_03280 28463 29044 gene locus_tag LOCUS_03290 28463 29044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 29106 31355 gene locus_tag LOCUS_03300 29106 31355 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039076.1 protein_id gnl|my_center|LOCUS_03300 32080 31331 gene locus_tag LOCUS_03310 32080 31331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 32066 32215 gene locus_tag LOCUS_03320 32066 32215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 32466 33071 gene locus_tag LOCUS_03330 32466 33071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 33195 33743 gene locus_tag LOCUS_03340 33195 33743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 33740 35074 gene locus_tag LOCUS_03350 gene xanA2 33740 35074 CDS product xanthomonadin biosynthesis 3-hydroxybenozate--AMP ligase XanA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506148.1 protein_id gnl|my_center|LOCUS_03350 35092 36282 gene locus_tag LOCUS_03360 35092 36282 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_03360 36279 37070 gene locus_tag LOCUS_03370 36279 37070 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039070.1 protein_id gnl|my_center|LOCUS_03370 37061 37495 gene locus_tag LOCUS_03380 37061 37495 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039075.1 protein_id gnl|my_center|LOCUS_03380 37492 38211 gene locus_tag LOCUS_03390 gene fabG 37492 38211 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 protein_id gnl|my_center|LOCUS_03390 38212 38964 gene locus_tag LOCUS_03400 38212 38964 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957975.1 protein_id gnl|my_center|LOCUS_03400 38998 39408 gene locus_tag LOCUS_03410 38998 39408 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460588.1 protein_id gnl|my_center|LOCUS_03410 39463 40140 gene locus_tag LOCUS_03420 39463 40140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 40444 40133 gene locus_tag LOCUS_03430 40444 40133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 40421 40612 gene locus_tag LOCUS_03440 40421 40612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 41282 40968 gene locus_tag LOCUS_03450 41282 40968 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_03450 41512 41279 gene locus_tag LOCUS_03460 41512 41279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 41628 42152 gene locus_tag LOCUS_03470 41628 42152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 42152 43468 gene locus_tag LOCUS_03480 gene pepP 42152 43468 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_03480 43465 44556 gene locus_tag LOCUS_03490 gene gcvT 43465 44556 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114049.1 protein_id gnl|my_center|LOCUS_03490 44570 44956 gene locus_tag LOCUS_03500 gene gcvH 44570 44956 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_03500 44981 46342 gene locus_tag LOCUS_03510 gene gcvPA 44981 46342 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945877.1 protein_id gnl|my_center|LOCUS_03510 46336 47790 gene locus_tag LOCUS_03520 gene gcvPB 46336 47790 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945875.1 protein_id gnl|my_center|LOCUS_03520 47822 48754 gene locus_tag LOCUS_03530 47822 48754 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_03530 48764 49282 gene locus_tag LOCUS_03540 gene moaB 48764 49282 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482393.1 protein_id gnl|my_center|LOCUS_03540 49338 50594 gene locus_tag LOCUS_03550 49338 50594 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895459.1 protein_id gnl|my_center|LOCUS_03550 51263 50601 gene locus_tag LOCUS_03560 51263 50601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 51325 52203 gene locus_tag LOCUS_03570 51325 52203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_03570 52200 53198 gene locus_tag LOCUS_03580 52200 53198 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_03580 53236 53865 gene locus_tag LOCUS_03590 gene msrA 53236 53865 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_03590 53862 54359 gene locus_tag LOCUS_03600 gene msrB 53862 54359 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124170.1 protein_id gnl|my_center|LOCUS_03600 54424 54744 gene locus_tag LOCUS_03610 54424 54744 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_03610 54741 55832 gene locus_tag LOCUS_03620 54741 55832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_03620 56079 57587 gene locus_tag LOCUS_03630 56079 57587 CDS product IS1182-like element ISMac2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021981.1 protein_id gnl|my_center|LOCUS_03630 59458 58865 gene locus_tag LOCUS_03640 59458 58865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 61007 59571 gene locus_tag LOCUS_03650 61007 59571 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190901.1 protein_id gnl|my_center|LOCUS_03650 61333 61019 gene locus_tag LOCUS_03660 61333 61019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 61803 61366 gene locus_tag LOCUS_03670 61803 61366 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_03670 63246 61807 gene locus_tag LOCUS_03680 gene gatB 63246 61807 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_03680 64712 63261 gene locus_tag LOCUS_03690 gene gatA 64712 63261 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091960758.1 protein_id gnl|my_center|LOCUS_03690 65063 64776 gene locus_tag LOCUS_03700 gene gatC 65063 64776 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_03700 65244 66293 gene locus_tag LOCUS_03710 65244 66293 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308111.1 protein_id gnl|my_center|LOCUS_03710 66404 67213 gene locus_tag LOCUS_03720 gene mreC 66404 67213 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 protein_id gnl|my_center|LOCUS_03720 67210 67698 gene locus_tag LOCUS_03730 gene mreD 67210 67698 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 protein_id gnl|my_center|LOCUS_03730 67707 69572 gene locus_tag LOCUS_03740 gene mrdA 67707 69572 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_03740 69569 70708 gene locus_tag LOCUS_03750 gene rodA 69569 70708 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818663.1 protein_id gnl|my_center|LOCUS_03750 70736 71764 gene locus_tag LOCUS_03760 gene mltB 70736 71764 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_03760 74540 71847 gene locus_tag LOCUS_03770 74540 71847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 76523 74868 gene locus_tag LOCUS_03780 gene nirS 76523 74868 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_03780 76856 77503 gene locus_tag LOCUS_03790 76856 77503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 78765 77740 gene locus_tag LOCUS_03800 gene holA 78765 77740 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_03800 79310 78804 gene locus_tag LOCUS_03810 79310 78804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 81973 79388 gene locus_tag LOCUS_03820 gene leuS 81973 79388 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_03820 82233 82766 gene locus_tag LOCUS_03830 82233 82766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 84124 82763 gene locus_tag LOCUS_03840 gene mgtE 84124 82763 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037936.1 protein_id gnl|my_center|LOCUS_03840 85943 84195 gene locus_tag LOCUS_03850 gene ptsP 85943 84195 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_03850 86209 85940 gene locus_tag LOCUS_03860 86209 85940 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_03860 86600 86217 gene locus_tag LOCUS_03870 86600 86217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_03870 87460 86597 gene locus_tag LOCUS_03880 gene rapZ 87460 86597 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377550.1 protein_id gnl|my_center|LOCUS_03880 88436 87465 gene locus_tag LOCUS_03890 gene hprK 88436 87465 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993219.1 protein_id gnl|my_center|LOCUS_03890 88903 88433 gene locus_tag LOCUS_03900 gene ptsN 88903 88433 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400244.1 protein_id gnl|my_center|LOCUS_03900 89272 88952 gene locus_tag LOCUS_03910 gene hpf 89272 88952 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_03910 90781 89297 gene locus_tag LOCUS_03920 90781 89297 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_03920 91598 90873 gene locus_tag LOCUS_03930 gene lptB 91598 90873 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_03930 92149 91595 gene locus_tag LOCUS_03940 gene lptA 92149 91595 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424523.1 protein_id gnl|my_center|LOCUS_03940 92702 92136 gene locus_tag LOCUS_03950 92702 92136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 93234 92710 gene locus_tag LOCUS_03960 gene kdsC 93234 92710 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 protein_id gnl|my_center|LOCUS_03960 94232 93234 gene locus_tag LOCUS_03970 94232 93234 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_03970 95263 94229 gene locus_tag LOCUS_03980 95263 94229 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_03980 95443 96291 gene locus_tag LOCUS_03990 gene mlaF 95443 96291 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_03990 96291 97067 gene locus_tag LOCUS_04000 gene mlaE 96291 97067 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174247.1 protein_id gnl|my_center|LOCUS_04000 >Feature sequence05 1198 341 gene locus_tag LOCUS_04010 1198 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 2100 1228 gene locus_tag LOCUS_04020 gene hisG 2100 1228 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_04020 2702 2121 gene locus_tag LOCUS_04030 2702 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 4740 2707 gene locus_tag LOCUS_04040 gene prlC 4740 2707 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_04040 4899 5432 gene locus_tag LOCUS_04050 4899 5432 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_04050 5873 6097 gene locus_tag LOCUS_04060 5873 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04060 6687 9425 gene locus_tag LOCUS_04070 6687 9425 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_04070 10756 9395 gene locus_tag LOCUS_04080 gene xseA 10756 9395 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099131.1 protein_id gnl|my_center|LOCUS_04080 11250 10777 gene locus_tag LOCUS_04090 11250 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 11398 12864 gene locus_tag LOCUS_04100 gene guaB 11398 12864 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947450.1 protein_id gnl|my_center|LOCUS_04100 12924 14510 gene locus_tag LOCUS_04110 gene guaA 12924 14510 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266918.1 protein_id gnl|my_center|LOCUS_04110 17338 15017 gene locus_tag LOCUS_04120 gene hypF 17338 15017 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338264.1 protein_id gnl|my_center|LOCUS_04120 18234 17314 gene locus_tag LOCUS_04130 18234 17314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 19060 18338 gene locus_tag LOCUS_04140 19060 18338 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_04140 19372 19070 gene locus_tag LOCUS_04150 19372 19070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 20431 19379 gene locus_tag LOCUS_04160 gene hypE 20431 19379 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_04160 21570 20428 gene locus_tag LOCUS_04170 gene hypD 21570 20428 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_04170 21791 21567 gene locus_tag LOCUS_04180 21791 21567 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_04180 22615 21794 gene locus_tag LOCUS_04190 22615 21794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 22953 22612 gene locus_tag LOCUS_04200 gene hypA 22953 22612 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_04200 23471 22968 gene locus_tag LOCUS_04210 23471 22968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 23993 23490 gene locus_tag LOCUS_04220 23993 23490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 25449 23977 gene locus_tag LOCUS_04230 25449 23977 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_04230 26093 25464 gene locus_tag LOCUS_04240 26093 25464 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_04240 26794 26090 gene locus_tag LOCUS_04250 26794 26090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 28599 26791 gene locus_tag LOCUS_04260 gene nuoF 28599 26791 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_04260 29019 28606 gene locus_tag LOCUS_04270 29019 28606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 29412 29023 gene locus_tag LOCUS_04280 29412 29023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 29608 29838 gene locus_tag LOCUS_04290 29608 29838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 29828 30166 gene locus_tag LOCUS_04300 29828 30166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 30317 32659 gene locus_tag LOCUS_04310 30317 32659 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119132.1 protein_id gnl|my_center|LOCUS_04310 34202 32664 gene locus_tag LOCUS_04320 34202 32664 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_04320 34468 35748 gene locus_tag LOCUS_04330 34468 35748 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022352.1 protein_id gnl|my_center|LOCUS_04330 35732 36679 gene locus_tag LOCUS_04340 35732 36679 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_04340 38208 36811 gene locus_tag LOCUS_04350 38208 36811 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529892.1 protein_id gnl|my_center|LOCUS_04350 39671 38229 gene locus_tag LOCUS_04360 39671 38229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 40246 39680 gene locus_tag LOCUS_04370 40246 39680 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813582.1 protein_id gnl|my_center|LOCUS_04370 41218 40523 gene locus_tag LOCUS_04380 41218 40523 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196980.1 protein_id gnl|my_center|LOCUS_04380 41394 41194 gene locus_tag LOCUS_04390 gene nrdD 41394 41194 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196981.1 protein_id gnl|my_center|LOCUS_04390 43482 41434 gene locus_tag LOCUS_04400 43482 41434 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_04400 44768 43878 gene locus_tag LOCUS_04410 gene metR 44768 43878 CDS product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 protein_id gnl|my_center|LOCUS_04410 44873 47167 gene locus_tag LOCUS_04420 gene metE 44873 47167 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 protein_id gnl|my_center|LOCUS_04420 47993 47295 gene locus_tag LOCUS_04430 gene anr 47993 47295 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_04430 48954 48271 gene locus_tag LOCUS_04440 48954 48271 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_04440 49548 48967 gene locus_tag LOCUS_04450 49548 48967 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_04450 49777 49529 gene locus_tag LOCUS_04460 49777 49529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 52315 49796 gene locus_tag LOCUS_04470 52315 49796 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_04470 52867 52340 gene locus_tag LOCUS_04480 52867 52340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 54294 52873 gene locus_tag LOCUS_04490 gene ccoG 54294 52873 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895670.1 protein_id gnl|my_center|LOCUS_04490 55312 54464 gene locus_tag LOCUS_04500 gene ccoP 55312 54464 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524999.1 protein_id gnl|my_center|LOCUS_04500 55514 55302 gene locus_tag LOCUS_04510 55514 55302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 56220 55507 gene locus_tag LOCUS_04520 gene ccoO 56220 55507 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 protein_id gnl|my_center|LOCUS_04520 57675 56233 gene locus_tag LOCUS_04530 gene ccoN 57675 56233 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_04530 58037 58711 gene locus_tag LOCUS_04540 58037 58711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 59670 58684 gene locus_tag LOCUS_04550 gene rpoS 59670 58684 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 protein_id gnl|my_center|LOCUS_04550 59922 59677 gene locus_tag LOCUS_04560 59922 59677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 61112 60534 gene locus_tag LOCUS_04570 61112 60534 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_04570 61774 61112 gene locus_tag LOCUS_04580 61774 61112 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766015.1 protein_id gnl|my_center|LOCUS_04580 62524 61787 gene locus_tag LOCUS_04590 gene surE 62524 61787 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073291.1 protein_id gnl|my_center|LOCUS_04590 63219 62896 gene locus_tag LOCUS_04600 63219 62896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 63911 63285 gene locus_tag LOCUS_04610 63911 63285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 65359 64049 gene locus_tag LOCUS_04620 gene amiB 65359 64049 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_04620 65945 65466 gene locus_tag LOCUS_04630 gene tsaE 65945 65466 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262729.1 protein_id gnl|my_center|LOCUS_04630 67438 65939 gene locus_tag LOCUS_04640 67438 65939 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_04640 69043 67478 gene locus_tag LOCUS_04650 69043 67478 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055169.1 protein_id gnl|my_center|LOCUS_04650 70471 69089 gene locus_tag LOCUS_04660 gene hemN 70471 69089 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_04660 71407 70511 gene locus_tag LOCUS_04670 gene prmB 71407 70511 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072977.1 protein_id gnl|my_center|LOCUS_04670 71565 72824 gene locus_tag LOCUS_04680 71565 72824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 73240 72821 gene locus_tag LOCUS_04690 73240 72821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 74980 73682 gene locus_tag LOCUS_04700 gene pabB 74980 73682 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819891.1 protein_id gnl|my_center|LOCUS_04700 >Feature sequence06 435 2180 gene locus_tag LOCUS_04710 435 2180 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_04710 2310 4346 gene locus_tag LOCUS_04720 2310 4346 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_04720 4599 5291 gene locus_tag LOCUS_04730 gene fnr 4599 5291 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243241.1 protein_id gnl|my_center|LOCUS_04730 5389 5721 gene locus_tag LOCUS_04740 5389 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 6160 5984 gene locus_tag LOCUS_04750 6160 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 6159 7445 gene locus_tag LOCUS_04760 gene oprP 6159 7445 CDS product outer membrane porin OprP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119678.1 protein_id gnl|my_center|LOCUS_04760 7680 9152 gene locus_tag LOCUS_04770 7680 9152 CDS product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258464.1 protein_id gnl|my_center|LOCUS_04770 9352 10455 gene locus_tag LOCUS_04780 9352 10455 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_04780 10468 11904 gene locus_tag LOCUS_04790 gene pstC 10468 11904 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_04790 11897 13195 gene locus_tag LOCUS_04800 gene pstA 11897 13195 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_04800 13206 14051 gene locus_tag LOCUS_04810 gene pstB 13206 14051 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 protein_id gnl|my_center|LOCUS_04810 14074 14790 gene locus_tag LOCUS_04820 gene phoU 14074 14790 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813242.1 protein_id gnl|my_center|LOCUS_04820 15255 16466 gene locus_tag LOCUS_04830 15255 16466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 18355 16463 gene locus_tag LOCUS_04840 gene ilvD 18355 16463 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528037.1 protein_id gnl|my_center|LOCUS_04840 18894 18469 gene locus_tag LOCUS_04850 18894 18469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 19892 18906 gene locus_tag LOCUS_04860 gene dusA 19892 18906 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 protein_id gnl|my_center|LOCUS_04860 20180 19905 gene locus_tag LOCUS_04870 20180 19905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 21708 20170 gene locus_tag LOCUS_04880 21708 20170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 23419 21887 gene locus_tag LOCUS_04890 23419 21887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 24067 23570 gene locus_tag LOCUS_04900 24067 23570 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_04900 25004 24048 gene locus_tag LOCUS_04910 gene thiL 25004 24048 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_04910 25435 25013 gene locus_tag LOCUS_04920 gene nusB 25435 25013 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_04920 25902 25435 gene locus_tag LOCUS_04930 gene ribE 25902 25435 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555427.1 protein_id gnl|my_center|LOCUS_04930 27061 25904 gene locus_tag LOCUS_04940 gene ribBA 27061 25904 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073314.1 protein_id gnl|my_center|LOCUS_04940 27825 27166 gene locus_tag LOCUS_04950 27825 27166 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_04950 29324 27849 gene locus_tag LOCUS_04960 29324 27849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 30457 29327 gene locus_tag LOCUS_04970 gene ribD 30457 29327 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150440.1 protein_id gnl|my_center|LOCUS_04970 30963 30454 gene locus_tag LOCUS_04980 gene nrdR 30963 30454 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379141.1 protein_id gnl|my_center|LOCUS_04980 32305 31049 gene locus_tag LOCUS_04990 32305 31049 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 protein_id gnl|my_center|LOCUS_04990 33069 32362 gene locus_tag LOCUS_05000 33069 32362 CDS product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480152.1 protein_id gnl|my_center|LOCUS_05000 33861 33163 gene locus_tag LOCUS_05010 33861 33163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 34112 35824 gene locus_tag LOCUS_05020 34112 35824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 35901 37241 gene locus_tag LOCUS_05030 35901 37241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 38581 37253 gene locus_tag LOCUS_05040 gene argA 38581 37253 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403912.1 protein_id gnl|my_center|LOCUS_05040 39745 38600 gene locus_tag LOCUS_05050 gene argE 39745 38600 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704559.1 protein_id gnl|my_center|LOCUS_05050 41867 39759 gene locus_tag LOCUS_05060 gene recG 41867 39759 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_05060 41903 42328 gene locus_tag LOCUS_05070 41903 42328 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_05070 42370 42558 gene locus_tag LOCUS_05080 42370 42558 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990233.1 protein_id gnl|my_center|LOCUS_05080 42580 43242 gene locus_tag LOCUS_05090 42580 43242 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_05090 44192 43284 gene locus_tag LOCUS_05100 44192 43284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 44350 45099 gene locus_tag LOCUS_05110 44350 45099 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124872.1 protein_id gnl|my_center|LOCUS_05110 45750 45109 gene locus_tag LOCUS_05120 gene pyrE 45750 45109 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094889.1 protein_id gnl|my_center|LOCUS_05120 45815 47359 gene locus_tag LOCUS_05130 45815 47359 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_05130 47940 47335 gene locus_tag LOCUS_05140 gene metW 47940 47335 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_05140 49075 47945 gene locus_tag LOCUS_05150 49075 47945 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266425.1 protein_id gnl|my_center|LOCUS_05150 51122 49143 gene locus_tag LOCUS_05160 51122 49143 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_05160 51698 51300 gene locus_tag LOCUS_05170 51698 51300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 52709 51897 gene locus_tag LOCUS_05180 gene mutM 52709 51897 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114647.1 protein_id gnl|my_center|LOCUS_05180 53216 52713 gene locus_tag LOCUS_05190 53216 52713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 54564 53224 gene locus_tag LOCUS_05200 54564 53224 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_05200 55320 54568 gene locus_tag LOCUS_05210 55320 54568 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679924.1 protein_id gnl|my_center|LOCUS_05210 56231 55317 gene locus_tag LOCUS_05220 56231 55317 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_05220 57201 56284 gene locus_tag LOCUS_05230 57201 56284 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_05230 57334 58338 gene locus_tag LOCUS_05240 57334 58338 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_05240 58664 60055 gene locus_tag LOCUS_05250 58664 60055 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262914.1 protein_id gnl|my_center|LOCUS_05250 61213 60167 gene locus_tag LOCUS_05260 61213 60167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 63920 61227 gene locus_tag LOCUS_05270 63920 61227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 64585 64205 gene locus_tag LOCUS_05280 64585 64205 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 protein_id gnl|my_center|LOCUS_05280 65512 64661 gene locus_tag LOCUS_05290 gene panC 65512 64661 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071159.1 protein_id gnl|my_center|LOCUS_05290 66306 65512 gene locus_tag LOCUS_05300 gene panB 66306 65512 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_05300 66992 66330 gene locus_tag LOCUS_05310 66992 66330 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_05310 67473 66982 gene locus_tag LOCUS_05320 gene folK 67473 66982 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420858.1 protein_id gnl|my_center|LOCUS_05320 68636 67476 gene locus_tag LOCUS_05330 68636 67476 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_05330 68842 68916 gene locus_tag LOCUS_t00070 68842 68916 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 69808 68960 gene locus_tag LOCUS_05340 69808 68960 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_05340 70241 69840 gene locus_tag LOCUS_05350 70241 69840 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463392.1 protein_id gnl|my_center|LOCUS_05350 70750 70349 gene locus_tag LOCUS_05360 70750 70349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941231.1 protein_id gnl|my_center|LOCUS_05360 71541 70747 gene locus_tag LOCUS_05370 gene rsmA 71541 70747 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_05370 72447 71800 gene locus_tag LOCUS_05380 72447 71800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 72966 72451 gene locus_tag LOCUS_05390 72966 72451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 73548 73222 gene locus_tag LOCUS_05400 73548 73222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 74838 73750 gene locus_tag LOCUS_05410 74838 73750 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104507.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05410 >Feature sequence07 173 925 gene locus_tag LOCUS_05420 173 925 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_05420 918 1370 gene locus_tag LOCUS_05430 gene rnhA 918 1370 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_05430 1377 2105 gene locus_tag LOCUS_05440 gene dnaQ 1377 2105 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267225.1 protein_id gnl|my_center|LOCUS_05440 2287 3924 gene locus_tag LOCUS_05450 2287 3924 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_05450 3921 4748 gene locus_tag LOCUS_05460 gene kdsA 3921 4748 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_05460 4817 6094 gene locus_tag LOCUS_05470 gene eno 4817 6094 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_05470 6123 6425 gene locus_tag LOCUS_05480 gene ftsB 6123 6425 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377835.1 protein_id gnl|my_center|LOCUS_05480 6415 7107 gene locus_tag LOCUS_05490 gene ispD 6415 7107 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478544.1 protein_id gnl|my_center|LOCUS_05490 7627 7133 gene locus_tag LOCUS_05500 7627 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 8240 7659 gene locus_tag LOCUS_05510 8240 7659 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_05510 9064 8237 gene locus_tag LOCUS_05520 gene proC 9064 8237 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_05520 9821 9129 gene locus_tag LOCUS_05530 9821 9129 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_05530 10013 11050 gene locus_tag LOCUS_05540 gene pilT 10013 11050 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_05540 11116 12450 gene locus_tag LOCUS_05550 gene rlmD 11116 12450 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 protein_id gnl|my_center|LOCUS_05550 13386 12457 gene locus_tag LOCUS_05560 gene fsa 13386 12457 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_05560 14142 13552 gene locus_tag LOCUS_05570 14142 13552 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461585.1 protein_id gnl|my_center|LOCUS_05570 14408 14644 gene locus_tag LOCUS_05580 14408 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 14688 16484 gene locus_tag LOCUS_05590 gene oadA 14688 16484 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_05590 16490 17788 gene locus_tag LOCUS_05600 16490 17788 CDS product oxalacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444843.1 protein_id gnl|my_center|LOCUS_05600 17913 18398 gene locus_tag LOCUS_05610 17913 18398 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_05610 18434 18625 gene locus_tag LOCUS_05620 gene rpmF 18434 18625 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010368401.1 protein_id gnl|my_center|LOCUS_05620 18704 19726 gene locus_tag LOCUS_05630 gene plsX 18704 19726 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_05630 19723 20691 gene locus_tag LOCUS_05640 19723 20691 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_05640 20696 21637 gene locus_tag LOCUS_05650 gene fabD 20696 21637 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816075.1 protein_id gnl|my_center|LOCUS_05650 21630 22370 gene locus_tag LOCUS_05660 gene fabG 21630 22370 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_05660 22557 22793 gene locus_tag LOCUS_05670 gene acpP 22557 22793 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_05670 23008 24252 gene locus_tag LOCUS_05680 gene fabF 23008 24252 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104132.1 protein_id gnl|my_center|LOCUS_05680 24480 25298 gene locus_tag LOCUS_05690 gene pabC 24480 25298 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_05690 25285 26298 gene locus_tag LOCUS_05700 gene mltG 25285 26298 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_05700 26303 26941 gene locus_tag LOCUS_05710 gene tmk 26303 26941 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 protein_id gnl|my_center|LOCUS_05710 26938 27945 gene locus_tag LOCUS_05720 26938 27945 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104126.1 protein_id gnl|my_center|LOCUS_05720 27955 28317 gene locus_tag LOCUS_05730 27955 28317 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_05730 28348 29130 gene locus_tag LOCUS_05740 28348 29130 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_05740 29266 29946 gene locus_tag LOCUS_05750 gene mip 29266 29946 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_05750 30121 31404 gene locus_tag LOCUS_05760 30121 31404 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941850.1 protein_id gnl|my_center|LOCUS_05760 31869 31483 gene locus_tag LOCUS_05770 gene gloA 31869 31483 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216418.1 protein_id gnl|my_center|LOCUS_05770 32881 31874 gene locus_tag LOCUS_05780 32881 31874 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057042.1 protein_id gnl|my_center|LOCUS_05780 34171 32894 gene locus_tag LOCUS_05790 gene tviB 34171 32894 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_05790 34366 35754 gene locus_tag LOCUS_05800 34366 35754 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_05800 35792 37888 gene locus_tag LOCUS_05810 gene prsK 35792 37888 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_05810 37885 39240 gene locus_tag LOCUS_05820 gene prsR 37885 39240 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_05820 39334 42063 gene locus_tag LOCUS_05830 gene prsT 39334 42063 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390845.1 protein_id gnl|my_center|LOCUS_05830 42467 42078 gene locus_tag LOCUS_05840 42467 42078 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_05840 42665 46177 gene locus_tag LOCUS_05850 gene smc 42665 46177 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_05850 46227 47054 gene locus_tag LOCUS_05860 gene zipA 46227 47054 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376124.1 protein_id gnl|my_center|LOCUS_05860 47051 49309 gene locus_tag LOCUS_05870 gene ligA 47051 49309 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213368.1 protein_id gnl|my_center|LOCUS_05870 50320 49349 gene locus_tag LOCUS_05880 50320 49349 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529440.1 protein_id gnl|my_center|LOCUS_05880 50686 50339 gene locus_tag LOCUS_05890 50686 50339 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404138.1 protein_id gnl|my_center|LOCUS_05890 52480 50723 gene locus_tag LOCUS_05900 gene hsbR 52480 50723 CDS product two-component system response regulator HsbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_05900 54249 52612 gene locus_tag LOCUS_05910 54249 52612 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_05910 54436 55458 gene locus_tag LOCUS_05920 54436 55458 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948008.1 protein_id gnl|my_center|LOCUS_05920 55597 58569 gene locus_tag LOCUS_05930 gene fimV 55597 58569 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_05930 58636 59415 gene locus_tag LOCUS_05940 gene truA 58636 59415 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368434.1 protein_id gnl|my_center|LOCUS_05940 59461 60084 gene locus_tag LOCUS_05950 59461 60084 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408280.1 protein_id gnl|my_center|LOCUS_05950 60071 61288 gene locus_tag LOCUS_05960 gene trpB 60071 61288 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_05960 61285 62100 gene locus_tag LOCUS_05970 gene trpA 61285 62100 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_05970 62160 63101 gene locus_tag LOCUS_05980 gene accD 62160 63101 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_05980 63136 64413 gene locus_tag LOCUS_05990 gene folC 63136 64413 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039854.1 protein_id gnl|my_center|LOCUS_05990 64456 64974 gene locus_tag LOCUS_06000 64456 64974 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957873.1 protein_id gnl|my_center|LOCUS_06000 64995 65504 gene locus_tag LOCUS_06010 64995 65504 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_06010 65550 67067 gene locus_tag LOCUS_06020 gene purF 65550 67067 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347797.1 protein_id gnl|my_center|LOCUS_06020 67270 68457 gene locus_tag LOCUS_06030 67270 68457 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence08 284 111 gene locus_tag LOCUS_06040 284 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 388 1599 gene locus_tag LOCUS_06050 388 1599 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_06050 1586 2302 gene locus_tag LOCUS_06060 1586 2302 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814000.1 protein_id gnl|my_center|LOCUS_06060 3495 2299 gene locus_tag LOCUS_06070 3495 2299 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212197.1 protein_id gnl|my_center|LOCUS_06070 4208 3534 gene locus_tag LOCUS_06080 4208 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4209 4502 gene locus_tag LOCUS_06090 4209 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4524 5324 gene locus_tag LOCUS_06100 4524 5324 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_06100 5419 5871 gene locus_tag LOCUS_06110 5419 5871 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 protein_id gnl|my_center|LOCUS_06110 6101 5967 gene locus_tag LOCUS_06120 6101 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 6132 8309 gene locus_tag LOCUS_06130 6132 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 10236 8251 gene locus_tag LOCUS_06140 gene slt 10236 8251 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_06140 10313 10813 gene locus_tag LOCUS_06150 10313 10813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 10914 11090 gene locus_tag LOCUS_06160 10914 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 12191 11133 gene locus_tag LOCUS_06170 gene aroG 12191 11133 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_06170 12926 12300 gene locus_tag LOCUS_06180 12926 12300 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_06180 13201 13659 gene locus_tag LOCUS_06190 13201 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240467.1 protein_id gnl|my_center|LOCUS_06190 13819 14037 gene locus_tag LOCUS_06200 13819 14037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 15463 14159 gene locus_tag LOCUS_06210 15463 14159 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_06210 15724 15903 gene locus_tag LOCUS_06220 15724 15903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 15999 16313 gene locus_tag LOCUS_06230 15999 16313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 17133 16321 gene locus_tag LOCUS_06240 17133 16321 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_06240 17271 18629 gene locus_tag LOCUS_06250 gene ffh 17271 18629 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098351.1 protein_id gnl|my_center|LOCUS_06250 18887 19159 gene locus_tag LOCUS_06260 gene rpsP 18887 19159 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653865.1 protein_id gnl|my_center|LOCUS_06260 19181 19708 gene locus_tag LOCUS_06270 gene rimM 19181 19708 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462552.1 protein_id gnl|my_center|LOCUS_06270 19708 20466 gene locus_tag LOCUS_06280 gene trmD 19708 20466 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765874.1 protein_id gnl|my_center|LOCUS_06280 20473 20826 gene locus_tag LOCUS_06290 gene rplS 20473 20826 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946144.1 protein_id gnl|my_center|LOCUS_06290 21115 22557 gene locus_tag LOCUS_06300 gene sbcB 21115 22557 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104954.1 protein_id gnl|my_center|LOCUS_06300 22890 22606 gene locus_tag LOCUS_06310 22890 22606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947734.1 protein_id gnl|my_center|LOCUS_06310 23663 22974 gene locus_tag LOCUS_06320 23663 22974 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109549.1 protein_id gnl|my_center|LOCUS_06320 23679 24050 gene locus_tag LOCUS_06330 23679 24050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 24413 24057 gene locus_tag LOCUS_06340 24413 24057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 24745 25926 gene locus_tag LOCUS_06350 24745 25926 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705890.1 protein_id gnl|my_center|LOCUS_06350 25919 26383 gene locus_tag LOCUS_06360 25919 26383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 26597 26932 gene locus_tag LOCUS_06370 26597 26932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06370 27438 26971 gene locus_tag LOCUS_06380 27438 26971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 28449 28745 gene locus_tag LOCUS_06390 28449 28745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 28975 29751 gene locus_tag LOCUS_06400 28975 29751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 30343 29711 gene locus_tag LOCUS_06410 30343 29711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 31360 30398 gene locus_tag LOCUS_06420 31360 30398 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_06420 31512 32855 gene locus_tag LOCUS_06430 31512 32855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 32876 33991 gene locus_tag LOCUS_06440 gene gmd 32876 33991 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_06440 33988 34965 gene locus_tag LOCUS_06450 33988 34965 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331384.1 protein_id gnl|my_center|LOCUS_06450 35000 36499 gene locus_tag LOCUS_06460 35000 36499 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_06460 36510 36902 gene locus_tag LOCUS_06470 36510 36902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 39610 36941 gene locus_tag LOCUS_06480 39610 36941 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880722.1 protein_id gnl|my_center|LOCUS_06480 40188 39679 gene locus_tag LOCUS_06490 40188 39679 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074168.1 protein_id gnl|my_center|LOCUS_06490 40261 42171 gene locus_tag LOCUS_06500 40261 42171 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168667914.1 protein_id gnl|my_center|LOCUS_06500 42248 43360 gene locus_tag LOCUS_06510 42248 43360 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_06510 43432 45957 gene locus_tag LOCUS_06520 43432 45957 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_06520 46548 45964 gene locus_tag LOCUS_06530 46548 45964 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036208.1 protein_id gnl|my_center|LOCUS_06530 46635 46922 gene locus_tag LOCUS_06540 46635 46922 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100122.1 protein_id gnl|my_center|LOCUS_06540 46959 48170 gene locus_tag LOCUS_06550 gene serB 46959 48170 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010528670.1 protein_id gnl|my_center|LOCUS_06550 48245 49459 gene locus_tag LOCUS_06560 48245 49459 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706654.1 protein_id gnl|my_center|LOCUS_06560 49669 49466 gene locus_tag LOCUS_06570 49669 49466 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153613.1 protein_id gnl|my_center|LOCUS_06570 50918 49773 gene locus_tag LOCUS_06580 gene zapE 50918 49773 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707598.1 protein_id gnl|my_center|LOCUS_06580 51421 50930 gene locus_tag LOCUS_06590 51421 50930 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_06590 52149 51544 gene locus_tag LOCUS_06600 gene nadD 52149 51544 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_06600 53471 52200 gene locus_tag LOCUS_06610 53471 52200 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_06610 54196 53528 gene locus_tag LOCUS_06620 54196 53528 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 protein_id gnl|my_center|LOCUS_06620 54403 56295 gene locus_tag LOCUS_06630 gene thiC 54403 56295 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_06630 56468 57271 gene locus_tag LOCUS_06640 gene ppk2 56468 57271 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460167.1 protein_id gnl|my_center|LOCUS_06640 58198 57287 gene locus_tag LOCUS_06650 58198 57287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 59074 58334 gene locus_tag LOCUS_06660 gene dnr 59074 58334 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_06660 60584 59247 gene locus_tag LOCUS_06670 60584 59247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_06670 60937 60689 gene locus_tag LOCUS_06680 60937 60689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 61473 61036 gene locus_tag LOCUS_06690 61473 61036 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_06690 61716 63290 gene locus_tag LOCUS_06700 gene nirS 61716 63290 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_06700 63505 63828 gene locus_tag LOCUS_06710 63505 63828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 63825 64997 gene locus_tag LOCUS_06720 gene nirF 63825 64997 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_06720 64997 65485 gene locus_tag LOCUS_06730 64997 65485 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 protein_id gnl|my_center|LOCUS_06730 65479 65955 gene locus_tag LOCUS_06740 65479 65955 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111534.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence09 803 522 gene locus_tag LOCUS_06750 803 522 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104336.1 protein_id gnl|my_center|LOCUS_06750 1293 856 gene locus_tag LOCUS_06760 1293 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3139 1349 gene locus_tag LOCUS_06770 3139 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 3639 3316 gene locus_tag LOCUS_06780 3639 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4983 3649 gene locus_tag LOCUS_06790 4983 3649 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706420.1 protein_id gnl|my_center|LOCUS_06790 5830 5051 gene locus_tag LOCUS_06800 gene gloB 5830 5051 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705462.1 protein_id gnl|my_center|LOCUS_06800 6261 5836 gene locus_tag LOCUS_06810 gene hisI 6261 5836 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_06810 6360 6689 gene locus_tag LOCUS_06820 6360 6689 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_06820 7988 6690 gene locus_tag LOCUS_06830 gene phoR 7988 6690 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705169.1 protein_id gnl|my_center|LOCUS_06830 8141 8833 gene locus_tag LOCUS_06840 gene phoB 8141 8833 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113938.1 protein_id gnl|my_center|LOCUS_06840 8934 9260 gene locus_tag LOCUS_06850 8934 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 9499 10374 gene locus_tag LOCUS_06860 9499 10374 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_06860 10406 11491 gene locus_tag LOCUS_06870 10406 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 11493 12401 gene locus_tag LOCUS_06880 11493 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 12498 13367 gene locus_tag LOCUS_06890 gene pstA 12498 13367 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990843.1 protein_id gnl|my_center|LOCUS_06890 13361 14131 gene locus_tag LOCUS_06900 gene pstB 13361 14131 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_06900 14135 14923 gene locus_tag LOCUS_06910 gene pstB 14135 14923 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_06910 16289 14925 gene locus_tag LOCUS_06920 16289 14925 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_06920 16373 17227 gene locus_tag LOCUS_06930 16373 17227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 17241 18239 gene locus_tag LOCUS_06940 17241 18239 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 protein_id gnl|my_center|LOCUS_06940 18454 18777 gene locus_tag LOCUS_06950 18454 18777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 18906 19229 gene locus_tag LOCUS_06960 18906 19229 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_06960 19226 19720 gene locus_tag LOCUS_06970 19226 19720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 19717 20988 gene locus_tag LOCUS_06980 19717 20988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 21647 20952 gene locus_tag LOCUS_06990 21647 20952 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444780.1 protein_id gnl|my_center|LOCUS_06990 21888 21631 gene locus_tag LOCUS_07000 21888 21631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 21805 23685 gene locus_tag LOCUS_07010 21805 23685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 23695 24453 gene locus_tag LOCUS_07020 23695 24453 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_07020 25153 25692 gene locus_tag LOCUS_07030 25153 25692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 25703 26464 gene locus_tag LOCUS_07040 25703 26464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 26449 27066 gene locus_tag LOCUS_07050 26449 27066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 27388 31083 gene locus_tag LOCUS_07060 gene metH 27388 31083 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_07060 31144 31494 gene locus_tag LOCUS_07070 gene rsfS 31144 31494 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_07070 31583 32140 gene locus_tag LOCUS_07080 31583 32140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 32978 32145 gene locus_tag LOCUS_07090 32978 32145 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925869.1 protein_id gnl|my_center|LOCUS_07090 33164 33325 gene locus_tag LOCUS_07100 33164 33325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 33316 35643 gene locus_tag LOCUS_07110 33316 35643 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 protein_id gnl|my_center|LOCUS_07110 35791 37614 gene locus_tag LOCUS_07120 35791 37614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261885.1 protein_id gnl|my_center|LOCUS_07120 38915 37617 gene locus_tag LOCUS_07130 38915 37617 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387846.1 protein_id gnl|my_center|LOCUS_07130 39248 40432 gene locus_tag LOCUS_07140 39248 40432 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118965.1 protein_id gnl|my_center|LOCUS_07140 40429 41721 gene locus_tag LOCUS_07150 40429 41721 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879247.1 protein_id gnl|my_center|LOCUS_07150 42147 41752 gene locus_tag LOCUS_07160 42147 41752 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057828.1 protein_id gnl|my_center|LOCUS_07160 42342 42160 gene locus_tag LOCUS_07170 42342 42160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 42929 42348 gene locus_tag LOCUS_07180 gene rsxA 42929 42348 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133204.1 protein_id gnl|my_center|LOCUS_07180 43575 42931 gene locus_tag LOCUS_07190 43575 42931 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_07190 44320 43619 gene locus_tag LOCUS_07200 44320 43619 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_07200 45326 44313 gene locus_tag LOCUS_07210 45326 44313 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082949.1 protein_id gnl|my_center|LOCUS_07210 46663 45323 gene locus_tag LOCUS_07220 gene rsxC 46663 45323 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082948.1 protein_id gnl|my_center|LOCUS_07220 47578 46703 gene locus_tag LOCUS_07230 gene sucD 47578 46703 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038208.1 protein_id gnl|my_center|LOCUS_07230 47987 47625 gene locus_tag LOCUS_07240 47987 47625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 49177 48017 gene locus_tag LOCUS_07250 gene sucC 49177 48017 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958199.1 protein_id gnl|my_center|LOCUS_07250 53890 49265 gene locus_tag LOCUS_07260 53890 49265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 54740 53883 gene locus_tag LOCUS_07270 54740 53883 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_07270 57322 54836 gene locus_tag LOCUS_07280 57322 54836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 58300 57347 gene locus_tag LOCUS_07290 58300 57347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 60217 58313 gene locus_tag LOCUS_07300 60217 58313 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_07300 61752 60505 gene locus_tag LOCUS_07310 gene nuoF 61752 60505 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969255.1 protein_id gnl|my_center|LOCUS_07310 61926 63542 gene locus_tag LOCUS_07320 61926 63542 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961458.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence10 1364 1744 gene locus_tag LOCUS_07330 1364 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1826 8695 gene locus_tag LOCUS_07340 1826 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 9988 8924 gene locus_tag LOCUS_07350 gene hemE 9988 8924 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 protein_id gnl|my_center|LOCUS_07350 11494 10052 gene locus_tag LOCUS_07360 11494 10052 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931634.1 protein_id gnl|my_center|LOCUS_07360 16163 11487 gene locus_tag LOCUS_07370 gene gltB 16163 11487 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_07370 16711 17343 gene locus_tag LOCUS_07380 gene dsbA 16711 17343 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_07380 17503 18603 gene locus_tag LOCUS_07390 17503 18603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 18734 19915 gene locus_tag LOCUS_07400 18734 19915 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_07400 19952 21142 gene locus_tag LOCUS_07410 19952 21142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 21373 22890 gene locus_tag LOCUS_07420 21373 22890 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115507.1 protein_id gnl|my_center|LOCUS_07420 23585 26056 gene locus_tag LOCUS_07430 23585 26056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 27844 26069 gene locus_tag LOCUS_07440 27844 26069 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975341.1 protein_id gnl|my_center|LOCUS_07440 28271 27915 gene locus_tag LOCUS_07450 28271 27915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 28406 28726 gene locus_tag LOCUS_07460 28406 28726 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_07460 28723 28941 gene locus_tag LOCUS_07470 28723 28941 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_07470 29249 29617 gene locus_tag LOCUS_07480 29249 29617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 30569 29847 gene locus_tag LOCUS_07490 30569 29847 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_07490 31479 30622 gene locus_tag LOCUS_07500 gene rsmI 31479 30622 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_07500 31531 33555 gene locus_tag LOCUS_07510 31531 33555 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_07510 33552 33920 gene locus_tag LOCUS_07520 33552 33920 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703589.1 protein_id gnl|my_center|LOCUS_07520 33947 34534 gene locus_tag LOCUS_07530 33947 34534 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620308.1 protein_id gnl|my_center|LOCUS_07530 34562 35140 gene locus_tag LOCUS_07540 gene dolP 34562 35140 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818900.1 protein_id gnl|my_center|LOCUS_07540 35127 36527 gene locus_tag LOCUS_07550 35127 36527 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_07550 37441 36533 gene locus_tag LOCUS_07560 37441 36533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 38021 37518 gene locus_tag LOCUS_07570 gene folA 38021 37518 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_07570 38830 38036 gene locus_tag LOCUS_07580 38830 38036 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110588.1 protein_id gnl|my_center|LOCUS_07580 39672 38833 gene locus_tag LOCUS_07590 gene lgt 39672 38833 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405275.1 protein_id gnl|my_center|LOCUS_07590 40047 39742 gene locus_tag LOCUS_07600 40047 39742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 39928 40701 gene locus_tag LOCUS_07610 39928 40701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 40984 41928 gene locus_tag LOCUS_07620 40984 41928 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306982.1 protein_id gnl|my_center|LOCUS_07620 41933 42247 gene locus_tag LOCUS_07630 41933 42247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 43029 43619 gene locus_tag LOCUS_07640 43029 43619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 44613 43624 gene locus_tag LOCUS_07650 44613 43624 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_07650 44817 44665 gene locus_tag LOCUS_07660 44817 44665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 45574 47160 gene locus_tag LOCUS_07670 45574 47160 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946608.1 protein_id gnl|my_center|LOCUS_07670 47273 47515 gene locus_tag LOCUS_07680 47273 47515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 47689 49026 gene locus_tag LOCUS_07690 47689 49026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 49108 50343 gene locus_tag LOCUS_07700 gene ispG 49108 50343 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930793.1 protein_id gnl|my_center|LOCUS_07700 50821 50354 gene locus_tag LOCUS_07710 gene rimI 50821 50354 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_07710 51665 50823 gene locus_tag LOCUS_07720 51665 50823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 53216 51675 gene locus_tag LOCUS_07730 53216 51675 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_07730 54235 53465 gene locus_tag LOCUS_07740 gene pssA 54235 53465 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_07740 55454 54432 gene locus_tag LOCUS_07750 gene ilvC 55454 54432 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_07750 55995 55504 gene locus_tag LOCUS_07760 gene ilvN 55995 55504 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040280.1 protein_id gnl|my_center|LOCUS_07760 57713 55995 gene locus_tag LOCUS_07770 57713 55995 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_07770 57956 58687 gene locus_tag LOCUS_07780 57956 58687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 58825 60471 gene locus_tag LOCUS_07790 58825 60471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 60550 61770 gene locus_tag LOCUS_07800 60550 61770 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_07800 61810 62334 gene locus_tag LOCUS_07810 61810 62334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 62427 63275 gene locus_tag LOCUS_07820 62427 63275 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_07820 63636 63385 gene locus_tag LOCUS_07830 63636 63385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence11 235 483 gene locus_tag LOCUS_07840 235 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1855 560 gene locus_tag LOCUS_07850 1855 560 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_07850 3057 1876 gene locus_tag LOCUS_07860 3057 1876 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 protein_id gnl|my_center|LOCUS_07860 3251 3066 gene locus_tag LOCUS_07870 3251 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 4212 3340 gene locus_tag LOCUS_07880 gene hflC 4212 3340 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_07880 5411 4212 gene locus_tag LOCUS_07890 gene hflK 5411 4212 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262723.1 protein_id gnl|my_center|LOCUS_07890 6797 5496 gene locus_tag LOCUS_07900 gene hflX 6797 5496 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460357.1 protein_id gnl|my_center|LOCUS_07900 7156 6896 gene locus_tag LOCUS_07910 gene hfq 7156 6896 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070934.1 protein_id gnl|my_center|LOCUS_07910 8217 7282 gene locus_tag LOCUS_07920 gene miaA 8217 7282 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704863.1 protein_id gnl|my_center|LOCUS_07920 9982 8219 gene locus_tag LOCUS_07930 gene mutL 9982 8219 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_07930 11080 9998 gene locus_tag LOCUS_07940 11080 9998 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_07940 14680 11093 gene locus_tag LOCUS_07950 14680 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 14916 15440 gene locus_tag LOCUS_07960 14916 15440 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881633.1 protein_id gnl|my_center|LOCUS_07960 16117 15437 gene locus_tag LOCUS_07970 gene lolD 16117 15437 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_07970 17357 16110 gene locus_tag LOCUS_07980 17357 16110 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_07980 18383 17457 gene locus_tag LOCUS_07990 18383 17457 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_07990 19064 18384 gene locus_tag LOCUS_08000 19064 18384 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172761.1 protein_id gnl|my_center|LOCUS_08000 19698 19090 gene locus_tag LOCUS_08010 gene cysC 19698 19090 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_08010 20782 19808 gene locus_tag LOCUS_08020 20782 19808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_08020 22923 20782 gene locus_tag LOCUS_08030 22923 20782 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_08030 23078 23854 gene locus_tag LOCUS_08040 gene fabI 23078 23854 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_08040 25850 23931 gene locus_tag LOCUS_08050 gene ppiD 25850 23931 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071919.1 protein_id gnl|my_center|LOCUS_08050 26008 25932 gene locus_tag LOCUS_t00080 26008 25932 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 26090 26015 gene locus_tag LOCUS_t00090 26090 26015 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26377 26105 gene locus_tag LOCUS_08060 gene hupB 26377 26105 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_08060 29105 26655 gene locus_tag LOCUS_08070 gene lon 29105 26655 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705882.1 protein_id gnl|my_center|LOCUS_08070 30646 29363 gene locus_tag LOCUS_08080 gene clpX 30646 29363 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770751.1 protein_id gnl|my_center|LOCUS_08080 31386 30760 gene locus_tag LOCUS_08090 gene clpP 31386 30760 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 protein_id gnl|my_center|LOCUS_08090 32742 31438 gene locus_tag LOCUS_08100 gene tig 32742 31438 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087920.1 protein_id gnl|my_center|LOCUS_08100 32966 32882 gene locus_tag LOCUS_t00100 32966 32882 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33170 34039 gene locus_tag LOCUS_08110 33170 34039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 37161 34036 gene locus_tag LOCUS_08120 37161 34036 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_08120 38542 37172 gene locus_tag LOCUS_08130 38542 37172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 38716 39411 gene locus_tag LOCUS_08140 38716 39411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 40884 39448 gene locus_tag LOCUS_08150 40884 39448 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812847.1 protein_id gnl|my_center|LOCUS_08150 41790 41437 gene locus_tag LOCUS_08160 41790 41437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 41992 42585 gene locus_tag LOCUS_08170 41992 42585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 43233 42703 gene locus_tag LOCUS_08180 43233 42703 CDS product DUF2058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086049.1 protein_id gnl|my_center|LOCUS_08180 43530 43297 gene locus_tag LOCUS_08190 gene yidD 43530 43297 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_08190 44687 44046 gene locus_tag LOCUS_08200 44687 44046 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_08200 47204 44709 gene locus_tag LOCUS_08210 47204 44709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 48839 47214 gene locus_tag LOCUS_08220 48839 47214 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_08220 49899 48832 gene locus_tag LOCUS_08230 49899 48832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 52154 49935 gene locus_tag LOCUS_08240 52154 49935 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228238.1 protein_id gnl|my_center|LOCUS_08240 52425 53456 gene locus_tag LOCUS_08250 gene argC 52425 53456 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_08250 53534 54211 gene locus_tag LOCUS_08260 53534 54211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 54214 54654 gene locus_tag LOCUS_08270 54214 54654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 54702 55055 gene locus_tag LOCUS_08280 gene erpA 54702 55055 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219692.1 protein_id gnl|my_center|LOCUS_08280 56587 55109 gene locus_tag LOCUS_08290 gene lnt 56587 55109 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268977.1 protein_id gnl|my_center|LOCUS_08290 57531 56662 gene locus_tag LOCUS_08300 57531 56662 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368790.1 protein_id gnl|my_center|LOCUS_08300 57914 57528 gene locus_tag LOCUS_08310 gene ybeY 57914 57528 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071410.1 protein_id gnl|my_center|LOCUS_08310 58962 57991 gene locus_tag LOCUS_08320 58962 57991 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 protein_id gnl|my_center|LOCUS_08320 <60309 58969 gene locus_tag LOCUS_08330 <60309 58969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071412.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence12 470 1081 gene locus_tag LOCUS_08340 gene hsp20 470 1081 CDS product small heat shock protein sHSP20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152117.1 protein_id gnl|my_center|LOCUS_08340 1640 1876 gene locus_tag LOCUS_08350 1640 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 2276 1932 gene locus_tag LOCUS_08360 2276 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 2552 2740 gene locus_tag LOCUS_08370 2552 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2737 6069 gene locus_tag LOCUS_08380 2737 6069 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_08380 6059 9913 gene locus_tag LOCUS_08390 6059 9913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 9910 11025 gene locus_tag LOCUS_08400 9910 11025 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_08400 11652 12398 gene locus_tag LOCUS_08410 11652 12398 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104614758.1 protein_id gnl|my_center|LOCUS_08410 12680 12925 gene locus_tag LOCUS_08420 12680 12925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 13980 13066 gene locus_tag LOCUS_08430 13980 13066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08430 14218 13991 gene locus_tag LOCUS_08440 14218 13991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 14774 14382 gene locus_tag LOCUS_tm00010 14774 14382 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 15976 14795 gene locus_tag LOCUS_08450 15976 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 16735 16055 gene locus_tag LOCUS_08460 gene tsaB 16735 16055 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113851.1 protein_id gnl|my_center|LOCUS_08460 18648 16732 gene locus_tag LOCUS_08470 18648 16732 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262264.1 protein_id gnl|my_center|LOCUS_08470 19157 18660 gene locus_tag LOCUS_08480 19157 18660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 19508 19305 gene locus_tag LOCUS_08490 gene cspE 19508 19305 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439184.1 protein_id gnl|my_center|LOCUS_08490 21138 19810 gene locus_tag LOCUS_08500 gene tolC 21138 19810 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735329.1 protein_id gnl|my_center|LOCUS_08500 21629 22000 gene locus_tag LOCUS_08510 21629 22000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 22026 22841 gene locus_tag LOCUS_08520 gene xthA 22026 22841 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 protein_id gnl|my_center|LOCUS_08520 22844 23218 gene locus_tag LOCUS_08530 22844 23218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 23919 23272 gene locus_tag LOCUS_08540 gene narL 23919 23272 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_08540 25925 23919 gene locus_tag LOCUS_08550 gene narX 25925 23919 CDS product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816562.1 protein_id gnl|my_center|LOCUS_08550 26213 27127 gene locus_tag LOCUS_08560 gene rdgC 26213 27127 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 protein_id gnl|my_center|LOCUS_08560 27613 27158 gene locus_tag LOCUS_08570 27613 27158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 29568 27691 gene locus_tag LOCUS_08580 29568 27691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 30341 29649 gene locus_tag LOCUS_08590 30341 29649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 31377 30439 gene locus_tag LOCUS_08600 31377 30439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 31517 31876 gene locus_tag LOCUS_08610 31517 31876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 31886 33361 gene locus_tag LOCUS_08620 31886 33361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 34395 33349 gene locus_tag LOCUS_08630 34395 33349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_08630 36044 34395 gene locus_tag LOCUS_08640 36044 34395 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_08640 37227 36205 gene locus_tag LOCUS_08650 37227 36205 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_08650 37942 37867 gene locus_tag LOCUS_t00110 37942 37867 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 38938 37997 gene locus_tag LOCUS_08660 gene ispH 38938 37997 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318785.1 protein_id gnl|my_center|LOCUS_08660 39178 40863 gene locus_tag LOCUS_08670 39178 40863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 42648 40870 gene locus_tag LOCUS_08680 gene aspS 42648 40870 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104814.1 protein_id gnl|my_center|LOCUS_08680 42993 42727 gene locus_tag LOCUS_08690 42993 42727 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807023.1 protein_id gnl|my_center|LOCUS_08690 43776 43147 gene locus_tag LOCUS_08700 43776 43147 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405698.1 protein_id gnl|my_center|LOCUS_08700 44890 43787 gene locus_tag LOCUS_08710 44890 43787 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071708.1 protein_id gnl|my_center|LOCUS_08710 45683 44922 gene locus_tag LOCUS_08720 gene pomA 45683 44922 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418107.1 protein_id gnl|my_center|LOCUS_08720 45861 46712 gene locus_tag LOCUS_08730 45861 46712 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704980.1 protein_id gnl|my_center|LOCUS_08730 47516 46749 gene locus_tag LOCUS_08740 47516 46749 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_08740 48927 47569 gene locus_tag LOCUS_08750 48927 47569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 49837 48944 gene locus_tag LOCUS_08760 gene ubiA 49837 48944 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095050.1 protein_id gnl|my_center|LOCUS_08760 50334 49834 gene locus_tag LOCUS_08770 50334 49834 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114374.1 protein_id gnl|my_center|LOCUS_08770 50581 50949 gene locus_tag LOCUS_08780 50581 50949 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023525.1 protein_id gnl|my_center|LOCUS_08780 50990 51958 gene locus_tag LOCUS_08790 50990 51958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 52026 52526 gene locus_tag LOCUS_08800 52026 52526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 54778 52523 gene locus_tag LOCUS_08810 gene parC 54778 52523 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_08810 56727 54838 gene locus_tag LOCUS_08820 gene parE 56727 54838 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_08820 56948 57715 gene locus_tag LOCUS_08830 gene ccsA 56948 57715 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943928.1 protein_id gnl|my_center|LOCUS_08830 57718 58704 gene locus_tag LOCUS_08840 57718 58704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 59261 58710 gene locus_tag LOCUS_08850 59261 58710 CDS product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767637.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence13 868 140 gene locus_tag LOCUS_08860 868 140 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_08860 1900 2178 gene locus_tag LOCUS_08870 1900 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2219 2974 gene locus_tag LOCUS_08880 2219 2974 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288211.1 protein_id gnl|my_center|LOCUS_08880 3147 4622 gene locus_tag LOCUS_08890 3147 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4674 6302 gene locus_tag LOCUS_08900 4674 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 6852 9749 gene locus_tag LOCUS_08910 gene rne 6852 9749 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895645.1 protein_id gnl|my_center|LOCUS_08910 10296 9811 gene locus_tag LOCUS_08920 10296 9811 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930569.1 protein_id gnl|my_center|LOCUS_08920 11380 10310 gene locus_tag LOCUS_08930 gene lpxD 11380 10310 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141862.1 protein_id gnl|my_center|LOCUS_08930 12531 11377 gene locus_tag LOCUS_08940 12531 11377 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_08940 13688 12588 gene locus_tag LOCUS_08950 gene aroC 13688 12588 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405788.1 protein_id gnl|my_center|LOCUS_08950 14919 13768 gene locus_tag LOCUS_08960 14919 13768 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_08960 15896 14916 gene locus_tag LOCUS_08970 gene glgA 15896 14916 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389828.1 protein_id gnl|my_center|LOCUS_08970 15991 16467 gene locus_tag LOCUS_08980 15991 16467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 18902 16515 gene locus_tag LOCUS_08990 18902 16515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 19842 19114 gene locus_tag LOCUS_09000 19842 19114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 21862 20393 gene locus_tag LOCUS_09010 21862 20393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 22925 21900 gene locus_tag LOCUS_09020 22925 21900 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931995.1 protein_id gnl|my_center|LOCUS_09020 23377 22931 gene locus_tag LOCUS_09030 23377 22931 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_09030 24762 23452 gene locus_tag LOCUS_09040 24762 23452 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_09040 26569 25256 gene locus_tag LOCUS_09050 26569 25256 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739890.1 protein_id gnl|my_center|LOCUS_09050 26958 26620 gene locus_tag LOCUS_09060 gene glnK 26958 26620 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_09060 27822 27394 gene locus_tag LOCUS_09070 27822 27394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 28806 28006 gene locus_tag LOCUS_09080 28806 28006 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_09080 29985 28987 gene locus_tag LOCUS_09090 gene galE 29985 28987 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_09090 30737 30060 gene locus_tag LOCUS_09100 30737 30060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 30756 32519 gene locus_tag LOCUS_09110 gene recJ 30756 32519 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173449.1 protein_id gnl|my_center|LOCUS_09110 32650 33027 gene locus_tag LOCUS_09120 gene sdhC 32650 33027 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705795.1 protein_id gnl|my_center|LOCUS_09120 33024 33368 gene locus_tag LOCUS_09130 gene sdhD 33024 33368 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688395.1 protein_id gnl|my_center|LOCUS_09130 33382 35145 gene locus_tag LOCUS_09140 gene sdhA 33382 35145 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688397.1 protein_id gnl|my_center|LOCUS_09140 35184 35879 gene locus_tag LOCUS_09150 35184 35879 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072029.1 protein_id gnl|my_center|LOCUS_09150 35880 36134 gene locus_tag LOCUS_09160 35880 36134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 36152 36601 gene locus_tag LOCUS_09170 36152 36601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 37444 36557 gene locus_tag LOCUS_09180 37444 36557 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_09180 37527 37946 gene locus_tag LOCUS_09190 gene arfB 37527 37946 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 protein_id gnl|my_center|LOCUS_09190 39019 37943 gene locus_tag LOCUS_09200 gene modC 39019 37943 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_09200 39675 39019 gene locus_tag LOCUS_09210 gene modB 39675 39019 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_09210 40427 39675 gene locus_tag LOCUS_09220 gene modA 40427 39675 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039007.1 protein_id gnl|my_center|LOCUS_09220 41845 40505 gene locus_tag LOCUS_09230 gene mtaB 41845 40505 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_09230 41904 43265 gene locus_tag LOCUS_09240 41904 43265 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_09240 43718 43269 gene locus_tag LOCUS_09250 43718 43269 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946477.1 protein_id gnl|my_center|LOCUS_09250 44234 43899 gene locus_tag LOCUS_09260 44234 43899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 46585 44276 gene locus_tag LOCUS_09270 46585 44276 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038357.1 protein_id gnl|my_center|LOCUS_09270 46925 47620 gene locus_tag LOCUS_09280 46925 47620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 47713 49557 gene locus_tag LOCUS_09290 47713 49557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 49557 50876 gene locus_tag LOCUS_09300 49557 50876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 51019 52065 gene locus_tag LOCUS_09310 gene truD 51019 52065 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 protein_id gnl|my_center|LOCUS_09310 52577 52023 gene locus_tag LOCUS_09320 52577 52023 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957861.1 protein_id gnl|my_center|LOCUS_09320 53053 54615 gene locus_tag LOCUS_09330 53053 54615 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085901.1 protein_id gnl|my_center|LOCUS_09330 54618 55523 gene locus_tag LOCUS_09340 54618 55523 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965715.1 protein_id gnl|my_center|LOCUS_09340 55764 55477 gene locus_tag LOCUS_09350 55764 55477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence14 1659 1928 gene locus_tag LOCUS_09360 1659 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1948 2343 gene locus_tag LOCUS_09370 1948 2343 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535286.1 protein_id gnl|my_center|LOCUS_09370 3682 2435 gene locus_tag LOCUS_09380 3682 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829069.1 protein_id gnl|my_center|LOCUS_09380 4332 3679 gene locus_tag LOCUS_09390 4332 3679 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484262.1 protein_id gnl|my_center|LOCUS_09390 4739 4332 gene locus_tag LOCUS_09400 4739 4332 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_09400 5344 4739 gene locus_tag LOCUS_09410 5344 4739 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_09410 6713 5337 gene locus_tag LOCUS_09420 6713 5337 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_09420 7453 6710 gene locus_tag LOCUS_09430 7453 6710 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 protein_id gnl|my_center|LOCUS_09430 7964 7488 gene locus_tag LOCUS_09440 7964 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 9207 7954 gene locus_tag LOCUS_09450 9207 7954 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536056.1 protein_id gnl|my_center|LOCUS_09450 11467 9197 gene locus_tag LOCUS_09460 11467 9197 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550100.1 protein_id gnl|my_center|LOCUS_09460 12477 11629 gene locus_tag LOCUS_09470 12477 11629 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262037.1 protein_id gnl|my_center|LOCUS_09470 14147 12522 gene locus_tag LOCUS_09480 gene nadB 14147 12522 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_09480 14343 14924 gene locus_tag LOCUS_09490 gene rpoE 14343 14924 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_09490 14940 15623 gene locus_tag LOCUS_09500 14940 15623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 15688 16614 gene locus_tag LOCUS_09510 15688 16614 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930931.1 protein_id gnl|my_center|LOCUS_09510 16728 17090 gene locus_tag LOCUS_09520 16728 17090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 17122 18594 gene locus_tag LOCUS_09530 17122 18594 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 protein_id gnl|my_center|LOCUS_09530 18587 18862 gene locus_tag LOCUS_09540 18587 18862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 19296 19093 gene locus_tag LOCUS_09550 19296 19093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 21747 19417 gene locus_tag LOCUS_09560 gene copA1 21747 19417 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_09560 21941 22894 gene locus_tag LOCUS_09570 gene ribF 21941 22894 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704352.1 protein_id gnl|my_center|LOCUS_09570 22904 25798 gene locus_tag LOCUS_09580 gene ileS 22904 25798 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704643.1 protein_id gnl|my_center|LOCUS_09580 25791 26336 gene locus_tag LOCUS_09590 gene lspA 25791 26336 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210508.1 protein_id gnl|my_center|LOCUS_09590 27562 26348 gene locus_tag LOCUS_09600 gene gspF 27562 26348 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_09600 29127 27625 gene locus_tag LOCUS_09610 gene xcpR 29127 27625 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_09610 31052 29133 gene locus_tag LOCUS_09620 gene xcpQ 31052 29133 CDS product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 protein_id gnl|my_center|LOCUS_09620 31761 31180 gene locus_tag LOCUS_09630 31761 31180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 32142 32531 gene locus_tag LOCUS_09640 gene xcpT 32142 32531 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_09640 32571 33113 gene locus_tag LOCUS_09650 32571 33113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 33110 33481 gene locus_tag LOCUS_09660 33110 33481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 33481 34083 gene locus_tag LOCUS_09670 gene xcpW 33481 34083 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_09670 34096 35088 gene locus_tag LOCUS_09680 gene gspK 34096 35088 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038516.1 protein_id gnl|my_center|LOCUS_09680 35088 36329 gene locus_tag LOCUS_09690 gene xcpY 35088 36329 CDS product GspL family type II secretion system protein XcpY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103522.1 protein_id gnl|my_center|LOCUS_09690 36326 36823 gene locus_tag LOCUS_09700 36326 36823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 38099 36825 gene locus_tag LOCUS_09710 38099 36825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 38522 38130 gene locus_tag LOCUS_09720 38522 38130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 38795 38556 gene locus_tag LOCUS_09730 38795 38556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 38884 39933 gene locus_tag LOCUS_09740 38884 39933 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812925.1 protein_id gnl|my_center|LOCUS_09740 40518 39940 gene locus_tag LOCUS_09750 40518 39940 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_09750 43302 40729 gene locus_tag LOCUS_09760 43302 40729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 44297 43299 gene locus_tag LOCUS_09770 44297 43299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 45229 45014 gene locus_tag LOCUS_09780 45229 45014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 46873 45530 gene locus_tag LOCUS_09790 gene pmbA 46873 45530 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_09790 48330 46888 gene locus_tag LOCUS_09800 gene tldD 48330 46888 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_09800 49200 48403 gene locus_tag LOCUS_09810 49200 48403 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_09810 53221 49322 gene locus_tag LOCUS_09820 53221 49322 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112738.1 protein_id gnl|my_center|LOCUS_09820 54703 53243 gene locus_tag LOCUS_09830 gene rng 54703 53243 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_09830 55325 54729 gene locus_tag LOCUS_09840 55325 54729 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence15 <1 1297 gene locus_tag LOCUS_09850 <1 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035598.1:integron integrase 1596 3170 gene locus_tag LOCUS_09860 1596 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 3253 4080 gene locus_tag LOCUS_09870 3253 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 4982 4077 gene locus_tag LOCUS_09880 gene gluQRS 4982 4077 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951304.1 protein_id gnl|my_center|LOCUS_09880 5473 5036 gene locus_tag LOCUS_09890 gene dksA 5473 5036 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_09890 6254 5643 gene locus_tag LOCUS_09900 6254 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 9461 6345 gene locus_tag LOCUS_09910 9461 6345 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_09910 10807 9458 gene locus_tag LOCUS_09920 10807 9458 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261107.1 protein_id gnl|my_center|LOCUS_09920 11214 10804 gene locus_tag LOCUS_09930 11214 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 11459 11211 gene locus_tag LOCUS_09940 11459 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 11608 12327 gene locus_tag LOCUS_09950 gene ompR 11608 12327 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199523.1 protein_id gnl|my_center|LOCUS_09950 12331 13647 gene locus_tag LOCUS_09960 12331 13647 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969540.1 protein_id gnl|my_center|LOCUS_09960 13729 14232 gene locus_tag LOCUS_09970 gene msrA 13729 14232 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970427.1 protein_id gnl|my_center|LOCUS_09970 14556 14263 gene locus_tag LOCUS_09980 14556 14263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 15260 15544 gene locus_tag LOCUS_09990 gene rpoZ 15260 15544 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096602.1 protein_id gnl|my_center|LOCUS_09990 15738 17795 gene locus_tag LOCUS_10000 gene spoT 15738 17795 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_10000 17836 18222 gene locus_tag LOCUS_10010 17836 18222 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_10010 19153 18236 gene locus_tag LOCUS_10020 19153 18236 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073135.1 protein_id gnl|my_center|LOCUS_10020 19435 19662 gene locus_tag LOCUS_10030 19435 19662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 20344 19745 gene locus_tag LOCUS_10040 20344 19745 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071224.1 protein_id gnl|my_center|LOCUS_10040 20779 21552 gene locus_tag LOCUS_10050 20779 21552 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039646584.1 protein_id gnl|my_center|LOCUS_10050 21711 22457 gene locus_tag LOCUS_10060 21711 22457 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072407.1 protein_id gnl|my_center|LOCUS_10060 22487 22999 gene locus_tag LOCUS_10070 gene ruvC 22487 22999 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072406.1 protein_id gnl|my_center|LOCUS_10070 22990 23607 gene locus_tag LOCUS_10080 gene ruvA 22990 23607 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_10080 23614 24654 gene locus_tag LOCUS_10090 gene ruvB 23614 24654 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694352.1 protein_id gnl|my_center|LOCUS_10090 24651 25058 gene locus_tag LOCUS_10100 gene ybgC 24651 25058 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 protein_id gnl|my_center|LOCUS_10100 25068 25742 gene locus_tag LOCUS_10110 gene tolQ 25068 25742 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707366.1 protein_id gnl|my_center|LOCUS_10110 25881 26255 gene locus_tag LOCUS_10120 gene tolR 25881 26255 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_10120 26261 27205 gene locus_tag LOCUS_10130 26261 27205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 27202 28512 gene locus_tag LOCUS_10140 gene tolB 27202 28512 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_10140 28527 29090 gene locus_tag LOCUS_10150 gene pal 28527 29090 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038133.1 protein_id gnl|my_center|LOCUS_10150 29230 30030 gene locus_tag LOCUS_10160 29230 30030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 30434 30045 gene locus_tag LOCUS_10170 gene hslR 30434 30045 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660485.1 protein_id gnl|my_center|LOCUS_10170 30695 30435 gene locus_tag LOCUS_10180 gene grxC 30695 30435 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948013.1 protein_id gnl|my_center|LOCUS_10180 30728 33358 gene locus_tag LOCUS_10190 gene pepN 30728 33358 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104725.1 protein_id gnl|my_center|LOCUS_10190 34460 33360 gene locus_tag LOCUS_10200 34460 33360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 34798 35169 gene locus_tag LOCUS_10210 34798 35169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 35182 36057 gene locus_tag LOCUS_10220 35182 36057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 36190 36822 gene locus_tag LOCUS_10230 36190 36822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 37882 36923 gene locus_tag LOCUS_10240 37882 36923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 38701 37901 gene locus_tag LOCUS_10250 38701 37901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10250 39852 38704 gene locus_tag LOCUS_10260 39852 38704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 41204 40167 gene locus_tag LOCUS_10270 41204 40167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 41593 42543 gene locus_tag LOCUS_10280 41593 42543 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706514.1 protein_id gnl|my_center|LOCUS_10280 42580 43575 gene locus_tag LOCUS_10290 42580 43575 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_10290 43606 44505 gene locus_tag LOCUS_10300 43606 44505 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 protein_id gnl|my_center|LOCUS_10300 44991 44581 gene locus_tag LOCUS_10310 44991 44581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 45440 46405 gene locus_tag LOCUS_10320 45440 46405 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_10320 46469 48721 gene locus_tag LOCUS_10330 46469 48721 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 protein_id gnl|my_center|LOCUS_10330 48749 49429 gene locus_tag LOCUS_10340 gene cas5c 48749 49429 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_10340 49426 51267 gene locus_tag LOCUS_10350 gene cas8c 49426 51267 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384679.1 protein_id gnl|my_center|LOCUS_10350 51286 52167 gene locus_tag LOCUS_10360 gene cas7c 51286 52167 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_10360 52370 52900 gene locus_tag LOCUS_10370 52370 52900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 protein_id gnl|my_center|LOCUS_10370 53033 53671 gene locus_tag LOCUS_10380 gene cas4 53033 53671 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935545.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence16 2814 1774 gene locus_tag LOCUS_10390 2814 1774 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_10390 3879 3049 gene locus_tag LOCUS_10400 3879 3049 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_10400 7177 4106 gene locus_tag LOCUS_10410 7177 4106 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_10410 8124 7180 gene locus_tag LOCUS_10420 8124 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 9314 8250 gene locus_tag LOCUS_10430 9314 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 10507 9488 gene locus_tag LOCUS_10440 10507 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 11698 10601 gene locus_tag LOCUS_10450 11698 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 12735 11740 gene locus_tag LOCUS_10460 12735 11740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 13987 12863 gene locus_tag LOCUS_10470 13987 12863 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_10470 15739 14015 gene locus_tag LOCUS_10480 15739 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 16354 16698 gene locus_tag LOCUS_10490 16354 16698 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_10490 17696 16905 gene locus_tag LOCUS_10500 17696 16905 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_10500 19099 17993 gene locus_tag LOCUS_10510 19099 17993 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_10510 19275 20306 gene locus_tag LOCUS_10520 gene cysB 19275 20306 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_10520 20306 22072 gene locus_tag LOCUS_10530 20306 22072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 23255 22122 gene locus_tag LOCUS_10540 23255 22122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 26604 23290 gene locus_tag LOCUS_10550 26604 23290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 26796 27590 gene locus_tag LOCUS_10560 26796 27590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 27739 29064 gene locus_tag LOCUS_10570 27739 29064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 29286 29462 gene locus_tag LOCUS_10580 29286 29462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 29873 29478 gene locus_tag LOCUS_10590 29873 29478 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946364.1 protein_id gnl|my_center|LOCUS_10590 34632 29977 gene locus_tag LOCUS_10600 34632 29977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 35111 34656 gene locus_tag LOCUS_10610 35111 34656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 36193 35114 gene locus_tag LOCUS_10620 36193 35114 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704649.1 protein_id gnl|my_center|LOCUS_10620 36704 36195 gene locus_tag LOCUS_10630 36704 36195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 37211 36723 gene locus_tag LOCUS_10640 37211 36723 CDS product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102598.1 protein_id gnl|my_center|LOCUS_10640 39653 37545 gene locus_tag LOCUS_10650 gene glgB 39653 37545 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_10650 39884 41152 gene locus_tag LOCUS_10660 gene glgC 39884 41152 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_10660 41142 42845 gene locus_tag LOCUS_10670 41142 42845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 42847 44319 gene locus_tag LOCUS_10680 gene malQ 42847 44319 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173324.1 protein_id gnl|my_center|LOCUS_10680 44334 45203 gene locus_tag LOCUS_10690 gene galU 44334 45203 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225519.1 protein_id gnl|my_center|LOCUS_10690 45627 45196 gene locus_tag LOCUS_10700 45627 45196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 46286 45870 gene locus_tag LOCUS_10710 46286 45870 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888099.1 protein_id gnl|my_center|LOCUS_10710 47637 46279 gene locus_tag LOCUS_10720 gene carS 47637 46279 CDS product two-component system sensor histidine kinase CarS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 protein_id gnl|my_center|LOCUS_10720 48302 47634 gene locus_tag LOCUS_10730 gene carR 48302 47634 CDS product two-component system response regulator CarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090494.1 protein_id gnl|my_center|LOCUS_10730 48607 48305 gene locus_tag LOCUS_10740 48607 48305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 49282 48701 gene locus_tag LOCUS_10750 49282 48701 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074113.1 protein_id gnl|my_center|LOCUS_10750 49714 49313 gene locus_tag LOCUS_10760 49714 49313 CDS product DUF1924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337164.1 protein_id gnl|my_center|LOCUS_10760 51006 49759 gene locus_tag LOCUS_10770 51006 49759 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337165.1 protein_id gnl|my_center|LOCUS_10770 51585 51019 gene locus_tag LOCUS_10780 51585 51019 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_10780 51752 51973 gene locus_tag LOCUS_10790 51752 51973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 52435 52049 gene locus_tag LOCUS_10800 52435 52049 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_10800 52737 52432 gene locus_tag LOCUS_10810 52737 52432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence17 45 743 gene locus_tag LOCUS_10820 45 743 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279795.1 protein_id gnl|my_center|LOCUS_10820 746 1900 gene locus_tag LOCUS_10830 746 1900 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071253.1 protein_id gnl|my_center|LOCUS_10830 1924 2148 gene locus_tag LOCUS_10840 1924 2148 CDS product DUF2835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110339.1 protein_id gnl|my_center|LOCUS_10840 2583 2945 gene locus_tag LOCUS_10850 2583 2945 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_10850 2986 5076 gene locus_tag LOCUS_10860 2986 5076 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_10860 5106 5633 gene locus_tag LOCUS_10870 gene cheW 5106 5633 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096054.1 protein_id gnl|my_center|LOCUS_10870 5660 8278 gene locus_tag LOCUS_10880 5660 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 8330 8857 gene locus_tag LOCUS_10890 gene cheW 8330 8857 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_10890 8864 9619 gene locus_tag LOCUS_10900 8864 9619 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_10900 9619 10098 gene locus_tag LOCUS_10910 9619 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 10184 11026 gene locus_tag LOCUS_10920 10184 11026 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525698.1 protein_id gnl|my_center|LOCUS_10920 11036 11674 gene locus_tag LOCUS_10930 gene cheD 11036 11674 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_10930 11717 12775 gene locus_tag LOCUS_10940 11717 12775 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 protein_id gnl|my_center|LOCUS_10940 12877 14079 gene locus_tag LOCUS_10950 12877 14079 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 protein_id gnl|my_center|LOCUS_10950 14103 14411 gene locus_tag LOCUS_10960 gene hsbA 14103 14411 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_10960 14421 14723 gene locus_tag LOCUS_10970 14421 14723 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616835.1 protein_id gnl|my_center|LOCUS_10970 14826 16295 gene locus_tag LOCUS_10980 14826 16295 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_10980 16379 17470 gene locus_tag LOCUS_10990 gene ychF 16379 17470 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 protein_id gnl|my_center|LOCUS_10990 17554 17630 gene locus_tag LOCUS_t00120 17554 17630 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18102 18557 gene locus_tag LOCUS_11000 18102 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 20711 18600 gene locus_tag LOCUS_11010 20711 18600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 20943 21617 gene locus_tag LOCUS_11020 gene yrfG 20943 21617 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_11020 21747 22706 gene locus_tag LOCUS_11030 21747 22706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 22716 23687 gene locus_tag LOCUS_11040 22716 23687 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_11040 23732 24058 gene locus_tag LOCUS_11050 23732 24058 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084574.1 protein_id gnl|my_center|LOCUS_11050 27022 24128 gene locus_tag LOCUS_11060 gene uvrA 27022 24128 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_11060 27231 28700 gene locus_tag LOCUS_11070 27231 28700 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216662111.1 protein_id gnl|my_center|LOCUS_11070 28746 29261 gene locus_tag LOCUS_11080 gene ssb 28746 29261 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_11080 29273 30328 gene locus_tag LOCUS_11090 gene rfbB 29273 30328 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035864.1 protein_id gnl|my_center|LOCUS_11090 30347 31225 gene locus_tag LOCUS_11100 gene rfbA 30347 31225 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439277.1 protein_id gnl|my_center|LOCUS_11100 31222 31785 gene locus_tag LOCUS_11110 gene rfbC 31222 31785 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035866.1 protein_id gnl|my_center|LOCUS_11110 31789 32682 gene locus_tag LOCUS_11120 gene rfbD 31789 32682 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112614.1 protein_id gnl|my_center|LOCUS_11120 33849 32692 gene locus_tag LOCUS_11130 gene rnd 33849 32692 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971431.1 protein_id gnl|my_center|LOCUS_11130 33956 34471 gene locus_tag LOCUS_11140 33956 34471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 34468 35844 gene locus_tag LOCUS_11150 gene mpl 34468 35844 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547405.1 protein_id gnl|my_center|LOCUS_11150 35952 36122 gene locus_tag LOCUS_11160 35952 36122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 36123 36737 gene locus_tag LOCUS_11170 gene ubiX 36123 36737 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_11170 38718 36667 gene locus_tag LOCUS_11180 38718 36667 CDS product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958113.1 protein_id gnl|my_center|LOCUS_11180 40170 38887 gene locus_tag LOCUS_11190 gene hemL 40170 38887 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_11190 40802 40167 gene locus_tag LOCUS_11200 gene thiE 40802 40167 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_11200 41608 40799 gene locus_tag LOCUS_11210 41608 40799 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_11210 41812 42297 gene locus_tag LOCUS_11220 41812 42297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 42423 42803 gene locus_tag LOCUS_11230 42423 42803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 43366 42938 gene locus_tag LOCUS_11240 gene hemJ 43366 42938 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 protein_id gnl|my_center|LOCUS_11240 44088 43393 gene locus_tag LOCUS_11250 44088 43393 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_11250 44758 44399 gene locus_tag LOCUS_11260 44758 44399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 45028 49608 gene locus_tag LOCUS_11270 45028 49608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 49589 51088 gene locus_tag LOCUS_11280 49589 51088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence18 144 620 gene locus_tag LOCUS_11290 144 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 760 996 gene locus_tag LOCUS_11300 760 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 986 1363 gene locus_tag LOCUS_11310 986 1363 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770889.1 protein_id gnl|my_center|LOCUS_11310 1383 2279 gene locus_tag LOCUS_11320 1383 2279 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_11320 2308 2967 gene locus_tag LOCUS_11330 2308 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4504 3281 gene locus_tag LOCUS_11340 4504 3281 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_11340 4612 5832 gene locus_tag LOCUS_11350 4612 5832 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974189.1 protein_id gnl|my_center|LOCUS_11350 5810 5992 gene locus_tag LOCUS_11360 5810 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 6007 6414 gene locus_tag LOCUS_11370 6007 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 6459 7658 gene locus_tag LOCUS_11380 gene wecA 6459 7658 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211988.1 protein_id gnl|my_center|LOCUS_11380 8840 7683 gene locus_tag LOCUS_11390 8840 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 9216 9965 gene locus_tag LOCUS_11400 9216 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 10593 10024 gene locus_tag LOCUS_11410 10593 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 11189 11034 gene locus_tag LOCUS_11420 11189 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 13090 11201 gene locus_tag LOCUS_11430 gene asnB 13090 11201 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333923.1 protein_id gnl|my_center|LOCUS_11430 13539 13087 gene locus_tag LOCUS_11440 13539 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 13798 13529 gene locus_tag LOCUS_11450 13798 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 15415 13826 gene locus_tag LOCUS_11460 15415 13826 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_11460 16174 15959 gene locus_tag LOCUS_11470 16174 15959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 16358 16134 gene locus_tag LOCUS_11480 16358 16134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 16781 18433 gene locus_tag LOCUS_11490 16781 18433 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_11490 18464 18994 gene locus_tag LOCUS_11500 18464 18994 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090050.1 protein_id gnl|my_center|LOCUS_11500 18996 19967 gene locus_tag LOCUS_11510 18996 19967 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_11510 19972 20250 gene locus_tag LOCUS_11520 19972 20250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 20237 20536 gene locus_tag LOCUS_11530 20237 20536 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_11530 20524 20829 gene locus_tag LOCUS_11540 20524 20829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 20795 21505 gene locus_tag LOCUS_11550 20795 21505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11550 21502 21807 gene locus_tag LOCUS_11560 21502 21807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 21830 23275 gene locus_tag LOCUS_11570 21830 23275 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090055.1 protein_id gnl|my_center|LOCUS_11570 23272 24768 gene locus_tag LOCUS_11580 23272 24768 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902375.1 protein_id gnl|my_center|LOCUS_11580 24765 26060 gene locus_tag LOCUS_11590 24765 26060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 26684 27226 gene locus_tag LOCUS_11600 gene hslV 26684 27226 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769770.1 protein_id gnl|my_center|LOCUS_11600 27238 28578 gene locus_tag LOCUS_11610 gene hslU 27238 28578 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208943.1 protein_id gnl|my_center|LOCUS_11610 28594 28956 gene locus_tag LOCUS_11620 28594 28956 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 protein_id gnl|my_center|LOCUS_11620 29016 29765 gene locus_tag LOCUS_11630 gene ubiE 29016 29765 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099241.1 protein_id gnl|my_center|LOCUS_11630 29765 30397 gene locus_tag LOCUS_11640 29765 30397 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_11640 30400 32052 gene locus_tag LOCUS_11650 gene ubiB 30400 32052 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_11650 32583 32074 gene locus_tag LOCUS_11660 32583 32074 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 protein_id gnl|my_center|LOCUS_11660 32844 34586 gene locus_tag LOCUS_11670 32844 34586 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_11670 35215 34580 gene locus_tag LOCUS_11680 35215 34580 CDS product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099106.1 protein_id gnl|my_center|LOCUS_11680 35666 37177 gene locus_tag LOCUS_11690 35666 37177 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022277.1 protein_id gnl|my_center|LOCUS_11690 37244 37576 gene locus_tag LOCUS_11700 37244 37576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 38619 37639 gene locus_tag LOCUS_11710 38619 37639 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_11710 38716 42543 gene locus_tag LOCUS_11720 38716 42543 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815152.1 protein_id gnl|my_center|LOCUS_11720 42876 42571 gene locus_tag LOCUS_11730 42876 42571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 45952 42887 gene locus_tag LOCUS_11740 45952 42887 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_11740 47031 45952 gene locus_tag LOCUS_11750 47031 45952 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144157.1 protein_id gnl|my_center|LOCUS_11750 48257 47031 gene locus_tag LOCUS_11760 48257 47031 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 protein_id gnl|my_center|LOCUS_11760 49143 48271 gene locus_tag LOCUS_11770 49143 48271 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044973.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence19 388 1245 gene locus_tag LOCUS_11780 gene soj 388 1245 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_11780 1286 2179 gene locus_tag LOCUS_11790 1286 2179 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_11790 2292 2651 gene locus_tag LOCUS_11800 2292 2651 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097239.1 protein_id gnl|my_center|LOCUS_11800 2684 3544 gene locus_tag LOCUS_11810 gene atpB 2684 3544 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100237.1 protein_id gnl|my_center|LOCUS_11810 3595 3834 gene locus_tag LOCUS_11820 gene atpE 3595 3834 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 protein_id gnl|my_center|LOCUS_11820 3903 4373 gene locus_tag LOCUS_11830 3903 4373 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214796.1 protein_id gnl|my_center|LOCUS_11830 4383 4922 gene locus_tag LOCUS_11840 4383 4922 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_11840 4935 6476 gene locus_tag LOCUS_11850 gene atpA 4935 6476 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_11850 6527 7387 gene locus_tag LOCUS_11860 gene atpG 6527 7387 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_11860 7480 8850 gene locus_tag LOCUS_11870 gene atpD 7480 8850 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948666.1 protein_id gnl|my_center|LOCUS_11870 8880 9305 gene locus_tag LOCUS_11880 8880 9305 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 protein_id gnl|my_center|LOCUS_11880 9413 10786 gene locus_tag LOCUS_11890 gene glmU 9413 10786 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707907.1 protein_id gnl|my_center|LOCUS_11890 10800 12626 gene locus_tag LOCUS_11900 gene glmS 10800 12626 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707902.1 protein_id gnl|my_center|LOCUS_11900 14278 12635 gene locus_tag LOCUS_11910 14278 12635 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262698.1 protein_id gnl|my_center|LOCUS_11910 15353 14253 gene locus_tag LOCUS_11920 gene aroB 15353 14253 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_11920 15966 15448 gene locus_tag LOCUS_11930 gene aroK 15966 15448 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381319.1 protein_id gnl|my_center|LOCUS_11930 18113 16041 gene locus_tag LOCUS_11940 18113 16041 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 protein_id gnl|my_center|LOCUS_11940 18975 18427 gene locus_tag LOCUS_11950 18975 18427 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_11950 19589 18975 gene locus_tag LOCUS_11960 gene pilO 19589 18975 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_11960 20146 19586 gene locus_tag LOCUS_11970 gene pilN 20146 19586 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_11970 21231 20149 gene locus_tag LOCUS_11980 21231 20149 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_11980 21489 23867 gene locus_tag LOCUS_11990 21489 23867 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 protein_id gnl|my_center|LOCUS_11990 23871 24479 gene locus_tag LOCUS_12000 23871 24479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 25783 24488 gene locus_tag LOCUS_12010 gene gltA 25783 24488 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389475.1 protein_id gnl|my_center|LOCUS_12010 27093 25945 gene locus_tag LOCUS_12020 gene hemW 27093 25945 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105287.1 protein_id gnl|my_center|LOCUS_12020 28247 27162 gene locus_tag LOCUS_12030 gene dctP 28247 27162 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_12030 30418 28262 gene locus_tag LOCUS_12040 gene uvrD 30418 28262 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815343.1 protein_id gnl|my_center|LOCUS_12040 30490 31056 gene locus_tag LOCUS_12050 30490 31056 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_12050 31053 33230 gene locus_tag LOCUS_12060 31053 33230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 33315 34178 gene locus_tag LOCUS_12070 33315 34178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 34443 34715 gene locus_tag LOCUS_12080 34443 34715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12080 36234 34954 gene locus_tag LOCUS_12090 36234 34954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 40379 36231 gene locus_tag LOCUS_12100 40379 36231 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459216.1 protein_id gnl|my_center|LOCUS_12100 41631 40399 gene locus_tag LOCUS_12110 41631 40399 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005646006.1 protein_id gnl|my_center|LOCUS_12110 44361 41647 gene locus_tag LOCUS_12120 44361 41647 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484637.1 protein_id gnl|my_center|LOCUS_12120 44597 44358 gene locus_tag LOCUS_12130 44597 44358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 45924 44701 gene locus_tag LOCUS_12140 45924 44701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 47414 45921 gene locus_tag LOCUS_12150 47414 45921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 47535 47774 gene locus_tag LOCUS_12160 47535 47774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12160 47716 47889 gene locus_tag LOCUS_12170 47716 47889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12170 48908 49102 gene locus_tag LOCUS_12180 48908 49102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 49412 49337 gene locus_tag LOCUS_t00130 49412 49337 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence20 7 495 gene locus_tag LOCUS_12190 7 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 624 1967 gene locus_tag LOCUS_12200 624 1967 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_12200 1972 3204 gene locus_tag LOCUS_12210 1972 3204 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_12210 3194 3967 gene locus_tag LOCUS_12220 3194 3967 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816934.1 protein_id gnl|my_center|LOCUS_12220 3967 4602 gene locus_tag LOCUS_12230 3967 4602 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160493.1 protein_id gnl|my_center|LOCUS_12230 4604 5212 gene locus_tag LOCUS_12240 gene nqrE 4604 5212 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_12240 5477 6700 gene locus_tag LOCUS_12250 gene nqrF 5477 6700 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816933.1 protein_id gnl|my_center|LOCUS_12250 6766 6972 gene locus_tag LOCUS_12260 6766 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 7097 8419 gene locus_tag LOCUS_12270 7097 8419 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943836.1 protein_id gnl|my_center|LOCUS_12270 8416 8688 gene locus_tag LOCUS_12280 8416 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 8693 9796 gene locus_tag LOCUS_12290 8693 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 10517 11665 gene locus_tag LOCUS_12300 10517 11665 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020792.1 protein_id gnl|my_center|LOCUS_12300 11831 13024 gene locus_tag LOCUS_12310 11831 13024 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_12310 13017 14402 gene locus_tag LOCUS_12320 13017 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 14395 17571 gene locus_tag LOCUS_12330 14395 17571 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_12330 17596 18438 gene locus_tag LOCUS_12340 17596 18438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 18446 18862 gene locus_tag LOCUS_12350 18446 18862 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_12350 18859 20076 gene locus_tag LOCUS_12360 18859 20076 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 protein_id gnl|my_center|LOCUS_12360 20063 21727 gene locus_tag LOCUS_12370 gene menD 20063 21727 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_12370 21724 22536 gene locus_tag LOCUS_12380 gene menB 21724 22536 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_12380 22560 23291 gene locus_tag LOCUS_12390 gene ubiE 22560 23291 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948588.1 protein_id gnl|my_center|LOCUS_12390 23918 23316 gene locus_tag LOCUS_12400 23918 23316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 25950 23998 gene locus_tag LOCUS_12410 25950 23998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 26168 26001 gene locus_tag LOCUS_12420 26168 26001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 26143 27432 gene locus_tag LOCUS_12430 26143 27432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 27786 29825 gene locus_tag LOCUS_12440 27786 29825 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_12440 30192 31460 gene locus_tag LOCUS_12450 30192 31460 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397146.1 protein_id gnl|my_center|LOCUS_12450 31457 34552 gene locus_tag LOCUS_12460 31457 34552 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_12460 35228 34542 gene locus_tag LOCUS_12470 35228 34542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 36054 35245 gene locus_tag LOCUS_12480 gene fldI 36054 35245 CDS product phenyllactyl-CoA dehydratase activase FldI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357618.1 protein_id gnl|my_center|LOCUS_12480 37334 36051 gene locus_tag LOCUS_12490 37334 36051 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869008.1 protein_id gnl|my_center|LOCUS_12490 38301 37327 gene locus_tag LOCUS_12500 38301 37327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 39238 38294 gene locus_tag LOCUS_12510 39238 38294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 39887 40522 gene locus_tag LOCUS_12520 39887 40522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 40525 41652 gene locus_tag LOCUS_12530 40525 41652 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972063.1 protein_id gnl|my_center|LOCUS_12530 41750 42151 gene locus_tag LOCUS_12540 41750 42151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 42252 43478 gene locus_tag LOCUS_12550 42252 43478 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_12550 43475 45208 gene locus_tag LOCUS_12560 43475 45208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 45346 48471 gene locus_tag LOCUS_12570 45346 48471 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence21 247 549 gene locus_tag LOCUS_12580 247 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1701 514 gene locus_tag LOCUS_12590 1701 514 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035961988.1 protein_id gnl|my_center|LOCUS_12590 1912 1839 gene locus_tag LOCUS_t00140 1912 1839 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2145 2070 gene locus_tag LOCUS_t00150 2145 2070 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2777 2214 gene locus_tag LOCUS_12600 gene pgsA 2777 2214 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_12600 4606 2774 gene locus_tag LOCUS_12610 gene uvrC 4606 2774 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_12610 5286 4642 gene locus_tag LOCUS_12620 5286 4642 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_12620 5934 5296 gene locus_tag LOCUS_12630 gene uvrY 5934 5296 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419913.1 protein_id gnl|my_center|LOCUS_12630 7314 6646 gene locus_tag LOCUS_12640 7314 6646 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_12640 9519 7321 gene locus_tag LOCUS_12650 9519 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 10995 9544 gene locus_tag LOCUS_12660 gene pyk 10995 9544 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093930.1 protein_id gnl|my_center|LOCUS_12660 12224 11043 gene locus_tag LOCUS_12670 12224 11043 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_12670 13342 12344 gene locus_tag LOCUS_12680 gene gap 13342 12344 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_12680 15395 13398 gene locus_tag LOCUS_12690 gene tkt 15395 13398 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098688.1 protein_id gnl|my_center|LOCUS_12690 16133 15576 gene locus_tag LOCUS_12700 16133 15576 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_12700 16314 17474 gene locus_tag LOCUS_12710 gene metK 16314 17474 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 protein_id gnl|my_center|LOCUS_12710 17658 19061 gene locus_tag LOCUS_12720 gene ahcY 17658 19061 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125935.1 protein_id gnl|my_center|LOCUS_12720 19135 20463 gene locus_tag LOCUS_12730 19135 20463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 20460 21032 gene locus_tag LOCUS_12740 20460 21032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 21241 21564 gene locus_tag LOCUS_12750 21241 21564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 21599 22480 gene locus_tag LOCUS_12760 gene metF 21599 22480 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765400.1 protein_id gnl|my_center|LOCUS_12760 22501 23607 gene locus_tag LOCUS_12770 22501 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 25004 23610 gene locus_tag LOCUS_12780 gene der 25004 23610 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_12780 26199 25033 gene locus_tag LOCUS_12790 gene bamB 26199 25033 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_12790 26850 26218 gene locus_tag LOCUS_12800 26850 26218 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_12800 28127 26847 gene locus_tag LOCUS_12810 gene hisS 28127 26847 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266910.1 protein_id gnl|my_center|LOCUS_12810 29234 28170 gene locus_tag LOCUS_12820 29234 28170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 30016 29231 gene locus_tag LOCUS_12830 gene tapF 30016 29231 CDS product PilW family type IVa pilus biogenesis/stability lipoprotein TapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705643.1 protein_id gnl|my_center|LOCUS_12830 31116 30013 gene locus_tag LOCUS_12840 31116 30013 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_12840 31554 31123 gene locus_tag LOCUS_12850 gene ndk 31554 31123 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812972.1 protein_id gnl|my_center|LOCUS_12850 33139 31805 gene locus_tag LOCUS_12860 33139 31805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 33687 34040 gene locus_tag LOCUS_12870 gene folB 33687 34040 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_12870 34021 34551 gene locus_tag LOCUS_12880 gene folK 34021 34551 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_12880 34801 35586 gene locus_tag LOCUS_12890 34801 35586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 35625 37049 gene locus_tag LOCUS_12900 35625 37049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 37066 37311 gene locus_tag LOCUS_12910 37066 37311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 37388 40006 gene locus_tag LOCUS_12920 37388 40006 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_12920 40146 42920 gene locus_tag LOCUS_12930 40146 42920 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787323.1 protein_id gnl|my_center|LOCUS_12930 43268 44155 gene locus_tag LOCUS_12940 43268 44155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 44404 44676 gene locus_tag LOCUS_12950 44404 44676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12950 44862 44644 gene locus_tag LOCUS_12960 44862 44644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 44931 46979 gene locus_tag LOCUS_12970 44931 46979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 46981 47259 gene locus_tag LOCUS_12980 gene cas2 46981 47259 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259224.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence22 389 1390 gene locus_tag LOCUS_12990 389 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 3554 1428 gene locus_tag LOCUS_13000 3554 1428 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_13000 3635 4354 gene locus_tag LOCUS_13010 gene aat 3635 4354 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_13010 4714 5082 gene locus_tag LOCUS_13020 4714 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 5139 5357 gene locus_tag LOCUS_13030 gene infA 5139 5357 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 protein_id gnl|my_center|LOCUS_13030 7640 5385 gene locus_tag LOCUS_13040 gene clpA 7640 5385 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_13040 8042 7722 gene locus_tag LOCUS_13050 gene clpS 8042 7722 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097649.1 protein_id gnl|my_center|LOCUS_13050 8412 8624 gene locus_tag LOCUS_13060 8412 8624 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_13060 8967 10034 gene locus_tag LOCUS_13070 gene mnmA 8967 10034 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109995.1 protein_id gnl|my_center|LOCUS_13070 10034 10675 gene locus_tag LOCUS_13080 gene hflD 10034 10675 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367144.1 protein_id gnl|my_center|LOCUS_13080 10672 11100 gene locus_tag LOCUS_13090 10672 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 11134 11922 gene locus_tag LOCUS_13100 11134 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13100 11909 12484 gene locus_tag LOCUS_13110 11909 12484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 13408 12494 gene locus_tag LOCUS_13120 13408 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 13463 14764 gene locus_tag LOCUS_13130 13463 14764 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895570.1 protein_id gnl|my_center|LOCUS_13130 14761 15057 gene locus_tag LOCUS_13140 14761 15057 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947507.1 protein_id gnl|my_center|LOCUS_13140 15479 15036 gene locus_tag LOCUS_13150 gene fliJ 15479 15036 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367979.1 protein_id gnl|my_center|LOCUS_13150 16897 15524 gene locus_tag LOCUS_13160 gene fliI 16897 15524 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086458.1 protein_id gnl|my_center|LOCUS_13160 17568 16894 gene locus_tag LOCUS_13170 17568 16894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 18562 17549 gene locus_tag LOCUS_13180 gene fliG 18562 17549 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890098.1 protein_id gnl|my_center|LOCUS_13180 20204 18552 gene locus_tag LOCUS_13190 gene fliF 20204 18552 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244370.1 protein_id gnl|my_center|LOCUS_13190 20566 20249 gene locus_tag LOCUS_13200 gene fliE 20566 20249 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086454.1 protein_id gnl|my_center|LOCUS_13200 21954 20620 gene locus_tag LOCUS_13210 21954 20620 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 protein_id gnl|my_center|LOCUS_13210 23189 21951 gene locus_tag LOCUS_13220 23189 21951 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268445.1 protein_id gnl|my_center|LOCUS_13220 24779 23307 gene locus_tag LOCUS_13230 gene fleQ 24779 23307 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_13230 24957 26237 gene locus_tag LOCUS_13240 24957 26237 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_13240 26403 27155 gene locus_tag LOCUS_13250 26403 27155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 27209 27583 gene locus_tag LOCUS_13260 gene mapZ 27209 27583 CDS product cyclic di-GMP-binding protein MapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094864.1 protein_id gnl|my_center|LOCUS_13260 28963 27587 gene locus_tag LOCUS_13270 gene radA 28963 27587 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770187.1 protein_id gnl|my_center|LOCUS_13270 30050 28941 gene locus_tag LOCUS_13280 gene alr 30050 28941 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209096.1 protein_id gnl|my_center|LOCUS_13280 31453 30050 gene locus_tag LOCUS_13290 gene dnaB 31453 30050 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380723.1 protein_id gnl|my_center|LOCUS_13290 32055 31606 gene locus_tag LOCUS_13300 gene rplI 32055 31606 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317208.1 protein_id gnl|my_center|LOCUS_13300 33011 32079 gene locus_tag LOCUS_13310 33011 32079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 protein_id gnl|my_center|LOCUS_13310 33296 33069 gene locus_tag LOCUS_13320 gene rpsR 33296 33069 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_13320 33777 33358 gene locus_tag LOCUS_13330 gene rpsF 33777 33358 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216677.1 protein_id gnl|my_center|LOCUS_13330 34882 33905 gene locus_tag LOCUS_13340 34882 33905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_13340 35273 35641 gene locus_tag LOCUS_13350 35273 35641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 35644 36927 gene locus_tag LOCUS_13360 35644 36927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 37302 36997 gene locus_tag LOCUS_13370 37302 36997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 37521 37880 gene locus_tag LOCUS_13380 37521 37880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 38014 38868 gene locus_tag LOCUS_13390 38014 38868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 39204 38875 gene locus_tag LOCUS_13400 39204 38875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 40013 39270 gene locus_tag LOCUS_13410 40013 39270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 40361 40915 gene locus_tag LOCUS_13420 40361 40915 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_13420 41750 41268 gene locus_tag LOCUS_13430 41750 41268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 42308 42487 gene locus_tag LOCUS_13440 42308 42487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 42946 42503 gene locus_tag LOCUS_13450 42946 42503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 45059 42939 gene locus_tag LOCUS_13460 45059 42939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 46175 45099 gene locus_tag LOCUS_13470 46175 45099 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 protein_id gnl|my_center|LOCUS_13470 47036 46731 gene locus_tag LOCUS_13480 47036 46731 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918758.1 protein_id gnl|my_center|LOCUS_13480 47269 47036 gene locus_tag LOCUS_13490 47269 47036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence23 440 1147 gene locus_tag LOCUS_13500 440 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2024 1209 gene locus_tag LOCUS_13510 2024 1209 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404263.1 protein_id gnl|my_center|LOCUS_13510 2731 2030 gene locus_tag LOCUS_13520 2731 2030 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268908.1 protein_id gnl|my_center|LOCUS_13520 2908 3930 gene locus_tag LOCUS_13530 2908 3930 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_13530 4293 4757 gene locus_tag LOCUS_13540 4293 4757 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349084.1 protein_id gnl|my_center|LOCUS_13540 4966 5766 gene locus_tag LOCUS_13550 4966 5766 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_13550 5792 7366 gene locus_tag LOCUS_13560 5792 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 7406 8416 gene locus_tag LOCUS_13570 7406 8416 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958577.1 protein_id gnl|my_center|LOCUS_13570 9507 8413 gene locus_tag LOCUS_13580 9507 8413 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_13580 10427 9504 gene locus_tag LOCUS_13590 10427 9504 CDS product HprK-related kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_13590 10690 10424 gene locus_tag LOCUS_13600 10690 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 11253 10750 gene locus_tag LOCUS_13610 11253 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 11843 11469 gene locus_tag LOCUS_13620 11843 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 13142 11853 gene locus_tag LOCUS_13630 gene purD 13142 11853 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_13630 14257 13481 gene locus_tag LOCUS_13640 gene lpxA 14257 13481 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690880.1 protein_id gnl|my_center|LOCUS_13640 15900 14344 gene locus_tag LOCUS_13650 gene purH 15900 14344 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_13650 16228 15932 gene locus_tag LOCUS_13660 gene fis 16228 15932 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462885.1 protein_id gnl|my_center|LOCUS_13660 17211 16225 gene locus_tag LOCUS_13670 gene dusB 17211 16225 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763161.1 protein_id gnl|my_center|LOCUS_13670 18253 17423 gene locus_tag LOCUS_13680 18253 17423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 19146 18247 gene locus_tag LOCUS_13690 gene prmA 19146 18247 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_13690 20511 19171 gene locus_tag LOCUS_13700 gene accC 20511 19171 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884888.1 protein_id gnl|my_center|LOCUS_13700 20957 20508 gene locus_tag LOCUS_13710 gene accB 20957 20508 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210070.1 protein_id gnl|my_center|LOCUS_13710 21431 20973 gene locus_tag LOCUS_13720 gene aroQ 21431 20973 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555369.1 protein_id gnl|my_center|LOCUS_13720 23448 21568 gene locus_tag LOCUS_13730 gene dsbD 23448 21568 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_13730 23756 23433 gene locus_tag LOCUS_13740 23756 23433 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819377.1 protein_id gnl|my_center|LOCUS_13740 23934 24383 gene locus_tag LOCUS_13750 23934 24383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 27008 24372 gene locus_tag LOCUS_13760 27008 24372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 27244 27534 gene locus_tag LOCUS_13770 gene groES 27244 27534 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_13770 27638 29290 gene locus_tag LOCUS_13780 gene groL 27638 29290 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_13780 29355 29495 gene locus_tag LOCUS_13790 29355 29495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 29526 30023 gene locus_tag LOCUS_13800 29526 30023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13800 30418 30891 gene locus_tag LOCUS_13810 30418 30891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 31195 32400 gene locus_tag LOCUS_13820 31195 32400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 32417 33001 gene locus_tag LOCUS_13830 gene vpsN 32417 33001 CDS product exopolysaccharide export protein VpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_13830 32998 35277 gene locus_tag LOCUS_13840 gene vpsO 32998 35277 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_13840 35341 36060 gene locus_tag LOCUS_13850 35341 36060 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476419.1 protein_id gnl|my_center|LOCUS_13850 36240 36902 gene locus_tag LOCUS_13860 36240 36902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 36912 38321 gene locus_tag LOCUS_13870 36912 38321 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947937.1 protein_id gnl|my_center|LOCUS_13870 38519 39754 gene locus_tag LOCUS_13880 38519 39754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 39853 40617 gene locus_tag LOCUS_13890 39853 40617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 40673 41932 gene locus_tag LOCUS_13900 40673 41932 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974188.1 protein_id gnl|my_center|LOCUS_13900 41949 43295 gene locus_tag LOCUS_13910 41949 43295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 43454 44644 gene locus_tag LOCUS_13920 43454 44644 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213498758.1 protein_id gnl|my_center|LOCUS_13920 44656 45858 gene locus_tag LOCUS_13930 44656 45858 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118864.1 protein_id gnl|my_center|LOCUS_13930 46295 46519 gene locus_tag LOCUS_13940 46295 46519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 <47483 46687 gene locus_tag LOCUS_13950 <47483 46687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086016636.1:IS3 family transposase >Feature sequence24 408 196 gene locus_tag LOCUS_13960 408 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1105 710 gene locus_tag LOCUS_13970 1105 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1332 1099 gene locus_tag LOCUS_13980 1332 1099 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_13980 1692 1495 gene locus_tag LOCUS_13990 1692 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 2167 1673 gene locus_tag LOCUS_14000 2167 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 4299 2368 gene locus_tag LOCUS_14010 4299 2368 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_14010 5090 7483 gene locus_tag LOCUS_14020 gene pgaA 5090 7483 CDS product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082816276.1 protein_id gnl|my_center|LOCUS_14020 7470 9425 gene locus_tag LOCUS_14030 gene pgaB 7470 9425 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064163.1 protein_id gnl|my_center|LOCUS_14030 9428 10696 gene locus_tag LOCUS_14040 gene pgaC 9428 10696 CDS product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206025.1 protein_id gnl|my_center|LOCUS_14040 10839 11333 gene locus_tag LOCUS_14050 10839 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 11608 12540 gene locus_tag LOCUS_14060 gene prfB 11608 12540 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14060 12568 14061 gene locus_tag LOCUS_14070 gene lysS 12568 14061 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 protein_id gnl|my_center|LOCUS_14070 14905 14066 gene locus_tag LOCUS_14080 14905 14066 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_14080 16156 15122 gene locus_tag LOCUS_14090 16156 15122 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_14090 16232 18049 gene locus_tag LOCUS_14100 16232 18049 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228742.1 protein_id gnl|my_center|LOCUS_14100 18115 18312 gene locus_tag LOCUS_14110 18115 18312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 18309 20126 gene locus_tag LOCUS_14120 18309 20126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 20166 20360 gene locus_tag LOCUS_14130 20166 20360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 20975 20403 gene locus_tag LOCUS_14140 gene mobA 20975 20403 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 protein_id gnl|my_center|LOCUS_14140 21351 22253 gene locus_tag LOCUS_14150 21351 22253 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037027.1 protein_id gnl|my_center|LOCUS_14150 24772 22250 gene locus_tag LOCUS_14160 24772 22250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 24893 25138 gene locus_tag LOCUS_14170 24893 25138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 25140 26354 gene locus_tag LOCUS_14180 25140 26354 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387806.1 protein_id gnl|my_center|LOCUS_14180 27931 26363 gene locus_tag LOCUS_14190 27931 26363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 28997 27936 gene locus_tag LOCUS_14200 28997 27936 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 protein_id gnl|my_center|LOCUS_14200 31954 29129 gene locus_tag LOCUS_14210 31954 29129 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103493.1 protein_id gnl|my_center|LOCUS_14210 33219 32062 gene locus_tag LOCUS_14220 33219 32062 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_14220 33572 35380 gene locus_tag LOCUS_14230 gene lepA 33572 35380 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085555.1 protein_id gnl|my_center|LOCUS_14230 35544 36395 gene locus_tag LOCUS_14240 gene lepB 35544 36395 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090229819.1 protein_id gnl|my_center|LOCUS_14240 36466 36843 gene locus_tag LOCUS_14250 36466 36843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 36840 37523 gene locus_tag LOCUS_14260 gene rnc 36840 37523 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 protein_id gnl|my_center|LOCUS_14260 37520 38428 gene locus_tag LOCUS_14270 gene era 37520 38428 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_14270 38453 39151 gene locus_tag LOCUS_14280 gene recO 38453 39151 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654053.1 protein_id gnl|my_center|LOCUS_14280 39176 39907 gene locus_tag LOCUS_14290 gene pdxJ 39176 39907 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101974.1 protein_id gnl|my_center|LOCUS_14290 40228 39896 gene locus_tag LOCUS_14300 40228 39896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 40341 41234 gene locus_tag LOCUS_14310 gene cysM 40341 41234 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554618.1 protein_id gnl|my_center|LOCUS_14310 41257 43326 gene locus_tag LOCUS_14320 41257 43326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 43387 43992 gene locus_tag LOCUS_14330 43387 43992 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_14330 44075 45202 gene locus_tag LOCUS_14340 gene pilU 44075 45202 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence25 402 614 gene locus_tag LOCUS_14350 402 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 681 1601 gene locus_tag LOCUS_14360 681 1601 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_14360 1637 3796 gene locus_tag LOCUS_14370 1637 3796 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_14370 3991 5511 gene locus_tag LOCUS_14380 gene gshA 3991 5511 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704677.1 protein_id gnl|my_center|LOCUS_14380 6137 6766 gene locus_tag LOCUS_14390 gene grpE 6137 6766 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444334.1 protein_id gnl|my_center|LOCUS_14390 6854 8803 gene locus_tag LOCUS_14400 gene dnaK 6854 8803 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 protein_id gnl|my_center|LOCUS_14400 8983 10116 gene locus_tag LOCUS_14410 gene dnaJ 8983 10116 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377482.1 protein_id gnl|my_center|LOCUS_14410 10164 10967 gene locus_tag LOCUS_14420 gene dapB 10164 10967 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_14420 11107 12351 gene locus_tag LOCUS_14430 11107 12351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 12459 12779 gene locus_tag LOCUS_14440 12459 12779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 12785 13963 gene locus_tag LOCUS_14450 gene lapB 12785 13963 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947152.1 protein_id gnl|my_center|LOCUS_14450 13990 14691 gene locus_tag LOCUS_14460 gene pyrF 13990 14691 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 protein_id gnl|my_center|LOCUS_14460 14696 15037 gene locus_tag LOCUS_14470 14696 15037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 15226 18435 gene locus_tag LOCUS_14480 gene recC 15226 18435 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_14480 18452 19279 gene locus_tag LOCUS_14490 18452 19279 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382474.1 protein_id gnl|my_center|LOCUS_14490 19607 19290 gene locus_tag LOCUS_14500 gene soxZ 19607 19290 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_14500 20036 19614 gene locus_tag LOCUS_14510 20036 19614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 21568 20099 gene locus_tag LOCUS_14520 21568 20099 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_14520 21709 22101 gene locus_tag LOCUS_14530 gene tusD 21709 22101 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209689.1 protein_id gnl|my_center|LOCUS_14530 22103 22465 gene locus_tag LOCUS_14540 gene tusC 22103 22465 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_14540 22475 22783 gene locus_tag LOCUS_14550 gene tusB 22475 22783 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_14550 22774 23112 gene locus_tag LOCUS_14560 22774 23112 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_14560 23128 24498 gene locus_tag LOCUS_14570 gene cobB 23128 24498 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_14570 24566 24997 gene locus_tag LOCUS_14580 24566 24997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 25292 24999 gene locus_tag LOCUS_14590 25292 24999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 26768 25479 gene locus_tag LOCUS_14600 gene rhlB 26768 25479 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099279.1 protein_id gnl|my_center|LOCUS_14600 26986 27312 gene locus_tag LOCUS_14610 gene trxA 26986 27312 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403255.1 protein_id gnl|my_center|LOCUS_14610 27499 28755 gene locus_tag LOCUS_14620 gene rho 27499 28755 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_14620 28761 29417 gene locus_tag LOCUS_14630 28761 29417 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237801.1 protein_id gnl|my_center|LOCUS_14630 30313 29462 gene locus_tag LOCUS_14640 gene cpdA 30313 29462 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707475.1 protein_id gnl|my_center|LOCUS_14640 30966 30451 gene locus_tag LOCUS_14650 gene fabA 30966 30451 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 protein_id gnl|my_center|LOCUS_14650 32794 31073 gene locus_tag LOCUS_14660 32794 31073 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 protein_id gnl|my_center|LOCUS_14660 33045 33641 gene locus_tag LOCUS_14670 33045 33641 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083022.1 protein_id gnl|my_center|LOCUS_14670 33670 35649 gene locus_tag LOCUS_14680 33670 35649 CDS product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946565.1 protein_id gnl|my_center|LOCUS_14680 36125 37150 gene locus_tag LOCUS_14690 gene recA 36125 37150 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772330.1 protein_id gnl|my_center|LOCUS_14690 37171 37599 gene locus_tag LOCUS_14700 gene recX 37171 37599 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703240.1 protein_id gnl|my_center|LOCUS_14700 37624 40254 gene locus_tag LOCUS_14710 gene alaS 37624 40254 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_14710 40337 41566 gene locus_tag LOCUS_14720 40337 41566 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 protein_id gnl|my_center|LOCUS_14720 41764 41964 gene locus_tag LOCUS_14730 gene csrA 41764 41964 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006082602.1 protein_id gnl|my_center|LOCUS_14730 42292 42382 gene locus_tag LOCUS_t00160 42292 42382 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 43901 42342 gene locus_tag LOCUS_14740 43901 42342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 44907 44233 gene locus_tag LOCUS_14750 44907 44233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence26 834 196 gene locus_tag LOCUS_14760 gene rsmG 834 196 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074339.1 protein_id gnl|my_center|LOCUS_14760 2723 831 gene locus_tag LOCUS_14770 gene mnmG 2723 831 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262905.1 protein_id gnl|my_center|LOCUS_14770 3867 2716 gene locus_tag LOCUS_14780 3867 2716 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958179.1 protein_id gnl|my_center|LOCUS_14780 4115 3873 gene locus_tag LOCUS_14790 4115 3873 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391974.1 protein_id gnl|my_center|LOCUS_14790 5155 4112 gene locus_tag LOCUS_14800 5155 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_14800 5271 6209 gene locus_tag LOCUS_14810 gene glyQ 5271 6209 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_14810 6202 8301 gene locus_tag LOCUS_14820 gene glyS 6202 8301 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693270.1 protein_id gnl|my_center|LOCUS_14820 8310 8852 gene locus_tag LOCUS_14830 gene gmhB 8310 8852 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_14830 8849 9574 gene locus_tag LOCUS_14840 8849 9574 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_14840 11998 9599 gene locus_tag LOCUS_14850 gene gyrB 11998 9599 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072067.1 protein_id gnl|my_center|LOCUS_14850 13137 12067 gene locus_tag LOCUS_14860 gene recF 13137 12067 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097265.1 protein_id gnl|my_center|LOCUS_14860 14236 13169 gene locus_tag LOCUS_14870 gene dnaN 14236 13169 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097262.1 protein_id gnl|my_center|LOCUS_14870 15741 14491 gene locus_tag LOCUS_14880 gene dnaA 15741 14491 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070424.1 protein_id gnl|my_center|LOCUS_14880 16671 16471 gene locus_tag LOCUS_14890 16671 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 16670 18331 gene locus_tag LOCUS_14900 gene yidC 16670 18331 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105595.1 protein_id gnl|my_center|LOCUS_14900 18354 19706 gene locus_tag LOCUS_14910 gene mnmE 18354 19706 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981435.1 protein_id gnl|my_center|LOCUS_14910 19830 22208 gene locus_tag LOCUS_14920 19830 22208 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451094.1 protein_id gnl|my_center|LOCUS_14920 22877 22215 gene locus_tag LOCUS_14930 22877 22215 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_14930 22844 23068 gene locus_tag LOCUS_14940 22844 23068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 23146 24150 gene locus_tag LOCUS_14950 gene hemB 23146 24150 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 protein_id gnl|my_center|LOCUS_14950 24161 24985 gene locus_tag LOCUS_14960 gene aroE 24161 24985 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 protein_id gnl|my_center|LOCUS_14960 25329 24982 gene locus_tag LOCUS_14970 25329 24982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 25394 25930 gene locus_tag LOCUS_14980 gene cobO 25394 25930 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086044.1 protein_id gnl|my_center|LOCUS_14980 26021 26674 gene locus_tag LOCUS_14990 gene bluB 26021 26674 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_14990 26678 27577 gene locus_tag LOCUS_15000 gene cbiB 26678 27577 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268581.1 protein_id gnl|my_center|LOCUS_15000 27570 28568 gene locus_tag LOCUS_15010 gene cobD 27570 28568 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_15010 28565 30079 gene locus_tag LOCUS_15020 28565 30079 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112353.1 protein_id gnl|my_center|LOCUS_15020 30182 30454 gene locus_tag LOCUS_15030 30182 30454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15030 30619 31146 gene locus_tag LOCUS_15040 gene cobU 30619 31146 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_15040 31136 32191 gene locus_tag LOCUS_15050 gene cobT 31136 32191 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112354.1 protein_id gnl|my_center|LOCUS_15050 32184 32786 gene locus_tag LOCUS_15060 32184 32786 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 protein_id gnl|my_center|LOCUS_15060 32783 33526 gene locus_tag LOCUS_15070 32783 33526 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086787.1 protein_id gnl|my_center|LOCUS_15070 34227 33523 gene locus_tag LOCUS_15080 34227 33523 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 protein_id gnl|my_center|LOCUS_15080 34990 34229 gene locus_tag LOCUS_15090 34990 34229 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_15090 36492 35059 gene locus_tag LOCUS_15100 gene dbpA 36492 35059 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_15100 36733 37425 gene locus_tag LOCUS_15110 36733 37425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 37447 38721 gene locus_tag LOCUS_15120 37447 38721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 38722 39012 gene locus_tag LOCUS_15130 38722 39012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 40454 39033 gene locus_tag LOCUS_15140 40454 39033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 40609 40875 gene locus_tag LOCUS_15150 40609 40875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 41970 41749 gene locus_tag LOCUS_15160 41970 41749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 42860 42312 gene locus_tag LOCUS_15170 42860 42312 CDS product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938122.1 protein_id gnl|my_center|LOCUS_15170 43562 42867 gene locus_tag LOCUS_15180 43562 42867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 44252 43968 gene locus_tag LOCUS_15190 44252 43968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 44482 44252 gene locus_tag LOCUS_15200 44482 44252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence27 414 695 gene locus_tag LOCUS_15210 414 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1358 897 gene locus_tag LOCUS_15220 1358 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1418 2650 gene locus_tag LOCUS_15230 1418 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2791 2979 gene locus_tag LOCUS_15240 2791 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15240 3107 3481 gene locus_tag LOCUS_15250 3107 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3593 3934 gene locus_tag LOCUS_15260 3593 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3970 5055 gene locus_tag LOCUS_15270 3970 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 5145 5747 gene locus_tag LOCUS_15280 5145 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 7418 5847 gene locus_tag LOCUS_15290 7418 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 8162 9028 gene locus_tag LOCUS_15300 8162 9028 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261581.1 protein_id gnl|my_center|LOCUS_15300 9716 9033 gene locus_tag LOCUS_15310 9716 9033 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_15310 9829 10797 gene locus_tag LOCUS_15320 gene bioB 9829 10797 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_15320 10803 11939 gene locus_tag LOCUS_15330 gene bioF 10803 11939 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 protein_id gnl|my_center|LOCUS_15330 11936 12724 gene locus_tag LOCUS_15340 gene bioH 11936 12724 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_15340 12717 13580 gene locus_tag LOCUS_15350 gene bioC 12717 13580 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_15350 13577 14251 gene locus_tag LOCUS_15360 gene bioD 13577 14251 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103336.1 protein_id gnl|my_center|LOCUS_15360 15190 14246 gene locus_tag LOCUS_15370 15190 14246 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168557.1 protein_id gnl|my_center|LOCUS_15370 15418 17085 gene locus_tag LOCUS_15380 gene pckA 15418 17085 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_15380 17102 17776 gene locus_tag LOCUS_15390 17102 17776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 18351 17782 gene locus_tag LOCUS_15400 18351 17782 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_15400 18585 18385 gene locus_tag LOCUS_15410 18585 18385 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_15410 18679 21372 gene locus_tag LOCUS_15420 18679 21372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 21365 22168 gene locus_tag LOCUS_15430 21365 22168 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_15430 22182 23567 gene locus_tag LOCUS_15440 22182 23567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 23585 24022 gene locus_tag LOCUS_15450 23585 24022 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933012.1 protein_id gnl|my_center|LOCUS_15450 24144 26420 gene locus_tag LOCUS_15460 24144 26420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 26945 26872 gene locus_tag LOCUS_t00170 26945 26872 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 27382 26990 gene locus_tag LOCUS_15470 gene rpsI 27382 26990 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336286.1 protein_id gnl|my_center|LOCUS_15470 27840 27412 gene locus_tag LOCUS_15480 gene rplM 27840 27412 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098967.1 protein_id gnl|my_center|LOCUS_15480 28196 28032 gene locus_tag LOCUS_15490 28196 28032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 28772 28437 gene locus_tag LOCUS_15500 28772 28437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 28743 29201 gene locus_tag LOCUS_15510 28743 29201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 29198 30505 gene locus_tag LOCUS_15520 gene bioA 29198 30505 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931741.1 protein_id gnl|my_center|LOCUS_15520 30890 30474 gene locus_tag LOCUS_15530 30890 30474 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_15530 31012 31665 gene locus_tag LOCUS_15540 gene crp 31012 31665 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 protein_id gnl|my_center|LOCUS_15540 32469 31666 gene locus_tag LOCUS_15550 gene trpC 32469 31666 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_15550 33488 32469 gene locus_tag LOCUS_15560 gene trpD 33488 32469 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316297.1 protein_id gnl|my_center|LOCUS_15560 34071 33490 gene locus_tag LOCUS_15570 34071 33490 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_15570 35879 34404 gene locus_tag LOCUS_15580 gene trpE 35879 34404 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_15580 36715 36050 gene locus_tag LOCUS_15590 36715 36050 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_15590 37133 36747 gene locus_tag LOCUS_15600 37133 36747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 37823 37134 gene locus_tag LOCUS_15610 gene rpe 37823 37134 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215694.1 protein_id gnl|my_center|LOCUS_15610 38661 37846 gene locus_tag LOCUS_15620 gene djlA 38661 37846 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 protein_id gnl|my_center|LOCUS_15620 38865 39071 gene locus_tag LOCUS_15630 38865 39071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 39228 41135 gene locus_tag LOCUS_15640 39228 41135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 41179 42144 gene locus_tag LOCUS_15650 41179 42144 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_15650 42897 42139 gene locus_tag LOCUS_15660 42897 42139 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence28 139 735 gene locus_tag LOCUS_15670 139 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1040 750 gene locus_tag LOCUS_15680 1040 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 2080 1340 gene locus_tag LOCUS_15690 2080 1340 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_15690 2932 2084 gene locus_tag LOCUS_15700 gene prmC 2932 2084 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266734.1 protein_id gnl|my_center|LOCUS_15700 4011 2929 gene locus_tag LOCUS_15710 gene prfA 4011 2929 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772919.1 protein_id gnl|my_center|LOCUS_15710 5279 4008 gene locus_tag LOCUS_15720 gene hemA 5279 4008 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266733.1 protein_id gnl|my_center|LOCUS_15720 5683 7425 gene locus_tag LOCUS_15730 5683 7425 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074907579.1 protein_id gnl|my_center|LOCUS_15730 7433 8278 gene locus_tag LOCUS_15740 gene ispE 7433 8278 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_15740 8324 8399 gene locus_tag LOCUS_t00180 8324 8399 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8482 9444 gene locus_tag LOCUS_15750 8482 9444 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_15750 9559 10188 gene locus_tag LOCUS_15760 9559 10188 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_15760 10251 10844 gene locus_tag LOCUS_15770 gene pth 10251 10844 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 protein_id gnl|my_center|LOCUS_15770 11000 11084 gene locus_tag LOCUS_t00190 11000 11084 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 11143 11216 gene locus_tag LOCUS_t00200 11143 11216 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11256 11331 gene locus_tag LOCUS_t00210 11256 11331 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11427 12617 gene locus_tag LOCUS_15780 gene tuf 11427 12617 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946066.1 protein_id gnl|my_center|LOCUS_15780 12700 12775 gene locus_tag LOCUS_t00220 12700 12775 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 12808 13185 gene locus_tag LOCUS_15790 gene secE 12808 13185 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768918.1 protein_id gnl|my_center|LOCUS_15790 13187 13720 gene locus_tag LOCUS_15800 gene nusG 13187 13720 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036113.1 protein_id gnl|my_center|LOCUS_15800 13841 14272 gene locus_tag LOCUS_15810 gene rplK 13841 14272 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093751.1 protein_id gnl|my_center|LOCUS_15810 14274 14969 gene locus_tag LOCUS_15820 gene rplA 14274 14969 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096676.1 protein_id gnl|my_center|LOCUS_15820 15240 15767 gene locus_tag LOCUS_15830 gene rplJ 15240 15767 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946071.1 protein_id gnl|my_center|LOCUS_15830 15824 16201 gene locus_tag LOCUS_15840 gene rplL 15824 16201 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_15840 16374 20453 gene locus_tag LOCUS_15850 gene rpoB 16374 20453 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_15850 20505 24722 gene locus_tag LOCUS_15860 gene rpoC 20505 24722 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_15860 25044 25418 gene locus_tag LOCUS_15870 gene rpsL 25044 25418 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 protein_id gnl|my_center|LOCUS_15870 25470 25940 gene locus_tag LOCUS_15880 gene rpsG 25470 25940 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397077.1 protein_id gnl|my_center|LOCUS_15880 25991 28087 gene locus_tag LOCUS_15890 gene fusA 25991 28087 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 protein_id gnl|my_center|LOCUS_15890 28111 29301 gene locus_tag LOCUS_15900 gene tuf 28111 29301 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946066.1 protein_id gnl|my_center|LOCUS_15900 29308 29619 gene locus_tag LOCUS_15910 gene rpsJ 29308 29619 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 protein_id gnl|my_center|LOCUS_15910 29631 30281 gene locus_tag LOCUS_15920 gene rplC 29631 30281 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070617.1 protein_id gnl|my_center|LOCUS_15920 30285 30902 gene locus_tag LOCUS_15930 gene rplD 30285 30902 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417226.1 protein_id gnl|my_center|LOCUS_15930 30899 31195 gene locus_tag LOCUS_15940 gene rplW 30899 31195 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307955.1 protein_id gnl|my_center|LOCUS_15940 31229 32056 gene locus_tag LOCUS_15950 gene rplB 31229 32056 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397049.1 protein_id gnl|my_center|LOCUS_15950 32077 32349 gene locus_tag LOCUS_15960 gene rpsS 32077 32349 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093734.1 protein_id gnl|my_center|LOCUS_15960 32364 32696 gene locus_tag LOCUS_15970 gene rplV 32364 32696 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_15970 32716 33423 gene locus_tag LOCUS_15980 gene rpsC 32716 33423 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_15980 33427 33840 gene locus_tag LOCUS_15990 gene rplP 33427 33840 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_15990 33841 34041 gene locus_tag LOCUS_16000 gene rpmC 33841 34041 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495193.1 protein_id gnl|my_center|LOCUS_16000 34038 34298 gene locus_tag LOCUS_16010 gene rpsQ 34038 34298 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 protein_id gnl|my_center|LOCUS_16010 34349 34717 gene locus_tag LOCUS_16020 gene rplN 34349 34717 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806916.1 protein_id gnl|my_center|LOCUS_16020 34728 35051 gene locus_tag LOCUS_16030 gene rplX 34728 35051 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771523.1 protein_id gnl|my_center|LOCUS_16030 35065 35604 gene locus_tag LOCUS_16040 gene rplE 35065 35604 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555477.1 protein_id gnl|my_center|LOCUS_16040 35614 35919 gene locus_tag LOCUS_16050 gene rpsN 35614 35919 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118930.1 protein_id gnl|my_center|LOCUS_16050 35989 36384 gene locus_tag LOCUS_16060 gene rpsH 35989 36384 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704316.1 protein_id gnl|my_center|LOCUS_16060 36396 36932 gene locus_tag LOCUS_16070 gene rplF 36396 36932 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_16070 36939 37301 gene locus_tag LOCUS_16080 gene rplR 36939 37301 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625873.1 protein_id gnl|my_center|LOCUS_16080 37313 37819 gene locus_tag LOCUS_16090 gene rpsE 37313 37819 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 protein_id gnl|my_center|LOCUS_16090 37823 38017 gene locus_tag LOCUS_16100 gene rpmD 37823 38017 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093696.1 protein_id gnl|my_center|LOCUS_16100 38017 38451 gene locus_tag LOCUS_16110 gene rplO 38017 38451 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417259.1 protein_id gnl|my_center|LOCUS_16110 38452 39795 gene locus_tag LOCUS_16120 gene secY 38452 39795 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101599.1 protein_id gnl|my_center|LOCUS_16120 40142 40498 gene locus_tag LOCUS_16130 gene rpsM 40142 40498 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070630.1 protein_id gnl|my_center|LOCUS_16130 40546 40929 gene locus_tag LOCUS_16140 gene rpsK 40546 40929 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543603.1 protein_id gnl|my_center|LOCUS_16140 40946 41566 gene locus_tag LOCUS_16150 gene rpsD 40946 41566 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070631.1 protein_id gnl|my_center|LOCUS_16150 41589 42608 gene locus_tag LOCUS_16160 gene rpoA 41589 42608 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_16160 42650 43039 gene locus_tag LOCUS_16170 gene rplQ 42650 43039 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417273.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence29 498 695 gene locus_tag LOCUS_16180 498 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1138 734 gene locus_tag LOCUS_16190 1138 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1563 1288 gene locus_tag LOCUS_16200 1563 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4315 1631 gene locus_tag LOCUS_16210 4315 1631 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_16210 5088 4312 gene locus_tag LOCUS_16220 gene map 5088 4312 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_16220 5309 6058 gene locus_tag LOCUS_16230 gene rpsB 5309 6058 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 protein_id gnl|my_center|LOCUS_16230 6176 7063 gene locus_tag LOCUS_16240 gene tsf 6176 7063 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_16240 7088 7810 gene locus_tag LOCUS_16250 gene pyrH 7088 7810 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_16250 7812 8369 gene locus_tag LOCUS_16260 gene frr 7812 8369 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_16260 8404 9174 gene locus_tag LOCUS_16270 gene uppS 8404 9174 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071788.1 protein_id gnl|my_center|LOCUS_16270 9180 10004 gene locus_tag LOCUS_16280 9180 10004 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036560.1 protein_id gnl|my_center|LOCUS_16280 10001 11179 gene locus_tag LOCUS_16290 gene ispC 10001 11179 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266975.1 protein_id gnl|my_center|LOCUS_16290 11214 12578 gene locus_tag LOCUS_16300 gene rseP 11214 12578 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 protein_id gnl|my_center|LOCUS_16300 12701 15001 gene locus_tag LOCUS_16310 gene bamA 12701 15001 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 protein_id gnl|my_center|LOCUS_16310 15020 15544 gene locus_tag LOCUS_16320 15020 15544 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690321.1 protein_id gnl|my_center|LOCUS_16320 15586 16599 gene locus_tag LOCUS_16330 gene lpxD 15586 16599 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_16330 16639 17082 gene locus_tag LOCUS_16340 gene fabZ 16639 17082 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_16340 17079 17870 gene locus_tag LOCUS_16350 gene lpxA 17079 17870 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314305.1 protein_id gnl|my_center|LOCUS_16350 17870 19039 gene locus_tag LOCUS_16360 gene lpxB 17870 19039 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103595.1 protein_id gnl|my_center|LOCUS_16360 19036 19611 gene locus_tag LOCUS_16370 gene rnhB 19036 19611 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_16370 20504 19713 gene locus_tag LOCUS_16380 20504 19713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 20937 22757 gene locus_tag LOCUS_16390 gene typA 20937 22757 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_16390 23055 24011 gene locus_tag LOCUS_16400 gene pip 23055 24011 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414210.1 protein_id gnl|my_center|LOCUS_16400 24020 24457 gene locus_tag LOCUS_16410 gene dtd 24020 24457 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200499.1 protein_id gnl|my_center|LOCUS_16410 24524 25114 gene locus_tag LOCUS_16420 gene hisB 24524 25114 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815795.1 protein_id gnl|my_center|LOCUS_16420 25122 25763 gene locus_tag LOCUS_16430 gene hisH 25122 25763 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207858.1 protein_id gnl|my_center|LOCUS_16430 25795 26535 gene locus_tag LOCUS_16440 gene hisA 25795 26535 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 protein_id gnl|my_center|LOCUS_16440 26560 27330 gene locus_tag LOCUS_16450 gene hisF 26560 27330 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767116.1 protein_id gnl|my_center|LOCUS_16450 27331 27648 gene locus_tag LOCUS_16460 27331 27648 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_16460 27762 28025 gene locus_tag LOCUS_16470 27762 28025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 28066 28440 gene locus_tag LOCUS_16480 28066 28440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 28418 29605 gene locus_tag LOCUS_16490 28418 29605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 29989 29645 gene locus_tag LOCUS_16500 29989 29645 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246096.1 protein_id gnl|my_center|LOCUS_16500 32059 30083 gene locus_tag LOCUS_16510 gene rep 32059 30083 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262872.1 protein_id gnl|my_center|LOCUS_16510 32331 32675 gene locus_tag LOCUS_16520 32331 32675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 32729 33679 gene locus_tag LOCUS_16530 32729 33679 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007184747.1 protein_id gnl|my_center|LOCUS_16530 33694 34257 gene locus_tag LOCUS_16540 33694 34257 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 protein_id gnl|my_center|LOCUS_16540 34257 35642 gene locus_tag LOCUS_16550 34257 35642 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_16550 35703 35855 gene locus_tag LOCUS_16560 35703 35855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 35897 37054 gene locus_tag LOCUS_16570 35897 37054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 37059 37571 gene locus_tag LOCUS_16580 37059 37571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 37634 39325 gene locus_tag LOCUS_16590 37634 39325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 39566 41986 gene locus_tag LOCUS_16600 39566 41986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 42319 42029 gene locus_tag LOCUS_16610 42319 42029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence30 429 1667 gene locus_tag LOCUS_16620 429 1667 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_16620 1740 3398 gene locus_tag LOCUS_16630 1740 3398 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_16630 4307 3420 gene locus_tag LOCUS_16640 4307 3420 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_16640 5178 4327 gene locus_tag LOCUS_16650 5178 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 5940 5497 gene locus_tag LOCUS_16660 5940 5497 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_16660 6568 5993 gene locus_tag LOCUS_16670 6568 5993 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073354.1 protein_id gnl|my_center|LOCUS_16670 7915 6728 gene locus_tag LOCUS_16680 7915 6728 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_16680 7998 10004 gene locus_tag LOCUS_16690 gene uvrB 7998 10004 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 protein_id gnl|my_center|LOCUS_16690 10174 11121 gene locus_tag LOCUS_16700 10174 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 11949 12563 gene locus_tag LOCUS_16710 11949 12563 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_16710 12560 12985 gene locus_tag LOCUS_16720 12560 12985 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 protein_id gnl|my_center|LOCUS_16720 12996 13979 gene locus_tag LOCUS_16730 gene lpxK 12996 13979 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693863.1 protein_id gnl|my_center|LOCUS_16730 13972 14151 gene locus_tag LOCUS_16740 13972 14151 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947637.1 protein_id gnl|my_center|LOCUS_16740 14159 14941 gene locus_tag LOCUS_16750 gene kdsB 14159 14941 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007039689.1 protein_id gnl|my_center|LOCUS_16750 14970 15128 gene locus_tag LOCUS_16760 14970 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 15446 15853 gene locus_tag LOCUS_16770 15446 15853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 16318 18147 gene locus_tag LOCUS_16780 gene btuB 16318 18147 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_16780 18276 19094 gene locus_tag LOCUS_16790 18276 19094 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 protein_id gnl|my_center|LOCUS_16790 19091 20098 gene locus_tag LOCUS_16800 19091 20098 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_16800 20095 20895 gene locus_tag LOCUS_16810 20095 20895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097242.1 protein_id gnl|my_center|LOCUS_16810 20990 21403 gene locus_tag LOCUS_16820 20990 21403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 23045 21441 gene locus_tag LOCUS_16830 23045 21441 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_16830 24203 23241 gene locus_tag LOCUS_16840 24203 23241 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152113.1 protein_id gnl|my_center|LOCUS_16840 24521 24210 gene locus_tag LOCUS_16850 24521 24210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 25466 24522 gene locus_tag LOCUS_16860 25466 24522 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_16860 25698 25954 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtctcaatcccttcttcatcagggcatggtttggaac 26457 26185 gene locus_tag LOCUS_16870 gene cas2 26457 26185 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259224.1 protein_id gnl|my_center|LOCUS_16870 26587 26820 gene locus_tag LOCUS_16880 26587 26820 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_16880 26817 27236 gene locus_tag LOCUS_16890 26817 27236 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_16890 28106 27477 gene locus_tag LOCUS_16900 28106 27477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 28459 28121 gene locus_tag LOCUS_16910 28459 28121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 28846 28502 gene locus_tag LOCUS_16920 28846 28502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 29037 28843 gene locus_tag LOCUS_16930 29037 28843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 30439 29276 gene locus_tag LOCUS_16940 30439 29276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 30842 30420 gene locus_tag LOCUS_16950 30842 30420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 31743 30820 gene locus_tag LOCUS_16960 gene cmr4 31743 30820 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 protein_id gnl|my_center|LOCUS_16960 32897 31740 gene locus_tag LOCUS_16970 32897 31740 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229143.1 protein_id gnl|my_center|LOCUS_16970 34663 32894 gene locus_tag LOCUS_16980 gene cas10 34663 32894 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229144.1 protein_id gnl|my_center|LOCUS_16980 36000 34660 gene locus_tag LOCUS_16990 36000 34660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 36974 36018 gene locus_tag LOCUS_17000 gene cas6 36974 36018 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_17000 37270 40647 gene locus_tag LOCUS_17010 gene mscK 37270 40647 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103675.1 protein_id gnl|my_center|LOCUS_17010 42425 40644 gene locus_tag LOCUS_17020 42425 40644 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262417.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence31 <1 1830 gene locus_tag LOCUS_17030 <1 1830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113911.1:acetate--CoA ligase 2024 2857 gene locus_tag LOCUS_17040 2024 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3481 2912 gene locus_tag LOCUS_17050 3481 2912 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_17050 3599 5074 gene locus_tag LOCUS_17060 gene ppx 3599 5074 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120380.1 protein_id gnl|my_center|LOCUS_17060 5730 5122 gene locus_tag LOCUS_17070 gene lexA 5730 5122 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 protein_id gnl|my_center|LOCUS_17070 6138 5848 gene locus_tag LOCUS_17080 6138 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 6684 6157 gene locus_tag LOCUS_17090 gene rppH 6684 6157 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165374.1 protein_id gnl|my_center|LOCUS_17090 6889 7587 gene locus_tag LOCUS_17100 6889 7587 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_17100 7729 11319 gene locus_tag LOCUS_17110 gene nifJ 7729 11319 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_17110 12691 11363 gene locus_tag LOCUS_17120 12691 11363 CDS product DUF5666 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087091.1 protein_id gnl|my_center|LOCUS_17120 13661 12795 gene locus_tag LOCUS_17130 13661 12795 CDS product DUF6502 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966857.1 protein_id gnl|my_center|LOCUS_17130 13842 14342 gene locus_tag LOCUS_17140 13842 14342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 16993 14396 gene locus_tag LOCUS_17150 gene clpB 16993 14396 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 protein_id gnl|my_center|LOCUS_17150 18951 17080 gene locus_tag LOCUS_17160 18951 17080 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_17160 19893 19818 gene locus_tag LOCUS_t00230 19893 19818 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 20690 20010 gene locus_tag LOCUS_17170 gene queC 20690 20010 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_17170 21325 20687 gene locus_tag LOCUS_17180 gene queE 21325 20687 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_17180 22162 21338 gene locus_tag LOCUS_17190 22162 21338 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_17190 22463 22539 gene locus_tag LOCUS_t00240 22463 22539 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22665 24575 gene locus_tag LOCUS_17200 gene thrS 22665 24575 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443963.1 protein_id gnl|my_center|LOCUS_17200 24752 25189 gene locus_tag LOCUS_17210 gene infC 24752 25189 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170846037.1 protein_id gnl|my_center|LOCUS_17210 25221 25418 gene locus_tag LOCUS_17220 gene rpmI 25221 25418 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596065.1 protein_id gnl|my_center|LOCUS_17220 25439 25792 gene locus_tag LOCUS_17230 gene rplT 25439 25792 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138366.1 protein_id gnl|my_center|LOCUS_17230 25877 26914 gene locus_tag LOCUS_17240 gene pheS 25877 26914 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_17240 26963 29341 gene locus_tag LOCUS_17250 gene pheT 26963 29341 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114408.1 protein_id gnl|my_center|LOCUS_17250 29344 29640 gene locus_tag LOCUS_17260 gene ihfA 29344 29640 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 protein_id gnl|my_center|LOCUS_17260 29624 29983 gene locus_tag LOCUS_17270 29624 29983 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_17270 30100 30176 gene locus_tag LOCUS_t00250 30100 30176 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 32232 30421 gene locus_tag LOCUS_17280 32232 30421 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_17280 34247 32238 gene locus_tag LOCUS_17290 34247 32238 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947325.1 protein_id gnl|my_center|LOCUS_17290 35562 34249 gene locus_tag LOCUS_17300 35562 34249 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_17300 38180 35748 gene locus_tag LOCUS_17310 38180 35748 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810115.1 protein_id gnl|my_center|LOCUS_17310 39449 38283 gene locus_tag LOCUS_17320 39449 38283 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_17320 40014 39568 gene locus_tag LOCUS_17330 40014 39568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 40381 41016 gene locus_tag LOCUS_17340 40381 41016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence32 <1 646 gene locus_tag LOCUS_17350 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482694.1:ABC transporter permease 658 1896 gene locus_tag LOCUS_17360 658 1896 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_17360 1951 2655 gene locus_tag LOCUS_17370 1951 2655 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_17370 2675 3868 gene locus_tag LOCUS_17380 2675 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3993 4583 gene locus_tag LOCUS_17390 3993 4583 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_17390 4888 6480 gene locus_tag LOCUS_17400 4888 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 7498 6497 gene locus_tag LOCUS_17410 gene rsgA 7498 6497 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_17410 8739 7498 gene locus_tag LOCUS_17420 8739 7498 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039491.1 protein_id gnl|my_center|LOCUS_17420 8861 9412 gene locus_tag LOCUS_17430 gene orn 8861 9412 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_17430 10413 9409 gene locus_tag LOCUS_17440 gene queG 10413 9409 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_17440 11568 10534 gene locus_tag LOCUS_17450 11568 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 11817 12938 gene locus_tag LOCUS_17460 gene carA 11817 12938 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105665.1 protein_id gnl|my_center|LOCUS_17460 12955 16161 gene locus_tag LOCUS_17470 gene carB 12955 16161 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243709.1 protein_id gnl|my_center|LOCUS_17470 16224 16700 gene locus_tag LOCUS_17480 gene greA 16224 16700 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 protein_id gnl|my_center|LOCUS_17480 16697 17320 gene locus_tag LOCUS_17490 gene rlmE 16697 17320 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_17490 17407 19335 gene locus_tag LOCUS_17500 gene ftsH 17407 19335 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443940.1 protein_id gnl|my_center|LOCUS_17500 19347 20186 gene locus_tag LOCUS_17510 gene folP 19347 20186 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_17510 20216 21553 gene locus_tag LOCUS_17520 gene glmM 20216 21553 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_17520 21629 22381 gene locus_tag LOCUS_17530 gene tpiA 21629 22381 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_17530 22410 22775 gene locus_tag LOCUS_17540 gene secG 22410 22775 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095194.1 protein_id gnl|my_center|LOCUS_17540 22828 22912 gene locus_tag LOCUS_t00260 22828 22912 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23113 23469 gene locus_tag LOCUS_17550 23113 23469 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040258.1 protein_id gnl|my_center|LOCUS_17550 23460 23942 gene locus_tag LOCUS_17560 23460 23942 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_17560 23945 24649 gene locus_tag LOCUS_17570 23945 24649 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958234.1 protein_id gnl|my_center|LOCUS_17570 24662 25918 gene locus_tag LOCUS_17580 24662 25918 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813935.1 protein_id gnl|my_center|LOCUS_17580 25928 26434 gene locus_tag LOCUS_17590 gene nuoE 25928 26434 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_17590 26440 27717 gene locus_tag LOCUS_17600 gene nuoF 26440 27717 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_17600 27749 30064 gene locus_tag LOCUS_17610 gene nuoG 27749 30064 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948472.1 protein_id gnl|my_center|LOCUS_17610 30069 31076 gene locus_tag LOCUS_17620 gene nuoH 30069 31076 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769061.1 protein_id gnl|my_center|LOCUS_17620 31094 31582 gene locus_tag LOCUS_17630 gene nuoI 31094 31582 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017376.1 protein_id gnl|my_center|LOCUS_17630 31634 32251 gene locus_tag LOCUS_17640 31634 32251 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 protein_id gnl|my_center|LOCUS_17640 32248 32553 gene locus_tag LOCUS_17650 gene nuoK 32248 32553 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215628.1 protein_id gnl|my_center|LOCUS_17650 32590 34569 gene locus_tag LOCUS_17660 gene nuoL 32590 34569 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951337.1 protein_id gnl|my_center|LOCUS_17660 34702 36111 gene locus_tag LOCUS_17670 34702 36111 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_17670 36148 37587 gene locus_tag LOCUS_17680 gene nuoN 36148 37587 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958226.1 protein_id gnl|my_center|LOCUS_17680 38156 37803 gene locus_tag LOCUS_17690 38156 37803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 38954 38169 gene locus_tag LOCUS_17700 38954 38169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 39076 39489 gene locus_tag LOCUS_17710 39076 39489 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704842.1 protein_id gnl|my_center|LOCUS_17710 39486 39818 gene locus_tag LOCUS_17720 39486 39818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence33 470 24 gene locus_tag LOCUS_17730 470 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 849 520 gene locus_tag LOCUS_17740 849 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1099 2184 gene locus_tag LOCUS_17750 gene apbC 1099 2184 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_17750 2317 2883 gene locus_tag LOCUS_17760 gene dcd 2317 2883 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_17760 3144 2932 gene locus_tag LOCUS_17770 3144 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3325 4677 gene locus_tag LOCUS_17780 3325 4677 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261107.1 protein_id gnl|my_center|LOCUS_17780 4674 7769 gene locus_tag LOCUS_17790 4674 7769 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_17790 10067 7845 gene locus_tag LOCUS_17800 10067 7845 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 protein_id gnl|my_center|LOCUS_17800 13302 10540 gene locus_tag LOCUS_17810 13302 10540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 14658 13363 gene locus_tag LOCUS_17820 14658 13363 CDS product succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880832.1 protein_id gnl|my_center|LOCUS_17820 15652 14717 gene locus_tag LOCUS_17830 gene mdh 15652 14717 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_17830 16578 15889 gene locus_tag LOCUS_17840 16578 15889 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174130.1 protein_id gnl|my_center|LOCUS_17840 17494 16571 gene locus_tag LOCUS_17850 gene argF 17494 16571 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104892.1 protein_id gnl|my_center|LOCUS_17850 18687 17491 gene locus_tag LOCUS_17860 18687 17491 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_17860 19341 18865 gene locus_tag LOCUS_17870 19341 18865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 19676 19338 gene locus_tag LOCUS_17880 19676 19338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 21765 19711 gene locus_tag LOCUS_17890 gene metG 21765 19711 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482411.1 protein_id gnl|my_center|LOCUS_17890 22131 22592 gene locus_tag LOCUS_17900 22131 22592 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_17900 22658 24328 gene locus_tag LOCUS_17910 22658 24328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 24328 25272 gene locus_tag LOCUS_17920 24328 25272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 25307 27124 gene locus_tag LOCUS_17930 25307 27124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 27117 28019 gene locus_tag LOCUS_17940 27117 28019 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_17940 30161 28026 gene locus_tag LOCUS_17950 30161 28026 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943762.1 protein_id gnl|my_center|LOCUS_17950 30297 31481 gene locus_tag LOCUS_17960 30297 31481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 31666 32385 gene locus_tag LOCUS_17970 31666 32385 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_17970 32492 36349 gene locus_tag LOCUS_17980 gene hrpA 32492 36349 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001785213.1 protein_id gnl|my_center|LOCUS_17980 36422 36901 gene locus_tag LOCUS_17990 36422 36901 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_17990 37007 37381 gene locus_tag LOCUS_18000 37007 37381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 37997 37413 gene locus_tag LOCUS_18010 37997 37413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 38717 38250 gene locus_tag LOCUS_18020 38717 38250 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941229.1 protein_id gnl|my_center|LOCUS_18020 38959 38747 gene locus_tag LOCUS_18030 gene ybcJ 38959 38747 CDS product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095928.1 protein_id gnl|my_center|LOCUS_18030 39146 39550 gene locus_tag LOCUS_18040 39146 39550 CDS product DUF4920 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838304.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence34 366 551 gene locus_tag LOCUS_18050 366 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 2442 832 gene locus_tag LOCUS_18060 2442 832 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_18060 2581 3177 gene locus_tag LOCUS_18070 2581 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 3191 5191 gene locus_tag LOCUS_18080 3191 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 5307 6413 gene locus_tag LOCUS_18090 5307 6413 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_18090 6427 7599 gene locus_tag LOCUS_18100 6427 7599 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_18100 7599 8159 gene locus_tag LOCUS_18110 7599 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 8156 10867 gene locus_tag LOCUS_18120 8156 10867 CDS product arsenate reductase (azurin) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229171.1 protein_id gnl|my_center|LOCUS_18120 11065 11622 gene locus_tag LOCUS_18130 11065 11622 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074099.1 protein_id gnl|my_center|LOCUS_18130 11761 12843 gene locus_tag LOCUS_18140 gene ntrB 11761 12843 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_18140 12836 14236 gene locus_tag LOCUS_18150 gene ntrC 12836 14236 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_18150 14599 14991 gene locus_tag LOCUS_18160 14599 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 15003 16370 gene locus_tag LOCUS_18170 gene ppnN 15003 16370 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093432.1 protein_id gnl|my_center|LOCUS_18170 16487 18163 gene locus_tag LOCUS_18180 16487 18163 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268122.1 protein_id gnl|my_center|LOCUS_18180 18307 19374 gene locus_tag LOCUS_18190 gene cgtA 18307 19374 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210181.1 protein_id gnl|my_center|LOCUS_18190 19447 20571 gene locus_tag LOCUS_18200 gene proB 19447 20571 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_18200 20902 20642 gene locus_tag LOCUS_18210 gene rpsT 20902 20642 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117906.1 protein_id gnl|my_center|LOCUS_18210 21179 22648 gene locus_tag LOCUS_18220 gene murJ 21179 22648 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911253.1 protein_id gnl|my_center|LOCUS_18220 23252 22638 gene locus_tag LOCUS_18230 23252 22638 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247882.1 protein_id gnl|my_center|LOCUS_18230 23300 23983 gene locus_tag LOCUS_18240 23300 23983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_18240 23980 26472 gene locus_tag LOCUS_18250 23980 26472 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_18250 26482 26913 gene locus_tag LOCUS_18260 26482 26913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 26925 27944 gene locus_tag LOCUS_18270 gene hemH 26925 27944 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925680.1 protein_id gnl|my_center|LOCUS_18270 28774 27941 gene locus_tag LOCUS_18280 gene nadC 28774 27941 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 protein_id gnl|my_center|LOCUS_18280 28936 29706 gene locus_tag LOCUS_18290 28936 29706 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_18290 29703 30503 gene locus_tag LOCUS_18300 29703 30503 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_18300 30506 30856 gene locus_tag LOCUS_18310 30506 30856 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_18310 30853 31254 gene locus_tag LOCUS_18320 30853 31254 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_18320 31259 31816 gene locus_tag LOCUS_18330 gene ampD 31259 31816 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 protein_id gnl|my_center|LOCUS_18330 33075 31822 gene locus_tag LOCUS_18340 33075 31822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 33439 33194 gene locus_tag LOCUS_18350 33439 33194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18350 33647 33901 gene locus_tag LOCUS_18360 33647 33901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 33891 34220 gene locus_tag LOCUS_18370 33891 34220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 35003 36271 gene locus_tag LOCUS_18380 gene ltrA 35003 36271 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_18380 36517 37332 gene locus_tag LOCUS_18390 36517 37332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 37467 37898 gene locus_tag LOCUS_18400 37467 37898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 37895 38251 gene locus_tag LOCUS_18410 37895 38251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence35 1407 337 gene locus_tag LOCUS_18420 gene amrS 1407 337 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_18420 1799 1470 gene locus_tag LOCUS_18430 1799 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 3148 1802 gene locus_tag LOCUS_18440 3148 1802 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_18440 3741 3154 gene locus_tag LOCUS_18450 gene lolA 3741 3154 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162301084.1 protein_id gnl|my_center|LOCUS_18450 5549 3858 gene locus_tag LOCUS_18460 5549 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 8070 5761 gene locus_tag LOCUS_18470 8070 5761 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_18470 9197 8118 gene locus_tag LOCUS_18480 gene ald 9197 8118 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057941.1 protein_id gnl|my_center|LOCUS_18480 9389 10351 gene locus_tag LOCUS_18490 gene trxB 9389 10351 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941156.1 protein_id gnl|my_center|LOCUS_18490 10837 10469 gene locus_tag LOCUS_18500 10837 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 12505 10892 gene locus_tag LOCUS_18510 12505 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 13134 12502 gene locus_tag LOCUS_18520 13134 12502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 13530 15437 gene locus_tag LOCUS_18530 13530 15437 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938363.1 protein_id gnl|my_center|LOCUS_18530 15444 17012 gene locus_tag LOCUS_18540 gene pntA 15444 17012 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295398.1 protein_id gnl|my_center|LOCUS_18540 17025 18443 gene locus_tag LOCUS_18550 gene pntB 17025 18443 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073523.1 protein_id gnl|my_center|LOCUS_18550 19310 18936 gene locus_tag LOCUS_18560 19310 18936 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_18560 19982 19329 gene locus_tag LOCUS_18570 gene elbB 19982 19329 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390979.1 protein_id gnl|my_center|LOCUS_18570 21817 19982 gene locus_tag LOCUS_18580 gene recD 21817 19982 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 protein_id gnl|my_center|LOCUS_18580 25305 21814 gene locus_tag LOCUS_18590 gene recB 25305 21814 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942181.1 protein_id gnl|my_center|LOCUS_18590 26860 25451 gene locus_tag LOCUS_18600 gene lpdA 26860 25451 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_18600 28122 26905 gene locus_tag LOCUS_18610 gene odhB 28122 26905 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083283.1 protein_id gnl|my_center|LOCUS_18610 31045 28142 gene locus_tag LOCUS_18620 31045 28142 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388968.1 protein_id gnl|my_center|LOCUS_18620 31360 31436 gene locus_tag LOCUS_t00270 31360 31436 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32516 31452 gene locus_tag LOCUS_18630 32516 31452 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 protein_id gnl|my_center|LOCUS_18630 32993 32793 gene locus_tag LOCUS_18640 32993 32793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 33831 34109 gene locus_tag LOCUS_18650 33831 34109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 34207 34509 gene locus_tag LOCUS_18660 34207 34509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 34527 35162 gene locus_tag LOCUS_18670 gene flhC 34527 35162 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_18670 35162 36706 gene locus_tag LOCUS_18680 35162 36706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 36711 37298 gene locus_tag LOCUS_18690 36711 37298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence36 2407 1046 gene locus_tag LOCUS_18700 2407 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2666 3919 gene locus_tag LOCUS_18710 2666 3919 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_18710 4262 4816 gene locus_tag LOCUS_18720 gene ppa 4262 4816 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948454.1 protein_id gnl|my_center|LOCUS_18720 4941 5420 gene locus_tag LOCUS_18730 gene moaC 4941 5420 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_18730 5425 6027 gene locus_tag LOCUS_18740 gene yihA 5425 6027 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945886.1 protein_id gnl|my_center|LOCUS_18740 8960 6267 gene locus_tag LOCUS_18750 gene polA 8960 6267 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 protein_id gnl|my_center|LOCUS_18750 9294 8968 gene locus_tag LOCUS_18760 9294 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 10004 9318 gene locus_tag LOCUS_18770 10004 9318 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024089.1 protein_id gnl|my_center|LOCUS_18770 10787 11239 gene locus_tag LOCUS_18780 gene mraZ 10787 11239 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103101.1 protein_id gnl|my_center|LOCUS_18780 11246 12172 gene locus_tag LOCUS_18790 gene rsmH 11246 12172 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651812.1 protein_id gnl|my_center|LOCUS_18790 12169 12441 gene locus_tag LOCUS_18800 gene ftsL 12169 12441 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739040.1 protein_id gnl|my_center|LOCUS_18800 12446 14212 gene locus_tag LOCUS_18810 gene ftsI 12446 14212 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_18810 14209 15750 gene locus_tag LOCUS_18820 14209 15750 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769454.1 protein_id gnl|my_center|LOCUS_18820 15747 17114 gene locus_tag LOCUS_18830 gene murF 15747 17114 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626681.1 protein_id gnl|my_center|LOCUS_18830 17116 18201 gene locus_tag LOCUS_18840 gene mraY 17116 18201 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_18840 18217 19605 gene locus_tag LOCUS_18850 gene murD 18217 19605 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_18850 19602 20798 gene locus_tag LOCUS_18860 gene ftsW 19602 20798 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406017.1 protein_id gnl|my_center|LOCUS_18860 20798 21862 gene locus_tag LOCUS_18870 gene murG 20798 21862 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_18870 21859 23304 gene locus_tag LOCUS_18880 gene murC 21859 23304 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_18880 23301 23465 gene locus_tag LOCUS_18890 23301 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 23459 24352 gene locus_tag LOCUS_18900 gene murB 23459 24352 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_18900 24349 25257 gene locus_tag LOCUS_18910 24349 25257 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210432.1 protein_id gnl|my_center|LOCUS_18910 25321 26058 gene locus_tag LOCUS_18920 25321 26058 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769491.1 protein_id gnl|my_center|LOCUS_18920 26059 27294 gene locus_tag LOCUS_18930 gene ftsA 26059 27294 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_18930 27360 28544 gene locus_tag LOCUS_18940 gene ftsZ 27360 28544 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948309.1 protein_id gnl|my_center|LOCUS_18940 28702 29613 gene locus_tag LOCUS_18950 gene lpxC 28702 29613 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_18950 30124 29690 gene locus_tag LOCUS_18960 30124 29690 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377653.1 protein_id gnl|my_center|LOCUS_18960 30167 31132 gene locus_tag LOCUS_18970 30167 31132 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_18970 31252 34065 gene locus_tag LOCUS_18980 gene secA 31252 34065 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073892.1 protein_id gnl|my_center|LOCUS_18980 34089 35300 gene locus_tag LOCUS_18990 gene argJ 34089 35300 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208443.1 protein_id gnl|my_center|LOCUS_18990 36118 35297 gene locus_tag LOCUS_19000 36118 35297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 36182 37165 gene locus_tag LOCUS_19010 36182 37165 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104999.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence37 311 2266 gene locus_tag LOCUS_19020 311 2266 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869969.1 protein_id gnl|my_center|LOCUS_19020 2663 2310 gene locus_tag LOCUS_19030 2663 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 5322 2719 gene locus_tag LOCUS_19040 5322 2719 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933347.1 protein_id gnl|my_center|LOCUS_19040 6685 5453 gene locus_tag LOCUS_19050 6685 5453 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_19050 7541 6855 gene locus_tag LOCUS_19060 gene pgl 7541 6855 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_19060 9028 7538 gene locus_tag LOCUS_19070 gene zwf 9028 7538 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_19070 10472 9033 gene locus_tag LOCUS_19080 gene gnd 10472 9033 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675469.1 protein_id gnl|my_center|LOCUS_19080 11716 10601 gene locus_tag LOCUS_19090 11716 10601 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_19090 12826 11720 gene locus_tag LOCUS_19100 12826 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 14586 12841 gene locus_tag LOCUS_19110 14586 12841 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391778.1 protein_id gnl|my_center|LOCUS_19110 15623 14589 gene locus_tag LOCUS_19120 15623 14589 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_19120 15831 16109 gene locus_tag LOCUS_19130 15831 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 16134 16679 gene locus_tag LOCUS_19140 16134 16679 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_19140 17800 16676 gene locus_tag LOCUS_19150 17800 16676 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546476.1 protein_id gnl|my_center|LOCUS_19150 18732 17797 gene locus_tag LOCUS_19160 18732 17797 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_19160 19795 18842 gene locus_tag LOCUS_19170 gene algW 19795 18842 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_19170 20096 20845 gene locus_tag LOCUS_19180 20096 20845 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261499.1 protein_id gnl|my_center|LOCUS_19180 20999 21592 gene locus_tag LOCUS_19190 gene petA 20999 21592 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_19190 21592 22806 gene locus_tag LOCUS_19200 21592 22806 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_19200 22806 23534 gene locus_tag LOCUS_19210 22806 23534 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070940.1 protein_id gnl|my_center|LOCUS_19210 23652 24275 gene locus_tag LOCUS_19220 gene sspA 23652 24275 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_19220 24320 24664 gene locus_tag LOCUS_19230 24320 24664 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207701.1 protein_id gnl|my_center|LOCUS_19230 26820 24736 gene locus_tag LOCUS_19240 gene fusA 26820 24736 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774533.1 protein_id gnl|my_center|LOCUS_19240 28464 27052 gene locus_tag LOCUS_19250 gene rhlE 28464 27052 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007095.1 protein_id gnl|my_center|LOCUS_19250 28913 29821 gene locus_tag LOCUS_19260 28913 29821 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_19260 29922 31835 gene locus_tag LOCUS_19270 gene dxs 29922 31835 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103240.1 protein_id gnl|my_center|LOCUS_19270 32054 32548 gene locus_tag LOCUS_19280 32054 32548 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_19280 32548 32832 gene locus_tag LOCUS_19290 32548 32832 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_19290 32829 33149 gene locus_tag LOCUS_19300 gene mnhG 32829 33149 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence38 295 1092 gene locus_tag LOCUS_19310 gene ttcA 295 1092 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126823.1 protein_id gnl|my_center|LOCUS_19310 1093 1701 gene locus_tag LOCUS_19320 1093 1701 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266483.1 protein_id gnl|my_center|LOCUS_19320 2842 1649 gene locus_tag LOCUS_19330 2842 1649 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_19330 3014 3463 gene locus_tag LOCUS_19340 3014 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 3474 4532 gene locus_tag LOCUS_19350 3474 4532 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_19350 4756 6117 gene locus_tag LOCUS_19360 4756 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 6114 7148 gene locus_tag LOCUS_19370 6114 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 7245 8336 gene locus_tag LOCUS_19380 7245 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 8434 9390 gene locus_tag LOCUS_19390 8434 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 9563 10021 gene locus_tag LOCUS_19400 9563 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 10234 10626 gene locus_tag LOCUS_19410 10234 10626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 10720 12405 gene locus_tag LOCUS_19420 10720 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 12399 12968 gene locus_tag LOCUS_19430 12399 12968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 12971 14299 gene locus_tag LOCUS_19440 12971 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 14441 15871 gene locus_tag LOCUS_19450 14441 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 15850 16272 gene locus_tag LOCUS_19460 15850 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 16628 17299 gene locus_tag LOCUS_19470 16628 17299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 17313 19361 gene locus_tag LOCUS_19480 17313 19361 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267838.1 protein_id gnl|my_center|LOCUS_19480 19412 20137 gene locus_tag LOCUS_19490 gene tagT 19412 20137 CDS product type IV secretion associated ABC transporter ATP-binding protein TagT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114657.1 protein_id gnl|my_center|LOCUS_19490 20134 21357 gene locus_tag LOCUS_19500 gene tagS 20134 21357 CDS product type IV secretion associated ABC transporter permease TagS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083634.1 protein_id gnl|my_center|LOCUS_19500 21357 22022 gene locus_tag LOCUS_19510 21357 22022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 23794 22499 gene locus_tag LOCUS_19520 gene gdhA 23794 22499 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_19520 23908 27048 gene locus_tag LOCUS_19530 23908 27048 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 protein_id gnl|my_center|LOCUS_19530 27924 27184 gene locus_tag LOCUS_19540 27924 27184 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_19540 28149 30422 gene locus_tag LOCUS_19550 28149 30422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 30444 31181 gene locus_tag LOCUS_19560 30444 31181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 31512 32918 gene locus_tag LOCUS_19570 gene glnA 31512 32918 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110151.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence39 209 574 gene locus_tag LOCUS_19580 209 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 574 936 gene locus_tag LOCUS_19590 574 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1089 2537 gene locus_tag LOCUS_19600 1089 2537 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_19600 2887 2543 gene locus_tag LOCUS_19610 2887 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 3800 2946 gene locus_tag LOCUS_19620 3800 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 4348 3926 gene locus_tag LOCUS_19630 4348 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 5562 4375 gene locus_tag LOCUS_19640 5562 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 6733 5636 gene locus_tag LOCUS_19650 6733 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 7737 6862 gene locus_tag LOCUS_19660 7737 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 8399 7962 gene locus_tag LOCUS_19670 8399 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 9232 8567 gene locus_tag LOCUS_19680 9232 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 11625 9274 gene locus_tag LOCUS_19690 11625 9274 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_19690 12547 11642 gene locus_tag LOCUS_19700 gene nrfD 12547 11642 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459139.1 protein_id gnl|my_center|LOCUS_19700 13194 12562 gene locus_tag LOCUS_19710 13194 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 14546 13776 gene locus_tag LOCUS_19720 14546 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 14715 16655 gene locus_tag LOCUS_19730 gene htpG 14715 16655 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_19730 16831 20370 gene locus_tag LOCUS_19740 gene dnaE 16831 20370 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946697.1 protein_id gnl|my_center|LOCUS_19740 20451 21410 gene locus_tag LOCUS_19750 gene accA 20451 21410 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349878.1 protein_id gnl|my_center|LOCUS_19750 21419 22750 gene locus_tag LOCUS_19760 gene tilS 21419 22750 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_19760 22846 23367 gene locus_tag LOCUS_19770 22846 23367 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_19770 23360 24145 gene locus_tag LOCUS_19780 23360 24145 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_19780 24142 25035 gene locus_tag LOCUS_19790 24142 25035 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143763.1 protein_id gnl|my_center|LOCUS_19790 25061 25768 gene locus_tag LOCUS_19800 25061 25768 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143764.1 protein_id gnl|my_center|LOCUS_19800 25765 26697 gene locus_tag LOCUS_19810 25765 26697 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143765.1 protein_id gnl|my_center|LOCUS_19810 26694 27437 gene locus_tag LOCUS_19820 26694 27437 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143766.1 protein_id gnl|my_center|LOCUS_19820 27466 28872 gene locus_tag LOCUS_19830 27466 28872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929376.1 protein_id gnl|my_center|LOCUS_19830 29280 30071 gene locus_tag LOCUS_19840 29280 30071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 30135 31052 gene locus_tag LOCUS_19850 30135 31052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 31244 32056 gene locus_tag LOCUS_19860 31244 32056 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143772.1 protein_id gnl|my_center|LOCUS_19860 32142 32978 gene locus_tag LOCUS_19870 32142 32978 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035329735.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence40 547 726 gene locus_tag LOCUS_19880 547 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1130 1849 gene locus_tag LOCUS_19890 1130 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2405 2106 gene locus_tag LOCUS_19900 2405 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2635 2429 gene locus_tag LOCUS_19910 2635 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2629 4092 gene locus_tag LOCUS_19920 2629 4092 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 protein_id gnl|my_center|LOCUS_19920 4239 4688 gene locus_tag LOCUS_19930 4239 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 4657 6012 gene locus_tag LOCUS_19940 gene glrR 4657 6012 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703177.1 protein_id gnl|my_center|LOCUS_19940 6068 6283 gene locus_tag LOCUS_19950 6068 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 7589 6366 gene locus_tag LOCUS_19960 7589 6366 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_19960 7885 7586 gene locus_tag LOCUS_19970 7885 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 8048 8533 gene locus_tag LOCUS_19980 gene tadA 8048 8533 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001934843.1 protein_id gnl|my_center|LOCUS_19980 9934 8537 gene locus_tag LOCUS_19990 gene mltF 9934 8537 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_19990 10224 10910 gene locus_tag LOCUS_20000 10224 10910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 10916 13264 gene locus_tag LOCUS_20010 10916 13264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 13328 13963 gene locus_tag LOCUS_20020 13328 13963 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_20020 17229 14032 gene locus_tag LOCUS_20030 17229 14032 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 protein_id gnl|my_center|LOCUS_20030 18524 17247 gene locus_tag LOCUS_20040 18524 17247 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 protein_id gnl|my_center|LOCUS_20040 19845 18544 gene locus_tag LOCUS_20050 19845 18544 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 protein_id gnl|my_center|LOCUS_20050 20229 19918 gene locus_tag LOCUS_20060 20229 19918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 20522 21421 gene locus_tag LOCUS_20070 20522 21421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 21457 24198 gene locus_tag LOCUS_20080 21457 24198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 24471 25307 gene locus_tag LOCUS_20090 24471 25307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 25304 28216 gene locus_tag LOCUS_20100 25304 28216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 28213 29406 gene locus_tag LOCUS_20110 28213 29406 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077104.1 protein_id gnl|my_center|LOCUS_20110 29489 30373 gene locus_tag LOCUS_20120 29489 30373 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_20120 <31122 30403 gene locus_tag LOCUS_20130 <31122 30403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104442.1:IS66 family transposase >Feature sequence41 819 253 gene locus_tag LOCUS_20140 819 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2009 822 gene locus_tag LOCUS_20150 2009 822 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_20150 2273 2121 gene locus_tag LOCUS_20160 2273 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2558 2403 gene locus_tag LOCUS_20170 2558 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 3711 2848 gene locus_tag LOCUS_20180 3711 2848 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_20180 5003 3708 gene locus_tag LOCUS_20190 5003 3708 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266429.1 protein_id gnl|my_center|LOCUS_20190 5977 5000 gene locus_tag LOCUS_20200 5977 5000 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736952.1 protein_id gnl|my_center|LOCUS_20200 6525 5995 gene locus_tag LOCUS_20210 gene pyrR 6525 5995 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_20210 6913 6509 gene locus_tag LOCUS_20220 gene ruvX 6913 6509 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084575.1 protein_id gnl|my_center|LOCUS_20220 7557 7027 gene locus_tag LOCUS_20230 7557 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261682.1 protein_id gnl|my_center|LOCUS_20230 8186 7623 gene locus_tag LOCUS_20240 8186 7623 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_20240 9180 8236 gene locus_tag LOCUS_20250 9180 8236 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004414710.1 protein_id gnl|my_center|LOCUS_20250 10133 9177 gene locus_tag LOCUS_20260 gene gshB 10133 9177 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316740.1 protein_id gnl|my_center|LOCUS_20260 10447 10845 gene locus_tag LOCUS_20270 gene pilG 10447 10845 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_20270 10886 11257 gene locus_tag LOCUS_20280 gene pilH 10886 11257 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_20280 11326 11874 gene locus_tag LOCUS_20290 11326 11874 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_20290 11931 13970 gene locus_tag LOCUS_20300 gene pilJ 11931 13970 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_20300 13995 19625 gene locus_tag LOCUS_20310 13995 19625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 19622 20086 gene locus_tag LOCUS_20320 19622 20086 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038042.1 protein_id gnl|my_center|LOCUS_20320 20823 20089 gene locus_tag LOCUS_20330 gene rsmE 20823 20089 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071124.1 protein_id gnl|my_center|LOCUS_20330 21680 20910 gene locus_tag LOCUS_20340 21680 20910 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_20340 22166 21684 gene locus_tag LOCUS_20350 22166 21684 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419131.1 protein_id gnl|my_center|LOCUS_20350 23139 22237 gene locus_tag LOCUS_20360 gene xerD 23139 22237 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_20360 23615 23136 gene locus_tag LOCUS_20370 23615 23136 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522636.1 protein_id gnl|my_center|LOCUS_20370 23693 24349 gene locus_tag LOCUS_20380 23693 24349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 24353 24619 gene locus_tag LOCUS_20390 24353 24619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 24946 25389 gene locus_tag LOCUS_20400 24946 25389 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300228.1 protein_id gnl|my_center|LOCUS_20400 25426 26463 gene locus_tag LOCUS_20410 25426 26463 CDS product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379749.1 protein_id gnl|my_center|LOCUS_20410 29034 26626 gene locus_tag LOCUS_20420 29034 26626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 29803 29381 gene locus_tag LOCUS_20430 29803 29381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence42 1074 1637 gene locus_tag LOCUS_20440 1074 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 4222 1640 gene locus_tag LOCUS_20450 gene mutS 4222 1640 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098485.1 protein_id gnl|my_center|LOCUS_20450 5089 4226 gene locus_tag LOCUS_20460 gene rluB 5089 4226 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113439.1 protein_id gnl|my_center|LOCUS_20460 5736 5104 gene locus_tag LOCUS_20470 gene scpB 5736 5104 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404130.1 protein_id gnl|my_center|LOCUS_20470 6575 5745 gene locus_tag LOCUS_20480 6575 5745 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037357.1 protein_id gnl|my_center|LOCUS_20480 7802 6585 gene locus_tag LOCUS_20490 7802 6585 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356903.1 protein_id gnl|my_center|LOCUS_20490 8501 7845 gene locus_tag LOCUS_20500 8501 7845 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_20500 9152 8529 gene locus_tag LOCUS_20510 9152 8529 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229052.1 protein_id gnl|my_center|LOCUS_20510 10058 9195 gene locus_tag LOCUS_20520 10058 9195 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227929.1 protein_id gnl|my_center|LOCUS_20520 10273 11238 gene locus_tag LOCUS_20530 10273 11238 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_20530 11258 12181 gene locus_tag LOCUS_20540 11258 12181 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091295.1 protein_id gnl|my_center|LOCUS_20540 12178 12687 gene locus_tag LOCUS_20550 12178 12687 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038328.1 protein_id gnl|my_center|LOCUS_20550 12684 13679 gene locus_tag LOCUS_20560 12684 13679 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_20560 13672 15453 gene locus_tag LOCUS_20570 13672 15453 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107432.1 protein_id gnl|my_center|LOCUS_20570 15447 17174 gene locus_tag LOCUS_20580 15447 17174 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_20580 19330 17195 gene locus_tag LOCUS_20590 gene recQ 19330 17195 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_20590 19638 21377 gene locus_tag LOCUS_20600 19638 21377 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080084.1 protein_id gnl|my_center|LOCUS_20600 21970 21374 gene locus_tag LOCUS_20610 21970 21374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 22150 22578 gene locus_tag LOCUS_20620 22150 22578 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_20620 22716 22792 gene locus_tag LOCUS_t00280 22716 22792 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22870 23145 gene locus_tag LOCUS_20630 22870 23145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 23152 25938 gene locus_tag LOCUS_20640 23152 25938 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048879517.1 protein_id gnl|my_center|LOCUS_20640 26112 26366 gene locus_tag LOCUS_20650 26112 26366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 26359 26634 gene locus_tag LOCUS_20660 26359 26634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 26641 28692 gene locus_tag LOCUS_20670 26641 28692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 protein_id gnl|my_center|LOCUS_20670 28685 29872 gene locus_tag LOCUS_20680 28685 29872 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037257.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence43 1346 576 gene locus_tag LOCUS_20690 1346 576 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126699554.1 protein_id gnl|my_center|LOCUS_20690 2016 1351 gene locus_tag LOCUS_20700 2016 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_20700 3085 2105 gene locus_tag LOCUS_20710 gene moaA 3085 2105 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074310.1 protein_id gnl|my_center|LOCUS_20710 3239 3874 gene locus_tag LOCUS_20720 gene ccmA 3239 3874 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420299.1 protein_id gnl|my_center|LOCUS_20720 3867 4538 gene locus_tag LOCUS_20730 gene ccmB 3867 4538 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_20730 4555 5304 gene locus_tag LOCUS_20740 gene ccmC 4555 5304 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_20740 5301 5480 gene locus_tag LOCUS_20750 5301 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 5477 5935 gene locus_tag LOCUS_20760 gene ccmE 5477 5935 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_20760 5932 7932 gene locus_tag LOCUS_20770 5932 7932 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 protein_id gnl|my_center|LOCUS_20770 7932 8492 gene locus_tag LOCUS_20780 gene dsbE 7932 8492 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083138.1 protein_id gnl|my_center|LOCUS_20780 8489 8974 gene locus_tag LOCUS_20790 8489 8974 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262346.1 protein_id gnl|my_center|LOCUS_20790 8971 10263 gene locus_tag LOCUS_20800 gene ccmI 8971 10263 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070639.1 protein_id gnl|my_center|LOCUS_20800 10997 10266 gene locus_tag LOCUS_20810 10997 10266 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_20810 11568 11002 gene locus_tag LOCUS_20820 11568 11002 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_20820 12642 11599 gene locus_tag LOCUS_20830 gene nagZ 12642 11599 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208334.1 protein_id gnl|my_center|LOCUS_20830 12743 13138 gene locus_tag LOCUS_20840 12743 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 13654 13172 gene locus_tag LOCUS_20850 gene elsL 13654 13172 CDS product cell wall-recycling L,D-carboxypeptidase ElsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_20850 13797 15383 gene locus_tag LOCUS_20860 13797 15383 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133503194.1 protein_id gnl|my_center|LOCUS_20860 18630 15445 gene locus_tag LOCUS_20870 18630 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 19676 18699 gene locus_tag LOCUS_20880 gene pdxA 19676 18699 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093001.1 protein_id gnl|my_center|LOCUS_20880 20985 19681 gene locus_tag LOCUS_20890 20985 19681 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_20890 23683 21260 gene locus_tag LOCUS_20900 gene lptD 23683 21260 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 protein_id gnl|my_center|LOCUS_20900 23860 25035 gene locus_tag LOCUS_20910 23860 25035 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144015.1 protein_id gnl|my_center|LOCUS_20910 25032 28166 gene locus_tag LOCUS_20920 25032 28166 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence44 188 403 gene locus_tag LOCUS_20930 188 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 1211 297 gene locus_tag LOCUS_20940 1211 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2731 1220 gene locus_tag LOCUS_20950 2731 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 3551 2796 gene locus_tag LOCUS_20960 3551 2796 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_20960 6696 4015 gene locus_tag LOCUS_20970 6696 4015 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_20970 7286 6696 gene locus_tag LOCUS_20980 7286 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 8431 7280 gene locus_tag LOCUS_20990 8431 7280 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_20990 10752 8428 gene locus_tag LOCUS_21000 10752 8428 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_21000 13847 11616 gene locus_tag LOCUS_21010 13847 11616 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925780.1 protein_id gnl|my_center|LOCUS_21010 14607 14137 gene locus_tag LOCUS_21020 gene rlmH 14607 14137 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261456.1 protein_id gnl|my_center|LOCUS_21020 19599 14683 gene locus_tag LOCUS_21030 19599 14683 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947310.1 protein_id gnl|my_center|LOCUS_21030 20504 19614 gene locus_tag LOCUS_21040 20504 19614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 20796 21362 gene locus_tag LOCUS_21050 gene yeiP 20796 21362 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465079.1 protein_id gnl|my_center|LOCUS_21050 21617 22618 gene locus_tag LOCUS_21060 21617 22618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_21060 22611 23387 gene locus_tag LOCUS_21070 22611 23387 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420864.1 protein_id gnl|my_center|LOCUS_21070 23893 23396 gene locus_tag LOCUS_21080 23893 23396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 25717 24203 gene locus_tag LOCUS_21090 25717 24203 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036607.1 protein_id gnl|my_center|LOCUS_21090 25861 26937 gene locus_tag LOCUS_21100 25861 26937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 26949 27380 gene locus_tag LOCUS_21110 26949 27380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 27370 27597 gene locus_tag LOCUS_21120 27370 27597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence45 2678 2274 gene locus_tag LOCUS_21130 gene zntR 2678 2274 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421287.1 protein_id gnl|my_center|LOCUS_21130 3407 2895 gene locus_tag LOCUS_21140 3407 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 4029 3442 gene locus_tag LOCUS_21150 4029 3442 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946769.1 protein_id gnl|my_center|LOCUS_21150 4374 4048 gene locus_tag LOCUS_21160 4374 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 4948 4379 gene locus_tag LOCUS_21170 4948 4379 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948185.1 protein_id gnl|my_center|LOCUS_21170 5572 5090 gene locus_tag LOCUS_21180 5572 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 8882 5733 gene locus_tag LOCUS_21190 8882 5733 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_21190 10378 8879 gene locus_tag LOCUS_21200 10378 8879 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190973259.1 protein_id gnl|my_center|LOCUS_21200 11660 10371 gene locus_tag LOCUS_21210 11660 10371 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_21210 11826 12044 gene locus_tag LOCUS_21220 11826 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 13641 12301 gene locus_tag LOCUS_21230 13641 12301 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_21230 14010 15272 gene locus_tag LOCUS_21240 14010 15272 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_21240 15490 16794 gene locus_tag LOCUS_21250 15490 16794 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_21250 17222 18058 gene locus_tag LOCUS_21260 17222 18058 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103186.1 protein_id gnl|my_center|LOCUS_21260 18092 18829 gene locus_tag LOCUS_21270 18092 18829 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_21270 18834 19181 gene locus_tag LOCUS_21280 18834 19181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 19362 20066 gene locus_tag LOCUS_21290 19362 20066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 20435 20076 gene locus_tag LOCUS_21300 20435 20076 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451084.1 protein_id gnl|my_center|LOCUS_21300 20908 20453 gene locus_tag LOCUS_21310 gene moaE 20908 20453 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 protein_id gnl|my_center|LOCUS_21310 21166 20915 gene locus_tag LOCUS_21320 gene moaD 21166 20915 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093027.1 protein_id gnl|my_center|LOCUS_21320 22413 21163 gene locus_tag LOCUS_21330 22413 21163 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389877.1 protein_id gnl|my_center|LOCUS_21330 23413 24813 gene locus_tag LOCUS_21340 23413 24813 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_21340 25036 26052 gene locus_tag LOCUS_21350 25036 26052 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence46 652 239 gene locus_tag LOCUS_21360 652 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 1007 645 gene locus_tag LOCUS_21370 1007 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2177 1083 gene locus_tag LOCUS_21380 2177 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939277.1 protein_id gnl|my_center|LOCUS_21380 2941 2192 gene locus_tag LOCUS_21390 2941 2192 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901594.1 protein_id gnl|my_center|LOCUS_21390 3578 2943 gene locus_tag LOCUS_21400 3578 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 6588 3592 gene locus_tag LOCUS_21410 6588 3592 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922724.1 protein_id gnl|my_center|LOCUS_21410 6764 8080 gene locus_tag LOCUS_21420 gene rimO 6764 8080 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704839.1 protein_id gnl|my_center|LOCUS_21420 8102 9676 gene locus_tag LOCUS_21430 8102 9676 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_21430 10640 9747 gene locus_tag LOCUS_21440 10640 9747 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050911213.1 protein_id gnl|my_center|LOCUS_21440 11866 10838 gene locus_tag LOCUS_21450 11866 10838 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765914.1 protein_id gnl|my_center|LOCUS_21450 12912 11863 gene locus_tag LOCUS_21460 12912 11863 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266950.1 protein_id gnl|my_center|LOCUS_21460 15188 12909 gene locus_tag LOCUS_21470 15188 12909 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525365.1 protein_id gnl|my_center|LOCUS_21470 15871 15185 gene locus_tag LOCUS_21480 15871 15185 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525366.1 protein_id gnl|my_center|LOCUS_21480 17117 15906 gene locus_tag LOCUS_21490 17117 15906 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525367.1 protein_id gnl|my_center|LOCUS_21490 17422 17141 gene locus_tag LOCUS_21500 17422 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 19594 17624 gene locus_tag LOCUS_21510 19594 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 20713 19961 gene locus_tag LOCUS_21520 gene rlmB 20713 19961 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073677.1 protein_id gnl|my_center|LOCUS_21520 22986 20710 gene locus_tag LOCUS_21530 gene rnr 22986 20710 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958002.1 protein_id gnl|my_center|LOCUS_21530 23109 23195 gene locus_tag LOCUS_t00290 23109 23195 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <26533 23272 gene locus_tag LOCUS_21540 <26533 23272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932819.1:AAA family ATPase >Feature sequence47 2264 270 gene locus_tag LOCUS_21550 2264 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 3151 2411 gene locus_tag LOCUS_21560 3151 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 4678 3467 gene locus_tag LOCUS_21570 4678 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 7892 4671 gene locus_tag LOCUS_21580 7892 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 9299 7935 gene locus_tag LOCUS_21590 9299 7935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 protein_id gnl|my_center|LOCUS_21590 11901 10594 gene locus_tag LOCUS_21600 11901 10594 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_21600 12627 12337 gene locus_tag LOCUS_21610 12627 12337 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_21610 12848 12624 gene locus_tag LOCUS_21620 12848 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 13531 13166 gene locus_tag LOCUS_21630 13531 13166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 13785 13534 gene locus_tag LOCUS_21640 13785 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 14458 14168 gene locus_tag LOCUS_21650 14458 14168 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074407.1 protein_id gnl|my_center|LOCUS_21650 14711 14445 gene locus_tag LOCUS_21660 14711 14445 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074406.1 protein_id gnl|my_center|LOCUS_21660 14916 15248 gene locus_tag LOCUS_21670 14916 15248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 15633 17483 gene locus_tag LOCUS_21680 15633 17483 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946701.1 protein_id gnl|my_center|LOCUS_21680 17490 18425 gene locus_tag LOCUS_21690 17490 18425 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267129.1 protein_id gnl|my_center|LOCUS_21690 18492 20249 gene locus_tag LOCUS_21700 gene msbA 18492 20249 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704886.1 protein_id gnl|my_center|LOCUS_21700 20246 20914 gene locus_tag LOCUS_21710 20246 20914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114545.1 protein_id gnl|my_center|LOCUS_21710 20904 22367 gene locus_tag LOCUS_21720 gene hldE 20904 22367 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707478.1 protein_id gnl|my_center|LOCUS_21720 22390 23583 gene locus_tag LOCUS_21730 22390 23583 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266476.1 protein_id gnl|my_center|LOCUS_21730 23574 24353 gene locus_tag LOCUS_21740 23574 24353 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114541.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence48 254 1681 gene locus_tag LOCUS_21750 254 1681 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338202.1 protein_id gnl|my_center|LOCUS_21750 1808 3589 gene locus_tag LOCUS_21760 1808 3589 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_21760 3591 4322 gene locus_tag LOCUS_21770 3591 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 4532 4386 gene locus_tag LOCUS_21780 4532 4386 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947264.1 protein_id gnl|my_center|LOCUS_21780 4689 5255 gene locus_tag LOCUS_21790 4689 5255 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_21790 5248 7056 gene locus_tag LOCUS_21800 gene kefC 5248 7056 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141343.1 protein_id gnl|my_center|LOCUS_21800 7188 7580 gene locus_tag LOCUS_21810 7188 7580 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868764.1 protein_id gnl|my_center|LOCUS_21810 7658 8158 gene locus_tag LOCUS_21820 gene tpx 7658 8158 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894924.1 protein_id gnl|my_center|LOCUS_21820 8216 8917 gene locus_tag LOCUS_21830 8216 8917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 9488 8976 gene locus_tag LOCUS_21840 9488 8976 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_21840 10269 9529 gene locus_tag LOCUS_21850 10269 9529 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704255.1 protein_id gnl|my_center|LOCUS_21850 10618 10412 gene locus_tag LOCUS_21860 10618 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 12940 10739 gene locus_tag LOCUS_21870 gene relA 12940 10739 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_21870 14226 12985 gene locus_tag LOCUS_21880 14226 12985 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_21880 14754 14299 gene locus_tag LOCUS_21890 gene greB 14754 14299 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037693.1 protein_id gnl|my_center|LOCUS_21890 15065 14865 gene locus_tag LOCUS_21900 gene iscX 15065 14865 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 protein_id gnl|my_center|LOCUS_21900 15414 15076 gene locus_tag LOCUS_21910 gene fdx 15414 15076 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417920.1 protein_id gnl|my_center|LOCUS_21910 17281 15407 gene locus_tag LOCUS_21920 gene hscA 17281 15407 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196624.1 protein_id gnl|my_center|LOCUS_21920 17914 17369 gene locus_tag LOCUS_21930 gene hscB 17914 17369 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105747.1 protein_id gnl|my_center|LOCUS_21930 18329 18006 gene locus_tag LOCUS_21940 gene iscA 18329 18006 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417916.1 protein_id gnl|my_center|LOCUS_21940 18718 18332 gene locus_tag LOCUS_21950 gene iscU 18718 18332 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654861.1 protein_id gnl|my_center|LOCUS_21950 20094 18880 gene locus_tag LOCUS_21960 20094 18880 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705635.1 protein_id gnl|my_center|LOCUS_21960 20868 20380 gene locus_tag LOCUS_21970 gene iscR 20868 20380 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707916.1 protein_id gnl|my_center|LOCUS_21970 21721 20924 gene locus_tag LOCUS_21980 gene cysE 21721 20924 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence49 1247 210 gene locus_tag LOCUS_21990 1247 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1959 1435 gene locus_tag LOCUS_22000 1959 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2773 2147 gene locus_tag LOCUS_22010 2773 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 3047 2853 gene locus_tag LOCUS_22020 3047 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 4037 3135 gene locus_tag LOCUS_22030 4037 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 4210 4644 gene locus_tag LOCUS_22040 4210 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 4626 5045 gene locus_tag LOCUS_22050 4626 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 5169 5354 gene locus_tag LOCUS_22060 5169 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 6187 5339 gene locus_tag LOCUS_22070 gene rpoH 6187 5339 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 protein_id gnl|my_center|LOCUS_22070 7234 6305 gene locus_tag LOCUS_22080 gene ftsX 7234 6305 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_22080 7905 7231 gene locus_tag LOCUS_22090 gene ftsE 7905 7231 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_22090 9252 8020 gene locus_tag LOCUS_22100 9252 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 9477 10799 gene locus_tag LOCUS_22110 9477 10799 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_22110 10789 12120 gene locus_tag LOCUS_22120 10789 12120 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948372.1 protein_id gnl|my_center|LOCUS_22120 12123 12692 gene locus_tag LOCUS_22130 gene rsmD 12123 12692 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003455683.1 protein_id gnl|my_center|LOCUS_22130 12758 13234 gene locus_tag LOCUS_22140 gene coaD 12758 13234 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737440.1 protein_id gnl|my_center|LOCUS_22140 13266 13511 gene locus_tag LOCUS_22150 13266 13511 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_22150 13585 15219 gene locus_tag LOCUS_22160 gene ggt 13585 15219 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946295.1 protein_id gnl|my_center|LOCUS_22160 16028 21475 gene locus_tag LOCUS_22170 16028 21475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence50 104 943 gene locus_tag LOCUS_22180 104 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 1029 1250 gene locus_tag LOCUS_22190 1029 1250 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312031.1 protein_id gnl|my_center|LOCUS_22190 1250 1429 gene locus_tag LOCUS_22200 1250 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3534 1525 gene locus_tag LOCUS_22210 3534 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 5733 3796 gene locus_tag LOCUS_22220 gene ilvB 5733 3796 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146975.1 protein_id gnl|my_center|LOCUS_22220 5831 6136 gene locus_tag LOCUS_22230 5831 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 7564 6251 gene locus_tag LOCUS_22240 7564 6251 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_22240 7639 8700 gene locus_tag LOCUS_22250 gene mtnA 7639 8700 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404235.1 protein_id gnl|my_center|LOCUS_22250 8805 11372 gene locus_tag LOCUS_22260 gene gyrA 8805 11372 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_22260 11432 12514 gene locus_tag LOCUS_22270 gene serC 11432 12514 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393775.1 protein_id gnl|my_center|LOCUS_22270 12538 13701 gene locus_tag LOCUS_22280 12538 13701 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_22280 13730 14815 gene locus_tag LOCUS_22290 gene pheA 13730 14815 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 protein_id gnl|my_center|LOCUS_22290 14845 15975 gene locus_tag LOCUS_22300 gene hisC 14845 15975 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_22300 15972 16835 gene locus_tag LOCUS_22310 15972 16835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 16871 18184 gene locus_tag LOCUS_22320 16871 18184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22320 18181 18858 gene locus_tag LOCUS_22330 gene cmk 18181 18858 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 protein_id gnl|my_center|LOCUS_22330 18971 20644 gene locus_tag LOCUS_22340 gene rpsA 18971 20644 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_22340 20681 21037 gene locus_tag LOCUS_22350 20681 21037 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence51 299 1672 gene locus_tag LOCUS_22360 299 1672 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_22360 1697 2146 gene locus_tag LOCUS_22370 1697 2146 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210715.1 protein_id gnl|my_center|LOCUS_22370 2143 2439 gene locus_tag LOCUS_22380 2143 2439 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649214.1 protein_id gnl|my_center|LOCUS_22380 2885 2436 gene locus_tag LOCUS_22390 2885 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2998 3438 gene locus_tag LOCUS_22400 gene fur 2998 3438 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_22400 5105 3435 gene locus_tag LOCUS_22410 gene recN 5105 3435 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418848.1 protein_id gnl|my_center|LOCUS_22410 5267 6085 gene locus_tag LOCUS_22420 5267 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 7012 6122 gene locus_tag LOCUS_22430 7012 6122 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409651.1 protein_id gnl|my_center|LOCUS_22430 7208 8281 gene locus_tag LOCUS_22440 gene hrcA 7208 8281 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_22440 10452 8395 gene locus_tag LOCUS_22450 gene feoB 10452 8395 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545132.1 protein_id gnl|my_center|LOCUS_22450 10535 11029 gene locus_tag LOCUS_22460 gene yjgA 10535 11029 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501414.1 protein_id gnl|my_center|LOCUS_22460 13155 11026 gene locus_tag LOCUS_22470 gene rlmKL 13155 11026 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_22470 13582 13848 gene locus_tag LOCUS_22480 13582 13848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 13960 15666 gene locus_tag LOCUS_22490 13960 15666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 15915 18350 gene locus_tag LOCUS_22500 gene nirB 15915 18350 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_22500 18363 18671 gene locus_tag LOCUS_22510 gene nirD 18363 18671 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_22510 18844 20541 gene locus_tag LOCUS_22520 gene glgP 18844 20541 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073139725.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence52 1303 233 gene locus_tag LOCUS_22530 gene algZ 1303 233 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_22530 1361 2761 gene locus_tag LOCUS_22540 gene argH 1361 2761 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401567.1 protein_id gnl|my_center|LOCUS_22540 2844 3662 gene locus_tag LOCUS_22550 2844 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 3683 6562 gene locus_tag LOCUS_22560 3683 6562 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114341.1 protein_id gnl|my_center|LOCUS_22560 6901 8148 gene locus_tag LOCUS_22570 gene lysA 6901 8148 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_22570 8371 9630 gene locus_tag LOCUS_22580 8371 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 10080 9736 gene locus_tag LOCUS_22590 10080 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 10517 10726 gene locus_tag LOCUS_22600 10517 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 10827 15815 gene locus_tag LOCUS_22610 10827 15815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 17651 15825 gene locus_tag LOCUS_22620 17651 15825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 18617 18225 gene locus_tag LOCUS_22630 18617 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence53 424 1167 gene locus_tag LOCUS_22640 gene istB 424 1167 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391832.1 protein_id gnl|my_center|LOCUS_22640 2817 1303 gene locus_tag LOCUS_22650 2817 1303 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073207.1 protein_id gnl|my_center|LOCUS_22650 2858 3463 gene locus_tag LOCUS_22660 2858 3463 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870396.1 protein_id gnl|my_center|LOCUS_22660 4108 3467 gene locus_tag LOCUS_22670 gene nth 4108 3467 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092050.1 protein_id gnl|my_center|LOCUS_22670 4162 6246 gene locus_tag LOCUS_22680 4162 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 6607 6293 gene locus_tag LOCUS_22690 6607 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 6871 8661 gene locus_tag LOCUS_22700 6871 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 8658 11264 gene locus_tag LOCUS_22710 8658 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 11278 14604 gene locus_tag LOCUS_22720 11278 14604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 15065 14610 gene locus_tag LOCUS_22730 15065 14610 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 protein_id gnl|my_center|LOCUS_22730 15537 15088 gene locus_tag LOCUS_22740 15537 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 16594 15746 gene locus_tag LOCUS_22750 16594 15746 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208160.1 protein_id gnl|my_center|LOCUS_22750 16612 16866 gene locus_tag LOCUS_22760 16612 16866 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038948.1 protein_id gnl|my_center|LOCUS_22760 16893 18401 gene locus_tag LOCUS_22770 16893 18401 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence54 502 164 gene locus_tag LOCUS_22780 502 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 1168 857 gene locus_tag LOCUS_22790 1168 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2217 1168 gene locus_tag LOCUS_22800 2217 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2740 2492 gene locus_tag LOCUS_22810 2740 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 10249 2777 gene locus_tag LOCUS_22820 10249 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 10908 10522 gene locus_tag LOCUS_22830 10908 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 11013 11141 gene locus_tag LOCUS_22840 11013 11141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22840 11155 11289 gene locus_tag LOCUS_22850 11155 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22850 11939 11346 gene locus_tag LOCUS_22860 11939 11346 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_22860 12364 14562 gene locus_tag LOCUS_22870 12364 14562 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_22870 14662 16431 gene locus_tag LOCUS_22880 gene argS 14662 16431 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_22880 16432 16992 gene locus_tag LOCUS_22890 16432 16992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 17409 17017 gene locus_tag LOCUS_22900 17409 17017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence55 270 452 gene locus_tag LOCUS_22910 270 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1087 527 gene locus_tag LOCUS_22920 1087 527 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038838.1 protein_id gnl|my_center|LOCUS_22920 1622 1116 gene locus_tag LOCUS_22930 gene purE 1622 1116 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_22930 3962 1680 gene locus_tag LOCUS_22940 gene topA 3962 1680 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958589.1 protein_id gnl|my_center|LOCUS_22940 4501 4025 gene locus_tag LOCUS_22950 4501 4025 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 protein_id gnl|my_center|LOCUS_22950 5694 4549 gene locus_tag LOCUS_22960 gene dprA 5694 4549 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807293.1 protein_id gnl|my_center|LOCUS_22960 6768 5719 gene locus_tag LOCUS_22970 6768 5719 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_22970 6899 7405 gene locus_tag LOCUS_22980 gene def 6899 7405 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107059.1 protein_id gnl|my_center|LOCUS_22980 7480 8406 gene locus_tag LOCUS_22990 gene fmt 7480 8406 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070447.1 protein_id gnl|my_center|LOCUS_22990 8399 9748 gene locus_tag LOCUS_23000 gene rsmB 8399 9748 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560556.1 protein_id gnl|my_center|LOCUS_23000 9756 10289 gene locus_tag LOCUS_23010 9756 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 10286 12499 gene locus_tag LOCUS_23020 10286 12499 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 protein_id gnl|my_center|LOCUS_23020 12506 13873 gene locus_tag LOCUS_23030 12506 13873 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087262.1 protein_id gnl|my_center|LOCUS_23030 13877 15250 gene locus_tag LOCUS_23040 gene trkA 13877 15250 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_23040 15260 15628 gene locus_tag LOCUS_23050 15260 15628 CDS product DUF6164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037243.1 protein_id gnl|my_center|LOCUS_23050 15950 17401 gene locus_tag LOCUS_23060 15950 17401 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160591.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence56 4038 148 gene locus_tag LOCUS_23070 gene purL 4038 148 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103562.1 protein_id gnl|my_center|LOCUS_23070 5361 4501 gene locus_tag LOCUS_23080 5361 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 5503 5339 gene locus_tag LOCUS_23090 5503 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5852 6274 gene locus_tag LOCUS_23100 5852 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 6275 7468 gene locus_tag LOCUS_23110 6275 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 7516 9267 gene locus_tag LOCUS_23120 7516 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 9375 10169 gene locus_tag LOCUS_23130 9375 10169 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061715.1 protein_id gnl|my_center|LOCUS_23130 10172 11155 gene locus_tag LOCUS_23140 10172 11155 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132696218.1 protein_id gnl|my_center|LOCUS_23140 11526 12770 gene locus_tag LOCUS_23150 11526 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 12785 14407 gene locus_tag LOCUS_23160 12785 14407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 14769 15782 gene locus_tag LOCUS_23170 14769 15782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 15782 16759 gene locus_tag LOCUS_23180 15782 16759 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128948458.1 protein_id gnl|my_center|LOCUS_23180 16772 17533 gene locus_tag LOCUS_23190 16772 17533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence57 1141 281 gene locus_tag LOCUS_23200 1141 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3029 1293 gene locus_tag LOCUS_23210 3029 1293 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_23210 3578 3036 gene locus_tag LOCUS_23220 3578 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 3804 3631 gene locus_tag LOCUS_23230 3804 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 4283 5269 gene locus_tag LOCUS_23240 4283 5269 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532214.1 protein_id gnl|my_center|LOCUS_23240 5311 5853 gene locus_tag LOCUS_23250 5311 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 6669 6097 gene locus_tag LOCUS_23260 6669 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 7499 6684 gene locus_tag LOCUS_23270 7499 6684 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083150.1 protein_id gnl|my_center|LOCUS_23270 8461 7511 gene locus_tag LOCUS_23280 8461 7511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539779.1 protein_id gnl|my_center|LOCUS_23280 9471 8479 gene locus_tag LOCUS_23290 9471 8479 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 protein_id gnl|my_center|LOCUS_23290 9598 9738 gene locus_tag LOCUS_23300 9598 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 12131 9894 gene locus_tag LOCUS_23310 12131 9894 CDS product NosR/NirI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536481.1 protein_id gnl|my_center|LOCUS_23310 14250 12382 gene locus_tag LOCUS_23320 gene nosZ 14250 12382 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967622.1 protein_id gnl|my_center|LOCUS_23320 15245 14340 gene locus_tag LOCUS_23330 15245 14340 CDS product DUF3034 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764776.1 protein_id gnl|my_center|LOCUS_23330 15367 15555 gene locus_tag LOCUS_23340 15367 15555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 15575 15952 gene locus_tag LOCUS_23350 15575 15952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 15977 17389 gene locus_tag LOCUS_23360 15977 17389 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103985.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence58 664 233 gene locus_tag LOCUS_23370 664 233 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948332.1 protein_id gnl|my_center|LOCUS_23370 2165 666 gene locus_tag LOCUS_23380 gene pepA 2165 666 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_23380 2261 3364 gene locus_tag LOCUS_23390 gene lptF 2261 3364 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443992.1 protein_id gnl|my_center|LOCUS_23390 3361 4425 gene locus_tag LOCUS_23400 gene lptG 3361 4425 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071579.1 protein_id gnl|my_center|LOCUS_23400 4900 4427 gene locus_tag LOCUS_23410 4900 4427 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_23410 5098 5457 gene locus_tag LOCUS_23420 5098 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 5856 6314 gene locus_tag LOCUS_23430 gene rimP 5856 6314 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222054.1 protein_id gnl|my_center|LOCUS_23430 6331 7833 gene locus_tag LOCUS_23440 gene nusA 6331 7833 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_23440 7858 10488 gene locus_tag LOCUS_23450 gene infB 7858 10488 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481598.1 protein_id gnl|my_center|LOCUS_23450 10492 10866 gene locus_tag LOCUS_23460 gene rbfA 10492 10866 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095188.1 protein_id gnl|my_center|LOCUS_23460 10866 11780 gene locus_tag LOCUS_23470 gene truB 10866 11780 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958222.1 protein_id gnl|my_center|LOCUS_23470 11867 12136 gene locus_tag LOCUS_23480 gene rpsO 11867 12136 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 protein_id gnl|my_center|LOCUS_23480 12163 14250 gene locus_tag LOCUS_23490 gene pnp 12163 14250 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456067.1 protein_id gnl|my_center|LOCUS_23490 15006 14404 gene locus_tag LOCUS_23500 15006 14404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 14962 15468 gene locus_tag LOCUS_23510 14962 15468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 15570 15806 gene locus_tag LOCUS_23520 15570 15806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 15793 16212 gene locus_tag LOCUS_23530 15793 16212 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220355038.1 protein_id gnl|my_center|LOCUS_23530 16331 17356 gene locus_tag LOCUS_23540 16331 17356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence59 <1 782 gene locus_tag LOCUS_23550 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324929.1:nitrate ABC transporter ATP-binding protein 2046 3656 gene locus_tag LOCUS_23560 2046 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 3782 7540 gene locus_tag LOCUS_23570 3782 7540 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555870.1 protein_id gnl|my_center|LOCUS_23570 7628 9190 gene locus_tag LOCUS_23580 gene narH 7628 9190 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524710.1 protein_id gnl|my_center|LOCUS_23580 9207 9722 gene locus_tag LOCUS_23590 9207 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 9734 10423 gene locus_tag LOCUS_23600 gene narI 9734 10423 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160110.1 protein_id gnl|my_center|LOCUS_23600 10531 10836 gene locus_tag LOCUS_23610 10531 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 10953 11570 gene locus_tag LOCUS_23620 10953 11570 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105394.1 protein_id gnl|my_center|LOCUS_23620 11654 11920 gene locus_tag LOCUS_23630 11654 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 11920 12360 gene locus_tag LOCUS_23640 11920 12360 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231280.1 protein_id gnl|my_center|LOCUS_23640 12446 12727 gene locus_tag LOCUS_23650 12446 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 14149 12782 gene locus_tag LOCUS_23660 14149 12782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880043.1 protein_id gnl|my_center|LOCUS_23660 14659 14150 gene locus_tag LOCUS_23670 14659 14150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 16220 14652 gene locus_tag LOCUS_23680 16220 14652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence60 1389 490 gene locus_tag LOCUS_23690 gene galU 1389 490 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225519.1 protein_id gnl|my_center|LOCUS_23690 1788 1396 gene locus_tag LOCUS_23700 1788 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2776 1826 gene locus_tag LOCUS_23710 2776 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 3911 4258 gene locus_tag LOCUS_23720 3911 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 4406 6082 gene locus_tag LOCUS_23730 4406 6082 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_23730 6416 6087 gene locus_tag LOCUS_23740 6416 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 6607 6921 gene locus_tag LOCUS_23750 6607 6921 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 protein_id gnl|my_center|LOCUS_23750 6927 7382 gene locus_tag LOCUS_23760 6927 7382 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_23760 7447 8436 gene locus_tag LOCUS_23770 7447 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 8411 8647 gene locus_tag LOCUS_23780 8411 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 8681 10282 gene locus_tag LOCUS_23790 gene dnaX 8681 10282 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957718.1 protein_id gnl|my_center|LOCUS_23790 10325 10648 gene locus_tag LOCUS_23800 10325 10648 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 protein_id gnl|my_center|LOCUS_23800 10733 11248 gene locus_tag LOCUS_23810 gene recR 10733 11248 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633741.1 protein_id gnl|my_center|LOCUS_23810 11266 11613 gene locus_tag LOCUS_23820 11266 11613 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_23820 11652 11957 gene locus_tag LOCUS_23830 11652 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 12049 14472 gene locus_tag LOCUS_23840 12049 14472 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_23840 14476 15267 gene locus_tag LOCUS_23850 14476 15267 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_23850 15277 16704 gene locus_tag LOCUS_23860 15277 16704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence61 513 115 gene locus_tag LOCUS_23870 513 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1803 2729 gene locus_tag LOCUS_23880 1803 2729 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946515.1 protein_id gnl|my_center|LOCUS_23880 2734 3627 gene locus_tag LOCUS_23890 2734 3627 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 protein_id gnl|my_center|LOCUS_23890 3691 4962 gene locus_tag LOCUS_23900 gene waaA 3691 4962 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957353.1 protein_id gnl|my_center|LOCUS_23900 5216 5677 gene locus_tag LOCUS_23910 5216 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 8091 5707 gene locus_tag LOCUS_23920 8091 5707 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_23920 9317 8109 gene locus_tag LOCUS_23930 9317 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880001.1 protein_id gnl|my_center|LOCUS_23930 10452 9310 gene locus_tag LOCUS_23940 10452 9310 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040065.1 protein_id gnl|my_center|LOCUS_23940 11995 10436 gene locus_tag LOCUS_23950 11995 10436 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_23950 12280 14379 gene locus_tag LOCUS_23960 12280 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 14878 14414 gene locus_tag LOCUS_23970 14878 14414 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545179.1 protein_id gnl|my_center|LOCUS_23970 16267 14945 gene locus_tag LOCUS_23980 16267 14945 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093087.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence62 435 566 gene locus_tag LOCUS_23990 435 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 966 1700 gene locus_tag LOCUS_24000 966 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 1893 2300 gene locus_tag LOCUS_24010 1893 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2356 3339 gene locus_tag LOCUS_24020 2356 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073538.1 protein_id gnl|my_center|LOCUS_24020 3360 4250 gene locus_tag LOCUS_24030 3360 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 4243 6030 gene locus_tag LOCUS_24040 4243 6030 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073540.1 protein_id gnl|my_center|LOCUS_24040 6081 6518 gene locus_tag LOCUS_24050 6081 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 6532 7230 gene locus_tag LOCUS_24060 6532 7230 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073541.1 protein_id gnl|my_center|LOCUS_24060 7281 7904 gene locus_tag LOCUS_24070 7281 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 7894 8223 gene locus_tag LOCUS_24080 7894 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 8220 9320 gene locus_tag LOCUS_24090 8220 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 9305 9850 gene locus_tag LOCUS_24100 9305 9850 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245166.1 protein_id gnl|my_center|LOCUS_24100 10379 11092 gene locus_tag LOCUS_24110 10379 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 11148 11864 gene locus_tag LOCUS_24120 11148 11864 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_24120 11857 12552 gene locus_tag LOCUS_24130 11857 12552 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222833.1 protein_id gnl|my_center|LOCUS_24130 12542 13375 gene locus_tag LOCUS_24140 gene hpnD 12542 13375 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_24140 13420 14178 gene locus_tag LOCUS_24150 13420 14178 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072839.1 protein_id gnl|my_center|LOCUS_24150 14380 15291 gene locus_tag LOCUS_24160 14380 15291 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766730.1 protein_id gnl|my_center|LOCUS_24160 15907 15281 gene locus_tag LOCUS_24170 15907 15281 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence63 1473 964 gene locus_tag LOCUS_24180 1473 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2359 1544 gene locus_tag LOCUS_24190 2359 1544 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_24190 3369 2356 gene locus_tag LOCUS_24200 3369 2356 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791853.1 protein_id gnl|my_center|LOCUS_24200 5444 3366 gene locus_tag LOCUS_24210 gene fdhF 5444 3366 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_24210 6091 5459 gene locus_tag LOCUS_24220 6091 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 6762 6154 gene locus_tag LOCUS_24230 6762 6154 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704791.1 protein_id gnl|my_center|LOCUS_24230 7478 6765 gene locus_tag LOCUS_24240 gene rph 7478 6765 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_24240 8353 7475 gene locus_tag LOCUS_24250 8353 7475 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_24250 9283 8363 gene locus_tag LOCUS_24260 9283 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 9405 10271 gene locus_tag LOCUS_24270 9405 10271 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459003.1 protein_id gnl|my_center|LOCUS_24270 10285 10917 gene locus_tag LOCUS_24280 gene gmk 10285 10917 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_24280 11165 10944 gene locus_tag LOCUS_24290 11165 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 12663 11353 gene locus_tag LOCUS_24300 12663 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 <15960 13000 gene locus_tag LOCUS_24310 <15960 13000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000934467.1:MSCRAMM family adhesin SdrD >Feature sequence64 245 1261 gene locus_tag LOCUS_24320 245 1261 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926817.1 protein_id gnl|my_center|LOCUS_24320 1982 1251 gene locus_tag LOCUS_24330 1982 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2729 1989 gene locus_tag LOCUS_24340 2729 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 3061 3240 gene locus_tag LOCUS_24350 3061 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 3656 5191 gene locus_tag LOCUS_24360 3656 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 5236 6258 gene locus_tag LOCUS_24370 5236 6258 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140332.1 protein_id gnl|my_center|LOCUS_24370 6286 7128 gene locus_tag LOCUS_24380 gene nfo 6286 7128 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932008.1 protein_id gnl|my_center|LOCUS_24380 8254 7118 gene locus_tag LOCUS_24390 8254 7118 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 protein_id gnl|my_center|LOCUS_24390 9742 8261 gene locus_tag LOCUS_24400 9742 8261 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_24400 9355 9431 gene locus_tag LOCUS_t00300 9355 9431 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9920 11119 gene locus_tag LOCUS_24410 gene tyrS 9920 11119 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_24410 11607 13142 gene locus_tag LOCUS_r00010 11607 13142 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 13211 13287 gene locus_tag LOCUS_t00310 13211 13287 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 13304 13379 gene locus_tag LOCUS_t00320 13304 13379 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence65 212 946 gene locus_tag LOCUS_24420 212 946 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233833.1 protein_id gnl|my_center|LOCUS_24420 946 1491 gene locus_tag LOCUS_24430 946 1491 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084272.1 protein_id gnl|my_center|LOCUS_24430 2404 1493 gene locus_tag LOCUS_24440 2404 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 4396 2423 gene locus_tag LOCUS_24450 4396 2423 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_24450 4814 6943 gene locus_tag LOCUS_24460 4814 6943 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267142.1 protein_id gnl|my_center|LOCUS_24460 7026 7400 gene locus_tag LOCUS_24470 gene crcB 7026 7400 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_24470 7400 7714 gene locus_tag LOCUS_24480 7400 7714 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957951.1 protein_id gnl|my_center|LOCUS_24480 7718 8986 gene locus_tag LOCUS_24490 gene serS 7718 8986 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317946.1 protein_id gnl|my_center|LOCUS_24490 9167 8988 gene locus_tag LOCUS_24500 9167 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 9915 9244 gene locus_tag LOCUS_24510 9915 9244 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_24510 10101 10190 gene locus_tag LOCUS_t00330 10101 10190 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10341 11738 gene locus_tag LOCUS_24520 gene leuC 10341 11738 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_24520 11739 12377 gene locus_tag LOCUS_24530 gene leuD 11739 12377 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_24530 12451 13530 gene locus_tag LOCUS_24540 gene leuB 12451 13530 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208285.1 protein_id gnl|my_center|LOCUS_24540 13574 14695 gene locus_tag LOCUS_24550 gene asd 13574 14695 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225714.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence66 874 1287 gene locus_tag LOCUS_24560 874 1287 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210018.1 protein_id gnl|my_center|LOCUS_24560 1307 1486 gene locus_tag LOCUS_24570 1307 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1480 1773 gene locus_tag LOCUS_24580 1480 1773 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074235.1 protein_id gnl|my_center|LOCUS_24580 3307 1928 gene locus_tag LOCUS_24590 3307 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 3825 3238 gene locus_tag LOCUS_24600 3825 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 4442 5389 gene locus_tag LOCUS_24610 4442 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 5555 6343 gene locus_tag LOCUS_24620 5555 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 7420 6353 gene locus_tag LOCUS_24630 7420 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24630 8299 7439 gene locus_tag LOCUS_24640 8299 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24640 11070 8299 gene locus_tag LOCUS_24650 11070 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 13916 11292 gene locus_tag LOCUS_24660 13916 11292 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence67 1768 1241 gene locus_tag LOCUS_24670 1768 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1873 4728 gene locus_tag LOCUS_24680 gene glnE 1873 4728 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_24680 4752 5675 gene locus_tag LOCUS_24690 gene ilvE 4752 5675 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_24690 5694 6266 gene locus_tag LOCUS_24700 5694 6266 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_24700 6280 7281 gene locus_tag LOCUS_24710 gene waaF 6280 7281 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105268.1 protein_id gnl|my_center|LOCUS_24710 7278 8330 gene locus_tag LOCUS_24720 gene waaC 7278 8330 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_24720 8315 9466 gene locus_tag LOCUS_24730 8315 9466 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266461.1 protein_id gnl|my_center|LOCUS_24730 9460 10251 gene locus_tag LOCUS_24740 gene rfaP 9460 10251 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114553.1 protein_id gnl|my_center|LOCUS_24740 10241 11614 gene locus_tag LOCUS_24750 10241 11614 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105266.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence68 58 537 gene locus_tag LOCUS_24760 gene mlaD 58 537 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_24760 527 1138 gene locus_tag LOCUS_24770 527 1138 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_24770 1135 1440 gene locus_tag LOCUS_24780 1135 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1440 2699 gene locus_tag LOCUS_24790 gene murA 1440 2699 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_24790 2742 3407 gene locus_tag LOCUS_24800 gene hisG 2742 3407 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739058.1 protein_id gnl|my_center|LOCUS_24800 3400 4758 gene locus_tag LOCUS_24810 gene hisD 3400 4758 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_24810 4760 5842 gene locus_tag LOCUS_24820 gene hisC 4760 5842 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_24820 5839 6678 gene locus_tag LOCUS_24830 5839 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880491.1 protein_id gnl|my_center|LOCUS_24830 7216 6773 gene locus_tag LOCUS_24840 7216 6773 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087637.1 protein_id gnl|my_center|LOCUS_24840 8788 7331 gene locus_tag LOCUS_24850 gene cysG 8788 7331 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_24850 9401 8862 gene locus_tag LOCUS_24860 9401 8862 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545903.1 protein_id gnl|my_center|LOCUS_24860 10968 9415 gene locus_tag LOCUS_24870 gene nirN 10968 9415 CDS product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_24870 12211 11027 gene locus_tag LOCUS_24880 gene nirJ 12211 11027 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_24880 12713 12222 gene locus_tag LOCUS_24890 12713 12222 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_24890 13162 12719 gene locus_tag LOCUS_24900 13162 12719 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence69 1431 2897 gene locus_tag LOCUS_24910 1431 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 2897 3274 gene locus_tag LOCUS_24920 2897 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 3268 3708 gene locus_tag LOCUS_24930 3268 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 3731 3931 gene locus_tag LOCUS_24940 3731 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 4301 4900 gene locus_tag LOCUS_24950 4301 4900 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312796.1 protein_id gnl|my_center|LOCUS_24950 4914 5813 gene locus_tag LOCUS_24960 4914 5813 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_24960 6785 6186 gene locus_tag LOCUS_24970 6785 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 7443 6835 gene locus_tag LOCUS_24980 7443 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 8963 7440 gene locus_tag LOCUS_24990 8963 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 9847 8960 gene locus_tag LOCUS_25000 9847 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 10028 9840 gene locus_tag LOCUS_25010 10028 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 10238 10044 gene locus_tag LOCUS_25020 10238 10044 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209920.1 protein_id gnl|my_center|LOCUS_25020 11245 10439 gene locus_tag LOCUS_25030 11245 10439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 11907 11242 gene locus_tag LOCUS_25040 11907 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence70 162 644 gene locus_tag LOCUS_25050 gene smpB 162 644 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948526.1 protein_id gnl|my_center|LOCUS_25050 698 934 gene locus_tag LOCUS_25060 698 934 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771337.1 protein_id gnl|my_center|LOCUS_25060 924 1826 gene locus_tag LOCUS_25070 924 1826 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_25070 1843 2631 gene locus_tag LOCUS_25080 gene folE2 1843 2631 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_25080 3283 2639 gene locus_tag LOCUS_25090 3283 2639 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_25090 3932 3399 gene locus_tag LOCUS_25100 3932 3399 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_25100 5199 3925 gene locus_tag LOCUS_25110 5199 3925 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_25110 5892 5326 gene locus_tag LOCUS_25120 5892 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 8101 5885 gene locus_tag LOCUS_25130 gene mrcB 8101 5885 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_25130 8720 8391 gene locus_tag LOCUS_25140 8720 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 9060 10238 gene locus_tag LOCUS_25150 9060 10238 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 protein_id gnl|my_center|LOCUS_25150 11012 10266 gene locus_tag LOCUS_25160 11012 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 11642 11049 gene locus_tag LOCUS_25170 11642 11049 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence71 919 191 gene locus_tag LOCUS_25180 gene trmJ 919 191 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958024.1 protein_id gnl|my_center|LOCUS_25180 1045 1833 gene locus_tag LOCUS_25190 gene suhB 1045 1833 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 protein_id gnl|my_center|LOCUS_25190 1945 2184 gene locus_tag LOCUS_25200 1945 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 3126 2188 gene locus_tag LOCUS_25210 gene secF 3126 2188 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 protein_id gnl|my_center|LOCUS_25210 5069 3213 gene locus_tag LOCUS_25220 gene secD 5069 3213 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 protein_id gnl|my_center|LOCUS_25220 5451 5176 gene locus_tag LOCUS_25230 gene yajC 5451 5176 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_25230 6658 5564 gene locus_tag LOCUS_25240 gene tgt 6658 5564 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100607.1 protein_id gnl|my_center|LOCUS_25240 7870 6815 gene locus_tag LOCUS_25250 gene queA 7870 6815 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_25250 7942 8028 gene locus_tag LOCUS_t00340 7942 8028 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8190 9065 gene locus_tag LOCUS_25260 8190 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25260 9130 9381 gene locus_tag LOCUS_25270 9130 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25270 10489 9386 gene locus_tag LOCUS_25280 10489 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 11185 10973 gene locus_tag LOCUS_25290 11185 10973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence72 484 2532 gene locus_tag LOCUS_25300 484 2532 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_25300 2559 3044 gene locus_tag LOCUS_25310 2559 3044 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_25310 3192 4085 gene locus_tag LOCUS_25320 3192 4085 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_25320 4153 5253 gene locus_tag LOCUS_25330 4153 5253 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940764.1 protein_id gnl|my_center|LOCUS_25330 5267 6112 gene locus_tag LOCUS_25340 5267 6112 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_25340 6258 6812 gene locus_tag LOCUS_25350 6258 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 6836 7363 gene locus_tag LOCUS_25360 6836 7363 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_25360 8479 7352 gene locus_tag LOCUS_25370 8479 7352 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_25370 11022 8479 gene locus_tag LOCUS_25380 11022 8479 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942827.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence73 3381 2116 gene locus_tag LOCUS_25390 3381 2116 CDS product lpg2382 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948086.1 protein_id gnl|my_center|LOCUS_25390 5066 3378 gene locus_tag LOCUS_25400 5066 3378 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140695.1 protein_id gnl|my_center|LOCUS_25400 5488 5084 gene locus_tag LOCUS_25410 gene cadR 5488 5084 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004364961.1 protein_id gnl|my_center|LOCUS_25410 6178 5594 gene locus_tag LOCUS_25420 6178 5594 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946769.1 protein_id gnl|my_center|LOCUS_25420 6523 6197 gene locus_tag LOCUS_25430 6523 6197 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631113.1 protein_id gnl|my_center|LOCUS_25430 7025 6537 gene locus_tag LOCUS_25440 7025 6537 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018991648.1 protein_id gnl|my_center|LOCUS_25440 7597 7022 gene locus_tag LOCUS_25450 7597 7022 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948185.1 protein_id gnl|my_center|LOCUS_25450 8487 7636 gene locus_tag LOCUS_25460 8487 7636 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109652.1 protein_id gnl|my_center|LOCUS_25460 10196 8607 gene locus_tag LOCUS_25470 10196 8607 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence74 1426 401 gene locus_tag LOCUS_25480 gene glk 1426 401 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_25480 1497 1667 gene locus_tag LOCUS_25490 1497 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 1660 2190 gene locus_tag LOCUS_25500 1660 2190 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_25500 2886 2401 gene locus_tag LOCUS_25510 2886 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 3277 3549 gene locus_tag LOCUS_25520 3277 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25520 3969 6872 gene locus_tag LOCUS_25530 3969 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 7930 6902 gene locus_tag LOCUS_25540 7930 6902 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103696.1 protein_id gnl|my_center|LOCUS_25540 8949 7927 gene locus_tag LOCUS_25550 8949 7927 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 protein_id gnl|my_center|LOCUS_25550 9548 8949 gene locus_tag LOCUS_25560 9548 8949 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_25560 9983 9606 gene locus_tag LOCUS_25570 gene mazF 9983 9606 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887062.1 protein_id gnl|my_center|LOCUS_25570 10252 9980 gene locus_tag LOCUS_25580 10252 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171960.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence75 79 1407 gene locus_tag LOCUS_25590 79 1407 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025385041.1 protein_id gnl|my_center|LOCUS_25590 2531 1395 gene locus_tag LOCUS_25600 2531 1395 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815525.1 protein_id gnl|my_center|LOCUS_25600 3244 5226 gene locus_tag LOCUS_25610 3244 5226 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385729.1 protein_id gnl|my_center|LOCUS_25610 5226 6536 gene locus_tag LOCUS_25620 5226 6536 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_25620 6547 7308 gene locus_tag LOCUS_25630 6547 7308 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104614758.1 protein_id gnl|my_center|LOCUS_25630 7523 10384 gene locus_tag LOCUS_25640 7523 10384 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385732.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence76 1870 989 gene locus_tag LOCUS_25650 1870 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 2742 2374 gene locus_tag LOCUS_25660 2742 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2820 3833 gene locus_tag LOCUS_25670 2820 3833 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_25670 5642 3828 gene locus_tag LOCUS_25680 5642 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 6168 5875 gene locus_tag LOCUS_25690 gene yhbY 6168 5875 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480467.1 protein_id gnl|my_center|LOCUS_25690 7170 6175 gene locus_tag LOCUS_25700 7170 6175 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944154.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25700 7412 7167 gene locus_tag LOCUS_25710 7412 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 7635 8453 gene locus_tag LOCUS_25720 7635 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 8434 9273 gene locus_tag LOCUS_25730 8434 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 9358 9579 gene locus_tag LOCUS_25740 9358 9579 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312031.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence77 885 511 gene locus_tag LOCUS_25750 885 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 1982 1005 gene locus_tag LOCUS_25760 1982 1005 CDS product DUF3034 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405355.1 protein_id gnl|my_center|LOCUS_25760 3182 2379 gene locus_tag LOCUS_25770 gene fetB 3182 2379 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_25770 3775 3173 gene locus_tag LOCUS_25780 3775 3173 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_25780 4467 3778 gene locus_tag LOCUS_25790 gene trmB 4467 3778 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 protein_id gnl|my_center|LOCUS_25790 5333 4542 gene locus_tag LOCUS_25800 5333 4542 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 protein_id gnl|my_center|LOCUS_25800 5626 5426 gene locus_tag LOCUS_25810 gene thiS 5626 5426 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_25810 5784 5857 gene locus_tag LOCUS_t00350 5784 5857 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9368 5937 gene locus_tag LOCUS_25820 9368 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence78 1168 2724 gene locus_tag LOCUS_25830 1168 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2849 4252 gene locus_tag LOCUS_25840 2849 4252 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942717.1 protein_id gnl|my_center|LOCUS_25840 4372 5385 gene locus_tag LOCUS_25850 4372 5385 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942716.1 protein_id gnl|my_center|LOCUS_25850 5884 5504 gene locus_tag LOCUS_25860 5884 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 6228 6800 gene locus_tag LOCUS_25870 6228 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 7033 7332 gene locus_tag LOCUS_25880 7033 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 7382 7891 gene locus_tag LOCUS_25890 gene pncC 7382 7891 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301974.1 protein_id gnl|my_center|LOCUS_25890 8483 8037 gene locus_tag LOCUS_25900 8483 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25900 8400 8702 gene locus_tag LOCUS_25910 8400 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25910 8699 9433 gene locus_tag LOCUS_25920 8699 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25920 >Feature sequence79 1490 309 gene locus_tag LOCUS_25930 1490 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 3097 1490 gene locus_tag LOCUS_25940 3097 1490 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_25940 4201 3158 gene locus_tag LOCUS_25950 4201 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 7626 4237 gene locus_tag LOCUS_25960 7626 4237 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_25960 7838 7623 gene locus_tag LOCUS_25970 7838 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence80 203 12 gene locus_tag LOCUS_25980 203 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 430 1056 gene locus_tag LOCUS_25990 gene rnt 430 1056 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_25990 1081 1761 gene locus_tag LOCUS_26000 1081 1761 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_26000 3164 1887 gene locus_tag LOCUS_26010 3164 1887 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948436.1 protein_id gnl|my_center|LOCUS_26010 4462 3161 gene locus_tag LOCUS_26020 4462 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 5574 4774 gene locus_tag LOCUS_26030 gene hemD 5574 4774 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883127.1 protein_id gnl|my_center|LOCUS_26030 6525 5596 gene locus_tag LOCUS_26040 gene hemC 6525 5596 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114031.1 protein_id gnl|my_center|LOCUS_26040 7337 6594 gene locus_tag LOCUS_26050 7337 6594 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247212.1 protein_id gnl|my_center|LOCUS_26050 >Feature sequence81 142 501 gene locus_tag LOCUS_26060 142 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 498 698 gene locus_tag LOCUS_26070 498 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 1263 1187 gene locus_tag LOCUS_t00360 1263 1187 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3106 1292 gene locus_tag LOCUS_26080 gene rpoD 3106 1292 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704782.1 protein_id gnl|my_center|LOCUS_26080 4961 3231 gene locus_tag LOCUS_26090 gene dnaG 4961 3231 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262668.1 protein_id gnl|my_center|LOCUS_26090 5442 4999 gene locus_tag LOCUS_26100 5442 4999 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038898.1 protein_id gnl|my_center|LOCUS_26100 5686 5471 gene locus_tag LOCUS_26110 gene rpsU 5686 5471 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 protein_id gnl|my_center|LOCUS_26110 5839 6891 gene locus_tag LOCUS_26120 gene tsaD 5839 6891 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262666.1 protein_id gnl|my_center|LOCUS_26120 7483 6899 gene locus_tag LOCUS_26130 gene plsY 7483 6899 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021296.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence82 456 217 gene locus_tag LOCUS_26140 456 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2210 462 gene locus_tag LOCUS_26150 gene dnaK 2210 462 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_26150 2869 2207 gene locus_tag LOCUS_26160 2869 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 3381 3067 gene locus_tag LOCUS_26170 3381 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 5913 3382 gene locus_tag LOCUS_26180 5913 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 7052 6411 gene locus_tag LOCUS_26190 7052 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence83 <1 1327 gene locus_tag LOCUS_26200 <1 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_133503194.1:PAS domain-containing methyl-accepting chemotaxis protein 1969 1894 gene locus_tag LOCUS_t00370 1969 1894 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2051 1976 gene locus_tag LOCUS_t00380 2051 1976 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3810 2119 gene locus_tag LOCUS_26210 3810 2119 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_26210 5256 3850 gene locus_tag LOCUS_26220 gene gltX 5256 3850 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222185.1 protein_id gnl|my_center|LOCUS_26220 5427 6071 gene locus_tag LOCUS_26230 5427 6071 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792222.1 protein_id gnl|my_center|LOCUS_26230 6173 6541 gene locus_tag LOCUS_26240 6173 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 6854 6612 gene locus_tag LOCUS_26250 6854 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence84 1190 147 gene locus_tag LOCUS_26260 1190 147 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463959.1 protein_id gnl|my_center|LOCUS_26260 1352 1277 gene locus_tag LOCUS_t00390 1352 1277 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2416 1382 gene locus_tag LOCUS_26270 2416 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 3165 2428 gene locus_tag LOCUS_26280 3165 2428 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093768.1 protein_id gnl|my_center|LOCUS_26280 4156 3146 gene locus_tag LOCUS_26290 gene birA 4156 3146 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478002.1 protein_id gnl|my_center|LOCUS_26290 5989 4160 gene locus_tag LOCUS_26300 5989 4160 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_26300 6219 6109 gene locus_tag LOCUS_r00020 6219 6109 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence85 104 469 gene locus_tag LOCUS_26310 104 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 650 1273 gene locus_tag LOCUS_26320 650 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 1289 1981 gene locus_tag LOCUS_26330 1289 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 2432 1998 gene locus_tag LOCUS_26340 2432 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 3079 2450 gene locus_tag LOCUS_26350 3079 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 3586 4227 gene locus_tag LOCUS_26360 3586 4227 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739535.1 protein_id gnl|my_center|LOCUS_26360 4269 5072 gene locus_tag LOCUS_26370 4269 5072 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095770.1 protein_id gnl|my_center|LOCUS_26370 5597 5049 gene locus_tag LOCUS_26380 5597 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 >Feature sequence86 1126 158 gene locus_tag LOCUS_26390 gene ispB 1126 158 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_26390 1351 1665 gene locus_tag LOCUS_26400 gene rplU 1351 1665 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417305.1 protein_id gnl|my_center|LOCUS_26400 1678 1935 gene locus_tag LOCUS_26410 gene rpmA 1678 1935 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004385076.1 protein_id gnl|my_center|LOCUS_26410 2292 2684 gene locus_tag LOCUS_26420 2292 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 2702 3616 gene locus_tag LOCUS_26430 2702 3616 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_26430 3643 4431 gene locus_tag LOCUS_26440 3643 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence87 540 2768 gene locus_tag LOCUS_26450 540 2768 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 protein_id gnl|my_center|LOCUS_26450 2877 3515 gene locus_tag LOCUS_26460 2877 3515 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_26460 3505 3903 gene locus_tag LOCUS_26470 3505 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 4040 4792 gene locus_tag LOCUS_26480 4040 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 5393 5133 gene locus_tag LOCUS_26490 5393 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26490 >Feature sequence88 1841 411 gene locus_tag LOCUS_26500 gene gltA 1841 411 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_26500 3482 1851 gene locus_tag LOCUS_26510 3482 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 4891 3887 gene locus_tag LOCUS_26520 4891 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence89 873 247 gene locus_tag LOCUS_26530 873 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 1331 861 gene locus_tag LOCUS_26540 1331 861 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207064.1 protein_id gnl|my_center|LOCUS_26540 1685 1452 gene locus_tag LOCUS_26550 1685 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26550 4255 1994 gene locus_tag LOCUS_26560 4255 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence90 1287 202 gene locus_tag LOCUS_26570 1287 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 2163 1291 gene locus_tag LOCUS_26580 2163 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26580 2521 3741 gene locus_tag LOCUS_26590 2521 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence91 565 1305 gene locus_tag LOCUS_26600 565 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26600 1278 1472 gene locus_tag LOCUS_26610 1278 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26610 1817 2572 gene locus_tag LOCUS_26620 1817 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence92 485 2533 gene locus_tag LOCUS_26630 485 2533 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_26630 2560 3045 gene locus_tag LOCUS_26640 2560 3045 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_26640 >Feature sequence93 830 222 gene locus_tag LOCUS_26650 830 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1189 848 gene locus_tag LOCUS_26660 1189 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2019 1249 gene locus_tag LOCUS_26670 2019 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2138 2016 gene locus_tag LOCUS_26680 2138 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 3072 2398 gene locus_tag LOCUS_26690 3072 2398 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_26690 3566 3348 gene locus_tag LOCUS_26700 3566 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence94 1626 1021 gene locus_tag LOCUS_26710 1626 1021 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence95 830 60 gene locus_tag LOCUS_26720 830 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 <2574 827 gene locus_tag LOCUS_26730 <2574 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927078.1:DUF559 domain-containing protein >Feature sequence96 >Feature sequence97 78 3 gene locus_tag LOCUS_t00400 78 3 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 210 135 gene locus_tag LOCUS_t00410 210 135 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 518 442 gene locus_tag LOCUS_t00420 518 442 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 615 539 gene locus_tag LOCUS_t00430 615 539 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 762 1625 gene locus_tag LOCUS_26740 gene folD 762 1625 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071914.1 protein_id gnl|my_center|LOCUS_26740 1706 2017 gene locus_tag LOCUS_26750 1706 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence98 406 825 gene locus_tag LOCUS_26760 406 825 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_26760 890 1246 gene locus_tag LOCUS_26770 890 1246 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_26770