>Feature sequence001 772 1137 gene locus_tag LOCUS_00010 772 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1141 2475 gene locus_tag LOCUS_00020 1141 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2488 4491 gene locus_tag LOCUS_00030 gene asnB 2488 4491 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_00030 4522 5658 gene locus_tag LOCUS_00040 4522 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6511 5636 gene locus_tag LOCUS_00050 6511 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6948 6514 gene locus_tag LOCUS_00060 6948 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7288 6962 gene locus_tag LOCUS_00070 7288 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8907 7363 gene locus_tag LOCUS_00080 8907 7363 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_00080 9932 8904 gene locus_tag LOCUS_00090 9932 8904 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_00090 10482 11804 gene locus_tag LOCUS_00100 gene rlmD 10482 11804 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869710.1 protein_id gnl|my_center|LOCUS_00100 12274 12531 gene locus_tag LOCUS_00110 12274 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12518 13240 gene locus_tag LOCUS_00120 gene pyrF 12518 13240 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_00120 13251 14027 gene locus_tag LOCUS_00130 13251 14027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14057 14785 gene locus_tag LOCUS_00140 14057 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17211 14983 gene locus_tag LOCUS_00150 17211 14983 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_00150 18267 17446 gene locus_tag LOCUS_00160 18267 17446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19297 18395 gene locus_tag LOCUS_00170 19297 18395 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468414.1 protein_id gnl|my_center|LOCUS_00170 20109 19297 gene locus_tag LOCUS_00180 gene mazG 20109 19297 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_00180 20682 20170 gene locus_tag LOCUS_00190 20682 20170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21736 20684 gene locus_tag LOCUS_00200 21736 20684 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939306.1 protein_id gnl|my_center|LOCUS_00200 23715 21754 gene locus_tag LOCUS_00210 gene gyrB 23715 21754 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933913.1 protein_id gnl|my_center|LOCUS_00210 24105 23743 gene locus_tag LOCUS_00220 24105 23743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25232 24114 gene locus_tag LOCUS_00230 gene dnaN 25232 24114 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402793.1 protein_id gnl|my_center|LOCUS_00230 27118 25724 gene locus_tag LOCUS_00240 gene dnaA 27118 25724 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931696.1 protein_id gnl|my_center|LOCUS_00240 28983 27355 gene locus_tag LOCUS_00250 28983 27355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29748 29188 gene locus_tag LOCUS_00260 29748 29188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30850 29741 gene locus_tag LOCUS_00270 30850 29741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31669 31028 gene locus_tag LOCUS_00280 31669 31028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32820 31669 gene locus_tag LOCUS_00290 32820 31669 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_00290 33803 32823 gene locus_tag LOCUS_00300 33803 32823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 34624 33803 gene locus_tag LOCUS_00310 34624 33803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 35793 34732 gene locus_tag LOCUS_00320 35793 34732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36194 35928 gene locus_tag LOCUS_00330 36194 35928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38230 36599 gene locus_tag LOCUS_00340 38230 36599 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227677.1 protein_id gnl|my_center|LOCUS_00340 38597 38256 gene locus_tag LOCUS_00350 38597 38256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40431 38608 gene locus_tag LOCUS_00360 40431 38608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 43252 40973 gene locus_tag LOCUS_00370 43252 40973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 46616 43533 gene locus_tag LOCUS_00380 46616 43533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 47822 46704 gene locus_tag LOCUS_00390 47822 46704 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_00390 48110 50614 gene locus_tag LOCUS_00400 gene gyrA 48110 50614 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_00400 50631 51266 gene locus_tag LOCUS_00410 50631 51266 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_00410 51278 52786 gene locus_tag LOCUS_00420 51278 52786 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_00420 53322 54191 gene locus_tag LOCUS_00430 53322 54191 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932877.1 protein_id gnl|my_center|LOCUS_00430 54193 55191 gene locus_tag LOCUS_00440 54193 55191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 55167 56243 gene locus_tag LOCUS_00450 55167 56243 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_00450 56311 57618 gene locus_tag LOCUS_00460 56311 57618 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932280.1 protein_id gnl|my_center|LOCUS_00460 57622 58266 gene locus_tag LOCUS_00470 57622 58266 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476335.1 protein_id gnl|my_center|LOCUS_00470 58328 59644 gene locus_tag LOCUS_00480 58328 59644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 59650 60423 gene locus_tag LOCUS_00490 59650 60423 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393905.1 protein_id gnl|my_center|LOCUS_00490 60504 61700 gene locus_tag LOCUS_00500 60504 61700 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_00500 62470 61784 gene locus_tag LOCUS_00510 62470 61784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 63366 62746 gene locus_tag LOCUS_00520 63366 62746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 65285 63423 gene locus_tag LOCUS_00530 gene mnmG 65285 63423 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115437557.1 protein_id gnl|my_center|LOCUS_00530 65782 65315 gene locus_tag LOCUS_00540 65782 65315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 67231 65876 gene locus_tag LOCUS_00550 gene mnmE 67231 65876 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016067.1 protein_id gnl|my_center|LOCUS_00550 69032 67251 gene locus_tag LOCUS_00560 gene yidC 69032 67251 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_00560 69318 69025 gene locus_tag LOCUS_00570 gene yidD 69318 69025 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_00570 71380 69896 gene locus_tag LOCUS_00580 gene gltX 71380 69896 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_00580 72289 71549 gene locus_tag LOCUS_00590 gene fabG 72289 71549 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_00590 72561 72884 gene locus_tag LOCUS_00600 72561 72884 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082959.1 protein_id gnl|my_center|LOCUS_00600 73287 72907 gene locus_tag LOCUS_00610 73287 72907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 73807 73454 gene locus_tag LOCUS_00620 73807 73454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 74149 74883 gene locus_tag LOCUS_00630 gene flgF 74149 74883 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_00630 74904 75692 gene locus_tag LOCUS_00640 gene flgG 74904 75692 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546478.1 protein_id gnl|my_center|LOCUS_00640 75699 76376 gene locus_tag LOCUS_00650 75699 76376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 76379 76972 gene locus_tag LOCUS_00660 76379 76972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 77108 78124 gene locus_tag LOCUS_00670 77108 78124 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_00670 78132 78899 gene locus_tag LOCUS_00680 78132 78899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 78883 79383 gene locus_tag LOCUS_00690 78883 79383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 79431 80753 gene locus_tag LOCUS_00700 gene flgK 79431 80753 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_00700 80771 81688 gene locus_tag LOCUS_00710 gene flgL 80771 81688 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_00710 81767 83524 gene locus_tag LOCUS_00720 81767 83524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 83524 84744 gene locus_tag LOCUS_00730 83524 84744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 84795 86621 gene locus_tag LOCUS_00740 84795 86621 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044916.1 protein_id gnl|my_center|LOCUS_00740 86652 88373 gene locus_tag LOCUS_00750 86652 88373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 88510 89682 gene locus_tag LOCUS_00760 88510 89682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 89719 90366 gene locus_tag LOCUS_00770 89719 90366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 90342 90719 gene locus_tag LOCUS_00780 90342 90719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 >Feature sequence002 1313 27 gene locus_tag LOCUS_00790 gene gdhA 1313 27 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_00790 2356 1520 gene locus_tag LOCUS_00800 2356 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 2556 2472 gene locus_tag LOCUS_t00010 2556 2472 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2966 2715 gene locus_tag LOCUS_00810 2966 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 3076 6030 gene locus_tag LOCUS_00820 3076 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 8015 6042 gene locus_tag LOCUS_00830 8015 6042 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922237.1 protein_id gnl|my_center|LOCUS_00830 8873 8037 gene locus_tag LOCUS_00840 8873 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 9022 9366 gene locus_tag LOCUS_00850 9022 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 9412 11454 gene locus_tag LOCUS_00860 9412 11454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 11667 11476 gene locus_tag LOCUS_00870 11667 11476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 12264 11749 gene locus_tag LOCUS_00880 12264 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 12592 12281 gene locus_tag LOCUS_00890 12592 12281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 13886 12612 gene locus_tag LOCUS_00900 gene eno 13886 12612 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103949.1 protein_id gnl|my_center|LOCUS_00900 14293 13913 gene locus_tag LOCUS_00910 14293 13913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 14632 15357 gene locus_tag LOCUS_00920 14632 15357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 15350 16831 gene locus_tag LOCUS_00930 15350 16831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 16840 18396 gene locus_tag LOCUS_00940 16840 18396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 18657 19781 gene locus_tag LOCUS_00950 18657 19781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 19784 20566 gene locus_tag LOCUS_00960 19784 20566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 20710 20895 gene locus_tag LOCUS_00970 20710 20895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 20919 21140 gene locus_tag LOCUS_00980 20919 21140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 21157 21717 gene locus_tag LOCUS_00990 gene hpt 21157 21717 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_00990 21754 22434 gene locus_tag LOCUS_01000 21754 22434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_01000 22551 25034 gene locus_tag LOCUS_01010 22551 25034 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_01010 25159 25950 gene locus_tag LOCUS_01020 25159 25950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 25961 26179 gene locus_tag LOCUS_01030 25961 26179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 26176 26583 gene locus_tag LOCUS_01040 26176 26583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 27711 26590 gene locus_tag LOCUS_01050 gene lpxB 27711 26590 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_01050 28285 27716 gene locus_tag LOCUS_01060 28285 27716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 29260 28286 gene locus_tag LOCUS_01070 29260 28286 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_01070 30290 29379 gene locus_tag LOCUS_01080 30290 29379 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_01080 31021 30587 gene locus_tag LOCUS_01090 31021 30587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 31386 34169 gene locus_tag LOCUS_01100 31386 34169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 34338 34910 gene locus_tag LOCUS_01110 34338 34910 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_01110 35091 36287 gene locus_tag LOCUS_01120 35091 36287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_01120 37019 40378 gene locus_tag LOCUS_01130 37019 40378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 42813 40627 gene locus_tag LOCUS_01140 gene purL 42813 40627 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_01140 43089 42916 gene locus_tag LOCUS_01150 43089 42916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 43375 43181 gene locus_tag LOCUS_01160 43375 43181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 44237 43437 gene locus_tag LOCUS_01170 44237 43437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 44610 44266 gene locus_tag LOCUS_01180 44610 44266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 44807 44583 gene locus_tag LOCUS_01190 44807 44583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402859.1 protein_id gnl|my_center|LOCUS_01190 45760 44906 gene locus_tag LOCUS_01200 gene accD 45760 44906 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_01200 46211 45753 gene locus_tag LOCUS_01210 gene rimI 46211 45753 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208657.1 protein_id gnl|my_center|LOCUS_01210 47294 46437 gene locus_tag LOCUS_01220 gene folP 47294 46437 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_01220 48067 47297 gene locus_tag LOCUS_01230 48067 47297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 48508 48080 gene locus_tag LOCUS_01240 48508 48080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 48973 48590 gene locus_tag LOCUS_01250 48973 48590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 49693 50109 gene locus_tag LOCUS_01260 49693 50109 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080666.1 protein_id gnl|my_center|LOCUS_01260 50225 51100 gene locus_tag LOCUS_01270 50225 51100 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_01270 53472 51184 gene locus_tag LOCUS_01280 53472 51184 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_01280 53699 54661 gene locus_tag LOCUS_01290 53699 54661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 54651 55709 gene locus_tag LOCUS_01300 gene mltG 54651 55709 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545006.1 protein_id gnl|my_center|LOCUS_01300 55789 58023 gene locus_tag LOCUS_01310 55789 58023 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403314.1 protein_id gnl|my_center|LOCUS_01310 58020 61676 gene locus_tag LOCUS_01320 58020 61676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 61684 62808 gene locus_tag LOCUS_01330 61684 62808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 62919 63401 gene locus_tag LOCUS_01340 62919 63401 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902435.1 protein_id gnl|my_center|LOCUS_01340 63764 64279 gene locus_tag LOCUS_01350 63764 64279 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_01350 64251 65039 gene locus_tag LOCUS_01360 64251 65039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 65609 65262 gene locus_tag LOCUS_01370 65609 65262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 65853 66116 gene locus_tag LOCUS_01380 65853 66116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 66116 66616 gene locus_tag LOCUS_01390 66116 66616 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027607744.1 protein_id gnl|my_center|LOCUS_01390 66905 66978 gene locus_tag LOCUS_t00020 66905 66978 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 67205 67035 gene locus_tag LOCUS_01400 67205 67035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 67387 68997 gene locus_tag LOCUS_01410 67387 68997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 69024 69380 gene locus_tag LOCUS_01420 69024 69380 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_01420 69615 71012 gene locus_tag LOCUS_01430 69615 71012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 71528 71100 gene locus_tag LOCUS_01440 71528 71100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 <72472 71556 gene locus_tag LOCUS_01450 <72472 71556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403901.1:RNA polymerase factor sigma-54 >Feature sequence003 238 1452 gene locus_tag LOCUS_01460 238 1452 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_01460 1623 3521 gene locus_tag LOCUS_01470 1623 3521 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103821.1 protein_id gnl|my_center|LOCUS_01470 3635 8719 gene locus_tag LOCUS_01480 3635 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 9091 11049 gene locus_tag LOCUS_01490 9091 11049 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225895010.1 protein_id gnl|my_center|LOCUS_01490 11541 13550 gene locus_tag LOCUS_01500 11541 13550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 13690 18927 gene locus_tag LOCUS_01510 13690 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 21374 19041 gene locus_tag LOCUS_01520 21374 19041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 22539 21385 gene locus_tag LOCUS_01530 22539 21385 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257505.1 protein_id gnl|my_center|LOCUS_01530 23939 22536 gene locus_tag LOCUS_01540 23939 22536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 24976 23978 gene locus_tag LOCUS_01550 24976 23978 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257504.1 protein_id gnl|my_center|LOCUS_01550 25792 24980 gene locus_tag LOCUS_01560 25792 24980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 26795 25782 gene locus_tag LOCUS_01570 26795 25782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 27772 26831 gene locus_tag LOCUS_01580 27772 26831 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108803.1 protein_id gnl|my_center|LOCUS_01580 29920 29093 gene locus_tag LOCUS_01590 29920 29093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 30642 29962 gene locus_tag LOCUS_01600 30642 29962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 31750 30662 gene locus_tag LOCUS_01610 31750 30662 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_01610 32777 31770 gene locus_tag LOCUS_01620 32777 31770 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_01620 33269 32805 gene locus_tag LOCUS_01630 33269 32805 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_01630 34892 33417 gene locus_tag LOCUS_01640 34892 33417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 35854 34901 gene locus_tag LOCUS_01650 35854 34901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 38391 36424 gene locus_tag LOCUS_01660 38391 36424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 38622 39428 gene locus_tag LOCUS_01670 38622 39428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 39515 39922 gene locus_tag LOCUS_01680 39515 39922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 41041 41310 gene locus_tag LOCUS_01690 41041 41310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 41307 41768 gene locus_tag LOCUS_01700 41307 41768 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_01700 41939 42118 gene locus_tag LOCUS_01710 41939 42118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 42133 44790 gene locus_tag LOCUS_01720 42133 44790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 45208 46707 gene locus_tag LOCUS_01730 45208 46707 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_01730 48496 46754 gene locus_tag LOCUS_01740 48496 46754 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_01740 51213 48628 gene locus_tag LOCUS_01750 51213 48628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 54443 51297 gene locus_tag LOCUS_01760 54443 51297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 55938 54592 gene locus_tag LOCUS_01770 gene tig 55938 54592 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_01770 58371 56158 gene locus_tag LOCUS_01780 58371 56158 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943762.1 protein_id gnl|my_center|LOCUS_01780 >Feature sequence004 <1 1118 gene locus_tag LOCUS_01790 <1 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840167.1:T9SS type A sorting domain-containing protein 1307 2968 gene locus_tag LOCUS_01800 1307 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 6119 3060 gene locus_tag LOCUS_01810 6119 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 6267 6959 gene locus_tag LOCUS_01820 6267 6959 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_01820 6956 7915 gene locus_tag LOCUS_01830 6956 7915 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_01830 7912 8922 gene locus_tag LOCUS_01840 7912 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 8942 9655 gene locus_tag LOCUS_01850 8942 9655 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545096.1 protein_id gnl|my_center|LOCUS_01850 9936 11234 gene locus_tag LOCUS_01860 9936 11234 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_01860 11462 12142 gene locus_tag LOCUS_01870 11462 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 12195 14612 gene locus_tag LOCUS_01880 12195 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 14640 15215 gene locus_tag LOCUS_01890 14640 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 15255 17552 gene locus_tag LOCUS_01900 15255 17552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 20355 17674 gene locus_tag LOCUS_01910 20355 17674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 22088 20373 gene locus_tag LOCUS_01920 22088 20373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 24688 22106 gene locus_tag LOCUS_01930 24688 22106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 25009 26262 gene locus_tag LOCUS_01940 25009 26262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 26259 28259 gene locus_tag LOCUS_01950 26259 28259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933167.1 protein_id gnl|my_center|LOCUS_01950 28256 30052 gene locus_tag LOCUS_01960 28256 30052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_01960 30308 30805 gene locus_tag LOCUS_01970 30308 30805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 30825 32996 gene locus_tag LOCUS_01980 30825 32996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 34193 33078 gene locus_tag LOCUS_01990 gene anmK 34193 33078 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_01990 35907 34174 gene locus_tag LOCUS_02000 35907 34174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 36507 37685 gene locus_tag LOCUS_02010 36507 37685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 38184 38546 gene locus_tag LOCUS_02020 38184 38546 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_02020 38704 39462 gene locus_tag LOCUS_02030 38704 39462 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082811.1 protein_id gnl|my_center|LOCUS_02030 39634 39936 gene locus_tag LOCUS_02040 39634 39936 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943454.1 protein_id gnl|my_center|LOCUS_02040 39989 40837 gene locus_tag LOCUS_02050 39989 40837 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_02050 41085 42047 gene locus_tag LOCUS_02060 41085 42047 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964929.1 protein_id gnl|my_center|LOCUS_02060 42044 42919 gene locus_tag LOCUS_02070 42044 42919 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939380.1 protein_id gnl|my_center|LOCUS_02070 42999 43337 gene locus_tag LOCUS_02080 42999 43337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 43420 43554 gene locus_tag LOCUS_02090 43420 43554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 43671 44117 gene locus_tag LOCUS_02100 43671 44117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 44188 44583 gene locus_tag LOCUS_02110 44188 44583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 44642 45811 gene locus_tag LOCUS_02120 44642 45811 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937699.1 protein_id gnl|my_center|LOCUS_02120 47790 45820 gene locus_tag LOCUS_02130 47790 45820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 48579 47791 gene locus_tag LOCUS_02140 48579 47791 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815883.1 protein_id gnl|my_center|LOCUS_02140 49277 48579 gene locus_tag LOCUS_02150 49277 48579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937838.1 protein_id gnl|my_center|LOCUS_02150 50761 49322 gene locus_tag LOCUS_02160 50761 49322 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393135.1 protein_id gnl|my_center|LOCUS_02160 51358 52344 gene locus_tag LOCUS_02170 51358 52344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 52395 52931 gene locus_tag LOCUS_02180 52395 52931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 53121 54422 gene locus_tag LOCUS_02190 gene orpR 53121 54422 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_02190 54661 56946 gene locus_tag LOCUS_02200 54661 56946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 56975 58054 gene locus_tag LOCUS_02210 56975 58054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 60025 58436 gene locus_tag LOCUS_02220 60025 58436 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582712.1 protein_id gnl|my_center|LOCUS_02220 60731 60054 gene locus_tag LOCUS_02230 60731 60054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 63876 60736 gene locus_tag LOCUS_02240 63876 60736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 64783 63935 gene locus_tag LOCUS_02250 64783 63935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 67514 65214 gene locus_tag LOCUS_02260 67514 65214 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119132.1 protein_id gnl|my_center|LOCUS_02260 67773 69296 gene locus_tag LOCUS_02270 67773 69296 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_02270 >Feature sequence005 <1 500 gene locus_tag LOCUS_02280 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811782.1:OmpH family outer membrane protein 545 1594 gene locus_tag LOCUS_02290 gene lpxD 545 1594 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_02290 1605 2177 gene locus_tag LOCUS_02300 gene pyrR 1605 2177 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_02300 2174 3109 gene locus_tag LOCUS_02310 2174 3109 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_02310 3102 4442 gene locus_tag LOCUS_02320 3102 4442 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404924.1 protein_id gnl|my_center|LOCUS_02320 4629 6446 gene locus_tag LOCUS_02330 gene lepA 4629 6446 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_02330 6738 7511 gene locus_tag LOCUS_02340 gene lepB 6738 7511 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_02340 7604 9607 gene locus_tag LOCUS_02350 gene ligA 7604 9607 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932145.1 protein_id gnl|my_center|LOCUS_02350 9659 10222 gene locus_tag LOCUS_02360 gene efp 9659 10222 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_02360 10236 10721 gene locus_tag LOCUS_02370 10236 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 10721 12055 gene locus_tag LOCUS_02380 gene accC 10721 12055 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931851.1 protein_id gnl|my_center|LOCUS_02380 12168 12560 gene locus_tag LOCUS_02390 gene gcvH 12168 12560 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_02390 12567 13910 gene locus_tag LOCUS_02400 gene gcvPA 12567 13910 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933289.1 protein_id gnl|my_center|LOCUS_02400 13971 14780 gene locus_tag LOCUS_02410 13971 14780 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_02410 14845 15558 gene locus_tag LOCUS_02420 14845 15558 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905862.1 protein_id gnl|my_center|LOCUS_02420 15560 16159 gene locus_tag LOCUS_02430 15560 16159 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_02430 16616 16810 gene locus_tag LOCUS_02440 16616 16810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 16982 20308 gene locus_tag LOCUS_02450 16982 20308 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_02450 20305 20985 gene locus_tag LOCUS_02460 20305 20985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 23789 21420 gene locus_tag LOCUS_02470 23789 21420 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937404.1 protein_id gnl|my_center|LOCUS_02470 26709 23884 gene locus_tag LOCUS_02480 26709 23884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 29517 26743 gene locus_tag LOCUS_02490 29517 26743 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769481.1 protein_id gnl|my_center|LOCUS_02490 30159 29737 gene locus_tag LOCUS_02500 30159 29737 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_02500 30552 31628 gene locus_tag LOCUS_02510 gene tgt 30552 31628 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225464.1 protein_id gnl|my_center|LOCUS_02510 31697 33229 gene locus_tag LOCUS_02520 31697 33229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 33244 33576 gene locus_tag LOCUS_02530 33244 33576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 33585 34508 gene locus_tag LOCUS_02540 gene fmt 33585 34508 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546616.1 protein_id gnl|my_center|LOCUS_02540 34556 35245 gene locus_tag LOCUS_02550 34556 35245 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870390.1 protein_id gnl|my_center|LOCUS_02550 35250 36572 gene locus_tag LOCUS_02560 gene rsmB 35250 36572 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_02560 36569 37372 gene locus_tag LOCUS_02570 36569 37372 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932876.1 protein_id gnl|my_center|LOCUS_02570 37411 38061 gene locus_tag LOCUS_02580 gene rpe 37411 38061 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 protein_id gnl|my_center|LOCUS_02580 38274 40808 gene locus_tag LOCUS_02590 38274 40808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 40805 42316 gene locus_tag LOCUS_02600 gene guaB 40805 42316 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869746.1 protein_id gnl|my_center|LOCUS_02600 42595 42311 gene locus_tag LOCUS_02610 gene rpsT 42595 42311 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_02610 42594 45113 gene locus_tag LOCUS_02620 42594 45113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 45103 45912 gene locus_tag LOCUS_02630 45103 45912 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583922.1 protein_id gnl|my_center|LOCUS_02630 45909 46826 gene locus_tag LOCUS_02640 45909 46826 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_02640 46823 47284 gene locus_tag LOCUS_02650 46823 47284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 47281 48117 gene locus_tag LOCUS_02660 47281 48117 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_02660 48234 49055 gene locus_tag LOCUS_02670 48234 49055 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002663.1 protein_id gnl|my_center|LOCUS_02670 49058 49990 gene locus_tag LOCUS_02680 49058 49990 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_02680 50148 51125 gene locus_tag LOCUS_02690 50148 51125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_02690 51314 52534 gene locus_tag LOCUS_02700 51314 52534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 52756 53256 gene locus_tag LOCUS_02710 52756 53256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 53630 53388 gene locus_tag LOCUS_02720 53630 53388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 53606 54517 gene locus_tag LOCUS_02730 gene menA 53606 54517 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_02730 54436 54609 gene locus_tag LOCUS_02740 54436 54609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 54611 57055 gene locus_tag LOCUS_02750 gene priA 54611 57055 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 protein_id gnl|my_center|LOCUS_02750 57048 58016 gene locus_tag LOCUS_02760 57048 58016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 58258 59226 gene locus_tag LOCUS_02770 58258 59226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 59323 60081 gene locus_tag LOCUS_02780 59323 60081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 60117 62906 gene locus_tag LOCUS_02790 60117 62906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 >Feature sequence006 42 833 gene locus_tag LOCUS_02800 42 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 846 3227 gene locus_tag LOCUS_02810 846 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 4275 3841 gene locus_tag LOCUS_02820 4275 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 5347 4289 gene locus_tag LOCUS_02830 5347 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 5962 6186 gene locus_tag LOCUS_02840 5962 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 7485 6241 gene locus_tag LOCUS_02850 gene tyrS 7485 6241 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546544.1 protein_id gnl|my_center|LOCUS_02850 8047 7580 gene locus_tag LOCUS_02860 gene smpB 8047 7580 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_02860 8219 9622 gene locus_tag LOCUS_02870 8219 9622 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943160.1 protein_id gnl|my_center|LOCUS_02870 9625 10353 gene locus_tag LOCUS_02880 9625 10353 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888542.1 protein_id gnl|my_center|LOCUS_02880 10350 11672 gene locus_tag LOCUS_02890 10350 11672 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216936.1 protein_id gnl|my_center|LOCUS_02890 11743 13803 gene locus_tag LOCUS_02900 11743 13803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 13790 14335 gene locus_tag LOCUS_02910 13790 14335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 14728 15930 gene locus_tag LOCUS_02920 14728 15930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 15927 17150 gene locus_tag LOCUS_02930 15927 17150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 17147 18487 gene locus_tag LOCUS_02940 17147 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 18763 19197 gene locus_tag LOCUS_02950 gene rpiB 18763 19197 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_02950 19197 20057 gene locus_tag LOCUS_02960 19197 20057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 20090 20722 gene locus_tag LOCUS_02970 20090 20722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 20723 21637 gene locus_tag LOCUS_02980 20723 21637 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_02980 21701 22990 gene locus_tag LOCUS_02990 21701 22990 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_02990 23022 23471 gene locus_tag LOCUS_03000 23022 23471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062537442.1 protein_id gnl|my_center|LOCUS_03000 23468 24232 gene locus_tag LOCUS_03010 23468 24232 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_03010 24260 24703 gene locus_tag LOCUS_03020 gene nrdR 24260 24703 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459010.1 protein_id gnl|my_center|LOCUS_03020 24723 25148 gene locus_tag LOCUS_03030 24723 25148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 25203 27095 gene locus_tag LOCUS_03040 25203 27095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 27203 27736 gene locus_tag LOCUS_03050 27203 27736 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_03050 27733 28038 gene locus_tag LOCUS_03060 gene nuoK 27733 28038 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404194.1 protein_id gnl|my_center|LOCUS_03060 28060 28710 gene locus_tag LOCUS_03070 28060 28710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 28688 29332 gene locus_tag LOCUS_03080 28688 29332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 29471 29764 gene locus_tag LOCUS_03090 29471 29764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 30367 30957 gene locus_tag LOCUS_03100 30367 30957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 31140 31772 gene locus_tag LOCUS_03110 31140 31772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 31870 32202 gene locus_tag LOCUS_03120 31870 32202 CDS product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534078.1 protein_id gnl|my_center|LOCUS_03120 32251 33759 gene locus_tag LOCUS_03130 32251 33759 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942570.1 protein_id gnl|my_center|LOCUS_03130 33756 34355 gene locus_tag LOCUS_03140 33756 34355 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391497.1 protein_id gnl|my_center|LOCUS_03140 34379 34585 gene locus_tag LOCUS_03150 34379 34585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 34635 36581 gene locus_tag LOCUS_03160 gene nuoL 34635 36581 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_03160 36668 37060 gene locus_tag LOCUS_03170 36668 37060 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_03170 37150 37407 gene locus_tag LOCUS_03180 37150 37407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 37404 38117 gene locus_tag LOCUS_03190 37404 38117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 38114 39055 gene locus_tag LOCUS_03200 38114 39055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 39208 39426 gene locus_tag LOCUS_03210 39208 39426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 39456 40565 gene locus_tag LOCUS_03220 39456 40565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 40702 41349 gene locus_tag LOCUS_03230 40702 41349 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_03230 41363 42406 gene locus_tag LOCUS_03240 41363 42406 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_03240 42890 43264 gene locus_tag LOCUS_03250 42890 43264 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_03250 43392 44846 gene locus_tag LOCUS_03260 43392 44846 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_03260 44986 45333 gene locus_tag LOCUS_03270 44986 45333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 45400 46419 gene locus_tag LOCUS_03280 45400 46419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 46446 47549 gene locus_tag LOCUS_03290 46446 47549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 47546 49378 gene locus_tag LOCUS_03300 47546 49378 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_03300 49568 49915 gene locus_tag LOCUS_03310 49568 49915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 50148 50333 gene locus_tag LOCUS_03320 50148 50333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 50330 53068 gene locus_tag LOCUS_03330 50330 53068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 53176 53793 gene locus_tag LOCUS_03340 53176 53793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 53793 54350 gene locus_tag LOCUS_03350 53793 54350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 54334 54840 gene locus_tag LOCUS_03360 54334 54840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 54932 56419 gene locus_tag LOCUS_03370 54932 56419 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_03370 57018 57275 gene locus_tag LOCUS_03380 57018 57275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence007 2307 199 gene locus_tag LOCUS_03390 2307 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 5079 2443 gene locus_tag LOCUS_03400 5079 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 7778 5124 gene locus_tag LOCUS_03410 7778 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 10567 8024 gene locus_tag LOCUS_03420 10567 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 10557 10766 gene locus_tag LOCUS_03430 10557 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 11898 10774 gene locus_tag LOCUS_03440 11898 10774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 12662 12090 gene locus_tag LOCUS_03450 12662 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 13459 12662 gene locus_tag LOCUS_03460 gene mutM 13459 12662 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_03460 14380 13460 gene locus_tag LOCUS_03470 14380 13460 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933862.1 protein_id gnl|my_center|LOCUS_03470 15514 14387 gene locus_tag LOCUS_03480 15514 14387 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_03480 16476 15511 gene locus_tag LOCUS_03490 16476 15511 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405124.1 protein_id gnl|my_center|LOCUS_03490 17192 16473 gene locus_tag LOCUS_03500 17192 16473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 18495 17194 gene locus_tag LOCUS_03510 18495 17194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 19680 18607 gene locus_tag LOCUS_03520 gene rseP 19680 18607 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_03520 20943 19783 gene locus_tag LOCUS_03530 20943 19783 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_03530 21801 20968 gene locus_tag LOCUS_03540 21801 20968 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141109.1 protein_id gnl|my_center|LOCUS_03540 22584 21802 gene locus_tag LOCUS_03550 gene lpxA 22584 21802 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880360.1 protein_id gnl|my_center|LOCUS_03550 23280 22585 gene locus_tag LOCUS_03560 23280 22585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 24079 23291 gene locus_tag LOCUS_03570 gene pyrF 24079 23291 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_03570 24419 25804 gene locus_tag LOCUS_03580 gene gatD 24419 25804 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 protein_id gnl|my_center|LOCUS_03580 25839 26720 gene locus_tag LOCUS_03590 25839 26720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 26815 28299 gene locus_tag LOCUS_03600 gene lysS 26815 28299 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933055.1 protein_id gnl|my_center|LOCUS_03600 28296 29603 gene locus_tag LOCUS_03610 28296 29603 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_03610 29832 31490 gene locus_tag LOCUS_03620 gene ggt 29832 31490 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595115.1 protein_id gnl|my_center|LOCUS_03620 31546 32487 gene locus_tag LOCUS_03630 gene trxB 31546 32487 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265863.1 protein_id gnl|my_center|LOCUS_03630 32489 34105 gene locus_tag LOCUS_03640 32489 34105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 34116 34946 gene locus_tag LOCUS_03650 34116 34946 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_03650 37501 34985 gene locus_tag LOCUS_03660 37501 34985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 39102 37501 gene locus_tag LOCUS_03670 39102 37501 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964265.1 protein_id gnl|my_center|LOCUS_03670 40527 39760 gene locus_tag LOCUS_03680 40527 39760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 41168 40659 gene locus_tag LOCUS_03690 41168 40659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 41503 42216 gene locus_tag LOCUS_03700 41503 42216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 42223 43311 gene locus_tag LOCUS_03710 42223 43311 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433710.1 protein_id gnl|my_center|LOCUS_03710 44356 43361 gene locus_tag LOCUS_03720 44356 43361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 44747 44346 gene locus_tag LOCUS_03730 44747 44346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943064.1 protein_id gnl|my_center|LOCUS_03730 46456 44918 gene locus_tag LOCUS_03740 gene cobA 46456 44918 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_03740 47103 46453 gene locus_tag LOCUS_03750 47103 46453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 48294 47104 gene locus_tag LOCUS_03760 gene hemA 48294 47104 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_03760 50008 48341 gene locus_tag LOCUS_03770 50008 48341 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877907.1 protein_id gnl|my_center|LOCUS_03770 51219 50065 gene locus_tag LOCUS_03780 gene nrfD 51219 50065 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272193.1 protein_id gnl|my_center|LOCUS_03780 52006 51227 gene locus_tag LOCUS_03790 52006 51227 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393110.1 protein_id gnl|my_center|LOCUS_03790 52542 52003 gene locus_tag LOCUS_03800 gene dsrJ 52542 52003 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546711.1 protein_id gnl|my_center|LOCUS_03800 54151 52535 gene locus_tag LOCUS_03810 54151 52535 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_03810 55146 54154 gene locus_tag LOCUS_03820 gene dsrM 55146 54154 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_03820 55863 55333 gene locus_tag LOCUS_03830 55863 55333 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546412.1 protein_id gnl|my_center|LOCUS_03830 56258 55941 gene locus_tag LOCUS_03840 56258 55941 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_03840 <56984 56294 gene locus_tag LOCUS_03850 <56984 56294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933900.1:NAD(P)-binding protein >Feature sequence008 138 482 gene locus_tag LOCUS_03860 138 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 506 781 gene locus_tag LOCUS_03870 506 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 1070 2578 gene locus_tag LOCUS_03880 gene katA 1070 2578 CDS product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245322.1 protein_id gnl|my_center|LOCUS_03880 2656 3426 gene locus_tag LOCUS_03890 2656 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 3428 3790 gene locus_tag LOCUS_03900 3428 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3806 6499 gene locus_tag LOCUS_03910 3806 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 7358 9880 gene locus_tag LOCUS_03920 7358 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 9899 10537 gene locus_tag LOCUS_03930 9899 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 10951 11313 gene locus_tag LOCUS_03940 10951 11313 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870211.1 protein_id gnl|my_center|LOCUS_03940 11352 12182 gene locus_tag LOCUS_03950 11352 12182 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_03950 14065 12338 gene locus_tag LOCUS_03960 14065 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 17019 15268 gene locus_tag LOCUS_03970 17019 15268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 18160 17045 gene locus_tag LOCUS_03980 18160 17045 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_03980 18870 18169 gene locus_tag LOCUS_03990 gene dapB 18870 18169 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880561.1 protein_id gnl|my_center|LOCUS_03990 19768 18863 gene locus_tag LOCUS_04000 gene dapA 19768 18863 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_04000 19901 21022 gene locus_tag LOCUS_04010 19901 21022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 21025 21369 gene locus_tag LOCUS_04020 21025 21369 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_04020 21373 21978 gene locus_tag LOCUS_04030 21373 21978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 22088 22504 gene locus_tag LOCUS_04040 22088 22504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 22541 23683 gene locus_tag LOCUS_04050 22541 23683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 23687 24190 gene locus_tag LOCUS_04060 23687 24190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 24253 25278 gene locus_tag LOCUS_04070 gene ruvB 24253 25278 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_04070 25343 26248 gene locus_tag LOCUS_04080 25343 26248 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_04080 27232 26237 gene locus_tag LOCUS_04090 27232 26237 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_04090 27733 29853 gene locus_tag LOCUS_04100 27733 29853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 30041 33181 gene locus_tag LOCUS_04110 30041 33181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 33201 35693 gene locus_tag LOCUS_04120 33201 35693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 35702 37057 gene locus_tag LOCUS_04130 35702 37057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 37093 38157 gene locus_tag LOCUS_04140 gene porV 37093 38157 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_04140 38176 40020 gene locus_tag LOCUS_04150 38176 40020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 40319 40657 gene locus_tag LOCUS_04160 40319 40657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 40669 41409 gene locus_tag LOCUS_04170 40669 41409 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933329.1 protein_id gnl|my_center|LOCUS_04170 41409 41915 gene locus_tag LOCUS_04180 gene ruvC 41409 41915 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_04180 41905 42492 gene locus_tag LOCUS_04190 gene ruvA 41905 42492 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_04190 42627 43595 gene locus_tag LOCUS_04200 42627 43595 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393454.1 protein_id gnl|my_center|LOCUS_04200 43592 44068 gene locus_tag LOCUS_04210 gene cutC 43592 44068 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_04210 44206 45147 gene locus_tag LOCUS_04220 44206 45147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 45131 46372 gene locus_tag LOCUS_04230 45131 46372 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_04230 46446 47657 gene locus_tag LOCUS_04240 46446 47657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 47650 48348 gene locus_tag LOCUS_04250 47650 48348 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614886.1 protein_id gnl|my_center|LOCUS_04250 48470 50836 gene locus_tag LOCUS_04260 48470 50836 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence009 3052 4416 gene locus_tag LOCUS_04270 3052 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 6148 4688 gene locus_tag LOCUS_04280 6148 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 7788 6358 gene locus_tag LOCUS_04290 7788 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 10714 7979 gene locus_tag LOCUS_04300 10714 7979 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_04300 12535 11066 gene locus_tag LOCUS_04310 12535 11066 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_04310 14052 12532 gene locus_tag LOCUS_04320 14052 12532 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_04320 14461 14111 gene locus_tag LOCUS_04330 14461 14111 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_04330 14774 14451 gene locus_tag LOCUS_04340 14774 14451 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_04340 17109 14803 gene locus_tag LOCUS_04350 gene nuoL 17109 14803 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927227.1 protein_id gnl|my_center|LOCUS_04350 17517 17212 gene locus_tag LOCUS_04360 gene nuoK 17517 17212 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_04360 18022 17519 gene locus_tag LOCUS_04370 18022 17519 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_04370 18308 18093 gene locus_tag LOCUS_04380 18308 18093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 18628 18305 gene locus_tag LOCUS_04390 18628 18305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 19275 18658 gene locus_tag LOCUS_04400 19275 18658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 20342 19290 gene locus_tag LOCUS_04410 gene nuoH 20342 19290 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_04410 21541 20339 gene locus_tag LOCUS_04420 21541 20339 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_04420 22047 21538 gene locus_tag LOCUS_04430 22047 21538 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_04430 22556 22047 gene locus_tag LOCUS_04440 22556 22047 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_04440 22947 22558 gene locus_tag LOCUS_04450 22947 22558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 23268 25223 gene locus_tag LOCUS_04460 23268 25223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 44543 25302 gene locus_tag LOCUS_04470 44543 25302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 46827 45349 gene locus_tag LOCUS_04480 46827 45349 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986561.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence010 663 1820 gene locus_tag LOCUS_04490 663 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 1825 2370 gene locus_tag LOCUS_04500 gene nudF 1825 2370 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_04500 2383 3390 gene locus_tag LOCUS_04510 2383 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 3425 4048 gene locus_tag LOCUS_04520 3425 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 4198 4770 gene locus_tag LOCUS_04530 4198 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 5792 4767 gene locus_tag LOCUS_04540 5792 4767 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_04540 8560 5798 gene locus_tag LOCUS_04550 8560 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 9400 8600 gene locus_tag LOCUS_04560 gene recO 9400 8600 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403930.1 protein_id gnl|my_center|LOCUS_04560 9670 9951 gene locus_tag LOCUS_04570 9670 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 10287 11168 gene locus_tag LOCUS_04580 10287 11168 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_04580 12241 11183 gene locus_tag LOCUS_04590 12241 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 13896 12241 gene locus_tag LOCUS_04600 13896 12241 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_04600 15229 13943 gene locus_tag LOCUS_04610 15229 13943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 16215 15310 gene locus_tag LOCUS_04620 gene meaB 16215 15310 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_04620 17160 16270 gene locus_tag LOCUS_04630 17160 16270 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_04630 17925 17248 gene locus_tag LOCUS_04640 17925 17248 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_04640 18225 17950 gene locus_tag LOCUS_04650 18225 17950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 19304 18222 gene locus_tag LOCUS_04660 19304 18222 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_04660 19884 19294 gene locus_tag LOCUS_04670 19884 19294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 21558 19972 gene locus_tag LOCUS_04680 21558 19972 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933669.1 protein_id gnl|my_center|LOCUS_04680 21899 23386 gene locus_tag LOCUS_04690 21899 23386 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153932.1 protein_id gnl|my_center|LOCUS_04690 23451 24917 gene locus_tag LOCUS_04700 23451 24917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 25067 26386 gene locus_tag LOCUS_04710 gene lat 25067 26386 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403564.1 protein_id gnl|my_center|LOCUS_04710 26467 27225 gene locus_tag LOCUS_04720 gene rsmI 26467 27225 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784666.1 protein_id gnl|my_center|LOCUS_04720 27206 28015 gene locus_tag LOCUS_04730 gene lgt 27206 28015 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_04730 28012 28632 gene locus_tag LOCUS_04740 gene tmk 28012 28632 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880600.1 protein_id gnl|my_center|LOCUS_04740 30020 29304 gene locus_tag LOCUS_04750 30020 29304 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112685.1 protein_id gnl|my_center|LOCUS_04750 31146 30001 gene locus_tag LOCUS_04760 31146 30001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 31998 31267 gene locus_tag LOCUS_04770 31998 31267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 33750 33373 gene locus_tag LOCUS_04780 33750 33373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 35868 34579 gene locus_tag LOCUS_04790 35868 34579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 36355 35897 gene locus_tag LOCUS_04800 36355 35897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 37097 36381 gene locus_tag LOCUS_04810 37097 36381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 38535 37120 gene locus_tag LOCUS_04820 38535 37120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 39646 38558 gene locus_tag LOCUS_04830 39646 38558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence011 1518 376 gene locus_tag LOCUS_04840 gene acdA 1518 376 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_04840 2389 1538 gene locus_tag LOCUS_04850 2389 1538 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887711.1 protein_id gnl|my_center|LOCUS_04850 3623 2427 gene locus_tag LOCUS_04860 3623 2427 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_04860 4410 3652 gene locus_tag LOCUS_04870 4410 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 5564 4425 gene locus_tag LOCUS_04880 5564 4425 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_04880 6874 5627 gene locus_tag LOCUS_04890 6874 5627 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545281.1 protein_id gnl|my_center|LOCUS_04890 7376 6852 gene locus_tag LOCUS_04900 7376 6852 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107788.1 protein_id gnl|my_center|LOCUS_04900 8899 7373 gene locus_tag LOCUS_04910 8899 7373 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870741.1 protein_id gnl|my_center|LOCUS_04910 9092 8922 gene locus_tag LOCUS_04920 9092 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 10587 9082 gene locus_tag LOCUS_04930 10587 9082 CDS product anti-phage dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036788256.1 protein_id gnl|my_center|LOCUS_04930 11105 10632 gene locus_tag LOCUS_04940 11105 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 11993 11196 gene locus_tag LOCUS_04950 11993 11196 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063886.1 protein_id gnl|my_center|LOCUS_04950 13612 12065 gene locus_tag LOCUS_04960 13612 12065 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957930.1 protein_id gnl|my_center|LOCUS_04960 14106 13801 gene locus_tag LOCUS_04970 14106 13801 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227980.1 protein_id gnl|my_center|LOCUS_04970 15673 14177 gene locus_tag LOCUS_04980 15673 14177 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_04980 17010 15670 gene locus_tag LOCUS_04990 17010 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 17458 17072 gene locus_tag LOCUS_05000 17458 17072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 17946 17560 gene locus_tag LOCUS_05010 17946 17560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 19106 17946 gene locus_tag LOCUS_05020 19106 17946 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_05020 20185 19133 gene locus_tag LOCUS_05030 20185 19133 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871070.1 protein_id gnl|my_center|LOCUS_05030 20302 20228 gene locus_tag LOCUS_t00030 20302 20228 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 22156 20462 gene locus_tag LOCUS_05040 gene recJ 22156 20462 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_05040 23556 22852 gene locus_tag LOCUS_05050 23556 22852 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_05050 23815 23743 gene locus_tag LOCUS_t00040 23815 23743 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 24957 23878 gene locus_tag LOCUS_05060 24957 23878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 25914 24970 gene locus_tag LOCUS_05070 25914 24970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 27019 25925 gene locus_tag LOCUS_05080 gene pgsW 27019 25925 CDS product poly-gamma-glutamate system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118209.1 protein_id gnl|my_center|LOCUS_05080 27503 27054 gene locus_tag LOCUS_05090 gene pgsC 27503 27054 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_05090 28675 27506 gene locus_tag LOCUS_05100 gene pgsB 28675 27506 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118210.1 protein_id gnl|my_center|LOCUS_05100 29916 28891 gene locus_tag LOCUS_05110 29916 28891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 30888 30004 gene locus_tag LOCUS_05120 gene folD 30888 30004 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_05120 31834 30905 gene locus_tag LOCUS_05130 31834 30905 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124976.1 protein_id gnl|my_center|LOCUS_05130 32904 31810 gene locus_tag LOCUS_05140 32904 31810 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807839.1 protein_id gnl|my_center|LOCUS_05140 34004 32919 gene locus_tag LOCUS_05150 34004 32919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 34921 34001 gene locus_tag LOCUS_05160 34921 34001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 35146 34928 gene locus_tag LOCUS_05170 35146 34928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 37146 35164 gene locus_tag LOCUS_05180 37146 35164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 37633 37178 gene locus_tag LOCUS_05190 37633 37178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 38923 37703 gene locus_tag LOCUS_05200 gene rodA 38923 37703 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141486.1 protein_id gnl|my_center|LOCUS_05200 40763 38925 gene locus_tag LOCUS_05210 gene mrdA 40763 38925 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_05210 41301 40771 gene locus_tag LOCUS_05220 41301 40771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 42061 41282 gene locus_tag LOCUS_05230 42061 41282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 43104 42079 gene locus_tag LOCUS_05240 43104 42079 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_05240 44713 43127 gene locus_tag LOCUS_05250 gene purH 44713 43127 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207145.1 protein_id gnl|my_center|LOCUS_05250 45308 44703 gene locus_tag LOCUS_05260 gene purN 45308 44703 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932011.1 protein_id gnl|my_center|LOCUS_05260 >Feature sequence012 1759 566 gene locus_tag LOCUS_05270 1759 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2693 1794 gene locus_tag LOCUS_05280 2693 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 3579 2854 gene locus_tag LOCUS_05290 3579 2854 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 protein_id gnl|my_center|LOCUS_05290 4562 3582 gene locus_tag LOCUS_05300 gene trpS 4562 3582 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257293.1 protein_id gnl|my_center|LOCUS_05300 5922 4576 gene locus_tag LOCUS_05310 gene der 5922 4576 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_05310 6056 5983 gene locus_tag LOCUS_t00050 6056 5983 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7469 6114 gene locus_tag LOCUS_05320 7469 6114 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108247.1 protein_id gnl|my_center|LOCUS_05320 7659 8093 gene locus_tag LOCUS_05330 gene rnhA 7659 8093 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770770.1 protein_id gnl|my_center|LOCUS_05330 8237 8563 gene locus_tag LOCUS_05340 gene trxA 8237 8563 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_05340 8765 9145 gene locus_tag LOCUS_05350 8765 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 10831 9314 gene locus_tag LOCUS_05360 10831 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 11415 11621 gene locus_tag LOCUS_05370 11415 11621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 11735 12646 gene locus_tag LOCUS_05380 11735 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 13335 12916 gene locus_tag LOCUS_05390 13335 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 13535 15991 gene locus_tag LOCUS_05400 13535 15991 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403423.1 protein_id gnl|my_center|LOCUS_05400 16008 16892 gene locus_tag LOCUS_05410 16008 16892 CDS product lauroyl/myristoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027687.1 protein_id gnl|my_center|LOCUS_05410 17006 18085 gene locus_tag LOCUS_05420 gene prfA 17006 18085 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_05420 18078 19028 gene locus_tag LOCUS_05430 18078 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 19054 19692 gene locus_tag LOCUS_05440 19054 19692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 19689 21242 gene locus_tag LOCUS_05450 19689 21242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 21244 22353 gene locus_tag LOCUS_05460 21244 22353 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815885.1 protein_id gnl|my_center|LOCUS_05460 22359 23144 gene locus_tag LOCUS_05470 22359 23144 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_05470 24503 23700 gene locus_tag LOCUS_05480 24503 23700 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_05480 26988 24697 gene locus_tag LOCUS_05490 26988 24697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 27625 26975 gene locus_tag LOCUS_05500 27625 26975 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_05500 28896 27640 gene locus_tag LOCUS_05510 28896 27640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_05510 29389 29760 gene locus_tag LOCUS_05520 29389 29760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05520 29839 31119 gene locus_tag LOCUS_05530 29839 31119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05530 31227 32093 gene locus_tag LOCUS_05540 31227 32093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 32093 33481 gene locus_tag LOCUS_05550 32093 33481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 34971 34753 gene locus_tag LOCUS_05560 34971 34753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 34957 36207 gene locus_tag LOCUS_05570 34957 36207 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937982.1 protein_id gnl|my_center|LOCUS_05570 36511 36891 gene locus_tag LOCUS_05580 36511 36891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 36888 37496 gene locus_tag LOCUS_05590 gene cysC 36888 37496 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 protein_id gnl|my_center|LOCUS_05590 37499 38155 gene locus_tag LOCUS_05600 37499 38155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 38218 39870 gene locus_tag LOCUS_05610 38218 39870 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_05610 39903 40475 gene locus_tag LOCUS_05620 39903 40475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 40468 41016 gene locus_tag LOCUS_05630 40468 41016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 41044 43077 gene locus_tag LOCUS_05640 41044 43077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 43182 43670 gene locus_tag LOCUS_05650 43182 43670 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545664.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence013 <1 712 gene locus_tag LOCUS_05660 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003421130.1:type I methionyl aminopeptidase 732 950 gene locus_tag LOCUS_05670 gene infA 732 950 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_05670 1121 1489 gene locus_tag LOCUS_05680 gene rpsM 1121 1489 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583368.1 protein_id gnl|my_center|LOCUS_05680 1600 1989 gene locus_tag LOCUS_05690 gene rpsK 1600 1989 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966387.1 protein_id gnl|my_center|LOCUS_05690 2045 2674 gene locus_tag LOCUS_05700 gene rpsD 2045 2674 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_05700 2709 3725 gene locus_tag LOCUS_05710 2709 3725 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061621.1 protein_id gnl|my_center|LOCUS_05710 3754 4419 gene locus_tag LOCUS_05720 gene rplQ 3754 4419 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418346.1 protein_id gnl|my_center|LOCUS_05720 4508 6163 gene locus_tag LOCUS_05730 gene hutU 4508 6163 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 protein_id gnl|my_center|LOCUS_05730 6160 6585 gene locus_tag LOCUS_05740 6160 6585 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_05740 6588 7397 gene locus_tag LOCUS_05750 6588 7397 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_05750 7644 8123 gene locus_tag LOCUS_05760 7644 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 8392 10332 gene locus_tag LOCUS_05770 8392 10332 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707195.1 protein_id gnl|my_center|LOCUS_05770 10350 11480 gene locus_tag LOCUS_05780 10350 11480 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818730.1 protein_id gnl|my_center|LOCUS_05780 11661 13202 gene locus_tag LOCUS_05790 11661 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 13352 14365 gene locus_tag LOCUS_05800 13352 14365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583524.1 protein_id gnl|my_center|LOCUS_05800 14358 15368 gene locus_tag LOCUS_05810 14358 15368 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_05810 15626 36715 gene locus_tag LOCUS_05820 15626 36715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 36800 40045 gene locus_tag LOCUS_05830 36800 40045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence014 1852 1523 gene locus_tag LOCUS_05840 1852 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3131 1893 gene locus_tag LOCUS_05850 3131 1893 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_05850 4760 3321 gene locus_tag LOCUS_05860 gene atoC 4760 3321 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_05860 6412 4757 gene locus_tag LOCUS_05870 6412 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 7269 6451 gene locus_tag LOCUS_05880 7269 6451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_05880 7373 7446 gene locus_tag LOCUS_t00060 7373 7446 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7461 7535 gene locus_tag LOCUS_t00070 7461 7535 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9724 7601 gene locus_tag LOCUS_05890 9724 7601 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990677.1 protein_id gnl|my_center|LOCUS_05890 10205 14125 gene locus_tag LOCUS_05900 10205 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 14318 16486 gene locus_tag LOCUS_05910 14318 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 16580 19429 gene locus_tag LOCUS_05920 16580 19429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 21246 19882 gene locus_tag LOCUS_05930 gene dinB 21246 19882 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 protein_id gnl|my_center|LOCUS_05930 21507 21250 gene locus_tag LOCUS_05940 21507 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 23057 21693 gene locus_tag LOCUS_05950 23057 21693 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203446.1 protein_id gnl|my_center|LOCUS_05950 23250 24668 gene locus_tag LOCUS_05960 gene lysA 23250 24668 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880764.1 protein_id gnl|my_center|LOCUS_05960 24895 27885 gene locus_tag LOCUS_05970 24895 27885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 28436 28005 gene locus_tag LOCUS_05980 28436 28005 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971070.1 protein_id gnl|my_center|LOCUS_05980 28923 28480 gene locus_tag LOCUS_05990 28923 28480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 29332 29937 gene locus_tag LOCUS_06000 29332 29937 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_06000 31259 30012 gene locus_tag LOCUS_06010 31259 30012 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938271.1 protein_id gnl|my_center|LOCUS_06010 34696 31577 gene locus_tag LOCUS_06020 34696 31577 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_06020 35985 35023 gene locus_tag LOCUS_06030 35985 35023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 38113 36431 gene locus_tag LOCUS_06040 38113 36431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 40272 39103 gene locus_tag LOCUS_06050 40272 39103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 41509 40277 gene locus_tag LOCUS_06060 41509 40277 CDS product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196835716.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence015 39 1772 gene locus_tag LOCUS_06070 39 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 1796 3526 gene locus_tag LOCUS_06080 1796 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4740 5051 gene locus_tag LOCUS_06090 4740 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 5051 5305 gene locus_tag LOCUS_06100 5051 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 5318 6031 gene locus_tag LOCUS_06110 5318 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 6152 7207 gene locus_tag LOCUS_06120 6152 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 7389 7751 gene locus_tag LOCUS_06130 7389 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 8058 10238 gene locus_tag LOCUS_06140 8058 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 10247 11776 gene locus_tag LOCUS_06150 gene accC 10247 11776 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_06150 11839 13659 gene locus_tag LOCUS_06160 11839 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 13909 15456 gene locus_tag LOCUS_06170 13909 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875631.1 protein_id gnl|my_center|LOCUS_06170 15594 17537 gene locus_tag LOCUS_06180 15594 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 17534 19303 gene locus_tag LOCUS_06190 17534 19303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 19997 19623 gene locus_tag LOCUS_06200 19997 19623 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545665.1 protein_id gnl|my_center|LOCUS_06200 21458 20616 gene locus_tag LOCUS_06210 21458 20616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 22312 21455 gene locus_tag LOCUS_06220 22312 21455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 25295 22323 gene locus_tag LOCUS_06230 25295 22323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 26136 25447 gene locus_tag LOCUS_06240 26136 25447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 26620 26532 gene locus_tag LOCUS_t00080 26620 26532 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26769 27143 gene locus_tag LOCUS_06250 26769 27143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 27170 27254 gene locus_tag LOCUS_t00090 27170 27254 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27359 28102 gene locus_tag LOCUS_06260 27359 28102 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065332.1 protein_id gnl|my_center|LOCUS_06260 28099 28779 gene locus_tag LOCUS_06270 28099 28779 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897325.1 protein_id gnl|my_center|LOCUS_06270 28996 31428 gene locus_tag LOCUS_06280 28996 31428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 31691 33919 gene locus_tag LOCUS_06290 31691 33919 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990677.1 protein_id gnl|my_center|LOCUS_06290 34325 33960 gene locus_tag LOCUS_06300 34325 33960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 35161 34427 gene locus_tag LOCUS_06310 35161 34427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 35364 36278 gene locus_tag LOCUS_06320 gene cysK 35364 36278 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_06320 38004 36547 gene locus_tag LOCUS_06330 38004 36547 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583645.1 protein_id gnl|my_center|LOCUS_06330 38449 39348 gene locus_tag LOCUS_06340 38449 39348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 39699 40445 gene locus_tag LOCUS_06350 39699 40445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence016 3417 2710 gene locus_tag LOCUS_06360 3417 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 4668 3427 gene locus_tag LOCUS_06370 4668 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 5106 6653 gene locus_tag LOCUS_06380 gene pruA 5106 6653 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 protein_id gnl|my_center|LOCUS_06380 6763 8913 gene locus_tag LOCUS_06390 6763 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 8999 9262 gene locus_tag LOCUS_06400 8999 9262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 9267 9497 gene locus_tag LOCUS_06410 9267 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 9571 10776 gene locus_tag LOCUS_06420 9571 10776 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249503.1 protein_id gnl|my_center|LOCUS_06420 10844 15718 gene locus_tag LOCUS_06430 10844 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 15820 17481 gene locus_tag LOCUS_06440 15820 17481 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957831.1 protein_id gnl|my_center|LOCUS_06440 17547 18695 gene locus_tag LOCUS_06450 17547 18695 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_06450 18834 19463 gene locus_tag LOCUS_06460 gene clpP 18834 19463 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_06460 19460 20752 gene locus_tag LOCUS_06470 gene clpX 19460 20752 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_06470 20756 21145 gene locus_tag LOCUS_06480 20756 21145 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451642.1 protein_id gnl|my_center|LOCUS_06480 21314 30706 gene locus_tag LOCUS_06490 21314 30706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 31081 34296 gene locus_tag LOCUS_06500 31081 34296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 34485 36296 gene locus_tag LOCUS_06510 34485 36296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 36599 36841 gene locus_tag LOCUS_06520 36599 36841 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_06520 36822 37181 gene locus_tag LOCUS_06530 gene mazF 36822 37181 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_06530 37271 40018 gene locus_tag LOCUS_06540 37271 40018 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence017 778 194 gene locus_tag LOCUS_06550 778 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 2250 841 gene locus_tag LOCUS_06560 2250 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 3691 2387 gene locus_tag LOCUS_06570 3691 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 5409 3751 gene locus_tag LOCUS_06580 5409 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5624 6028 gene locus_tag LOCUS_06590 gene mce 5624 6028 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_06590 6146 7330 gene locus_tag LOCUS_06600 gene megL 6146 7330 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_06600 7345 7833 gene locus_tag LOCUS_06610 7345 7833 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259432.1 protein_id gnl|my_center|LOCUS_06610 8059 9927 gene locus_tag LOCUS_06620 gene uvrC 8059 9927 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933467.1 protein_id gnl|my_center|LOCUS_06620 9928 11310 gene locus_tag LOCUS_06630 9928 11310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 11533 11961 gene locus_tag LOCUS_06640 11533 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 12167 12655 gene locus_tag LOCUS_06650 12167 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 13012 16053 gene locus_tag LOCUS_06660 13012 16053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 16329 17807 gene locus_tag LOCUS_06670 16329 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 17650 17738 gene locus_tag LOCUS_t00100 17650 17738 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 18209 21340 gene locus_tag LOCUS_06680 18209 21340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 21975 25106 gene locus_tag LOCUS_06690 21975 25106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 25228 27372 gene locus_tag LOCUS_06700 25228 27372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 27568 29712 gene locus_tag LOCUS_06710 27568 29712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 30163 30645 gene locus_tag LOCUS_06720 30163 30645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 30685 31611 gene locus_tag LOCUS_06730 gene rsmH 30685 31611 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_06730 31604 31999 gene locus_tag LOCUS_06740 31604 31999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 32121 34106 gene locus_tag LOCUS_06750 32121 34106 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_06750 34111 35643 gene locus_tag LOCUS_06760 34111 35643 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_06760 35643 36773 gene locus_tag LOCUS_06770 gene mraY 35643 36773 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545877.1 protein_id gnl|my_center|LOCUS_06770 36773 38140 gene locus_tag LOCUS_06780 gene murD 36773 38140 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863046.1 protein_id gnl|my_center|LOCUS_06780 38133 39302 gene locus_tag LOCUS_06790 gene spoVE 38133 39302 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence018 <1 1403 gene locus_tag LOCUS_06800 <1 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840167.1:T9SS type A sorting domain-containing protein 5196 1762 gene locus_tag LOCUS_06810 5196 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 6759 5206 gene locus_tag LOCUS_06820 6759 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 8392 6803 gene locus_tag LOCUS_06830 8392 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 9985 8435 gene locus_tag LOCUS_06840 9985 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 11423 10320 gene locus_tag LOCUS_06850 11423 10320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06850 11862 11401 gene locus_tag LOCUS_06860 11862 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 12934 11960 gene locus_tag LOCUS_06870 12934 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 13461 13132 gene locus_tag LOCUS_06880 13461 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 18821 13740 gene locus_tag LOCUS_06890 18821 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 19684 19109 gene locus_tag LOCUS_06900 19684 19109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 21458 19809 gene locus_tag LOCUS_06910 gene groL 21458 19809 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932217.1 protein_id gnl|my_center|LOCUS_06910 21845 21546 gene locus_tag LOCUS_06920 gene groES 21845 21546 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_06920 22961 22077 gene locus_tag LOCUS_06930 22961 22077 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_06930 23211 23723 gene locus_tag LOCUS_06940 23211 23723 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423733.1 protein_id gnl|my_center|LOCUS_06940 23762 24247 gene locus_tag LOCUS_06950 23762 24247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 24244 25401 gene locus_tag LOCUS_06960 gene orr 24244 25401 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_06960 25609 27039 gene locus_tag LOCUS_06970 25609 27039 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_06970 27023 28504 gene locus_tag LOCUS_06980 27023 28504 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228893.1 protein_id gnl|my_center|LOCUS_06980 28509 29474 gene locus_tag LOCUS_06990 28509 29474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 29525 29986 gene locus_tag LOCUS_07000 gene ssb 29525 29986 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927163.1 protein_id gnl|my_center|LOCUS_07000 30055 30873 gene locus_tag LOCUS_07010 30055 30873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07010 30870 31202 gene locus_tag LOCUS_07020 30870 31202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07020 31162 32397 gene locus_tag LOCUS_07030 gene alr 31162 32397 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982425.1 protein_id gnl|my_center|LOCUS_07030 32582 33445 gene locus_tag LOCUS_07040 gene argB 32582 33445 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_07040 33438 34625 gene locus_tag LOCUS_07050 33438 34625 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_07050 34618 35688 gene locus_tag LOCUS_07060 gene argC 34618 35688 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965686.1 protein_id gnl|my_center|LOCUS_07060 35722 36927 gene locus_tag LOCUS_07070 gene argJ 35722 36927 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_07070 37605 37817 gene locus_tag LOCUS_07080 37605 37817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 37847 38086 gene locus_tag LOCUS_07090 37847 38086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 38247 38966 gene locus_tag LOCUS_07100 38247 38966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence019 2202 388 gene locus_tag LOCUS_07110 2202 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2585 2361 gene locus_tag LOCUS_07120 2585 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2938 2588 gene locus_tag LOCUS_07130 2938 2588 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_07130 3608 3084 gene locus_tag LOCUS_07140 3608 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 5863 4235 gene locus_tag LOCUS_07150 gene amrB 5863 4235 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_07150 7107 5860 gene locus_tag LOCUS_07160 gene amrS 7107 5860 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_07160 7362 7868 gene locus_tag LOCUS_07170 gene coaD 7362 7868 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_07170 7958 10042 gene locus_tag LOCUS_07180 gene pta 7958 10042 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_07180 10064 10378 gene locus_tag LOCUS_07190 10064 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 10456 10659 gene locus_tag LOCUS_07200 10456 10659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 10681 11019 gene locus_tag LOCUS_07210 10681 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 12295 11138 gene locus_tag LOCUS_07220 12295 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 13348 12329 gene locus_tag LOCUS_07230 13348 12329 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_07230 14444 13329 gene locus_tag LOCUS_07240 14444 13329 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_07240 15341 14502 gene locus_tag LOCUS_07250 15341 14502 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837305.1 protein_id gnl|my_center|LOCUS_07250 16831 15350 gene locus_tag LOCUS_07260 16831 15350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 18026 16839 gene locus_tag LOCUS_07270 18026 16839 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_07270 19777 18062 gene locus_tag LOCUS_07280 19777 18062 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_07280 19991 21238 gene locus_tag LOCUS_07290 gene hacA 19991 21238 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_07290 21352 22491 gene locus_tag LOCUS_07300 21352 22491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 22803 23813 gene locus_tag LOCUS_07310 22803 23813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 23815 24087 gene locus_tag LOCUS_07320 23815 24087 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_07320 24135 24839 gene locus_tag LOCUS_07330 24135 24839 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_07330 24836 25246 gene locus_tag LOCUS_07340 24836 25246 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881317.1 protein_id gnl|my_center|LOCUS_07340 25246 25998 gene locus_tag LOCUS_07350 25246 25998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 26026 26820 gene locus_tag LOCUS_07360 26026 26820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 26888 27691 gene locus_tag LOCUS_07370 26888 27691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 27769 28428 gene locus_tag LOCUS_07380 27769 28428 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268041.1 protein_id gnl|my_center|LOCUS_07380 29773 29177 gene locus_tag LOCUS_07390 29773 29177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 30906 29770 gene locus_tag LOCUS_07400 30906 29770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 32101 31340 gene locus_tag LOCUS_07410 32101 31340 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020468.1 protein_id gnl|my_center|LOCUS_07410 32593 33000 gene locus_tag LOCUS_07420 32593 33000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 33525 34079 gene locus_tag LOCUS_07430 33525 34079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 35070 34171 gene locus_tag LOCUS_07440 35070 34171 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250986.1 protein_id gnl|my_center|LOCUS_07440 35278 36465 gene locus_tag LOCUS_07450 35278 36465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 <37616 36594 gene locus_tag LOCUS_07460 <37616 36594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232971.1:beta-ketoacyl-ACP synthase III >Feature sequence020 <1 692 gene locus_tag LOCUS_07470 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000099773.1:ribonuclease Y 734 2272 gene locus_tag LOCUS_07480 734 2272 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016558.1 protein_id gnl|my_center|LOCUS_07480 2362 3093 gene locus_tag LOCUS_07490 2362 3093 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256367.1 protein_id gnl|my_center|LOCUS_07490 3095 4096 gene locus_tag LOCUS_07500 gene holA 3095 4096 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583467.1 protein_id gnl|my_center|LOCUS_07500 4097 4690 gene locus_tag LOCUS_07510 4097 4690 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_07510 4739 5254 gene locus_tag LOCUS_07520 4739 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 5514 5693 gene locus_tag LOCUS_07530 5514 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 5694 6293 gene locus_tag LOCUS_07540 5694 6293 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_07540 6324 7475 gene locus_tag LOCUS_07550 gene nifS 6324 7475 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_07550 7565 8656 gene locus_tag LOCUS_07560 gene mnmA 7565 8656 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933514.1 protein_id gnl|my_center|LOCUS_07560 8672 9481 gene locus_tag LOCUS_07570 gene panB 8672 9481 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_07570 9693 13850 gene locus_tag LOCUS_07580 9693 13850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 13947 14453 gene locus_tag LOCUS_07590 13947 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 15555 14554 gene locus_tag LOCUS_07600 15555 14554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 15850 17466 gene locus_tag LOCUS_07610 15850 17466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875631.1 protein_id gnl|my_center|LOCUS_07610 17463 18071 gene locus_tag LOCUS_07620 17463 18071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 18064 18876 gene locus_tag LOCUS_07630 18064 18876 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902575.1 protein_id gnl|my_center|LOCUS_07630 18881 19558 gene locus_tag LOCUS_07640 18881 19558 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_07640 19574 20635 gene locus_tag LOCUS_07650 gene lpxK 19574 20635 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_07650 20812 21732 gene locus_tag LOCUS_07660 20812 21732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 22345 22091 gene locus_tag LOCUS_07670 22345 22091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 22235 23707 gene locus_tag LOCUS_07680 22235 23707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 23721 25835 gene locus_tag LOCUS_07690 23721 25835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 26512 27741 gene locus_tag LOCUS_07700 26512 27741 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_07700 28181 30631 gene locus_tag LOCUS_07710 28181 30631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence021 1053 883 gene locus_tag LOCUS_07720 1053 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 1417 1740 gene locus_tag LOCUS_07730 1417 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 1740 2594 gene locus_tag LOCUS_07740 1740 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 2758 3732 gene locus_tag LOCUS_07750 2758 3732 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_07750 3767 6112 gene locus_tag LOCUS_07760 3767 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 6117 6572 gene locus_tag LOCUS_07770 6117 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 6562 7851 gene locus_tag LOCUS_07780 6562 7851 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_07780 7844 8389 gene locus_tag LOCUS_07790 7844 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 8382 10838 gene locus_tag LOCUS_07800 8382 10838 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_07800 10966 12519 gene locus_tag LOCUS_07810 10966 12519 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933910.1 protein_id gnl|my_center|LOCUS_07810 12601 12915 gene locus_tag LOCUS_07820 gene rplU 12601 12915 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957542.1 protein_id gnl|my_center|LOCUS_07820 12919 13170 gene locus_tag LOCUS_07830 gene rpmA 12919 13170 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943850.1 protein_id gnl|my_center|LOCUS_07830 13174 13389 gene locus_tag LOCUS_07840 13174 13389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 13441 13668 gene locus_tag LOCUS_07850 13441 13668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 13870 14076 gene locus_tag LOCUS_07860 13870 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 14073 14333 gene locus_tag LOCUS_07870 14073 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 14404 15345 gene locus_tag LOCUS_07880 gene mdh 14404 15345 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942112.1 protein_id gnl|my_center|LOCUS_07880 15445 15909 gene locus_tag LOCUS_07890 15445 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 15942 16469 gene locus_tag LOCUS_07900 15942 16469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 16472 17296 gene locus_tag LOCUS_07910 16472 17296 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021957.1 protein_id gnl|my_center|LOCUS_07910 17897 17301 gene locus_tag LOCUS_07920 17897 17301 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_07920 18735 17887 gene locus_tag LOCUS_07930 18735 17887 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876722.1 protein_id gnl|my_center|LOCUS_07930 19495 18737 gene locus_tag LOCUS_07940 19495 18737 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958567.1 protein_id gnl|my_center|LOCUS_07940 20812 19496 gene locus_tag LOCUS_07950 20812 19496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 22554 20893 gene locus_tag LOCUS_07960 22554 20893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 23473 22799 gene locus_tag LOCUS_07970 23473 22799 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_07970 24690 23479 gene locus_tag LOCUS_07980 24690 23479 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545188.1 protein_id gnl|my_center|LOCUS_07980 27571 24692 gene locus_tag LOCUS_07990 27571 24692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 27792 28610 gene locus_tag LOCUS_08000 27792 28610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 30483 28708 gene locus_tag LOCUS_08010 gene aspS 30483 28708 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_08010 31599 30565 gene locus_tag LOCUS_08020 31599 30565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 32094 31609 gene locus_tag LOCUS_08030 32094 31609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 32796 32173 gene locus_tag LOCUS_08040 32796 32173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 33390 32797 gene locus_tag LOCUS_08050 33390 32797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 33858 33553 gene locus_tag LOCUS_08060 33858 33553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 34676 33867 gene locus_tag LOCUS_08070 34676 33867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 <35795 34669 gene locus_tag LOCUS_08080 <35795 34669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein >Feature sequence022 321 4019 gene locus_tag LOCUS_08090 321 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 4104 5138 gene locus_tag LOCUS_08100 4104 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 5481 6794 gene locus_tag LOCUS_08110 5481 6794 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_08110 6816 7775 gene locus_tag LOCUS_08120 gene arcC 6816 7775 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393607.1 protein_id gnl|my_center|LOCUS_08120 7811 8971 gene locus_tag LOCUS_08130 gene sucC 7811 8971 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_08130 9006 9878 gene locus_tag LOCUS_08140 gene sucD 9006 9878 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403441.1 protein_id gnl|my_center|LOCUS_08140 9982 10326 gene locus_tag LOCUS_08150 9982 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 10319 11470 gene locus_tag LOCUS_08160 10319 11470 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 protein_id gnl|my_center|LOCUS_08160 11470 12291 gene locus_tag LOCUS_08170 11470 12291 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_08170 12308 12862 gene locus_tag LOCUS_08180 12308 12862 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388051.1 protein_id gnl|my_center|LOCUS_08180 12881 13303 gene locus_tag LOCUS_08190 gene ndk 12881 13303 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883257.1 protein_id gnl|my_center|LOCUS_08190 13314 14273 gene locus_tag LOCUS_08200 13314 14273 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390868.1 protein_id gnl|my_center|LOCUS_08200 14489 15592 gene locus_tag LOCUS_08210 14489 15592 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_08210 15602 19027 gene locus_tag LOCUS_08220 15602 19027 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_08220 19102 22242 gene locus_tag LOCUS_08230 19102 22242 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861545.1 protein_id gnl|my_center|LOCUS_08230 22284 22358 gene locus_tag LOCUS_t00110 22284 22358 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22425 24887 gene locus_tag LOCUS_08240 gene leuS 22425 24887 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948005.1 protein_id gnl|my_center|LOCUS_08240 24949 26364 gene locus_tag LOCUS_08250 gene glnA 24949 26364 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_08250 26413 29151 gene locus_tag LOCUS_08260 26413 29151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 29722 29219 gene locus_tag LOCUS_08270 29722 29219 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_08270 30360 29719 gene locus_tag LOCUS_08280 30360 29719 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_08280 30997 30362 gene locus_tag LOCUS_08290 30997 30362 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 protein_id gnl|my_center|LOCUS_08290 32322 31054 gene locus_tag LOCUS_08300 32322 31054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 32828 32328 gene locus_tag LOCUS_08310 32828 32328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 33856 32828 gene locus_tag LOCUS_08320 33856 32828 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938008.1 protein_id gnl|my_center|LOCUS_08320 34679 33882 gene locus_tag LOCUS_08330 34679 33882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence023 18153 18239 gene locus_tag LOCUS_t00120 18153 18239 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18893 18276 gene locus_tag LOCUS_08340 18893 18276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 21516 18946 gene locus_tag LOCUS_08350 21516 18946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 22672 21554 gene locus_tag LOCUS_08360 gene alr 22672 21554 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_08360 24228 22687 gene locus_tag LOCUS_08370 24228 22687 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927177.1 protein_id gnl|my_center|LOCUS_08370 24989 24309 gene locus_tag LOCUS_08380 24989 24309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 25801 25121 gene locus_tag LOCUS_08390 25801 25121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 26573 25902 gene locus_tag LOCUS_08400 26573 25902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 27286 26693 gene locus_tag LOCUS_08410 27286 26693 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_08410 28145 27297 gene locus_tag LOCUS_08420 28145 27297 CDS product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_08420 28987 28169 gene locus_tag LOCUS_08430 28987 28169 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404263.1 protein_id gnl|my_center|LOCUS_08430 29562 28972 gene locus_tag LOCUS_08440 29562 28972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 32820 29575 gene locus_tag LOCUS_08450 32820 29575 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839665.1 protein_id gnl|my_center|LOCUS_08450 33931 32924 gene locus_tag LOCUS_08460 33931 32924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence024 412 627 gene locus_tag LOCUS_08470 412 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 624 878 gene locus_tag LOCUS_08480 624 878 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249916.1 protein_id gnl|my_center|LOCUS_08480 1103 1378 gene locus_tag LOCUS_08490 1103 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1371 1604 gene locus_tag LOCUS_08500 1371 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1625 1786 gene locus_tag LOCUS_08510 1625 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1783 1998 gene locus_tag LOCUS_08520 1783 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2056 2739 gene locus_tag LOCUS_08530 2056 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 2864 3469 gene locus_tag LOCUS_08540 2864 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 3462 4025 gene locus_tag LOCUS_08550 3462 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4033 4569 gene locus_tag LOCUS_08560 4033 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 4687 6297 gene locus_tag LOCUS_08570 4687 6297 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_08570 6301 6498 gene locus_tag LOCUS_08580 6301 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 6495 6734 gene locus_tag LOCUS_08590 6495 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 6804 7103 gene locus_tag LOCUS_08600 6804 7103 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517660.1 protein_id gnl|my_center|LOCUS_08600 7122 7430 gene locus_tag LOCUS_08610 7122 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 7526 7768 gene locus_tag LOCUS_08620 7526 7768 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_08620 7900 9030 gene locus_tag LOCUS_08630 7900 9030 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_08630 9135 9530 gene locus_tag LOCUS_08640 9135 9530 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_08640 9532 11115 gene locus_tag LOCUS_08650 9532 11115 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_08650 11096 11371 gene locus_tag LOCUS_08660 11096 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 11433 13010 gene locus_tag LOCUS_08670 11433 13010 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545223.1 protein_id gnl|my_center|LOCUS_08670 13010 13816 gene locus_tag LOCUS_08680 13010 13816 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546419.1 protein_id gnl|my_center|LOCUS_08680 13941 14189 gene locus_tag LOCUS_08690 13941 14189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 14190 14396 gene locus_tag LOCUS_08700 14190 14396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 14455 16485 gene locus_tag LOCUS_08710 14455 16485 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_08710 16605 16922 gene locus_tag LOCUS_08720 16605 16922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 17051 17257 gene locus_tag LOCUS_08730 17051 17257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 17368 17796 gene locus_tag LOCUS_08740 gene mce 17368 17796 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879707.1 protein_id gnl|my_center|LOCUS_08740 17860 18093 gene locus_tag LOCUS_08750 17860 18093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 18139 18735 gene locus_tag LOCUS_08760 18139 18735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 18821 19039 gene locus_tag LOCUS_08770 18821 19039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 19036 19494 gene locus_tag LOCUS_08780 19036 19494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 19491 19697 gene locus_tag LOCUS_08790 19491 19697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 19697 20902 gene locus_tag LOCUS_08800 19697 20902 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_08800 20960 24361 gene locus_tag LOCUS_08810 20960 24361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 24363 24944 gene locus_tag LOCUS_08820 24363 24944 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021058.1 protein_id gnl|my_center|LOCUS_08820 25021 25302 gene locus_tag LOCUS_08830 25021 25302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 25978 26457 gene locus_tag LOCUS_08840 25978 26457 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_08840 26543 28837 gene locus_tag LOCUS_08850 26543 28837 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_08850 29031 29900 gene locus_tag LOCUS_08860 29031 29900 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_08860 29935 30963 gene locus_tag LOCUS_08870 gene hisC 29935 30963 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_08870 31160 32413 gene locus_tag LOCUS_08880 31160 32413 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence025 <1 1573 gene locus_tag LOCUS_08890 <1 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405023.1:S8 family serine peptidase 6072 1876 gene locus_tag LOCUS_08900 6072 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 6293 6366 gene locus_tag LOCUS_t00130 6293 6366 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 10386 6793 gene locus_tag LOCUS_08910 10386 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 11321 10578 gene locus_tag LOCUS_08920 11321 10578 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945512.1 protein_id gnl|my_center|LOCUS_08920 12321 11431 gene locus_tag LOCUS_08930 12321 11431 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_08930 12444 13826 gene locus_tag LOCUS_08940 12444 13826 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930764.1 protein_id gnl|my_center|LOCUS_08940 13967 18055 gene locus_tag LOCUS_08950 13967 18055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 18074 18970 gene locus_tag LOCUS_08960 18074 18970 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_08960 18997 21000 gene locus_tag LOCUS_08970 gene uvrB 18997 21000 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722621.1 protein_id gnl|my_center|LOCUS_08970 20997 22340 gene locus_tag LOCUS_08980 gene purD 20997 22340 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242993.1 protein_id gnl|my_center|LOCUS_08980 22340 23257 gene locus_tag LOCUS_08990 22340 23257 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_08990 23410 24546 gene locus_tag LOCUS_09000 23410 24546 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933163.1 protein_id gnl|my_center|LOCUS_09000 24780 25265 gene locus_tag LOCUS_09010 24780 25265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 25265 26386 gene locus_tag LOCUS_09020 25265 26386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 26376 27407 gene locus_tag LOCUS_09030 26376 27407 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735619.1 protein_id gnl|my_center|LOCUS_09030 27400 28458 gene locus_tag LOCUS_09040 27400 28458 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_09040 28595 30673 gene locus_tag LOCUS_09050 gene secD 28595 30673 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839265.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence026 1750 2046 gene locus_tag LOCUS_09060 1750 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 2037 2522 gene locus_tag LOCUS_09070 2037 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 2612 3142 gene locus_tag LOCUS_09080 2612 3142 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_09080 3198 4331 gene locus_tag LOCUS_09090 3198 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 4371 4592 gene locus_tag LOCUS_09100 4371 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 4638 4964 gene locus_tag LOCUS_09110 4638 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 4957 5364 gene locus_tag LOCUS_09120 4957 5364 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903015.1 protein_id gnl|my_center|LOCUS_09120 5469 6617 gene locus_tag LOCUS_09130 5469 6617 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990075.1 protein_id gnl|my_center|LOCUS_09130 6649 6894 gene locus_tag LOCUS_09140 6649 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 6881 7222 gene locus_tag LOCUS_09150 6881 7222 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_09150 7257 9020 gene locus_tag LOCUS_09160 7257 9020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 9232 9984 gene locus_tag LOCUS_09170 9232 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 10558 12090 gene locus_tag LOCUS_09180 10558 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 12090 13175 gene locus_tag LOCUS_09190 gene nuoH 12090 13175 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_09190 13228 14391 gene locus_tag LOCUS_09200 13228 14391 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065470411.1 protein_id gnl|my_center|LOCUS_09200 14388 14870 gene locus_tag LOCUS_09210 14388 14870 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039844900.1 protein_id gnl|my_center|LOCUS_09210 14901 15236 gene locus_tag LOCUS_09220 14901 15236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 15284 15850 gene locus_tag LOCUS_09230 15284 15850 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537600.1 protein_id gnl|my_center|LOCUS_09230 15852 16415 gene locus_tag LOCUS_09240 gene def 15852 16415 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082176.1 protein_id gnl|my_center|LOCUS_09240 16427 18112 gene locus_tag LOCUS_09250 16427 18112 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449775.1 protein_id gnl|my_center|LOCUS_09250 18206 19081 gene locus_tag LOCUS_09260 18206 19081 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096571.1 protein_id gnl|my_center|LOCUS_09260 19398 21923 gene locus_tag LOCUS_09270 gene alaS 19398 21923 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_09270 21920 22654 gene locus_tag LOCUS_09280 21920 22654 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_09280 22800 23801 gene locus_tag LOCUS_09290 22800 23801 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545786.1 protein_id gnl|my_center|LOCUS_09290 23819 24598 gene locus_tag LOCUS_09300 23819 24598 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942894.1 protein_id gnl|my_center|LOCUS_09300 24595 27213 gene locus_tag LOCUS_09310 gene mutS 24595 27213 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_09310 27350 27829 gene locus_tag LOCUS_09320 27350 27829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 27927 28604 gene locus_tag LOCUS_09330 27927 28604 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_09330 29851 28601 gene locus_tag LOCUS_09340 29851 28601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence027 3215 642 gene locus_tag LOCUS_09350 3215 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3701 7285 gene locus_tag LOCUS_09360 3701 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 7458 10154 gene locus_tag LOCUS_09370 7458 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 10168 10581 gene locus_tag LOCUS_09380 10168 10581 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_09380 10592 11266 gene locus_tag LOCUS_09390 10592 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 11392 12009 gene locus_tag LOCUS_09400 11392 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 13477 12092 gene locus_tag LOCUS_09410 13477 12092 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898767.1 protein_id gnl|my_center|LOCUS_09410 14264 13479 gene locus_tag LOCUS_09420 gene fetB 14264 13479 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937792.1 protein_id gnl|my_center|LOCUS_09420 14507 14818 gene locus_tag LOCUS_09430 14507 14818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 14820 15092 gene locus_tag LOCUS_09440 14820 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 16087 15224 gene locus_tag LOCUS_09450 16087 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 16677 16123 gene locus_tag LOCUS_09460 16677 16123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 18855 16966 gene locus_tag LOCUS_09470 18855 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 19630 18848 gene locus_tag LOCUS_09480 19630 18848 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_09480 20403 19630 gene locus_tag LOCUS_09490 20403 19630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 22068 20656 gene locus_tag LOCUS_09500 22068 20656 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878054.1 protein_id gnl|my_center|LOCUS_09500 22427 22978 gene locus_tag LOCUS_09510 22427 22978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 23010 24527 gene locus_tag LOCUS_09520 23010 24527 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546144.1 protein_id gnl|my_center|LOCUS_09520 24608 25279 gene locus_tag LOCUS_09530 24608 25279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 25276 25743 gene locus_tag LOCUS_09540 25276 25743 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937834.1 protein_id gnl|my_center|LOCUS_09540 25736 26980 gene locus_tag LOCUS_09550 25736 26980 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_09550 26977 27555 gene locus_tag LOCUS_09560 gene thpR 26977 27555 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_09560 27569 28609 gene locus_tag LOCUS_09570 gene recA 27569 28609 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_09570 28660 29127 gene locus_tag LOCUS_09580 28660 29127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 29138 30541 gene locus_tag LOCUS_09590 29138 30541 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence028 <1 1383 gene locus_tag LOCUS_09600 <1 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883567.1:cysteine--tRNA ligase 1498 1571 gene locus_tag LOCUS_t00140 1498 1571 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1597 1679 gene locus_tag LOCUS_t00150 1597 1679 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1684 1758 gene locus_tag LOCUS_t00160 1684 1758 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1792 1865 gene locus_tag LOCUS_t00170 1792 1865 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1937 3127 gene locus_tag LOCUS_09610 gene tuf 1937 3127 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_09610 3373 3447 gene locus_tag LOCUS_t00180 3373 3447 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3465 3647 gene locus_tag LOCUS_09620 3465 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3661 4236 gene locus_tag LOCUS_09630 gene nusG 3661 4236 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404507.1 protein_id gnl|my_center|LOCUS_09630 4260 4691 gene locus_tag LOCUS_09640 gene rplK 4260 4691 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_09640 4696 5397 gene locus_tag LOCUS_09650 gene rplA 4696 5397 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_09650 5436 6383 gene locus_tag LOCUS_09660 5436 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 6670 10443 gene locus_tag LOCUS_09670 gene rpoB 6670 10443 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051010823.1 protein_id gnl|my_center|LOCUS_09670 10643 15058 gene locus_tag LOCUS_09680 gene rpoC 10643 15058 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404501.1 protein_id gnl|my_center|LOCUS_09680 15183 15560 gene locus_tag LOCUS_09690 gene rpsL 15183 15560 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880443.1 protein_id gnl|my_center|LOCUS_09690 15572 16042 gene locus_tag LOCUS_09700 gene rpsG 15572 16042 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091209.1 protein_id gnl|my_center|LOCUS_09700 16301 18409 gene locus_tag LOCUS_09710 gene fusA 16301 18409 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_09710 19068 19376 gene locus_tag LOCUS_09720 gene rpsJ 19068 19376 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403794.1 protein_id gnl|my_center|LOCUS_09720 19373 19993 gene locus_tag LOCUS_09730 gene rplC 19373 19993 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_09730 20006 20698 gene locus_tag LOCUS_09740 gene rplD 20006 20698 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933841.1 protein_id gnl|my_center|LOCUS_09740 20688 20978 gene locus_tag LOCUS_09750 gene rplW 20688 20978 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_09750 20982 21806 gene locus_tag LOCUS_09760 gene rplB 20982 21806 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_09760 21851 22138 gene locus_tag LOCUS_09770 gene rpsS 21851 22138 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762037.1 protein_id gnl|my_center|LOCUS_09770 22166 22534 gene locus_tag LOCUS_09780 gene rplV 22166 22534 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387530.1 protein_id gnl|my_center|LOCUS_09780 22584 23267 gene locus_tag LOCUS_09790 gene rpsC 22584 23267 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_09790 23286 23696 gene locus_tag LOCUS_09800 gene rplP 23286 23696 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545254.1 protein_id gnl|my_center|LOCUS_09800 23706 23936 gene locus_tag LOCUS_09810 gene rpmC 23706 23936 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720942.1 protein_id gnl|my_center|LOCUS_09810 23937 24197 gene locus_tag LOCUS_09820 gene rpsQ 23937 24197 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_09820 24305 24673 gene locus_tag LOCUS_09830 gene rplN 24305 24673 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_09830 24686 25045 gene locus_tag LOCUS_09840 gene rplX 24686 25045 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_09840 25054 25752 gene locus_tag LOCUS_09850 gene rplE 25054 25752 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842801.1 protein_id gnl|my_center|LOCUS_09850 25826 26011 gene locus_tag LOCUS_09860 gene rpsN 25826 26011 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085700.1 protein_id gnl|my_center|LOCUS_09860 26029 26427 gene locus_tag LOCUS_09870 gene rpsH 26029 26427 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288675.1 protein_id gnl|my_center|LOCUS_09870 26468 27007 gene locus_tag LOCUS_09880 gene rplF 26468 27007 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776362.1 protein_id gnl|my_center|LOCUS_09880 27078 27461 gene locus_tag LOCUS_09890 gene rplR 27078 27461 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_09890 27474 28037 gene locus_tag LOCUS_09900 gene rpsE 27474 28037 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_09900 28030 28377 gene locus_tag LOCUS_09910 28030 28377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 28370 28894 gene locus_tag LOCUS_09920 gene rplO 28370 28894 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546521.1 protein_id gnl|my_center|LOCUS_09920 28939 30270 gene locus_tag LOCUS_09930 gene secY 28939 30270 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933822.1 protein_id gnl|my_center|LOCUS_09930 30308 30937 gene locus_tag LOCUS_09940 30308 30937 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence029 <1 715 gene locus_tag LOCUS_09950 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392933.1:DUF364 domain-containing protein 773 1144 gene locus_tag LOCUS_09960 773 1144 CDS product DUF5320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064827.1 protein_id gnl|my_center|LOCUS_09960 1137 1502 gene locus_tag LOCUS_09970 1137 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 6001 1616 gene locus_tag LOCUS_09980 6001 1616 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107756.1 protein_id gnl|my_center|LOCUS_09980 6918 6127 gene locus_tag LOCUS_09990 gene prfB 6918 6127 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205591.1 protein_id gnl|my_center|LOCUS_09990 7522 7208 gene locus_tag LOCUS_10000 7522 7208 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_10000 7666 7592 gene locus_tag LOCUS_t00190 7666 7592 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7811 10543 gene locus_tag LOCUS_10010 7811 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 10784 14965 gene locus_tag LOCUS_10020 10784 14965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 16061 15429 gene locus_tag LOCUS_10030 16061 15429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 16283 19498 gene locus_tag LOCUS_10040 16283 19498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 21254 19935 gene locus_tag LOCUS_10050 gene icd 21254 19935 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878150.1 protein_id gnl|my_center|LOCUS_10050 23183 22389 gene locus_tag LOCUS_10060 23183 22389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 24158 23205 gene locus_tag LOCUS_10070 24158 23205 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817156.1 protein_id gnl|my_center|LOCUS_10070 25174 24428 gene locus_tag LOCUS_10080 25174 24428 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_10080 25564 25779 gene locus_tag LOCUS_10090 25564 25779 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942550.1 protein_id gnl|my_center|LOCUS_10090 28058 26061 gene locus_tag LOCUS_10100 28058 26061 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114620.1 protein_id gnl|my_center|LOCUS_10100 29571 28051 gene locus_tag LOCUS_10110 29571 28051 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_10110 <31054 30054 gene locus_tag LOCUS_10120 <31054 30054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258815.1:pyruvate, phosphate dikinase >Feature sequence030 3 491 gene locus_tag LOCUS_10130 3 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 716 1021 gene locus_tag LOCUS_10140 716 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1014 1514 gene locus_tag LOCUS_10150 1014 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1511 2653 gene locus_tag LOCUS_10160 1511 2653 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_10160 2656 3897 gene locus_tag LOCUS_10170 2656 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3934 4290 gene locus_tag LOCUS_10180 3934 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4256 4408 gene locus_tag LOCUS_10190 4256 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 4396 4734 gene locus_tag LOCUS_10200 4396 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 5109 4744 gene locus_tag LOCUS_10210 5109 4744 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_10210 5905 5135 gene locus_tag LOCUS_10220 gene nfsA 5905 5135 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458388.1 protein_id gnl|my_center|LOCUS_10220 6645 6019 gene locus_tag LOCUS_10230 6645 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10230 7181 8173 gene locus_tag LOCUS_10240 7181 8173 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_10240 8416 9180 gene locus_tag LOCUS_10250 8416 9180 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_10250 9480 10427 gene locus_tag LOCUS_10260 9480 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 protein_id gnl|my_center|LOCUS_10260 10417 11412 gene locus_tag LOCUS_10270 10417 11412 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_10270 11409 12434 gene locus_tag LOCUS_10280 11409 12434 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_10280 12434 13216 gene locus_tag LOCUS_10290 12434 13216 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803588.1 protein_id gnl|my_center|LOCUS_10290 13210 15087 gene locus_tag LOCUS_10300 13210 15087 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_10300 15089 15862 gene locus_tag LOCUS_10310 15089 15862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 16056 16628 gene locus_tag LOCUS_10320 16056 16628 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_10320 16630 17226 gene locus_tag LOCUS_10330 16630 17226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 17479 17294 gene locus_tag LOCUS_10340 17479 17294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 17930 17520 gene locus_tag LOCUS_10350 17930 17520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 18929 18075 gene locus_tag LOCUS_10360 18929 18075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 19105 18932 gene locus_tag LOCUS_10370 19105 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 19422 19102 gene locus_tag LOCUS_10380 19422 19102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 20105 19452 gene locus_tag LOCUS_10390 20105 19452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 20953 20105 gene locus_tag LOCUS_10400 20953 20105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 22679 21069 gene locus_tag LOCUS_10410 22679 21069 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_10410 23341 22763 gene locus_tag LOCUS_10420 23341 22763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 24990 23392 gene locus_tag LOCUS_10430 24990 23392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 25569 25021 gene locus_tag LOCUS_10440 25569 25021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 26932 25571 gene locus_tag LOCUS_10450 26932 25571 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_10450 27577 26969 gene locus_tag LOCUS_10460 27577 26969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 28698 27574 gene locus_tag LOCUS_10470 28698 27574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 29559 28789 gene locus_tag LOCUS_10480 29559 28789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 30375 29608 gene locus_tag LOCUS_10490 30375 29608 CDS product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354507.1 protein_id gnl|my_center|LOCUS_10490 <30913 30401 gene locus_tag LOCUS_10500 <30913 30401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942026.1:enoyl-CoA hydratase-related protein >Feature sequence031 3463 2393 gene locus_tag LOCUS_10510 gene corA 3463 2393 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_10510 5304 3511 gene locus_tag LOCUS_10520 5304 3511 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367282.1 protein_id gnl|my_center|LOCUS_10520 9350 5304 gene locus_tag LOCUS_10530 9350 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 9292 9447 gene locus_tag LOCUS_10540 9292 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 9535 12606 gene locus_tag LOCUS_10550 9535 12606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 12619 13677 gene locus_tag LOCUS_10560 12619 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 13969 14514 gene locus_tag LOCUS_10570 13969 14514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 14521 15018 gene locus_tag LOCUS_10580 14521 15018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 15320 16195 gene locus_tag LOCUS_10590 15320 16195 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_10590 16646 16852 gene locus_tag LOCUS_10600 16646 16852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 16865 17161 gene locus_tag LOCUS_10610 16865 17161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 17158 18378 gene locus_tag LOCUS_10620 17158 18378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 18362 19027 gene locus_tag LOCUS_10630 18362 19027 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_10630 19309 20523 gene locus_tag LOCUS_10640 19309 20523 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023814.1 protein_id gnl|my_center|LOCUS_10640 20611 21348 gene locus_tag LOCUS_10650 20611 21348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 22545 21625 gene locus_tag LOCUS_10660 gene bmt 22545 21625 CDS product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240571.1 protein_id gnl|my_center|LOCUS_10660 23501 22668 gene locus_tag LOCUS_10670 23501 22668 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_10670 25564 23792 gene locus_tag LOCUS_10680 25564 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 26316 25777 gene locus_tag LOCUS_10690 26316 25777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 27299 26646 gene locus_tag LOCUS_10700 gene phoU 27299 26646 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_10700 28140 27313 gene locus_tag LOCUS_10710 gene pstB 28140 27313 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193614.1 protein_id gnl|my_center|LOCUS_10710 28988 28137 gene locus_tag LOCUS_10720 gene pstA 28988 28137 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175158.1 protein_id gnl|my_center|LOCUS_10720 29983 28988 gene locus_tag LOCUS_10730 gene pstC 29983 28988 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371940.1 protein_id gnl|my_center|LOCUS_10730 <30713 29983 gene locus_tag LOCUS_10740 <30713 29983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965256.1:phosphate ABC transporter substrate-binding protein PstS >Feature sequence032 3908 540 gene locus_tag LOCUS_10750 3908 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 4835 3909 gene locus_tag LOCUS_10760 4835 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 6332 4836 gene locus_tag LOCUS_10770 gene glgA 6332 4836 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546574.1 protein_id gnl|my_center|LOCUS_10770 8020 6341 gene locus_tag LOCUS_10780 8020 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 8887 8033 gene locus_tag LOCUS_10790 8887 8033 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_10790 10169 8895 gene locus_tag LOCUS_10800 gene hutI 10169 8895 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673322.1 protein_id gnl|my_center|LOCUS_10800 12864 10249 gene locus_tag LOCUS_10810 12864 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 13097 12867 gene locus_tag LOCUS_10820 13097 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 13815 13099 gene locus_tag LOCUS_10830 13815 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10830 14737 14012 gene locus_tag LOCUS_10840 14737 14012 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_10840 16760 14850 gene locus_tag LOCUS_10850 gene gatE 16760 14850 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979281.1 protein_id gnl|my_center|LOCUS_10850 19277 17061 gene locus_tag LOCUS_10860 19277 17061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 20843 19368 gene locus_tag LOCUS_10870 20843 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 21338 21973 gene locus_tag LOCUS_10880 gene cysC 21338 21973 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 protein_id gnl|my_center|LOCUS_10880 22048 22266 gene locus_tag LOCUS_10890 22048 22266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 22277 24157 gene locus_tag LOCUS_10900 22277 24157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 24170 25462 gene locus_tag LOCUS_10910 24170 25462 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158904.1 protein_id gnl|my_center|LOCUS_10910 25462 27015 gene locus_tag LOCUS_10920 25462 27015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 27025 27747 gene locus_tag LOCUS_10930 27025 27747 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_10930 27797 28789 gene locus_tag LOCUS_10940 27797 28789 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077753831.1 protein_id gnl|my_center|LOCUS_10940 28913 29872 gene locus_tag LOCUS_10950 28913 29872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence033 716 234 gene locus_tag LOCUS_10960 716 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2057 765 gene locus_tag LOCUS_10970 gene leuC 2057 765 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_10970 3158 2115 gene locus_tag LOCUS_10980 3158 2115 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 protein_id gnl|my_center|LOCUS_10980 3466 8478 gene locus_tag LOCUS_10990 3466 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 8508 9263 gene locus_tag LOCUS_11000 8508 9263 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887067.1 protein_id gnl|my_center|LOCUS_11000 10768 9542 gene locus_tag LOCUS_11010 10768 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 12392 10806 gene locus_tag LOCUS_11020 12392 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 13880 12468 gene locus_tag LOCUS_11030 13880 12468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 15887 14916 gene locus_tag LOCUS_11040 15887 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 17118 15898 gene locus_tag LOCUS_11050 17118 15898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 20045 17250 gene locus_tag LOCUS_11060 20045 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 23704 20063 gene locus_tag LOCUS_11070 23704 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 27250 24035 gene locus_tag LOCUS_11080 27250 24035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 <30629 27829 gene locus_tag LOCUS_11090 <30629 27829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence034 2086 554 gene locus_tag LOCUS_11100 2086 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 3253 2156 gene locus_tag LOCUS_11110 gene wecB 3253 2156 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_11110 4670 3255 gene locus_tag LOCUS_11120 4670 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 7015 4877 gene locus_tag LOCUS_11130 7015 4877 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_11130 7959 7159 gene locus_tag LOCUS_11140 7959 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 8906 7995 gene locus_tag LOCUS_11150 8906 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 10178 9105 gene locus_tag LOCUS_11160 10178 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 11299 10241 gene locus_tag LOCUS_11170 11299 10241 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692504.1 protein_id gnl|my_center|LOCUS_11170 12026 11403 gene locus_tag LOCUS_11180 12026 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 12079 12306 gene locus_tag LOCUS_11190 12079 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 14086 12950 gene locus_tag LOCUS_11200 14086 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 14160 14357 gene locus_tag LOCUS_11210 14160 14357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 14767 14564 gene locus_tag LOCUS_11220 14767 14564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 15701 14862 gene locus_tag LOCUS_11230 15701 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 17112 15880 gene locus_tag LOCUS_11240 17112 15880 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_11240 17585 17112 gene locus_tag LOCUS_11250 17585 17112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 22839 17629 gene locus_tag LOCUS_11260 22839 17629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 23101 24198 gene locus_tag LOCUS_11270 23101 24198 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146738.1 protein_id gnl|my_center|LOCUS_11270 24206 24472 gene locus_tag LOCUS_11280 24206 24472 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_11280 24556 24651 gene locus_tag LOCUS_t00200 24556 24651 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 24827 26317 gene locus_tag LOCUS_11290 gene glpK 24827 26317 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_11290 28149 26425 gene locus_tag LOCUS_11300 28149 26425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence035 3788 651 gene locus_tag LOCUS_11310 3788 651 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_11310 4990 3785 gene locus_tag LOCUS_11320 4990 3785 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_11320 6328 4991 gene locus_tag LOCUS_11330 6328 4991 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267715.1 protein_id gnl|my_center|LOCUS_11330 7072 6500 gene locus_tag LOCUS_11340 7072 6500 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_11340 7221 9140 gene locus_tag LOCUS_11350 gene selB 7221 9140 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048014.1 protein_id gnl|my_center|LOCUS_11350 9267 9659 gene locus_tag LOCUS_11360 9267 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 9711 10658 gene locus_tag LOCUS_11370 gene selD 9711 10658 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_11370 10732 13071 gene locus_tag LOCUS_11380 10732 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 13129 13398 gene locus_tag LOCUS_11390 13129 13398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 13576 15438 gene locus_tag LOCUS_11400 13576 15438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 15685 16041 gene locus_tag LOCUS_11410 15685 16041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 16063 16956 gene locus_tag LOCUS_11420 16063 16956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11420 16953 17189 gene locus_tag LOCUS_11430 16953 17189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 17186 18241 gene locus_tag LOCUS_11440 17186 18241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 18231 19196 gene locus_tag LOCUS_11450 18231 19196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 19308 19526 gene locus_tag LOCUS_11460 19308 19526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 19682 19861 gene locus_tag LOCUS_11470 19682 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 19889 20209 gene locus_tag LOCUS_11480 19889 20209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 20187 20357 gene locus_tag LOCUS_11490 20187 20357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 20576 22966 gene locus_tag LOCUS_11500 20576 22966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 23075 24589 gene locus_tag LOCUS_11510 gene selA 23075 24589 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 protein_id gnl|my_center|LOCUS_11510 24726 29120 gene locus_tag LOCUS_11520 24726 29120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 <30059 29224 gene locus_tag LOCUS_11530 <30059 29224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence036 746 234 gene locus_tag LOCUS_11540 746 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 868 794 gene locus_tag LOCUS_t00210 868 794 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1479 4853 gene locus_tag LOCUS_11550 1479 4853 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073269.1 protein_id gnl|my_center|LOCUS_11550 5118 5516 gene locus_tag LOCUS_11560 gene spo0F 5118 5516 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398594.1 protein_id gnl|my_center|LOCUS_11560 6298 5522 gene locus_tag LOCUS_11570 6298 5522 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614984.1 protein_id gnl|my_center|LOCUS_11570 6419 7666 gene locus_tag LOCUS_11580 6419 7666 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_11580 7963 8976 gene locus_tag LOCUS_11590 7963 8976 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227975.1 protein_id gnl|my_center|LOCUS_11590 8987 9970 gene locus_tag LOCUS_11600 8987 9970 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_11600 10001 10408 gene locus_tag LOCUS_11610 10001 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 10420 11301 gene locus_tag LOCUS_11620 10420 11301 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_11620 11314 12030 gene locus_tag LOCUS_11630 11314 12030 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679577.1 protein_id gnl|my_center|LOCUS_11630 12027 12911 gene locus_tag LOCUS_11640 12027 12911 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629595.1 protein_id gnl|my_center|LOCUS_11640 13081 13893 gene locus_tag LOCUS_11650 13081 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 13904 15577 gene locus_tag LOCUS_11660 13904 15577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 15803 16204 gene locus_tag LOCUS_11670 15803 16204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 16214 16762 gene locus_tag LOCUS_11680 16214 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 16809 16997 gene locus_tag LOCUS_11690 16809 16997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 16939 17385 gene locus_tag LOCUS_11700 16939 17385 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_11700 19392 17386 gene locus_tag LOCUS_11710 19392 17386 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 protein_id gnl|my_center|LOCUS_11710 20264 19389 gene locus_tag LOCUS_11720 20264 19389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 20688 20356 gene locus_tag LOCUS_11730 gene trxA 20688 20356 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022275.1 protein_id gnl|my_center|LOCUS_11730 21502 20720 gene locus_tag LOCUS_11740 21502 20720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 21984 21505 gene locus_tag LOCUS_11750 21984 21505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 23237 21999 gene locus_tag LOCUS_11760 23237 21999 CDS product aconitase/3-isopropylmalate dehydratase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870106.1 protein_id gnl|my_center|LOCUS_11760 23459 23845 gene locus_tag LOCUS_11770 23459 23845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 28097 24570 gene locus_tag LOCUS_11780 28097 24570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence037 2363 867 gene locus_tag LOCUS_11790 2363 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3158 2382 gene locus_tag LOCUS_11800 3158 2382 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_11800 3615 4898 gene locus_tag LOCUS_11810 3615 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 4991 6745 gene locus_tag LOCUS_11820 4991 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 9168 7489 gene locus_tag LOCUS_11830 9168 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 9998 9189 gene locus_tag LOCUS_11840 9998 9189 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861146.1 protein_id gnl|my_center|LOCUS_11840 10497 10030 gene locus_tag LOCUS_11850 10497 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 12391 10580 gene locus_tag LOCUS_11860 12391 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 13699 12458 gene locus_tag LOCUS_11870 13699 12458 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047968.1 protein_id gnl|my_center|LOCUS_11870 14777 13749 gene locus_tag LOCUS_11880 gene nadA 14777 13749 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546803.1 protein_id gnl|my_center|LOCUS_11880 16805 15108 gene locus_tag LOCUS_11890 16805 15108 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_11890 17345 16806 gene locus_tag LOCUS_11900 17345 16806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 18218 17364 gene locus_tag LOCUS_11910 18218 17364 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_11910 19063 18221 gene locus_tag LOCUS_11920 gene kdsA 19063 18221 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_11920 20911 19082 gene locus_tag LOCUS_11930 gene glmS 20911 19082 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_11930 22246 20924 gene locus_tag LOCUS_11940 22246 20924 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_11940 22839 22483 gene locus_tag LOCUS_11950 22839 22483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 24362 22857 gene locus_tag LOCUS_11960 24362 22857 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_11960 25943 24405 gene locus_tag LOCUS_11970 25943 24405 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_11970 27342 26131 gene locus_tag LOCUS_11980 27342 26131 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680236.1 protein_id gnl|my_center|LOCUS_11980 27825 27352 gene locus_tag LOCUS_11990 27825 27352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence038 <1 623 gene locus_tag LOCUS_12000 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811605.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB 637 960 gene locus_tag LOCUS_12010 637 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1018 1740 gene locus_tag LOCUS_12020 1018 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1727 2500 gene locus_tag LOCUS_12030 1727 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2705 3751 gene locus_tag LOCUS_12040 2705 3751 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_12040 4442 3957 gene locus_tag LOCUS_12050 4442 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 4597 5508 gene locus_tag LOCUS_12060 gene dusB 4597 5508 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_12060 6999 5548 gene locus_tag LOCUS_12070 6999 5548 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583646.1 protein_id gnl|my_center|LOCUS_12070 7282 7731 gene locus_tag LOCUS_12080 7282 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 7739 10111 gene locus_tag LOCUS_12090 gene lon 7739 10111 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_12090 10108 11211 gene locus_tag LOCUS_12100 10108 11211 CDS product reductive dehalogenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889925.1 protein_id gnl|my_center|LOCUS_12100 11818 11324 gene locus_tag LOCUS_12110 11818 11324 CDS product DUF2703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940568.1 protein_id gnl|my_center|LOCUS_12110 12465 12046 gene locus_tag LOCUS_12120 12465 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 14011 12755 gene locus_tag LOCUS_12130 14011 12755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 14819 13989 gene locus_tag LOCUS_12140 14819 13989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 15102 14806 gene locus_tag LOCUS_12150 15102 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 15598 15230 gene locus_tag LOCUS_12160 15598 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 16152 15595 gene locus_tag LOCUS_12170 16152 15595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 16722 16243 gene locus_tag LOCUS_12180 16722 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 17263 17054 gene locus_tag LOCUS_12190 17263 17054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 17686 19236 gene locus_tag LOCUS_12200 17686 19236 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_12200 19250 19603 gene locus_tag LOCUS_12210 19250 19603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 19629 20066 gene locus_tag LOCUS_12220 19629 20066 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_12220 20135 21280 gene locus_tag LOCUS_12230 20135 21280 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_12230 22328 21579 gene locus_tag LOCUS_12240 22328 21579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 25230 22546 gene locus_tag LOCUS_12250 25230 22546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 <28061 25305 gene locus_tag LOCUS_12260 <28061 25305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943279.1:DUF4388 domain-containing protein >Feature sequence039 1084 530 gene locus_tag LOCUS_12270 1084 530 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_12270 2295 1168 gene locus_tag LOCUS_12280 gene prf1 2295 1168 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_12280 2990 2424 gene locus_tag LOCUS_12290 gene pdxT 2990 2424 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026851.1 protein_id gnl|my_center|LOCUS_12290 3901 2990 gene locus_tag LOCUS_12300 gene pdxS 3901 2990 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583836.1 protein_id gnl|my_center|LOCUS_12300 4087 5058 gene locus_tag LOCUS_12310 4087 5058 CDS product aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082912.1 protein_id gnl|my_center|LOCUS_12310 5136 6539 gene locus_tag LOCUS_12320 5136 6539 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081585.1 protein_id gnl|my_center|LOCUS_12320 6582 7775 gene locus_tag LOCUS_12330 6582 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 7941 11288 gene locus_tag LOCUS_12340 7941 11288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 11347 12186 gene locus_tag LOCUS_12350 11347 12186 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705115.1 protein_id gnl|my_center|LOCUS_12350 13207 12311 gene locus_tag LOCUS_12360 13207 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 13994 13287 gene locus_tag LOCUS_12370 13994 13287 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_12370 14964 13984 gene locus_tag LOCUS_12380 gene rfaE1 14964 13984 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_12380 15368 15757 gene locus_tag LOCUS_12390 15368 15757 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958148.1 protein_id gnl|my_center|LOCUS_12390 16344 16763 gene locus_tag LOCUS_12400 16344 16763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 16760 17602 gene locus_tag LOCUS_12410 16760 17602 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938734.1 protein_id gnl|my_center|LOCUS_12410 19320 17740 gene locus_tag LOCUS_12420 19320 17740 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_12420 20722 19475 gene locus_tag LOCUS_12430 gene kbl 20722 19475 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_12430 21120 21890 gene locus_tag LOCUS_12440 21120 21890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 21901 22116 gene locus_tag LOCUS_12450 21901 22116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 23493 22333 gene locus_tag LOCUS_12460 23493 22333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 24210 23677 gene locus_tag LOCUS_12470 24210 23677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 25290 24310 gene locus_tag LOCUS_12480 25290 24310 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680329.1 protein_id gnl|my_center|LOCUS_12480 26080 25487 gene locus_tag LOCUS_12490 26080 25487 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence040 561 1016 gene locus_tag LOCUS_12500 561 1016 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391711.1 protein_id gnl|my_center|LOCUS_12500 1019 2035 gene locus_tag LOCUS_12510 gene rfbB 1019 2035 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_12510 2072 3745 gene locus_tag LOCUS_12520 2072 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3842 5017 gene locus_tag LOCUS_12530 3842 5017 CDS product GumC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930608.1 protein_id gnl|my_center|LOCUS_12530 5714 6382 gene locus_tag LOCUS_12540 5714 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 6363 7487 gene locus_tag LOCUS_12550 6363 7487 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048110.1 protein_id gnl|my_center|LOCUS_12550 7484 8821 gene locus_tag LOCUS_12560 7484 8821 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048114.1 protein_id gnl|my_center|LOCUS_12560 8822 10036 gene locus_tag LOCUS_12570 8822 10036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 10038 10994 gene locus_tag LOCUS_12580 10038 10994 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_12580 11030 12055 gene locus_tag LOCUS_12590 gene waaF 11030 12055 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530068.1 protein_id gnl|my_center|LOCUS_12590 12052 13431 gene locus_tag LOCUS_12600 12052 13431 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_12600 13574 14869 gene locus_tag LOCUS_12610 gene serS 13574 14869 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_12610 14866 16218 gene locus_tag LOCUS_12620 gene trkA 14866 16218 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_12620 16240 17700 gene locus_tag LOCUS_12630 16240 17700 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_12630 17727 18707 gene locus_tag LOCUS_12640 17727 18707 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_12640 18799 19740 gene locus_tag LOCUS_12650 18799 19740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 19743 20813 gene locus_tag LOCUS_12660 gene tsaD 19743 20813 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_12660 20807 22963 gene locus_tag LOCUS_12670 20807 22963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404150.1 protein_id gnl|my_center|LOCUS_12670 22960 24282 gene locus_tag LOCUS_12680 gene hpnE 22960 24282 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_12680 24679 24287 gene locus_tag LOCUS_12690 24679 24287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 24887 25771 gene locus_tag LOCUS_12700 24887 25771 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence041 764 24 gene locus_tag LOCUS_12710 gene fabG 764 24 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_12710 3258 1096 gene locus_tag LOCUS_12720 3258 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 4116 3517 gene locus_tag LOCUS_12730 gene nadD 4116 3517 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_12730 4919 4122 gene locus_tag LOCUS_12740 gene bamD 4919 4122 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926787.1 protein_id gnl|my_center|LOCUS_12740 5302 4919 gene locus_tag LOCUS_12750 5302 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 6822 5302 gene locus_tag LOCUS_12760 gene lnt 6822 5302 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_12760 7820 6819 gene locus_tag LOCUS_12770 7820 6819 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_12770 8301 7840 gene locus_tag LOCUS_12780 8301 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 10486 8303 gene locus_tag LOCUS_12790 gene relA 10486 8303 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262810.1 protein_id gnl|my_center|LOCUS_12790 12048 10537 gene locus_tag LOCUS_12800 gene dnaB 12048 10537 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583712.1 protein_id gnl|my_center|LOCUS_12800 12761 12054 gene locus_tag LOCUS_12810 12761 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 13969 12758 gene locus_tag LOCUS_12820 gene coaBC 13969 12758 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402817.1 protein_id gnl|my_center|LOCUS_12820 14533 14093 gene locus_tag LOCUS_12830 14533 14093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 15113 14553 gene locus_tag LOCUS_12840 gene gmk 15113 14553 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931939.1 protein_id gnl|my_center|LOCUS_12840 15984 15106 gene locus_tag LOCUS_12850 15984 15106 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931938.1 protein_id gnl|my_center|LOCUS_12850 17057 16083 gene locus_tag LOCUS_12860 17057 16083 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_12860 20107 17222 gene locus_tag LOCUS_12870 20107 17222 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838372.1 protein_id gnl|my_center|LOCUS_12870 21654 20383 gene locus_tag LOCUS_12880 21654 20383 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_12880 22730 21819 gene locus_tag LOCUS_12890 gene xerD 22730 21819 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_12890 23577 22918 gene locus_tag LOCUS_12900 23577 22918 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_12900 24457 23567 gene locus_tag LOCUS_12910 24457 23567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence042 172 654 gene locus_tag LOCUS_12920 172 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 658 2211 gene locus_tag LOCUS_12930 gene fliF 658 2211 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_12930 2286 3299 gene locus_tag LOCUS_12940 gene fliG 2286 3299 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_12940 3299 4003 gene locus_tag LOCUS_12950 3299 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4009 5379 gene locus_tag LOCUS_12960 gene fliI 4009 5379 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460756.1 protein_id gnl|my_center|LOCUS_12960 5376 5840 gene locus_tag LOCUS_12970 5376 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 5830 7005 gene locus_tag LOCUS_12980 5830 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 6987 8492 gene locus_tag LOCUS_12990 6987 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 8733 9470 gene locus_tag LOCUS_13000 8733 9470 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839909.1 protein_id gnl|my_center|LOCUS_13000 9472 9867 gene locus_tag LOCUS_13010 9472 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 10017 11918 gene locus_tag LOCUS_13020 10017 11918 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870070.1 protein_id gnl|my_center|LOCUS_13020 12037 12279 gene locus_tag LOCUS_13030 12037 12279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 12299 13069 gene locus_tag LOCUS_13040 12299 13069 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_13040 13069 13830 gene locus_tag LOCUS_13050 13069 13830 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392303.1 protein_id gnl|my_center|LOCUS_13050 13845 14387 gene locus_tag LOCUS_13060 13845 14387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 14401 15393 gene locus_tag LOCUS_13070 gene fliM 14401 15393 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_13070 15380 16438 gene locus_tag LOCUS_13080 gene fliY 15380 16438 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 protein_id gnl|my_center|LOCUS_13080 16435 16911 gene locus_tag LOCUS_13090 16435 16911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 16901 17650 gene locus_tag LOCUS_13100 16901 17650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 17650 17919 gene locus_tag LOCUS_13110 gene fliQ 17650 17919 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405299.1 protein_id gnl|my_center|LOCUS_13110 17919 18698 gene locus_tag LOCUS_13120 gene fliR 17919 18698 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941094.1 protein_id gnl|my_center|LOCUS_13120 18716 19771 gene locus_tag LOCUS_13130 gene flhB 18716 19771 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_13130 20184 19957 gene locus_tag LOCUS_13140 20184 19957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 20069 22027 gene locus_tag LOCUS_13150 gene flhA 20069 22027 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421556.1 protein_id gnl|my_center|LOCUS_13150 22172 23383 gene locus_tag LOCUS_13160 gene flhF 22172 23383 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460748.1 protein_id gnl|my_center|LOCUS_13160 23376 24266 gene locus_tag LOCUS_13170 23376 24266 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946724.1 protein_id gnl|my_center|LOCUS_13170 24263 24574 gene locus_tag LOCUS_13180 24263 24574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 24571 25350 gene locus_tag LOCUS_13190 24571 25350 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223860.1 protein_id gnl|my_center|LOCUS_13190 25354 25584 gene locus_tag LOCUS_13200 25354 25584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence043 <1 7344 gene locus_tag LOCUS_13210 <1 7344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein 11062 7478 gene locus_tag LOCUS_13220 11062 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 11626 11808 gene locus_tag LOCUS_13230 11626 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 12132 11851 gene locus_tag LOCUS_13240 12132 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 12552 13574 gene locus_tag LOCUS_13250 gene amrS 12552 13574 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_13250 13832 15190 gene locus_tag LOCUS_13260 13832 15190 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_13260 15187 16242 gene locus_tag LOCUS_13270 15187 16242 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_13270 16239 19400 gene locus_tag LOCUS_13280 16239 19400 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880476.1 protein_id gnl|my_center|LOCUS_13280 19405 19683 gene locus_tag LOCUS_13290 19405 19683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 19688 20278 gene locus_tag LOCUS_13300 19688 20278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 20275 21399 gene locus_tag LOCUS_13310 20275 21399 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_13310 21615 24638 gene locus_tag LOCUS_13320 21615 24638 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_13320 25259 >25491 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cctgtttgtaccccccaaattagggtcagtaacacc >Feature sequence044 3396 373 gene locus_tag LOCUS_13330 3396 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 4103 3828 gene locus_tag LOCUS_13340 4103 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 <25107 4201 gene locus_tag LOCUS_13350 <25107 4201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein >Feature sequence045 9765 6832 gene locus_tag LOCUS_13360 9765 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 10450 10037 gene locus_tag LOCUS_13370 10450 10037 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_13370 11915 10443 gene locus_tag LOCUS_13380 gene atpD 11915 10443 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_13380 12513 11995 gene locus_tag LOCUS_13390 12513 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 13394 12534 gene locus_tag LOCUS_13400 13394 12534 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_13400 14952 13432 gene locus_tag LOCUS_13410 gene atpA 14952 13432 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545369.1 protein_id gnl|my_center|LOCUS_13410 15535 14999 gene locus_tag LOCUS_13420 15535 14999 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425856.1 protein_id gnl|my_center|LOCUS_13420 16014 15532 gene locus_tag LOCUS_13430 gene atpF 16014 15532 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699938.1 protein_id gnl|my_center|LOCUS_13430 16376 16125 gene locus_tag LOCUS_13440 16376 16125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 16926 16462 gene locus_tag LOCUS_13450 16926 16462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 17461 16973 gene locus_tag LOCUS_13460 17461 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 18392 17496 gene locus_tag LOCUS_13470 18392 17496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 18889 18503 gene locus_tag LOCUS_13480 18889 18503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 19145 18876 gene locus_tag LOCUS_13490 19145 18876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 19602 19180 gene locus_tag LOCUS_13500 19602 19180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 19886 19623 gene locus_tag LOCUS_13510 19886 19623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 20745 19909 gene locus_tag LOCUS_13520 20745 19909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 21578 20826 gene locus_tag LOCUS_13530 gene rlmB 21578 20826 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_13530 23418 22117 gene locus_tag LOCUS_13540 23418 22117 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_13540 24143 23418 gene locus_tag LOCUS_13550 24143 23418 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023677.1 protein_id gnl|my_center|LOCUS_13550 <24983 24286 gene locus_tag LOCUS_13560 <24983 24286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103016249.1:GTPase HflX >Feature sequence046 857 612 gene locus_tag LOCUS_13570 857 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2278 917 gene locus_tag LOCUS_13580 2278 917 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583125.1 protein_id gnl|my_center|LOCUS_13580 2965 2306 gene locus_tag LOCUS_13590 2965 2306 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080389.1 protein_id gnl|my_center|LOCUS_13590 4048 2966 gene locus_tag LOCUS_13600 4048 2966 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_13600 5260 4052 gene locus_tag LOCUS_13610 5260 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 5815 8052 gene locus_tag LOCUS_13620 5815 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 10773 8101 gene locus_tag LOCUS_13630 10773 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 10984 12327 gene locus_tag LOCUS_13640 10984 12327 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_13640 12306 12566 gene locus_tag LOCUS_13650 12306 12566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 15255 12640 gene locus_tag LOCUS_13660 15255 12640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 16323 15754 gene locus_tag LOCUS_13670 16323 15754 CDS product DUF6305 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016768.1 protein_id gnl|my_center|LOCUS_13670 17845 16646 gene locus_tag LOCUS_13680 17845 16646 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779464.1 protein_id gnl|my_center|LOCUS_13680 17998 18654 gene locus_tag LOCUS_13690 17998 18654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 18708 19829 gene locus_tag LOCUS_13700 gene buk 18708 19829 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_13700 20074 21900 gene locus_tag LOCUS_13710 gene iorA 20074 21900 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_13710 21897 22694 gene locus_tag LOCUS_13720 21897 22694 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_13720 23068 23673 gene locus_tag LOCUS_13730 23068 23673 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841930.1 protein_id gnl|my_center|LOCUS_13730 23670 24152 gene locus_tag LOCUS_13740 23670 24152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence047 492 76 gene locus_tag LOCUS_13750 492 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1376 489 gene locus_tag LOCUS_13760 1376 489 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546361.1 protein_id gnl|my_center|LOCUS_13760 3404 1500 gene locus_tag LOCUS_13770 3404 1500 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455018.1 protein_id gnl|my_center|LOCUS_13770 5079 3730 gene locus_tag LOCUS_13780 gene orpR 5079 3730 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_13780 7358 5661 gene locus_tag LOCUS_13790 7358 5661 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_13790 9274 7682 gene locus_tag LOCUS_13800 9274 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 10790 9306 gene locus_tag LOCUS_13810 10790 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 14300 10953 gene locus_tag LOCUS_13820 14300 10953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 15086 15766 gene locus_tag LOCUS_13830 15086 15766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 15818 16318 gene locus_tag LOCUS_13840 15818 16318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 16326 17564 gene locus_tag LOCUS_13850 gene nusA 16326 17564 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839192.1 protein_id gnl|my_center|LOCUS_13850 17666 20527 gene locus_tag LOCUS_13860 gene infB 17666 20527 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012779652.1 protein_id gnl|my_center|LOCUS_13860 20524 20805 gene locus_tag LOCUS_13870 20524 20805 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393381.1 protein_id gnl|my_center|LOCUS_13870 20834 21214 gene locus_tag LOCUS_13880 gene rbfA 20834 21214 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_13880 21198 22238 gene locus_tag LOCUS_13890 21198 22238 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_13890 22231 22932 gene locus_tag LOCUS_13900 22231 22932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence048 9 767 gene locus_tag LOCUS_13910 9 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 880 2736 gene locus_tag LOCUS_13920 880 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 2955 4367 gene locus_tag LOCUS_13930 2955 4367 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_13930 4392 5555 gene locus_tag LOCUS_13940 4392 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 6266 5670 gene locus_tag LOCUS_13950 6266 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 8496 6289 gene locus_tag LOCUS_13960 8496 6289 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_13960 9025 8645 gene locus_tag LOCUS_13970 9025 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 9307 9954 gene locus_tag LOCUS_13980 9307 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 9944 11125 gene locus_tag LOCUS_13990 9944 11125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 11650 12906 gene locus_tag LOCUS_14000 11650 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 12822 13100 gene locus_tag LOCUS_14010 12822 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 13742 13668 gene locus_tag LOCUS_t00220 13742 13668 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13945 14610 gene locus_tag LOCUS_14020 gene ubiE 13945 14610 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_14020 15060 14713 gene locus_tag LOCUS_14030 15060 14713 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_14030 15390 15154 gene locus_tag LOCUS_14040 15390 15154 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097013212.1 protein_id gnl|my_center|LOCUS_14040 16247 15567 gene locus_tag LOCUS_14050 16247 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14050 18237 16378 gene locus_tag LOCUS_14060 18237 16378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 18910 22287 gene locus_tag LOCUS_14070 18910 22287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 22654 22926 gene locus_tag LOCUS_14080 22654 22926 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence049 1969 1286 gene locus_tag LOCUS_14090 1969 1286 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_14090 2440 1970 gene locus_tag LOCUS_14100 2440 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2762 2529 gene locus_tag LOCUS_14110 2762 2529 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_14110 3102 2779 gene locus_tag LOCUS_14120 3102 2779 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938934.1 protein_id gnl|my_center|LOCUS_14120 3249 4547 gene locus_tag LOCUS_14130 3249 4547 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_14130 4783 5880 gene locus_tag LOCUS_14140 4783 5880 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_14140 6106 5909 gene locus_tag LOCUS_14150 6106 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 7682 6258 gene locus_tag LOCUS_14160 gene mpl 7682 6258 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_14160 8416 7688 gene locus_tag LOCUS_14170 8416 7688 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087143.1 protein_id gnl|my_center|LOCUS_14170 8897 8454 gene locus_tag LOCUS_14180 gene dtd 8897 8454 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_14180 12350 8901 gene locus_tag LOCUS_14190 gene dnaE 12350 8901 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_14190 13083 12427 gene locus_tag LOCUS_14200 13083 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 13504 13145 gene locus_tag LOCUS_14210 13504 13145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 14843 13554 gene locus_tag LOCUS_14220 gene asnS 14843 13554 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_14220 15151 14927 gene locus_tag LOCUS_14230 15151 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 16419 15412 gene locus_tag LOCUS_14240 16419 15412 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_14240 17410 16424 gene locus_tag LOCUS_14250 gene purM 17410 16424 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931788.1 protein_id gnl|my_center|LOCUS_14250 18413 17508 gene locus_tag LOCUS_14260 18413 17508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 18596 18510 gene locus_tag LOCUS_t00230 18596 18510 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18893 18645 gene locus_tag LOCUS_14270 18893 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 22649 18921 gene locus_tag LOCUS_14280 22649 18921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 <23457 22642 gene locus_tag LOCUS_14290 <23457 22642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011166785.1:molecular chaperone DnaJ >Feature sequence050 1095 1676 gene locus_tag LOCUS_14300 1095 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1686 2189 gene locus_tag LOCUS_14310 1686 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 2193 4334 gene locus_tag LOCUS_14320 2193 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 4349 14998 gene locus_tag LOCUS_14330 4349 14998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 15116 15865 gene locus_tag LOCUS_14340 15116 15865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 16140 17291 gene locus_tag LOCUS_14350 16140 17291 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_14350 17275 19302 gene locus_tag LOCUS_14360 17275 19302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 19394 19783 gene locus_tag LOCUS_14370 19394 19783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 19799 21481 gene locus_tag LOCUS_14380 19799 21481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 22917 21715 gene locus_tag LOCUS_14390 22917 21715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence051 787 1644 gene locus_tag LOCUS_14400 787 1644 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403665.1 protein_id gnl|my_center|LOCUS_14400 2656 1631 gene locus_tag LOCUS_14410 2656 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3683 2748 gene locus_tag LOCUS_14420 gene prmC 3683 2748 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_14420 5420 3726 gene locus_tag LOCUS_14430 5420 3726 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_14430 6139 5468 gene locus_tag LOCUS_14440 6139 5468 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480036.1 protein_id gnl|my_center|LOCUS_14440 7819 6155 gene locus_tag LOCUS_14450 7819 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 9285 7798 gene locus_tag LOCUS_14460 9285 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 10329 9304 gene locus_tag LOCUS_14470 10329 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 11561 10899 gene locus_tag LOCUS_14480 11561 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14480 11969 11595 gene locus_tag LOCUS_14490 11969 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14490 15078 12220 gene locus_tag LOCUS_14500 gene uvrA 15078 12220 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_14500 15476 15691 gene locus_tag LOCUS_14510 15476 15691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 15835 16320 gene locus_tag LOCUS_14520 15835 16320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 16380 16799 gene locus_tag LOCUS_14530 16380 16799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 17320 18927 gene locus_tag LOCUS_14540 17320 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 20132 19281 gene locus_tag LOCUS_14550 20132 19281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 20923 20171 gene locus_tag LOCUS_14560 20923 20171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_14560 21753 20926 gene locus_tag LOCUS_14570 21753 20926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_14570 22896 21760 gene locus_tag LOCUS_14580 22896 21760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence052 <1 574 gene locus_tag LOCUS_14590 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037269.1:endonuclease 738 3176 gene locus_tag LOCUS_14600 738 3176 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_14600 3461 3240 gene locus_tag LOCUS_14610 3461 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 5090 3522 gene locus_tag LOCUS_14620 5090 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 7125 5197 gene locus_tag LOCUS_14630 7125 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 9155 7122 gene locus_tag LOCUS_14640 9155 7122 CDS product DUF3857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203669.1 protein_id gnl|my_center|LOCUS_14640 10319 9432 gene locus_tag LOCUS_14650 10319 9432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 10767 13058 gene locus_tag LOCUS_14660 10767 13058 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345313.1 protein_id gnl|my_center|LOCUS_14660 13201 14457 gene locus_tag LOCUS_14670 13201 14457 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_14670 16789 14741 gene locus_tag LOCUS_14680 16789 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 16995 19916 gene locus_tag LOCUS_14690 gene dinG 16995 19916 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398920.1 protein_id gnl|my_center|LOCUS_14690 19920 22391 gene locus_tag LOCUS_14700 19920 22391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence053 1405 473 gene locus_tag LOCUS_14710 1405 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1890 1402 gene locus_tag LOCUS_14720 gene moaC 1890 1402 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530031.1 protein_id gnl|my_center|LOCUS_14720 2414 1887 gene locus_tag LOCUS_14730 gene mobB 2414 1887 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879742.1 protein_id gnl|my_center|LOCUS_14730 2989 2411 gene locus_tag LOCUS_14740 2989 2411 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357726.1 protein_id gnl|my_center|LOCUS_14740 4191 2986 gene locus_tag LOCUS_14750 4191 2986 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868536.1 protein_id gnl|my_center|LOCUS_14750 5178 4192 gene locus_tag LOCUS_14760 gene moaA 5178 4192 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_14760 5568 8237 gene locus_tag LOCUS_14770 5568 8237 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 protein_id gnl|my_center|LOCUS_14770 8275 8901 gene locus_tag LOCUS_14780 8275 8901 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320694.1 protein_id gnl|my_center|LOCUS_14780 8961 9929 gene locus_tag LOCUS_14790 gene nrfD 8961 9929 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879873.1 protein_id gnl|my_center|LOCUS_14790 10117 10869 gene locus_tag LOCUS_14800 gene fdhD 10117 10869 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896043.1 protein_id gnl|my_center|LOCUS_14800 10875 11663 gene locus_tag LOCUS_14810 10875 11663 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455762.1 protein_id gnl|my_center|LOCUS_14810 11665 12426 gene locus_tag LOCUS_14820 11665 12426 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948648.1 protein_id gnl|my_center|LOCUS_14820 12691 15648 gene locus_tag LOCUS_14830 12691 15648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 16048 15734 gene locus_tag LOCUS_14840 16048 15734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 16739 16272 gene locus_tag LOCUS_14850 16739 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 18251 17043 gene locus_tag LOCUS_14860 18251 17043 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_14860 19181 18630 gene locus_tag LOCUS_14870 19181 18630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 19760 22930 gene locus_tag LOCUS_14880 19760 22930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence054 420 1865 gene locus_tag LOCUS_14890 420 1865 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_14890 1966 2280 gene locus_tag LOCUS_14900 1966 2280 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_14900 2298 3059 gene locus_tag LOCUS_14910 2298 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 3301 4320 gene locus_tag LOCUS_14920 3301 4320 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056629.1 protein_id gnl|my_center|LOCUS_14920 4419 6464 gene locus_tag LOCUS_14930 4419 6464 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_14930 6477 7724 gene locus_tag LOCUS_14940 6477 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 9909 7834 gene locus_tag LOCUS_14950 9909 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 10986 10006 gene locus_tag LOCUS_14960 gene vexA 10986 10006 CDS product Vi polysaccharide ABC transporter protein VexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720235.1 protein_id gnl|my_center|LOCUS_14960 11411 11028 gene locus_tag LOCUS_14970 11411 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 12022 11411 gene locus_tag LOCUS_14980 12022 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 13282 12182 gene locus_tag LOCUS_14990 13282 12182 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_14990 13557 13279 gene locus_tag LOCUS_15000 13557 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 14365 13571 gene locus_tag LOCUS_15010 14365 13571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 15509 14355 gene locus_tag LOCUS_15020 15509 14355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 15723 15502 gene locus_tag LOCUS_15030 15723 15502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 17049 15793 gene locus_tag LOCUS_15040 17049 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 17862 17062 gene locus_tag LOCUS_15050 17862 17062 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence055 25 423 gene locus_tag LOCUS_15060 25 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 814 3426 gene locus_tag LOCUS_15070 814 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3934 3542 gene locus_tag LOCUS_15080 3934 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4464 3931 gene locus_tag LOCUS_15090 gene rpoE 4464 3931 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005346.1 protein_id gnl|my_center|LOCUS_15090 5744 4461 gene locus_tag LOCUS_15100 5744 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6532 5918 gene locus_tag LOCUS_15110 6532 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 8049 6586 gene locus_tag LOCUS_15120 8049 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 11061 8233 gene locus_tag LOCUS_15130 11061 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 11533 11784 gene locus_tag LOCUS_15140 11533 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 11842 12282 gene locus_tag LOCUS_15150 11842 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 12435 13499 gene locus_tag LOCUS_15160 12435 13499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 13849 14214 gene locus_tag LOCUS_15170 13849 14214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 14228 15073 gene locus_tag LOCUS_15180 14228 15073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 15101 16465 gene locus_tag LOCUS_15190 15101 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 16625 17995 gene locus_tag LOCUS_15200 16625 17995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 18000 18161 gene locus_tag LOCUS_15210 18000 18161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 18161 18853 gene locus_tag LOCUS_15220 18161 18853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 19010 19570 gene locus_tag LOCUS_15230 19010 19570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 19558 20415 gene locus_tag LOCUS_15240 19558 20415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 20412 20714 gene locus_tag LOCUS_15250 20412 20714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 20707 20940 gene locus_tag LOCUS_15260 20707 20940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 20942 21205 gene locus_tag LOCUS_15270 20942 21205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 21370 21798 gene locus_tag LOCUS_15280 21370 21798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence056 501 55 gene locus_tag LOCUS_15290 501 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1208 552 gene locus_tag LOCUS_15300 1208 552 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_15300 2316 1210 gene locus_tag LOCUS_15310 2316 1210 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_15310 3096 2341 gene locus_tag LOCUS_15320 gene truA 3096 2341 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932658.1 protein_id gnl|my_center|LOCUS_15320 3900 3118 gene locus_tag LOCUS_15330 3900 3118 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 protein_id gnl|my_center|LOCUS_15330 4047 4955 gene locus_tag LOCUS_15340 4047 4955 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894028.1 protein_id gnl|my_center|LOCUS_15340 5117 5881 gene locus_tag LOCUS_15350 5117 5881 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_15350 5878 7518 gene locus_tag LOCUS_15360 gene bshC 5878 7518 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_15360 7508 8230 gene locus_tag LOCUS_15370 gene bshB1 7508 8230 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015666.1 protein_id gnl|my_center|LOCUS_15370 8227 9345 gene locus_tag LOCUS_15380 gene bshA 8227 9345 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768296.1 protein_id gnl|my_center|LOCUS_15380 9430 10782 gene locus_tag LOCUS_15390 9430 10782 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_15390 10860 11069 gene locus_tag LOCUS_15400 10860 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 11080 11973 gene locus_tag LOCUS_15410 gene hpnC 11080 11973 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020997346.1 protein_id gnl|my_center|LOCUS_15410 11952 12857 gene locus_tag LOCUS_15420 11952 12857 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530151.1 protein_id gnl|my_center|LOCUS_15420 12980 14809 gene locus_tag LOCUS_15430 12980 14809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 15077 16879 gene locus_tag LOCUS_15440 15077 16879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 17075 19570 gene locus_tag LOCUS_15450 17075 19570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 19584 20165 gene locus_tag LOCUS_15460 19584 20165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence057 1924 425 gene locus_tag LOCUS_15470 1924 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3538 2069 gene locus_tag LOCUS_15480 3538 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4330 3608 gene locus_tag LOCUS_15490 4330 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 4893 4399 gene locus_tag LOCUS_15500 4893 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 5982 5050 gene locus_tag LOCUS_15510 5982 5050 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073221.1 protein_id gnl|my_center|LOCUS_15510 6600 6178 gene locus_tag LOCUS_15520 6600 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 8934 7021 gene locus_tag LOCUS_15530 8934 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 10617 8995 gene locus_tag LOCUS_15540 gene nadB 10617 8995 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_15540 11818 10643 gene locus_tag LOCUS_15550 11818 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 12708 11815 gene locus_tag LOCUS_15560 12708 11815 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403324.1 protein_id gnl|my_center|LOCUS_15560 13221 13640 gene locus_tag LOCUS_15570 13221 13640 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_15570 13582 14772 gene locus_tag LOCUS_15580 gene pdhA 13582 14772 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_15580 14759 15739 gene locus_tag LOCUS_15590 14759 15739 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289463.1 protein_id gnl|my_center|LOCUS_15590 15858 17186 gene locus_tag LOCUS_15600 15858 17186 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863439.1 protein_id gnl|my_center|LOCUS_15600 17199 18608 gene locus_tag LOCUS_15610 gene lpdA 17199 18608 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_15610 18659 19336 gene locus_tag LOCUS_15620 18659 19336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 19639 20085 gene locus_tag LOCUS_15630 19639 20085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 20075 20440 gene locus_tag LOCUS_15640 20075 20440 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403264.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence058 2121 1270 gene locus_tag LOCUS_15650 2121 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 3133 2114 gene locus_tag LOCUS_15660 3133 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 4255 3203 gene locus_tag LOCUS_15670 4255 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4476 5387 gene locus_tag LOCUS_15680 4476 5387 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_15680 5394 6005 gene locus_tag LOCUS_15690 5394 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 8134 6263 gene locus_tag LOCUS_15700 8134 6263 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926891.1 protein_id gnl|my_center|LOCUS_15700 9065 8580 gene locus_tag LOCUS_15710 9065 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 9565 10167 gene locus_tag LOCUS_15720 9565 10167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 10253 10798 gene locus_tag LOCUS_15730 10253 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 10941 13550 gene locus_tag LOCUS_15740 10941 13550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 15599 13812 gene locus_tag LOCUS_15750 15599 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 16814 15939 gene locus_tag LOCUS_15760 16814 15939 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048149073.1 protein_id gnl|my_center|LOCUS_15760 17211 16804 gene locus_tag LOCUS_15770 17211 16804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 19511 17460 gene locus_tag LOCUS_15780 19511 17460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence059 1409 2335 gene locus_tag LOCUS_15790 gene argF 1409 2335 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_15790 2314 3189 gene locus_tag LOCUS_15800 2314 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 3207 4013 gene locus_tag LOCUS_15810 3207 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 4346 4420 gene locus_tag LOCUS_t00240 4346 4420 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4465 6873 gene locus_tag LOCUS_15820 gene lon 4465 6873 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036186.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence060 1999 1124 gene locus_tag LOCUS_15830 1999 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 2309 2917 gene locus_tag LOCUS_15840 2309 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 3044 4069 gene locus_tag LOCUS_15850 3044 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 4077 5591 gene locus_tag LOCUS_15860 4077 5591 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_15860 5584 6306 gene locus_tag LOCUS_15870 5584 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 6310 7173 gene locus_tag LOCUS_15880 6310 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 7299 8693 gene locus_tag LOCUS_15890 7299 8693 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933015.1 protein_id gnl|my_center|LOCUS_15890 8683 9366 gene locus_tag LOCUS_15900 8683 9366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_15900 9363 10001 gene locus_tag LOCUS_15910 9363 10001 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_15910 10240 11433 gene locus_tag LOCUS_15920 10240 11433 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_15920 11602 13812 gene locus_tag LOCUS_15930 11602 13812 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402805.1 protein_id gnl|my_center|LOCUS_15930 13813 14448 gene locus_tag LOCUS_15940 gene rnhB 13813 14448 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163155.1 protein_id gnl|my_center|LOCUS_15940 14441 14827 gene locus_tag LOCUS_15950 14441 14827 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546712.1 protein_id gnl|my_center|LOCUS_15950 15081 16001 gene locus_tag LOCUS_15960 15081 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 16031 17038 gene locus_tag LOCUS_15970 gene hflK 16031 17038 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_15970 17038 17883 gene locus_tag LOCUS_15980 17038 17883 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence061 2298 472 gene locus_tag LOCUS_15990 gene typA 2298 472 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_15990 5004 2971 gene locus_tag LOCUS_16000 5004 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 5952 5005 gene locus_tag LOCUS_16010 5952 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 7504 6440 gene locus_tag LOCUS_16020 gene rsgA 7504 6440 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_16020 8378 9139 gene locus_tag LOCUS_16030 8378 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 9148 9363 gene locus_tag LOCUS_16040 9148 9363 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_16040 9451 11937 gene locus_tag LOCUS_16050 9451 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 12153 13517 gene locus_tag LOCUS_16060 12153 13517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 14564 13641 gene locus_tag LOCUS_16070 14564 13641 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_16070 15289 15146 gene locus_tag LOCUS_16080 15289 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 16085 19582 gene locus_tag LOCUS_16090 16085 19582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence062 6555 2920 gene locus_tag LOCUS_16100 6555 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 6843 6769 gene locus_tag LOCUS_t00250 6843 6769 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7002 7691 gene locus_tag LOCUS_16110 7002 7691 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_16110 8027 7662 gene locus_tag LOCUS_16120 gene nifU 8027 7662 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_16120 8696 8031 gene locus_tag LOCUS_16130 8696 8031 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020851.1 protein_id gnl|my_center|LOCUS_16130 9906 8710 gene locus_tag LOCUS_16140 gene nifS 9906 8710 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_16140 10495 9956 gene locus_tag LOCUS_16150 10495 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 10748 10497 gene locus_tag LOCUS_16160 10748 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 11950 10772 gene locus_tag LOCUS_16170 11950 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 12458 11940 gene locus_tag LOCUS_16180 12458 11940 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630908.1 protein_id gnl|my_center|LOCUS_16180 12882 12526 gene locus_tag LOCUS_16190 12882 12526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 15164 13116 gene locus_tag LOCUS_16200 15164 13116 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_16200 15756 15247 gene locus_tag LOCUS_16210 15756 15247 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_16210 17840 15756 gene locus_tag LOCUS_16220 gene fusA 17840 15756 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_16220 <19447 18137 gene locus_tag LOCUS_16230 <19447 18137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928646.1:FG-GAP-like repeat-containing protein >Feature sequence063 2220 6263 gene locus_tag LOCUS_16240 2220 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 6572 8836 gene locus_tag LOCUS_16250 6572 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 8990 11593 gene locus_tag LOCUS_16260 gene clpB 8990 11593 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939160.1 protein_id gnl|my_center|LOCUS_16260 13603 11627 gene locus_tag LOCUS_16270 13603 11627 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259283.1 protein_id gnl|my_center|LOCUS_16270 15060 13831 gene locus_tag LOCUS_16280 15060 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 15885 15124 gene locus_tag LOCUS_16290 gene tpiA 15885 15124 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_16290 17090 15885 gene locus_tag LOCUS_16300 17090 15885 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_16300 18102 17101 gene locus_tag LOCUS_16310 gene gap 18102 17101 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_16310 18896 18093 gene locus_tag LOCUS_16320 18896 18093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence064 3545 408 gene locus_tag LOCUS_16330 3545 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 6522 3829 gene locus_tag LOCUS_16340 6522 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 7499 6525 gene locus_tag LOCUS_16350 7499 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 8483 7755 gene locus_tag LOCUS_16360 8483 7755 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_16360 9795 8764 gene locus_tag LOCUS_16370 gene pheS 9795 8764 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_16370 10291 9938 gene locus_tag LOCUS_16380 gene rplT 10291 9938 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918929.1 protein_id gnl|my_center|LOCUS_16380 10531 10301 gene locus_tag LOCUS_16390 gene rpmI 10531 10301 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 protein_id gnl|my_center|LOCUS_16390 11035 10658 gene locus_tag LOCUS_16400 11035 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 13214 11319 gene locus_tag LOCUS_16410 gene thrS 13214 11319 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869471.1 protein_id gnl|my_center|LOCUS_16410 13324 13248 gene locus_tag LOCUS_t00260 13324 13248 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13519 13434 gene locus_tag LOCUS_t00270 13519 13434 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13651 13578 gene locus_tag LOCUS_t00280 13651 13578 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 14389 14006 gene locus_tag LOCUS_16420 14389 14006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence065 366 1442 gene locus_tag LOCUS_16430 gene queA 366 1442 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943258.1 protein_id gnl|my_center|LOCUS_16430 1599 2231 gene locus_tag LOCUS_16440 1599 2231 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_16440 2505 4340 gene locus_tag LOCUS_16450 gene mutL 2505 4340 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933683.1 protein_id gnl|my_center|LOCUS_16450 4342 5313 gene locus_tag LOCUS_16460 gene miaA 4342 5313 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070933.1 protein_id gnl|my_center|LOCUS_16460 5375 7561 gene locus_tag LOCUS_16470 5375 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 7800 9164 gene locus_tag LOCUS_16480 7800 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 9161 10399 gene locus_tag LOCUS_16490 9161 10399 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530116.1 protein_id gnl|my_center|LOCUS_16490 10586 11725 gene locus_tag LOCUS_16500 10586 11725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 11738 12064 gene locus_tag LOCUS_16510 11738 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 12052 12264 gene locus_tag LOCUS_16520 12052 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 12371 13537 gene locus_tag LOCUS_16530 12371 13537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 13635 15098 gene locus_tag LOCUS_16540 13635 15098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 15177 16721 gene locus_tag LOCUS_16550 15177 16721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 16724 17809 gene locus_tag LOCUS_16560 16724 17809 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172812.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence066 >Feature sequence067 129 203 gene locus_tag LOCUS_t00290 129 203 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 266 339 gene locus_tag LOCUS_t00300 266 339 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 693 3705 gene locus_tag LOCUS_r00010 693 3705 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4004 4104 gene locus_tag LOCUS_r00020 4004 4104 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4318 4551 gene locus_tag LOCUS_16570 4318 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 4783 6198 gene locus_tag LOCUS_16580 4783 6198 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_16580 6214 7446 gene locus_tag LOCUS_16590 6214 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 7761 9110 gene locus_tag LOCUS_16600 gene orpR 7761 9110 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_16600 9740 9138 gene locus_tag LOCUS_16610 9740 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 10280 10642 gene locus_tag LOCUS_16620 10280 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 10709 10897 gene locus_tag LOCUS_16630 10709 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 11085 11345 gene locus_tag LOCUS_16640 11085 11345 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_16640 11342 11761 gene locus_tag LOCUS_16650 11342 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 11758 14472 gene locus_tag LOCUS_16660 11758 14472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16660 14469 16202 gene locus_tag LOCUS_16670 14469 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16670 16199 16441 gene locus_tag LOCUS_16680 16199 16441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 16525 16836 gene locus_tag LOCUS_16690 16525 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 16840 17805 gene locus_tag LOCUS_16700 16840 17805 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812204.1 protein_id gnl|my_center|LOCUS_16700 17905 18282 gene locus_tag LOCUS_16710 17905 18282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence068 2608 1481 gene locus_tag LOCUS_16720 gene hemW 2608 1481 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016482.1 protein_id gnl|my_center|LOCUS_16720 3716 2790 gene locus_tag LOCUS_16730 3716 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 4277 4825 gene locus_tag LOCUS_16740 4277 4825 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_16740 5075 6727 gene locus_tag LOCUS_16750 5075 6727 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088555170.1 protein_id gnl|my_center|LOCUS_16750 6746 7051 gene locus_tag LOCUS_16760 6746 7051 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227980.1 protein_id gnl|my_center|LOCUS_16760 7044 7439 gene locus_tag LOCUS_16770 7044 7439 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249914.1 protein_id gnl|my_center|LOCUS_16770 7535 8695 gene locus_tag LOCUS_16780 7535 8695 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250930.1 protein_id gnl|my_center|LOCUS_16780 8764 9678 gene locus_tag LOCUS_16790 8764 9678 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_16790 9909 10748 gene locus_tag LOCUS_16800 9909 10748 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_16800 11498 10749 gene locus_tag LOCUS_16810 11498 10749 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_16810 11889 11539 gene locus_tag LOCUS_16820 11889 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 12075 12509 gene locus_tag LOCUS_16830 12075 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 12898 12626 gene locus_tag LOCUS_16840 12898 12626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 14617 13214 gene locus_tag LOCUS_16850 gene noeA 14617 13214 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127582344.1 protein_id gnl|my_center|LOCUS_16850 14813 14610 gene locus_tag LOCUS_16860 14813 14610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 18011 14904 gene locus_tag LOCUS_16870 gene nifJ 18011 14904 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence069 1620 202 gene locus_tag LOCUS_16880 1620 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3606 1738 gene locus_tag LOCUS_16890 3606 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 4063 3740 gene locus_tag LOCUS_16900 4063 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 4422 4042 gene locus_tag LOCUS_16910 4422 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 5817 4552 gene locus_tag LOCUS_16920 gene murA 5817 4552 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932242.1 protein_id gnl|my_center|LOCUS_16920 7527 5827 gene locus_tag LOCUS_16930 gene recN 7527 5827 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403565.1 protein_id gnl|my_center|LOCUS_16930 9925 7637 gene locus_tag LOCUS_16940 9925 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 11459 9951 gene locus_tag LOCUS_16950 11459 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 12015 11476 gene locus_tag LOCUS_16960 gene ribE 12015 11476 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933692.1 protein_id gnl|my_center|LOCUS_16960 13118 12057 gene locus_tag LOCUS_16970 13118 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 14485 13277 gene locus_tag LOCUS_16980 14485 13277 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_16980 15134 14487 gene locus_tag LOCUS_16990 15134 14487 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228413.1 protein_id gnl|my_center|LOCUS_16990 16224 15136 gene locus_tag LOCUS_17000 gene ribD 16224 15136 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_17000 17945 16632 gene locus_tag LOCUS_17010 17945 16632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence070 1 1038 gene locus_tag LOCUS_17020 1 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1038 1742 gene locus_tag LOCUS_17030 1038 1742 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546880.1 protein_id gnl|my_center|LOCUS_17030 1751 2146 gene locus_tag LOCUS_17040 1751 2146 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065851.1 protein_id gnl|my_center|LOCUS_17040 2162 2332 gene locus_tag LOCUS_17050 2162 2332 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_17050 2393 3730 gene locus_tag LOCUS_17060 2393 3730 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940529.1 protein_id gnl|my_center|LOCUS_17060 3730 4740 gene locus_tag LOCUS_17070 gene cydB 3730 4740 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940528.1 protein_id gnl|my_center|LOCUS_17070 4745 6781 gene locus_tag LOCUS_17080 4745 6781 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_17080 6886 7482 gene locus_tag LOCUS_17090 6886 7482 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943859.1 protein_id gnl|my_center|LOCUS_17090 7591 8073 gene locus_tag LOCUS_17100 7591 8073 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942833.1 protein_id gnl|my_center|LOCUS_17100 8474 8953 gene locus_tag LOCUS_17110 8474 8953 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349893.1 protein_id gnl|my_center|LOCUS_17110 8950 9384 gene locus_tag LOCUS_17120 8950 9384 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640541.1 protein_id gnl|my_center|LOCUS_17120 11134 9587 gene locus_tag LOCUS_17130 11134 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 13341 11179 gene locus_tag LOCUS_17140 13341 11179 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990677.1 protein_id gnl|my_center|LOCUS_17140 14700 14131 gene locus_tag LOCUS_17150 14700 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 15905 14727 gene locus_tag LOCUS_17160 15905 14727 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582795.1 protein_id gnl|my_center|LOCUS_17160 16158 17231 gene locus_tag LOCUS_17170 16158 17231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 17904 17296 gene locus_tag LOCUS_17180 gene coaE 17904 17296 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583248.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence071 3674 318 gene locus_tag LOCUS_17190 3674 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215436752.1 protein_id gnl|my_center|LOCUS_17190 4369 3671 gene locus_tag LOCUS_17200 4369 3671 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403539.1 protein_id gnl|my_center|LOCUS_17200 6793 4457 gene locus_tag LOCUS_17210 6793 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 7749 6865 gene locus_tag LOCUS_17220 7749 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 9250 7958 gene locus_tag LOCUS_17230 9250 7958 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016767.1 protein_id gnl|my_center|LOCUS_17230 11106 9289 gene locus_tag LOCUS_17240 gene ggt 11106 9289 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021415.1 protein_id gnl|my_center|LOCUS_17240 11857 11282 gene locus_tag LOCUS_17250 11857 11282 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_17250 12383 12904 gene locus_tag LOCUS_17260 12383 12904 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_17260 12892 13767 gene locus_tag LOCUS_17270 12892 13767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 13905 15416 gene locus_tag LOCUS_17280 13905 15416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence072 2370 1183 gene locus_tag LOCUS_17290 2370 1183 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_17290 3055 2633 gene locus_tag LOCUS_17300 3055 2633 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_17300 4492 3068 gene locus_tag LOCUS_17310 4492 3068 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716439.1 protein_id gnl|my_center|LOCUS_17310 10455 4759 gene locus_tag LOCUS_17320 10455 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 <17694 10876 gene locus_tag LOCUS_17330 <17694 10876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405023.1:S8 family serine peptidase >Feature sequence073 1613 159 gene locus_tag LOCUS_17340 gene floT 1613 159 CDS product flotillin lipid rafts scaffold protein FloT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228960.1 protein_id gnl|my_center|LOCUS_17340 2222 1767 gene locus_tag LOCUS_17350 2222 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3926 2244 gene locus_tag LOCUS_17360 3926 2244 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_17360 5164 4061 gene locus_tag LOCUS_17370 5164 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 6432 5269 gene locus_tag LOCUS_17380 6432 5269 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898036.1 protein_id gnl|my_center|LOCUS_17380 6691 6476 gene locus_tag LOCUS_17390 6691 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 8201 6693 gene locus_tag LOCUS_17400 8201 6693 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931965.1 protein_id gnl|my_center|LOCUS_17400 9726 8272 gene locus_tag LOCUS_17410 gene hisS 9726 8272 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_17410 10063 11067 gene locus_tag LOCUS_17420 10063 11067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 11048 12172 gene locus_tag LOCUS_17430 11048 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 12221 13315 gene locus_tag LOCUS_17440 12221 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839453.1 protein_id gnl|my_center|LOCUS_17440 14491 13409 gene locus_tag LOCUS_17450 14491 13409 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206646.1 protein_id gnl|my_center|LOCUS_17450 15051 14488 gene locus_tag LOCUS_17460 15051 14488 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645314.1 protein_id gnl|my_center|LOCUS_17460 17234 15090 gene locus_tag LOCUS_17470 17234 15090 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841931.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence074 <1 1672 gene locus_tag LOCUS_17480 <1 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005799138.1:S8 family serine peptidase 2095 3609 gene locus_tag LOCUS_17490 2095 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3640 6351 gene locus_tag LOCUS_17500 3640 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 6368 8554 gene locus_tag LOCUS_17510 6368 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 8570 10705 gene locus_tag LOCUS_17520 8570 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 10705 12900 gene locus_tag LOCUS_17530 10705 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 13156 16203 gene locus_tag LOCUS_17540 13156 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 17016 16234 gene locus_tag LOCUS_17550 17016 16234 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092159.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence075 1141 614 gene locus_tag LOCUS_17560 1141 614 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17560 1761 1138 gene locus_tag LOCUS_17570 gene recR 1761 1138 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_17570 2975 2001 gene locus_tag LOCUS_17580 2975 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 4597 2975 gene locus_tag LOCUS_17590 4597 2975 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_17590 5320 4610 gene locus_tag LOCUS_17600 5320 4610 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_17600 6257 5325 gene locus_tag LOCUS_17610 6257 5325 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_17610 6574 9477 gene locus_tag LOCUS_17620 6574 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 10399 9590 gene locus_tag LOCUS_17630 10399 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 10715 13942 gene locus_tag LOCUS_17640 gene mfd 10715 13942 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402849.1 protein_id gnl|my_center|LOCUS_17640 13897 16377 gene locus_tag LOCUS_17650 13897 16377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence076 1097 1171 gene locus_tag LOCUS_t00310 1097 1171 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2957 1263 gene locus_tag LOCUS_17660 2957 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4848 3028 gene locus_tag LOCUS_17670 4848 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5632 4955 gene locus_tag LOCUS_17680 5632 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 9609 5635 gene locus_tag LOCUS_17690 9609 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 10717 9659 gene locus_tag LOCUS_17700 10717 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 13671 10762 gene locus_tag LOCUS_17710 13671 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 15728 13710 gene locus_tag LOCUS_17720 15728 13710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 17133 15883 gene locus_tag LOCUS_17730 17133 15883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence077 1609 524 gene locus_tag LOCUS_17740 gene lptG 1609 524 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_17740 2792 1596 gene locus_tag LOCUS_17750 2792 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 3643 2867 gene locus_tag LOCUS_17760 gene cobB2 3643 2867 CDS product NAD-dependent protein deacylase Cob2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877626.1 protein_id gnl|my_center|LOCUS_17760 4990 3734 gene locus_tag LOCUS_17770 4990 3734 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256635.1 protein_id gnl|my_center|LOCUS_17770 5348 5103 gene locus_tag LOCUS_17780 5348 5103 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_17780 7359 5614 gene locus_tag LOCUS_17790 7359 5614 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_17790 7547 7474 gene locus_tag LOCUS_t00320 7547 7474 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7861 7788 gene locus_tag LOCUS_t00330 7861 7788 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13484 8514 gene locus_tag LOCUS_17800 13484 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 15165 13729 gene locus_tag LOCUS_17810 gene spoVR 15165 13729 CDS product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233364.1 protein_id gnl|my_center|LOCUS_17810 16400 15162 gene locus_tag LOCUS_17820 gene yhbH 16400 15162 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963900.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence078 1145 678 gene locus_tag LOCUS_17830 1145 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1994 1248 gene locus_tag LOCUS_17840 1994 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2905 2066 gene locus_tag LOCUS_17850 gene panC 2905 2066 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084897.1 protein_id gnl|my_center|LOCUS_17850 4903 3056 gene locus_tag LOCUS_17860 gene metG 4903 3056 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228577.1 protein_id gnl|my_center|LOCUS_17860 5706 4954 gene locus_tag LOCUS_17870 5706 4954 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_17870 6845 5703 gene locus_tag LOCUS_17880 6845 5703 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403619.1 protein_id gnl|my_center|LOCUS_17880 8099 6864 gene locus_tag LOCUS_17890 8099 6864 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546667.1 protein_id gnl|my_center|LOCUS_17890 8297 8734 gene locus_tag LOCUS_17900 gene rplM 8297 8734 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933443.1 protein_id gnl|my_center|LOCUS_17900 8787 9179 gene locus_tag LOCUS_17910 gene rpsI 8787 9179 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_17910 9133 10071 gene locus_tag LOCUS_17920 9133 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 10071 10667 gene locus_tag LOCUS_17930 gene tsf 10071 10667 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_17930 10670 11389 gene locus_tag LOCUS_17940 gene pyrH 10670 11389 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_17940 11431 11949 gene locus_tag LOCUS_17950 gene frr 11431 11949 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_17950 12062 12256 gene locus_tag LOCUS_17960 12062 12256 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390530.1 protein_id gnl|my_center|LOCUS_17960 12433 13128 gene locus_tag LOCUS_17970 12433 13128 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546731.1 protein_id gnl|my_center|LOCUS_17970 13125 14891 gene locus_tag LOCUS_17980 gene phoR 13125 14891 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_17980 15168 16328 gene locus_tag LOCUS_17990 15168 16328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence079 1275 19 gene locus_tag LOCUS_18000 1275 19 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073547.1 protein_id gnl|my_center|LOCUS_18000 1956 1285 gene locus_tag LOCUS_18010 1956 1285 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073546.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence080 2533 4299 gene locus_tag LOCUS_18020 2533 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 4388 5995 gene locus_tag LOCUS_18030 4388 5995 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_18030 6833 6063 gene locus_tag LOCUS_18040 6833 6063 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_18040 7915 6830 gene locus_tag LOCUS_18050 gene gcvT 7915 6830 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_18050 8919 8380 gene locus_tag LOCUS_18060 8919 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 9205 11718 gene locus_tag LOCUS_18070 9205 11718 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838538.1 protein_id gnl|my_center|LOCUS_18070 11950 13245 gene locus_tag LOCUS_18080 11950 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 13863 13348 gene locus_tag LOCUS_18090 13863 13348 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107788.1 protein_id gnl|my_center|LOCUS_18090 14096 15022 gene locus_tag LOCUS_18100 14096 15022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 15029 16114 gene locus_tag LOCUS_18110 15029 16114 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence081 413 3079 gene locus_tag LOCUS_18120 413 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 3264 3112 gene locus_tag LOCUS_18130 3264 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 3242 6106 gene locus_tag LOCUS_18140 3242 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 6358 6717 gene locus_tag LOCUS_18150 6358 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 6939 7778 gene locus_tag LOCUS_18160 6939 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 7778 8236 gene locus_tag LOCUS_18170 7778 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 8237 8809 gene locus_tag LOCUS_18180 8237 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 8934 9299 gene locus_tag LOCUS_18190 8934 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 9340 9609 gene locus_tag LOCUS_18200 9340 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 9654 12080 gene locus_tag LOCUS_18210 9654 12080 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948260.1 protein_id gnl|my_center|LOCUS_18210 12185 12853 gene locus_tag LOCUS_18220 12185 12853 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_18220 12962 14287 gene locus_tag LOCUS_18230 gene pfp 12962 14287 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_18230 15727 14924 gene locus_tag LOCUS_18240 15727 14924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 15842 15994 gene locus_tag LOCUS_18250 15842 15994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence082 2366 675 gene locus_tag LOCUS_18260 2366 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 3050 2796 gene locus_tag LOCUS_18270 3050 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 3878 3054 gene locus_tag LOCUS_18280 3878 3054 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_18280 4089 3835 gene locus_tag LOCUS_18290 4089 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5828 4113 gene locus_tag LOCUS_18300 5828 4113 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524295.1 protein_id gnl|my_center|LOCUS_18300 6846 6067 gene locus_tag LOCUS_18310 6846 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 7971 6997 gene locus_tag LOCUS_18320 7971 6997 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_18320 9021 7978 gene locus_tag LOCUS_18330 9021 7978 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_18330 10213 9191 gene locus_tag LOCUS_18340 10213 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 10836 10402 gene locus_tag LOCUS_18350 10836 10402 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_18350 10934 11392 gene locus_tag LOCUS_18360 10934 11392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 11878 11411 gene locus_tag LOCUS_18370 11878 11411 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073661.1 protein_id gnl|my_center|LOCUS_18370 12960 11983 gene locus_tag LOCUS_18380 12960 11983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 14347 13157 gene locus_tag LOCUS_18390 14347 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 15332 14481 gene locus_tag LOCUS_18400 15332 14481 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927154.1 protein_id gnl|my_center|LOCUS_18400 16098 15325 gene locus_tag LOCUS_18410 16098 15325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876244.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence083 2544 1333 gene locus_tag LOCUS_18420 gene hydF 2544 1333 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_18420 4003 2552 gene locus_tag LOCUS_18430 gene hydG 4003 2552 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079985.1 protein_id gnl|my_center|LOCUS_18430 5087 3993 gene locus_tag LOCUS_18440 gene hydE 5087 3993 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_18440 7093 5162 gene locus_tag LOCUS_18450 7093 5162 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_18450 8808 7090 gene locus_tag LOCUS_18460 gene nuoF 8808 7090 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_18460 10185 8854 gene locus_tag LOCUS_18470 10185 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 10667 10182 gene locus_tag LOCUS_18480 10667 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 11616 10741 gene locus_tag LOCUS_18490 11616 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 13484 11640 gene locus_tag LOCUS_18500 13484 11640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 14398 13544 gene locus_tag LOCUS_18510 14398 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 15953 14406 gene locus_tag LOCUS_18520 15953 14406 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence084 817 1800 gene locus_tag LOCUS_18530 817 1800 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658378.1 protein_id gnl|my_center|LOCUS_18530 1940 5059 gene locus_tag LOCUS_18540 1940 5059 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_18540 5959 5510 gene locus_tag LOCUS_18550 gene rplI 5959 5510 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_18550 6757 6209 gene locus_tag LOCUS_18560 6757 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 7423 6761 gene locus_tag LOCUS_18570 7423 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 8100 7522 gene locus_tag LOCUS_18580 gene pth 8100 7522 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_18580 8781 8140 gene locus_tag LOCUS_18590 8781 8140 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678895.1 protein_id gnl|my_center|LOCUS_18590 9799 8873 gene locus_tag LOCUS_18600 9799 8873 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838396.1 protein_id gnl|my_center|LOCUS_18600 9908 9836 gene locus_tag LOCUS_t00340 9908 9836 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10303 10028 gene locus_tag LOCUS_18610 gene spoVG 10303 10028 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_18610 11210 10341 gene locus_tag LOCUS_18620 gene ispE 11210 10341 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545467.1 protein_id gnl|my_center|LOCUS_18620 12144 11200 gene locus_tag LOCUS_18630 12144 11200 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_18630 13066 12422 gene locus_tag LOCUS_18640 13066 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 15276 13063 gene locus_tag LOCUS_18650 15276 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 16061 15591 gene locus_tag LOCUS_18660 16061 15591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence085 190 2166 gene locus_tag LOCUS_18670 190 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2159 4141 gene locus_tag LOCUS_18680 2159 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 4265 4570 gene locus_tag LOCUS_18690 4265 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 4574 5254 gene locus_tag LOCUS_18700 4574 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 6488 5331 gene locus_tag LOCUS_18710 6488 5331 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_18710 7136 6504 gene locus_tag LOCUS_18720 gene rnc 7136 6504 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_18720 8539 7283 gene locus_tag LOCUS_18730 gene fabF 8539 7283 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_18730 8797 8564 gene locus_tag LOCUS_18740 gene acpP 8797 8564 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942249.1 protein_id gnl|my_center|LOCUS_18740 9895 8825 gene locus_tag LOCUS_18750 gene plsX 9895 8825 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_18750 10587 10117 gene locus_tag LOCUS_18760 10587 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 12040 10673 gene locus_tag LOCUS_18770 gene mgtE 12040 10673 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_18770 12831 12037 gene locus_tag LOCUS_18780 gene rsmA 12831 12037 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016282.1 protein_id gnl|my_center|LOCUS_18780 13997 12837 gene locus_tag LOCUS_18790 13997 12837 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880128.1 protein_id gnl|my_center|LOCUS_18790 14920 14006 gene locus_tag LOCUS_18800 gene dapF 14920 14006 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence086 84 869 gene locus_tag LOCUS_18810 84 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 872 1507 gene locus_tag LOCUS_18820 872 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1540 2103 gene locus_tag LOCUS_18830 1540 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2123 2722 gene locus_tag LOCUS_18840 2123 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2804 4222 gene locus_tag LOCUS_18850 2804 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 4317 5957 gene locus_tag LOCUS_18860 4317 5957 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582971.1 protein_id gnl|my_center|LOCUS_18860 6051 9608 gene locus_tag LOCUS_18870 6051 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 9709 11451 gene locus_tag LOCUS_18880 gene pilB 9709 11451 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_18880 11487 12740 gene locus_tag LOCUS_18890 11487 12740 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_18890 12867 13646 gene locus_tag LOCUS_18900 12867 13646 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393059.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence087 <1 968 gene locus_tag LOCUS_18910 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942081.1:ABC transporter permease 975 1388 gene locus_tag LOCUS_18920 975 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 1388 1738 gene locus_tag LOCUS_18930 1388 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1710 2099 gene locus_tag LOCUS_18940 1710 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2109 2465 gene locus_tag LOCUS_18950 2109 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2511 3650 gene locus_tag LOCUS_18960 2511 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 4365 3661 gene locus_tag LOCUS_18970 4365 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 4936 4370 gene locus_tag LOCUS_18980 4936 4370 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390290.1 protein_id gnl|my_center|LOCUS_18980 5083 6339 gene locus_tag LOCUS_18990 gene ahcY 5083 6339 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_18990 6422 6652 gene locus_tag LOCUS_19000 6422 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 6812 8755 gene locus_tag LOCUS_19010 gene asnB 6812 8755 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_19010 8974 9495 gene locus_tag LOCUS_19020 8974 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 9633 10085 gene locus_tag LOCUS_19030 9633 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 10102 11427 gene locus_tag LOCUS_19040 gene mtaB 10102 11427 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_19040 11873 13321 gene locus_tag LOCUS_19050 11873 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 15163 13379 gene locus_tag LOCUS_19060 gene ptsP 15163 13379 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence088 <1 1100 gene locus_tag LOCUS_19070 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813193.1:signal recognition particle protein 538 628 gene locus_tag LOCUS_t00350 538 628 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1120 1392 gene locus_tag LOCUS_19080 1120 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 1431 2246 gene locus_tag LOCUS_19090 1431 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2200 2811 gene locus_tag LOCUS_19100 gene rimM 2200 2811 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_19100 2808 3506 gene locus_tag LOCUS_19110 gene trmD 2808 3506 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_19110 3513 3863 gene locus_tag LOCUS_19120 gene rplS 3513 3863 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003629071.1 protein_id gnl|my_center|LOCUS_19120 3996 4562 gene locus_tag LOCUS_19130 3996 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 4564 6402 gene locus_tag LOCUS_19140 4564 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 6441 6830 gene locus_tag LOCUS_19150 6441 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 10736 7374 gene locus_tag LOCUS_19160 10736 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 13564 11231 gene locus_tag LOCUS_19170 13564 11231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 14687 13566 gene locus_tag LOCUS_19180 14687 13566 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405266.1 protein_id gnl|my_center|LOCUS_19180 <15537 14950 gene locus_tag LOCUS_19190 <15537 14950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868007.1:sodium ion-translocating decarboxylase subunit beta >Feature sequence089 1226 87 gene locus_tag LOCUS_19200 gene metK 1226 87 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_19200 2229 1252 gene locus_tag LOCUS_19210 2229 1252 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_19210 3406 2258 gene locus_tag LOCUS_19220 3406 2258 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_19220 4989 3433 gene locus_tag LOCUS_19230 4989 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 6651 5005 gene locus_tag LOCUS_19240 6651 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 7524 6682 gene locus_tag LOCUS_19250 7524 6682 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_19250 8028 7549 gene locus_tag LOCUS_19260 gene lspA 8028 7549 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_19260 8462 8028 gene locus_tag LOCUS_19270 8462 8028 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926834.1 protein_id gnl|my_center|LOCUS_19270 11661 8476 gene locus_tag LOCUS_19280 gene ileS 11661 8476 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_19280 12529 11687 gene locus_tag LOCUS_19290 12529 11687 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_19290 13004 12519 gene locus_tag LOCUS_19300 13004 12519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 13990 13280 gene locus_tag LOCUS_19310 13990 13280 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_19310 14232 14912 gene locus_tag LOCUS_19320 14232 14912 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020681.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence090 <1 1357 gene locus_tag LOCUS_19330 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966175.1:CTP synthase 1338 2510 gene locus_tag LOCUS_19340 1338 2510 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_19340 2486 3478 gene locus_tag LOCUS_19350 2486 3478 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140017877.1 protein_id gnl|my_center|LOCUS_19350 3501 3866 gene locus_tag LOCUS_19360 gene folB 3501 3866 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262834.1 protein_id gnl|my_center|LOCUS_19360 3859 4371 gene locus_tag LOCUS_19370 gene folK 3859 4371 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242690.1 protein_id gnl|my_center|LOCUS_19370 4372 5013 gene locus_tag LOCUS_19380 4372 5013 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_19380 5015 5194 gene locus_tag LOCUS_19390 5015 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 5298 7325 gene locus_tag LOCUS_19400 5298 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 7381 7788 gene locus_tag LOCUS_19410 7381 7788 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_19410 7767 8243 gene locus_tag LOCUS_19420 7767 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 8240 8794 gene locus_tag LOCUS_19430 8240 8794 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081962.1 protein_id gnl|my_center|LOCUS_19430 8791 10182 gene locus_tag LOCUS_19440 gene purF 8791 10182 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086941.1 protein_id gnl|my_center|LOCUS_19440 10186 11148 gene locus_tag LOCUS_19450 10186 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 12209 12880 gene locus_tag LOCUS_19460 12209 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 12957 15125 gene locus_tag LOCUS_19470 12957 15125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence091 <1 1152 gene locus_tag LOCUS_19480 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931980.1:30S ribosomal protein S1 1706 1239 gene locus_tag LOCUS_19490 1706 1239 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022240.1 protein_id gnl|my_center|LOCUS_19490 1951 4707 gene locus_tag LOCUS_19500 1951 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 5011 8334 gene locus_tag LOCUS_19510 5011 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 9060 8407 gene locus_tag LOCUS_19520 9060 8407 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_19520 9274 9939 gene locus_tag LOCUS_19530 gene elbB 9274 9939 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210143.1 protein_id gnl|my_center|LOCUS_19530 10043 11422 gene locus_tag LOCUS_19540 gene fumC 10043 11422 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_19540 11736 12989 gene locus_tag LOCUS_19550 11736 12989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 13245 14570 gene locus_tag LOCUS_19560 13245 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 14741 15237 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtgttactgaccctaatttggggggtacaaacagg >Feature sequence092 2490 3926 gene locus_tag LOCUS_19570 2490 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 4204 6237 gene locus_tag LOCUS_19580 4204 6237 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841931.1 protein_id gnl|my_center|LOCUS_19580 6212 7468 gene locus_tag LOCUS_19590 6212 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 9156 7483 gene locus_tag LOCUS_19600 9156 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 10770 9511 gene locus_tag LOCUS_19610 10770 9511 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162518500.1 protein_id gnl|my_center|LOCUS_19610 10931 14857 gene locus_tag LOCUS_19620 10931 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence093 240 617 gene locus_tag LOCUS_19630 240 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 614 2227 gene locus_tag LOCUS_19640 gene argS 614 2227 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086456.1 protein_id gnl|my_center|LOCUS_19640 2279 3193 gene locus_tag LOCUS_19650 2279 3193 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_19650 3264 4298 gene locus_tag LOCUS_19660 gene mtnA 3264 4298 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_19660 4397 6010 gene locus_tag LOCUS_19670 4397 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 6020 6802 gene locus_tag LOCUS_19680 6020 6802 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_19680 6799 7539 gene locus_tag LOCUS_19690 6799 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 7554 12011 gene locus_tag LOCUS_19700 7554 12011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 12134 14389 gene locus_tag LOCUS_19710 gene bamA 12134 14389 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_19710 14402 14971 gene locus_tag LOCUS_19720 14402 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence094 2715 3851 gene locus_tag LOCUS_19730 2715 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 4030 4752 gene locus_tag LOCUS_19740 4030 4752 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439273.1 protein_id gnl|my_center|LOCUS_19740 4754 5932 gene locus_tag LOCUS_19750 4754 5932 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120956.1 protein_id gnl|my_center|LOCUS_19750 5929 7203 gene locus_tag LOCUS_19760 5929 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 7200 7946 gene locus_tag LOCUS_19770 7200 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 9994 8270 gene locus_tag LOCUS_19780 9994 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 <13953 10176 gene locus_tag LOCUS_19790 <13953 10176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477759.1:tandem-95 repeat protein >Feature sequence095 18 908 gene locus_tag LOCUS_19800 18 908 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_19800 974 3502 gene locus_tag LOCUS_19810 974 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 3506 3910 gene locus_tag LOCUS_19820 3506 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3934 5019 gene locus_tag LOCUS_19830 gene sppA 3934 5019 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989751.1 protein_id gnl|my_center|LOCUS_19830 6832 5285 gene locus_tag LOCUS_19840 6832 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 10244 6843 gene locus_tag LOCUS_19850 gene metH 10244 6843 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_19850 12261 10393 gene locus_tag LOCUS_19860 12261 10393 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_19860 13246 12383 gene locus_tag LOCUS_19870 13246 12383 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence096 1196 471 gene locus_tag LOCUS_19880 gene lptB 1196 471 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927114.1 protein_id gnl|my_center|LOCUS_19880 2356 1193 gene locus_tag LOCUS_19890 2356 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2846 2334 gene locus_tag LOCUS_19900 2846 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 3412 2873 gene locus_tag LOCUS_19910 3412 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 3649 4287 gene locus_tag LOCUS_19920 gene lexA 3649 4287 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942262.1 protein_id gnl|my_center|LOCUS_19920 4447 4998 gene locus_tag LOCUS_19930 4447 4998 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062451.1 protein_id gnl|my_center|LOCUS_19930 5228 5611 gene locus_tag LOCUS_19940 5228 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 5740 8907 gene locus_tag LOCUS_19950 5740 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 8988 10622 gene locus_tag LOCUS_19960 8988 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 12561 10696 gene locus_tag LOCUS_19970 12561 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 13442 12558 gene locus_tag LOCUS_19980 gene lipA 13442 12558 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119196.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence097 881 708 gene locus_tag LOCUS_19990 881 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 4450 878 gene locus_tag LOCUS_20000 4450 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 5994 4447 gene locus_tag LOCUS_20010 5994 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 6492 6004 gene locus_tag LOCUS_20020 6492 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 6943 6494 gene locus_tag LOCUS_20030 6943 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 9288 6940 gene locus_tag LOCUS_20040 9288 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 9869 9288 gene locus_tag LOCUS_20050 9869 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179259.1 protein_id gnl|my_center|LOCUS_20050 10860 9814 gene locus_tag LOCUS_20060 10860 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 11395 10919 gene locus_tag LOCUS_20070 11395 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 11663 11379 gene locus_tag LOCUS_20080 11663 11379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 12053 11673 gene locus_tag LOCUS_20090 12053 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 13033 12065 gene locus_tag LOCUS_20100 13033 12065 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039458.1 protein_id gnl|my_center|LOCUS_20100 13793 13053 gene locus_tag LOCUS_20110 13793 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence098 >Feature sequence099 1230 2573 gene locus_tag LOCUS_20120 1230 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 3625 5481 gene locus_tag LOCUS_20130 3625 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 5511 5798 gene locus_tag LOCUS_20140 5511 5798 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_20140 6015 6503 gene locus_tag LOCUS_20150 6015 6503 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022955.1 protein_id gnl|my_center|LOCUS_20150 6500 7708 gene locus_tag LOCUS_20160 gene xseA 6500 7708 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838345.1 protein_id gnl|my_center|LOCUS_20160 7698 7934 gene locus_tag LOCUS_20170 7698 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 7927 9861 gene locus_tag LOCUS_20180 gene dxs 7927 9861 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_20180 9858 10772 gene locus_tag LOCUS_20190 9858 10772 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_20190 10759 11673 gene locus_tag LOCUS_20200 10759 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 11648 12949 gene locus_tag LOCUS_20210 11648 12949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence100 3454 1706 gene locus_tag LOCUS_20220 3454 1706 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_20220 3820 4800 gene locus_tag LOCUS_20230 3820 4800 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228360.1 protein_id gnl|my_center|LOCUS_20230 4973 5908 gene locus_tag LOCUS_20240 4973 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 5896 6672 gene locus_tag LOCUS_20250 5896 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 6672 7607 gene locus_tag LOCUS_20260 6672 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 7835 8926 gene locus_tag LOCUS_20270 gene serC 7835 8926 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_20270 9054 9950 gene locus_tag LOCUS_20280 9054 9950 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948783.1 protein_id gnl|my_center|LOCUS_20280 10170 10946 gene locus_tag LOCUS_20290 10170 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 11011 12372 gene locus_tag LOCUS_20300 11011 12372 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_20300 13169 12456 gene locus_tag LOCUS_20310 13169 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence101 2268 1411 gene locus_tag LOCUS_20320 2268 1411 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_20320 2472 4028 gene locus_tag LOCUS_20330 2472 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 5200 4835 gene locus_tag LOCUS_20340 5200 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004239.1 protein_id gnl|my_center|LOCUS_20340 5596 5210 gene locus_tag LOCUS_20350 5596 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339583.1 protein_id gnl|my_center|LOCUS_20350 6984 5608 gene locus_tag LOCUS_20360 6984 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119899931.1 protein_id gnl|my_center|LOCUS_20360 7355 7068 gene locus_tag LOCUS_20370 7355 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 7935 8153 gene locus_tag LOCUS_20380 7935 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 8518 8210 gene locus_tag LOCUS_20390 8518 8210 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403823.1 protein_id gnl|my_center|LOCUS_20390 8758 8549 gene locus_tag LOCUS_20400 8758 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 8799 10097 gene locus_tag LOCUS_20410 8799 10097 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933230.1 protein_id gnl|my_center|LOCUS_20410 10115 11026 gene locus_tag LOCUS_20420 10115 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 11036 11743 gene locus_tag LOCUS_20430 gene ispD 11036 11743 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_20430 11749 12222 gene locus_tag LOCUS_20440 gene ispF 11749 12222 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933265.1 protein_id gnl|my_center|LOCUS_20440 12359 13258 gene locus_tag LOCUS_20450 12359 13258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence102 1242 2162 gene locus_tag LOCUS_20460 1242 2162 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_20460 2131 2676 gene locus_tag LOCUS_20470 2131 2676 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064908.1 protein_id gnl|my_center|LOCUS_20470 2673 3809 gene locus_tag LOCUS_20480 2673 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 3799 4626 gene locus_tag LOCUS_20490 3799 4626 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942215.1 protein_id gnl|my_center|LOCUS_20490 4689 5678 gene locus_tag LOCUS_20500 4689 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 6016 8139 gene locus_tag LOCUS_20510 6016 8139 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_20510 8174 9415 gene locus_tag LOCUS_20520 gene sat 8174 9415 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_20520 9473 9913 gene locus_tag LOCUS_20530 gene aprB 9473 9913 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546160.1 protein_id gnl|my_center|LOCUS_20530 9927 11813 gene locus_tag LOCUS_20540 gene aprA 9927 11813 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_20540 11975 12187 gene locus_tag LOCUS_20550 11975 12187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 12208 13038 gene locus_tag LOCUS_20560 12208 13038 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence103 9527 912 gene locus_tag LOCUS_20570 9527 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 9999 11099 gene locus_tag LOCUS_20580 9999 11099 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_20580 11431 11147 gene locus_tag LOCUS_20590 11431 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence104 440 1012 gene locus_tag LOCUS_20600 440 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 1116 1358 gene locus_tag LOCUS_20610 1116 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 1361 1549 gene locus_tag LOCUS_20620 1361 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 1584 2885 gene locus_tag LOCUS_20630 1584 2885 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_20630 3002 3802 gene locus_tag LOCUS_20640 3002 3802 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_20640 3870 4739 gene locus_tag LOCUS_20650 3870 4739 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_20650 4785 5066 gene locus_tag LOCUS_20660 4785 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 5073 7601 gene locus_tag LOCUS_20670 5073 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 7745 8206 gene locus_tag LOCUS_20680 7745 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 8209 8442 gene locus_tag LOCUS_20690 8209 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 8654 9688 gene locus_tag LOCUS_20700 8654 9688 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730444.1 protein_id gnl|my_center|LOCUS_20700 9996 11147 gene locus_tag LOCUS_20710 gene acdA 9996 11147 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_20710 11223 11567 gene locus_tag LOCUS_20720 11223 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence105 3460 383 gene locus_tag LOCUS_20730 3460 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4734 3673 gene locus_tag LOCUS_20740 gene porV 4734 3673 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_20740 5785 4799 gene locus_tag LOCUS_20750 5785 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 9924 6049 gene locus_tag LOCUS_20760 gene porU 9924 6049 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_20760 10093 9902 gene locus_tag LOCUS_20770 10093 9902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 10294 10130 gene locus_tag LOCUS_20780 10294 10130 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_20780 10871 10437 gene locus_tag LOCUS_20790 10871 10437 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405066.1 protein_id gnl|my_center|LOCUS_20790 11815 10856 gene locus_tag LOCUS_20800 11815 10856 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931855.1 protein_id gnl|my_center|LOCUS_20800 <12869 11816 gene locus_tag LOCUS_20810 <12869 11816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020404386.1:glycosyltransferase >Feature sequence106 393 620 gene locus_tag LOCUS_20820 393 620 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393808.1 protein_id gnl|my_center|LOCUS_20820 733 1662 gene locus_tag LOCUS_20830 733 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1763 3064 gene locus_tag LOCUS_20840 1763 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3155 3835 gene locus_tag LOCUS_20850 3155 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3837 4703 gene locus_tag LOCUS_20860 3837 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 4706 5419 gene locus_tag LOCUS_20870 4706 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 5640 6755 gene locus_tag LOCUS_20880 5640 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 6773 7726 gene locus_tag LOCUS_20890 6773 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 7757 8314 gene locus_tag LOCUS_20900 7757 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 8292 8546 gene locus_tag LOCUS_20910 8292 8546 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065663.1 protein_id gnl|my_center|LOCUS_20910 8588 9571 gene locus_tag LOCUS_20920 8588 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 9574 10548 gene locus_tag LOCUS_20930 9574 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 10607 11461 gene locus_tag LOCUS_20940 10607 11461 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence107 2172 385 gene locus_tag LOCUS_20950 2172 385 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_20950 3343 2180 gene locus_tag LOCUS_20960 3343 2180 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986854.1 protein_id gnl|my_center|LOCUS_20960 4018 3524 gene locus_tag LOCUS_20970 4018 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4438 4022 gene locus_tag LOCUS_20980 4438 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 4890 4435 gene locus_tag LOCUS_20990 4890 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 5266 8100 gene locus_tag LOCUS_21000 5266 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 8479 10026 gene locus_tag LOCUS_21010 8479 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 10140 11150 gene locus_tag LOCUS_21020 10140 11150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence108 333 139 gene locus_tag LOCUS_21030 333 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 563 318 gene locus_tag LOCUS_21040 563 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1342 575 gene locus_tag LOCUS_21050 1342 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1985 1344 gene locus_tag LOCUS_21060 1985 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2192 2013 gene locus_tag LOCUS_21070 2192 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2380 2186 gene locus_tag LOCUS_21080 2380 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2678 2436 gene locus_tag LOCUS_21090 2678 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 3235 3432 gene locus_tag LOCUS_21100 3235 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 3532 3720 gene locus_tag LOCUS_21110 3532 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 3737 4051 gene locus_tag LOCUS_21120 3737 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 4073 4366 gene locus_tag LOCUS_21130 4073 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 4339 4548 gene locus_tag LOCUS_21140 4339 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 4536 4916 gene locus_tag LOCUS_21150 4536 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 4913 5053 gene locus_tag LOCUS_21160 4913 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 5010 5225 gene locus_tag LOCUS_21170 5010 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 5229 5492 gene locus_tag LOCUS_21180 5229 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 5646 6173 gene locus_tag LOCUS_21190 5646 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 6176 6577 gene locus_tag LOCUS_21200 6176 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 6669 8177 gene locus_tag LOCUS_21210 6669 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 8375 9073 gene locus_tag LOCUS_21220 8375 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 9121 9744 gene locus_tag LOCUS_21230 9121 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 9762 10040 gene locus_tag LOCUS_21240 9762 10040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 10782 10078 gene locus_tag LOCUS_21250 10782 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 11360 11049 gene locus_tag LOCUS_21260 11360 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 11699 11442 gene locus_tag LOCUS_21270 11699 11442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 11874 11692 gene locus_tag LOCUS_21280 11874 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence109 1829 618 gene locus_tag LOCUS_21290 1829 618 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462130.1 protein_id gnl|my_center|LOCUS_21290 2629 1826 gene locus_tag LOCUS_21300 2629 1826 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938071.1 protein_id gnl|my_center|LOCUS_21300 2952 3434 gene locus_tag LOCUS_21310 2952 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 4836 3454 gene locus_tag LOCUS_21320 4836 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 5168 6397 gene locus_tag LOCUS_21330 5168 6397 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206376.1 protein_id gnl|my_center|LOCUS_21330 7528 6644 gene locus_tag LOCUS_21340 7528 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 7857 10400 gene locus_tag LOCUS_21350 7857 10400 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_21350 10927 11397 gene locus_tag LOCUS_21360 10927 11397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 11711 11484 gene locus_tag LOCUS_21370 11711 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence110 <1 939 gene locus_tag LOCUS_21380 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986707.1:oligopeptide transporter, OPT family 1016 3676 gene locus_tag LOCUS_21390 1016 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3666 4358 gene locus_tag LOCUS_21400 gene nfi 3666 4358 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583138.1 protein_id gnl|my_center|LOCUS_21400 4998 4483 gene locus_tag LOCUS_21410 4998 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 5228 5488 gene locus_tag LOCUS_21420 5228 5488 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228830.1 protein_id gnl|my_center|LOCUS_21420 5489 5914 gene locus_tag LOCUS_21430 5489 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 7640 5916 gene locus_tag LOCUS_21440 7640 5916 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_21440 7755 8105 gene locus_tag LOCUS_21450 7755 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 8241 8798 gene locus_tag LOCUS_21460 8241 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706253.1 protein_id gnl|my_center|LOCUS_21460 9781 9155 gene locus_tag LOCUS_21470 9781 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 10033 9821 gene locus_tag LOCUS_21480 10033 9821 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_21480 10406 11947 gene locus_tag LOCUS_r00030 10406 11947 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence111 480 689 gene locus_tag LOCUS_21490 480 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 701 1132 gene locus_tag LOCUS_21500 701 1132 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_21500 1141 1728 gene locus_tag LOCUS_21510 1141 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1788 3254 gene locus_tag LOCUS_21520 1788 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 3271 4401 gene locus_tag LOCUS_21530 3271 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 4437 4757 gene locus_tag LOCUS_21540 4437 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 4776 5522 gene locus_tag LOCUS_21550 gene fabG 4776 5522 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_21550 5632 6825 gene locus_tag LOCUS_21560 5632 6825 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_21560 6918 7373 gene locus_tag LOCUS_21570 6918 7373 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393877.1 protein_id gnl|my_center|LOCUS_21570 7414 7785 gene locus_tag LOCUS_21580 7414 7785 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_21580 7838 8605 gene locus_tag LOCUS_21590 7838 8605 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_21590 8712 9836 gene locus_tag LOCUS_21600 gene hadC 8712 9836 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_21600 9923 10432 gene locus_tag LOCUS_21610 9923 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 10419 10937 gene locus_tag LOCUS_21620 10419 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 10965 11336 gene locus_tag LOCUS_21630 10965 11336 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928433.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence112 931 1566 gene locus_tag LOCUS_21640 931 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1612 2751 gene locus_tag LOCUS_21650 gene carA 1612 2751 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056605.1 protein_id gnl|my_center|LOCUS_21650 2768 6019 gene locus_tag LOCUS_21660 gene carB 2768 6019 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257643.1 protein_id gnl|my_center|LOCUS_21660 7307 6024 gene locus_tag LOCUS_21670 7307 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence113 110 1942 gene locus_tag LOCUS_21680 110 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2314 3891 gene locus_tag LOCUS_21690 2314 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3934 5463 gene locus_tag LOCUS_21700 3934 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 6022 5660 gene locus_tag LOCUS_21710 6022 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 7782 6328 gene locus_tag LOCUS_21720 7782 6328 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_21720 8202 7783 gene locus_tag LOCUS_21730 8202 7783 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228886.1 protein_id gnl|my_center|LOCUS_21730 10895 8577 gene locus_tag LOCUS_21740 10895 8577 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_21740 <11562 10924 gene locus_tag LOCUS_21750 <11562 10924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000559125.1:two-component system sensor histidine kinase AtoS >Feature sequence114 4112 2250 gene locus_tag LOCUS_21760 4112 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 4387 5727 gene locus_tag LOCUS_21770 4387 5727 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_21770 5787 6185 gene locus_tag LOCUS_21780 5787 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 6203 6412 gene locus_tag LOCUS_21790 6203 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 7397 6546 gene locus_tag LOCUS_21800 7397 6546 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947474.1 protein_id gnl|my_center|LOCUS_21800 8490 7387 gene locus_tag LOCUS_21810 8490 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 8647 10146 gene locus_tag LOCUS_21820 8647 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 10146 11021 gene locus_tag LOCUS_21830 10146 11021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence115 2 1102 gene locus_tag LOCUS_21840 2 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 1194 2177 gene locus_tag LOCUS_21850 gene obgE 1194 2177 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933866.1 protein_id gnl|my_center|LOCUS_21850 2177 3298 gene locus_tag LOCUS_21860 gene dprA 2177 3298 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_21860 3400 4986 gene locus_tag LOCUS_21870 3400 4986 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_21870 5246 5857 gene locus_tag LOCUS_21880 5246 5857 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_21880 5873 6298 gene locus_tag LOCUS_21890 5873 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 6327 6749 gene locus_tag LOCUS_21900 6327 6749 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_21900 6818 7474 gene locus_tag LOCUS_21910 6818 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 7577 8233 gene locus_tag LOCUS_21920 7577 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 8458 10155 gene locus_tag LOCUS_21930 gene dsbD 8458 10155 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958394.1 protein_id gnl|my_center|LOCUS_21930 10304 10627 gene locus_tag LOCUS_21940 gene trxA 10304 10627 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022275.1 protein_id gnl|my_center|LOCUS_21940 10648 11241 gene locus_tag LOCUS_21950 10648 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence116 474 22 gene locus_tag LOCUS_21960 474 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 617 1426 gene locus_tag LOCUS_21970 617 1426 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_21970 1423 2205 gene locus_tag LOCUS_21980 1423 2205 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_21980 2202 3638 gene locus_tag LOCUS_21990 2202 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 3838 4320 gene locus_tag LOCUS_22000 gene greA 3838 4320 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_22000 4334 5368 gene locus_tag LOCUS_22010 gene galT 4334 5368 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943868.1 protein_id gnl|my_center|LOCUS_22010 5375 6367 gene locus_tag LOCUS_22020 5375 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 7054 6485 gene locus_tag LOCUS_22030 gene rsmD 7054 6485 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_22030 8506 7163 gene locus_tag LOCUS_22040 8506 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 10028 8526 gene locus_tag LOCUS_22050 10028 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 <11236 10284 gene locus_tag LOCUS_22060 <11236 10284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405023.1:S8 family serine peptidase >Feature sequence117 <1 556 gene locus_tag LOCUS_22070 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase 2143 932 gene locus_tag LOCUS_22080 2143 932 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799743.1 protein_id gnl|my_center|LOCUS_22080 2933 2169 gene locus_tag LOCUS_22090 2933 2169 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022068.1 protein_id gnl|my_center|LOCUS_22090 4630 3164 gene locus_tag LOCUS_22100 4630 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 5696 4662 gene locus_tag LOCUS_22110 5696 4662 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974772.1 protein_id gnl|my_center|LOCUS_22110 6710 6967 gene locus_tag LOCUS_22120 6710 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 7190 9457 gene locus_tag LOCUS_22130 7190 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 10529 9531 gene locus_tag LOCUS_22140 10529 9531 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875811.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence118 1753 194 gene locus_tag LOCUS_22150 1753 194 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 protein_id gnl|my_center|LOCUS_22150 2666 1740 gene locus_tag LOCUS_22160 2666 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 3476 2772 gene locus_tag LOCUS_22170 3476 2772 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 protein_id gnl|my_center|LOCUS_22170 4546 3500 gene locus_tag LOCUS_22180 4546 3500 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973597.1 protein_id gnl|my_center|LOCUS_22180 6365 4548 gene locus_tag LOCUS_22190 6365 4548 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397828.1 protein_id gnl|my_center|LOCUS_22190 7285 6488 gene locus_tag LOCUS_22200 7285 6488 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397831.1 protein_id gnl|my_center|LOCUS_22200 8284 7289 gene locus_tag LOCUS_22210 8284 7289 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463614.1 protein_id gnl|my_center|LOCUS_22210 10548 8281 gene locus_tag LOCUS_22220 10548 8281 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence119 620 3814 gene locus_tag LOCUS_22230 620 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 3827 4105 gene locus_tag LOCUS_22240 3827 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 4808 4149 gene locus_tag LOCUS_22250 4808 4149 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798173.1 protein_id gnl|my_center|LOCUS_22250 5698 4805 gene locus_tag LOCUS_22260 5698 4805 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927126.1 protein_id gnl|my_center|LOCUS_22260 6312 5896 gene locus_tag LOCUS_22270 6312 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 7478 6309 gene locus_tag LOCUS_22280 7478 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 8416 7475 gene locus_tag LOCUS_22290 8416 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 9252 8533 gene locus_tag LOCUS_22300 gene pdxJ 9252 8533 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482574.1 protein_id gnl|my_center|LOCUS_22300 10318 9365 gene locus_tag LOCUS_22310 10318 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence120 4143 3547 gene locus_tag LOCUS_22320 4143 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22320 5712 4222 gene locus_tag LOCUS_22330 5712 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22330 8009 5724 gene locus_tag LOCUS_22340 8009 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 9448 8006 gene locus_tag LOCUS_22350 9448 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 <10830 9582 gene locus_tag LOCUS_22360 <10830 9582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405023.1:S8 family serine peptidase >Feature sequence121 <1 2861 gene locus_tag LOCUS_22370 <1 2861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838071.1:DPP IV N-terminal domain-containing protein 3037 3966 gene locus_tag LOCUS_22380 3037 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 4095 4694 gene locus_tag LOCUS_22390 4095 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 4840 8079 gene locus_tag LOCUS_22400 4840 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 8209 8655 gene locus_tag LOCUS_22410 8209 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 8866 8780 gene locus_tag LOCUS_t00360 8866 8780 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9050 9220 gene locus_tag LOCUS_22420 9050 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 10379 9417 gene locus_tag LOCUS_22430 10379 9417 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095491983.1 protein_id gnl|my_center|LOCUS_22430 10609 10376 gene locus_tag LOCUS_22440 10609 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence122 310 777 gene locus_tag LOCUS_22450 310 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 807 3086 gene locus_tag LOCUS_22460 gene topA 807 3086 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_22460 3076 3984 gene locus_tag LOCUS_22470 gene xerC 3076 3984 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_22470 3984 4271 gene locus_tag LOCUS_22480 3984 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 4545 5519 gene locus_tag LOCUS_22490 gene hprK 4545 5519 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127244.1 protein_id gnl|my_center|LOCUS_22490 5512 7242 gene locus_tag LOCUS_22500 gene ade 5512 7242 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_22500 7384 8763 gene locus_tag LOCUS_22510 gene glmM 7384 8763 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931952.1 protein_id gnl|my_center|LOCUS_22510 8788 10335 gene locus_tag LOCUS_22520 8788 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence123 2950 2879 gene locus_tag LOCUS_t00370 2950 2879 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3810 3100 gene locus_tag LOCUS_22530 3810 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 4581 4153 gene locus_tag LOCUS_22540 4581 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 4806 6677 gene locus_tag LOCUS_22550 4806 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 6829 8235 gene locus_tag LOCUS_22560 6829 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence124 <1 9071 gene locus_tag LOCUS_22570 <1 9071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase 9165 9353 gene locus_tag LOCUS_22580 9165 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence125 <1 1812 gene locus_tag LOCUS_22590 <1 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037269.1:endonuclease 2423 1968 gene locus_tag LOCUS_22600 2423 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3526 2471 gene locus_tag LOCUS_22610 3526 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 5892 3622 gene locus_tag LOCUS_22620 5892 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 7244 6285 gene locus_tag LOCUS_22630 7244 6285 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813250.1 protein_id gnl|my_center|LOCUS_22630 8886 7465 gene locus_tag LOCUS_22640 8886 7465 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546417.1 protein_id gnl|my_center|LOCUS_22640 10313 8883 gene locus_tag LOCUS_22650 10313 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence126 505 2010 gene locus_tag LOCUS_22660 505 2010 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545685.1 protein_id gnl|my_center|LOCUS_22660 2739 4007 gene locus_tag LOCUS_22670 2739 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 4133 4059 gene locus_tag LOCUS_t00380 4133 4059 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4217 4143 gene locus_tag LOCUS_t00390 4217 4143 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4327 5211 gene locus_tag LOCUS_22680 4327 5211 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_22680 8413 5237 gene locus_tag LOCUS_22690 8413 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 9286 8738 gene locus_tag LOCUS_22700 9286 8738 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_22700 9392 10120 gene locus_tag LOCUS_22710 9392 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence127 >Feature sequence128 6474 256 gene locus_tag LOCUS_22720 6474 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 7530 6673 gene locus_tag LOCUS_22730 7530 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 7809 8882 gene locus_tag LOCUS_22740 gene msrB 7809 8882 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261262.1 protein_id gnl|my_center|LOCUS_22740 9668 8994 gene locus_tag LOCUS_22750 9668 8994 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062678.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence129 <1 943 gene locus_tag LOCUS_22760 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460696.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase 940 2334 gene locus_tag LOCUS_22770 gene murC 940 2334 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403337.1 protein_id gnl|my_center|LOCUS_22770 2426 3364 gene locus_tag LOCUS_22780 gene murB 2426 3364 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963832.1 protein_id gnl|my_center|LOCUS_22780 3348 4244 gene locus_tag LOCUS_22790 3348 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 4302 5549 gene locus_tag LOCUS_22800 gene ftsA 4302 5549 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_22800 5681 6907 gene locus_tag LOCUS_22810 gene ftsZ 5681 6907 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_22810 6964 7752 gene locus_tag LOCUS_22820 6964 7752 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921948.1 protein_id gnl|my_center|LOCUS_22820 7758 8417 gene locus_tag LOCUS_22830 gene ftsE 7758 8417 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564191.1 protein_id gnl|my_center|LOCUS_22830 8420 9274 gene locus_tag LOCUS_22840 8420 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence130 <1 1135 gene locus_tag LOCUS_22850 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929319.1:tetratricopeptide repeat protein 1295 1894 gene locus_tag LOCUS_22860 1295 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2017 2469 gene locus_tag LOCUS_22870 2017 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 2466 3758 gene locus_tag LOCUS_22880 2466 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 4186 4980 gene locus_tag LOCUS_22890 4186 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 4973 5569 gene locus_tag LOCUS_22900 4973 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 5667 6239 gene locus_tag LOCUS_22910 5667 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 6775 6320 gene locus_tag LOCUS_22920 6775 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 7187 6780 gene locus_tag LOCUS_22930 gene fliS 7187 6780 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392287.1 protein_id gnl|my_center|LOCUS_22930 8877 7213 gene locus_tag LOCUS_22940 gene fliD 8877 7213 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938162.1 protein_id gnl|my_center|LOCUS_22940 <9640 9025 gene locus_tag LOCUS_22950 <9640 9025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939359.1:flagellin >Feature sequence131 143 1432 gene locus_tag LOCUS_22960 143 1432 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404565.1 protein_id gnl|my_center|LOCUS_22960 1450 1524 gene locus_tag LOCUS_t00400 1450 1524 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4583 1584 gene locus_tag LOCUS_22970 4583 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 8233 4619 gene locus_tag LOCUS_22980 8233 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 <9576 8454 gene locus_tag LOCUS_22990 <9576 8454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840167.1:T9SS type A sorting domain-containing protein >Feature sequence132 2454 568 gene locus_tag LOCUS_23000 2454 568 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_23000 2663 2451 gene locus_tag LOCUS_23010 2663 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3238 2888 gene locus_tag LOCUS_23020 3238 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987057.1 protein_id gnl|my_center|LOCUS_23020 3711 3235 gene locus_tag LOCUS_23030 3711 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 4211 5032 gene locus_tag LOCUS_23040 gene rsgA 4211 5032 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_23040 5091 5690 gene locus_tag LOCUS_23050 5091 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence133 <1 924 gene locus_tag LOCUS_23060 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392090.1:NAD+ synthase 954 2339 gene locus_tag LOCUS_23070 954 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 3866 2388 gene locus_tag LOCUS_23080 3866 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 4312 3890 gene locus_tag LOCUS_23090 4312 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5481 4342 gene locus_tag LOCUS_23100 gene dnaJ 5481 4342 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933150.1 protein_id gnl|my_center|LOCUS_23100 6073 5474 gene locus_tag LOCUS_23110 gene grpE 6073 5474 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_23110 7178 6081 gene locus_tag LOCUS_23120 gene hrcA 7178 6081 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933152.1 protein_id gnl|my_center|LOCUS_23120 7407 8804 gene locus_tag LOCUS_23130 gene lpdA 7407 8804 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271667.1 protein_id gnl|my_center|LOCUS_23130 8958 8779 gene locus_tag LOCUS_23140 8958 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence134 <1 4143 gene locus_tag LOCUS_23150 <1 4143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase 4653 4348 gene locus_tag LOCUS_23160 4653 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 7763 4728 gene locus_tag LOCUS_23170 7763 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 9059 8109 gene locus_tag LOCUS_23180 9059 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence135 605 3991 gene locus_tag LOCUS_23190 605 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 5075 4299 gene locus_tag LOCUS_23200 5075 4299 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_23200 6859 5072 gene locus_tag LOCUS_23210 6859 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 8453 6912 gene locus_tag LOCUS_23220 gene guaA 8453 6912 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence136 2742 3188 gene locus_tag LOCUS_23230 2742 3188 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_23230 3305 3448 gene locus_tag LOCUS_23240 3305 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 3755 5164 gene locus_tag LOCUS_23250 3755 5164 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943972.1 protein_id gnl|my_center|LOCUS_23250 5168 5689 gene locus_tag LOCUS_23260 5168 5689 CDS product Isopropylmalate/citramalate isomerase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870790.1 protein_id gnl|my_center|LOCUS_23260 5763 6068 gene locus_tag LOCUS_23270 5763 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 6068 6364 gene locus_tag LOCUS_23280 6068 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 6361 7926 gene locus_tag LOCUS_23290 6361 7926 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence137 >Feature sequence138 3464 870 gene locus_tag LOCUS_23300 3464 870 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_23300 3709 3527 gene locus_tag LOCUS_23310 3709 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3890 4093 gene locus_tag LOCUS_23320 3890 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 6185 4062 gene locus_tag LOCUS_23330 6185 4062 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_23330 6920 6558 gene locus_tag LOCUS_tm00010 6920 6558 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 <8323 7052 gene locus_tag LOCUS_23340 <8323 7052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942056.1:Mrp/NBP35 family ATP-binding protein >Feature sequence139 1468 1205 gene locus_tag LOCUS_23350 1468 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545371.1 protein_id gnl|my_center|LOCUS_23350 2568 1486 gene locus_tag LOCUS_23360 gene dsrB 2568 1486 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546493.1 protein_id gnl|my_center|LOCUS_23360 3903 2680 gene locus_tag LOCUS_23370 gene dsrA 3903 2680 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393107.1 protein_id gnl|my_center|LOCUS_23370 6221 3963 gene locus_tag LOCUS_23380 6221 3963 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878165.1 protein_id gnl|my_center|LOCUS_23380 7463 6225 gene locus_tag LOCUS_23390 7463 6225 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546111.1 protein_id gnl|my_center|LOCUS_23390 <8297 7475 gene locus_tag LOCUS_23400 <8297 7475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932549.1:quinone-interacting membrane-bound oxidoreductase complex subunit QmoC >Feature sequence140 1022 591 gene locus_tag LOCUS_23410 1022 591 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140634.1 protein_id gnl|my_center|LOCUS_23410 1258 1019 gene locus_tag LOCUS_23420 1258 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 3478 1724 gene locus_tag LOCUS_23430 3478 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 5529 3796 gene locus_tag LOCUS_23440 5529 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 5576 5713 gene locus_tag LOCUS_23450 5576 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 6251 6493 gene locus_tag LOCUS_23460 6251 6493 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392534.1 protein_id gnl|my_center|LOCUS_23460 6487 6843 gene locus_tag LOCUS_23470 gene mazF 6487 6843 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_23470 7248 7619 gene locus_tag LOCUS_23480 7248 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 7659 7877 gene locus_tag LOCUS_23490 7659 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence141 1383 616 gene locus_tag LOCUS_23500 1383 616 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_23500 2353 1454 gene locus_tag LOCUS_23510 gene rfbD 2353 1454 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_23510 2825 2355 gene locus_tag LOCUS_23520 gene purE 2825 2355 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_23520 3882 2830 gene locus_tag LOCUS_23530 3882 2830 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_23530 4770 3955 gene locus_tag LOCUS_23540 4770 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 5707 4913 gene locus_tag LOCUS_23550 5707 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 6826 5801 gene locus_tag LOCUS_23560 6826 5801 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_23560 7570 6968 gene locus_tag LOCUS_23570 7570 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence142 506 1351 gene locus_tag LOCUS_23580 gene speB 506 1351 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125998.1 protein_id gnl|my_center|LOCUS_23580 1585 1409 gene locus_tag LOCUS_23590 1585 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1611 3218 gene locus_tag LOCUS_23600 1611 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 3249 4949 gene locus_tag LOCUS_23610 3249 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 5075 5752 gene locus_tag LOCUS_23620 5075 5752 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258299.1 protein_id gnl|my_center|LOCUS_23620 5838 5912 gene locus_tag LOCUS_t00410 5838 5912 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7453 5879 gene locus_tag LOCUS_23630 7453 5879 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence143 2696 1395 gene locus_tag LOCUS_23640 2696 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2927 3214 gene locus_tag LOCUS_23650 2927 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 3264 3339 gene locus_tag LOCUS_t00420 3264 3339 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3804 5000 gene locus_tag LOCUS_23660 3804 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 5132 6595 gene locus_tag LOCUS_23670 5132 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence144 >Feature sequence145 <1 581 gene locus_tag LOCUS_23680 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256392.1:branched-chain amino acid transaminase 591 1073 gene locus_tag LOCUS_23690 gene nusB 591 1073 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402806.1 protein_id gnl|my_center|LOCUS_23690 1070 1750 gene locus_tag LOCUS_23700 1070 1750 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_23700 1751 4966 gene locus_tag LOCUS_23710 1751 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence146 898 176 gene locus_tag LOCUS_23720 898 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 1282 3933 gene locus_tag LOCUS_23730 gene polA 1282 3933 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_23730 3926 4804 gene locus_tag LOCUS_23740 gene nadC 3926 4804 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_23740 4890 5159 gene locus_tag LOCUS_23750 4890 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 5343 5687 gene locus_tag LOCUS_23760 5343 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 5716 7272 gene locus_tag LOCUS_23770 gene gpmI 5716 7272 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence147 735 2156 gene locus_tag LOCUS_23780 735 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 2153 3310 gene locus_tag LOCUS_23790 2153 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 3780 4220 gene locus_tag LOCUS_23800 gene dut 3780 4220 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880090.1 protein_id gnl|my_center|LOCUS_23800 4217 5164 gene locus_tag LOCUS_23810 4217 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 5265 5603 gene locus_tag LOCUS_23820 5265 5603 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831050.1 protein_id gnl|my_center|LOCUS_23820 5641 5715 gene locus_tag LOCUS_t00430 5641 5715 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence148 1477 1172 gene locus_tag LOCUS_23830 1477 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1842 1585 gene locus_tag LOCUS_23840 1842 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 4585 1868 gene locus_tag LOCUS_23850 4585 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 5152 4679 gene locus_tag LOCUS_23860 5152 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 6108 5245 gene locus_tag LOCUS_23870 6108 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 6501 6184 gene locus_tag LOCUS_23880 6501 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 6965 6498 gene locus_tag LOCUS_23890 6965 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence149 1987 2076 gene locus_tag LOCUS_t00440 1987 2076 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2856 4271 gene locus_tag LOCUS_23900 2856 4271 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143780.1 protein_id gnl|my_center|LOCUS_23900 4315 5055 gene locus_tag LOCUS_23910 4315 5055 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941333.1 protein_id gnl|my_center|LOCUS_23910 5042 6016 gene locus_tag LOCUS_23920 5042 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence150 <1 671 gene locus_tag LOCUS_23930 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886567.1:flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase 1058 1630 gene locus_tag LOCUS_23940 1058 1630 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880554.1 protein_id gnl|my_center|LOCUS_23940 2716 1733 gene locus_tag LOCUS_23950 gene hemB 2716 1733 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_23950 3605 2721 gene locus_tag LOCUS_23960 gene hemC 3605 2721 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_23960 3786 4313 gene locus_tag LOCUS_23970 3786 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 4313 5317 gene locus_tag LOCUS_23980 4313 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 5500 6774 gene locus_tag LOCUS_23990 gene hemL 5500 6774 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence151 <1 996 gene locus_tag LOCUS_24000 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973141.1:glycosyltransferase family 4 protein 1267 2202 gene locus_tag LOCUS_24010 1267 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2382 3338 gene locus_tag LOCUS_24020 2382 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 3371 4483 gene locus_tag LOCUS_24030 gene hisC 3371 4483 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_24030 4523 4975 gene locus_tag LOCUS_24040 4523 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 5013 5657 gene locus_tag LOCUS_24050 5013 5657 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_24050 5658 6395 gene locus_tag LOCUS_24060 gene kdsB 5658 6395 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence152 274 4173 gene locus_tag LOCUS_24070 274 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 4183 5949 gene locus_tag LOCUS_24080 4183 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence153 955 242 gene locus_tag LOCUS_24090 955 242 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249791.1 protein_id gnl|my_center|LOCUS_24090 1135 2682 gene locus_tag LOCUS_24100 1135 2682 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_24100 2698 3471 gene locus_tag LOCUS_24110 2698 3471 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_24110 3576 4256 gene locus_tag LOCUS_24120 3576 4256 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_24120 4260 6422 gene locus_tag LOCUS_24130 4260 6422 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927193.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence154 1335 103 gene locus_tag LOCUS_24140 1335 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 1643 3754 gene locus_tag LOCUS_24150 1643 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 4055 4708 gene locus_tag LOCUS_24160 4055 4708 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257343.1 protein_id gnl|my_center|LOCUS_24160 5853 5020 gene locus_tag LOCUS_24170 5853 5020 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938734.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence155 145 1872 gene locus_tag LOCUS_24180 145 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 3418 1907 gene locus_tag LOCUS_24190 gene rho 3418 1907 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179608.1 protein_id gnl|my_center|LOCUS_24190 4165 4992 gene locus_tag LOCUS_24200 4165 4992 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787710.1 protein_id gnl|my_center|LOCUS_24200 4992 6035 gene locus_tag LOCUS_24210 4992 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 6461 6117 gene locus_tag LOCUS_24220 6461 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence156 1923 1198 gene locus_tag LOCUS_24230 1923 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 2212 2391 gene locus_tag LOCUS_24240 2212 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 3632 2811 gene locus_tag LOCUS_24250 3632 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 5050 3635 gene locus_tag LOCUS_24260 5050 3635 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_24260 <6551 5307 gene locus_tag LOCUS_24270 <6551 5307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924817.1:bi-domain-containing oxidoreductase >Feature sequence157 2227 1877 gene locus_tag LOCUS_24280 2227 1877 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928433.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence158 559 1299 gene locus_tag LOCUS_24290 559 1299 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224330.1 protein_id gnl|my_center|LOCUS_24290 3894 1315 gene locus_tag LOCUS_24300 3894 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 4327 3851 gene locus_tag LOCUS_24310 4327 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 <6364 4516 gene locus_tag LOCUS_24320 <6364 4516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144073.1:aconitate hydratase >Feature sequence159 710 561 gene locus_tag LOCUS_24330 710 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 3637 740 gene locus_tag LOCUS_24340 3637 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 3801 5759 gene locus_tag LOCUS_24350 3801 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence160 2039 192 gene locus_tag LOCUS_24360 2039 192 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_24360 2646 3647 gene locus_tag LOCUS_24370 2646 3647 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_24370 3941 4174 gene locus_tag LOCUS_24380 3941 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 4161 5000 gene locus_tag LOCUS_24390 4161 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence161 1334 735 gene locus_tag LOCUS_24400 1334 735 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258068.1 protein_id gnl|my_center|LOCUS_24400 1966 1331 gene locus_tag LOCUS_24410 1966 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 3552 1963 gene locus_tag LOCUS_24420 3552 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 4112 3552 gene locus_tag LOCUS_24430 gene folE 4112 3552 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429416.1 protein_id gnl|my_center|LOCUS_24430 <6286 4099 gene locus_tag LOCUS_24440 <6286 4099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200858940.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence162 2324 4759 gene locus_tag LOCUS_24450 2324 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 4777 5481 gene locus_tag LOCUS_24460 4777 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence163 902 1294 gene locus_tag LOCUS_24470 902 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1287 1643 gene locus_tag LOCUS_24480 1287 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 1661 3241 gene locus_tag LOCUS_24490 1661 3241 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_24490 3263 3982 gene locus_tag LOCUS_24500 3263 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 4303 5832 gene locus_tag LOCUS_24510 gene hutH 4303 5832 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925153.1 protein_id gnl|my_center|LOCUS_24510 5990 6064 gene locus_tag LOCUS_t00450 5990 6064 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence164 914 3004 gene locus_tag LOCUS_24520 914 3004 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990677.1 protein_id gnl|my_center|LOCUS_24520 3216 4652 gene locus_tag LOCUS_24530 3216 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence165 2844 115 gene locus_tag LOCUS_24540 2844 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 3545 4099 gene locus_tag LOCUS_24550 3545 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 4096 5481 gene locus_tag LOCUS_24560 4096 5481 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259576.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence166 4877 1074 gene locus_tag LOCUS_24570 4877 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence167 290 1039 gene locus_tag LOCUS_24580 290 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 1036 2478 gene locus_tag LOCUS_24590 1036 2478 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_24590 2554 2826 gene locus_tag LOCUS_24600 2554 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 3159 3911 gene locus_tag LOCUS_24610 3159 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24610 3908 4738 gene locus_tag LOCUS_24620 3908 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24620 >Feature sequence168 1338 4103 gene locus_tag LOCUS_24630 1338 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence169 113 322 gene locus_tag LOCUS_24640 113 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 344 2194 gene locus_tag LOCUS_24650 gene pcrA 344 2194 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989648.1 protein_id gnl|my_center|LOCUS_24650 2321 2542 gene locus_tag LOCUS_24660 2321 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2705 4264 gene locus_tag LOCUS_24670 gene citF 2705 4264 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_24670 4392 5240 gene locus_tag LOCUS_24680 4392 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680