>Feature sequence001 194 469 gene locus_tag LOCUS_00010 194 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 481 693 gene locus_tag LOCUS_00020 481 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 695 943 gene locus_tag LOCUS_00030 695 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 956 1366 gene locus_tag LOCUS_00040 956 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 1557 1832 gene locus_tag LOCUS_00050 1557 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 1859 2536 gene locus_tag LOCUS_00060 1859 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 2559 3251 gene locus_tag LOCUS_00070 2559 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 3251 3577 gene locus_tag LOCUS_00080 3251 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 3567 6062 gene locus_tag LOCUS_00090 3567 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6049 7083 gene locus_tag LOCUS_00100 6049 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7086 7955 gene locus_tag LOCUS_00110 7086 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 7997 9766 gene locus_tag LOCUS_00120 7997 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9834 10997 gene locus_tag LOCUS_00130 9834 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11010 12476 gene locus_tag LOCUS_00140 11010 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12477 16109 gene locus_tag LOCUS_00150 12477 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16292 16116 gene locus_tag LOCUS_00160 16292 16116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17004 16282 gene locus_tag LOCUS_00170 17004 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17915 17001 gene locus_tag LOCUS_00180 17915 17001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18271 18053 gene locus_tag LOCUS_00190 18271 18053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18873 18268 gene locus_tag LOCUS_00200 gene def 18873 18268 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115010.1 protein_id gnl|my_center|LOCUS_00200 19511 18765 gene locus_tag LOCUS_00210 19511 18765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20062 19508 gene locus_tag LOCUS_00220 20062 19508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23178 20062 gene locus_tag LOCUS_00230 23178 20062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23734 23168 gene locus_tag LOCUS_00240 23734 23168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23948 23736 gene locus_tag LOCUS_00250 23948 23736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 24622 23945 gene locus_tag LOCUS_00260 gene thyX 24622 23945 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081517.1 protein_id gnl|my_center|LOCUS_00260 27582 24619 gene locus_tag LOCUS_00270 27582 24619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27880 27566 gene locus_tag LOCUS_00280 27880 27566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28145 27903 gene locus_tag LOCUS_00290 28145 27903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 28507 28142 gene locus_tag LOCUS_00300 28507 28142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 29301 28504 gene locus_tag LOCUS_00310 29301 28504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 29666 29298 gene locus_tag LOCUS_00320 29666 29298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 29889 29590 gene locus_tag LOCUS_00330 29889 29590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 30443 29886 gene locus_tag LOCUS_00340 gene clpP 30443 29886 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_00340 32298 30421 gene locus_tag LOCUS_00350 32298 30421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 33283 32288 gene locus_tag LOCUS_00360 33283 32288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 34354 33284 gene locus_tag LOCUS_00370 gene recA 34354 33284 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870381.1 protein_id gnl|my_center|LOCUS_00370 34721 34347 gene locus_tag LOCUS_00380 34721 34347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 35608 34721 gene locus_tag LOCUS_00390 35608 34721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 36071 35646 gene locus_tag LOCUS_00400 36071 35646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 36448 36068 gene locus_tag LOCUS_00410 36448 36068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 39063 36445 gene locus_tag LOCUS_00420 39063 36445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 39919 39038 gene locus_tag LOCUS_00430 39919 39038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 40162 39998 gene locus_tag LOCUS_00440 40162 39998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 41754 40288 gene locus_tag LOCUS_00450 41754 40288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 43217 41796 gene locus_tag LOCUS_00460 43217 41796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 43882 43229 gene locus_tag LOCUS_00470 43882 43229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 44390 43875 gene locus_tag LOCUS_00480 44390 43875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 44961 44302 gene locus_tag LOCUS_00490 44961 44302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 45179 44958 gene locus_tag LOCUS_00500 45179 44958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 45451 45176 gene locus_tag LOCUS_00510 45451 45176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 45626 45402 gene locus_tag LOCUS_00520 45626 45402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 46104 45619 gene locus_tag LOCUS_00530 46104 45619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 46335 46153 gene locus_tag LOCUS_00540 46335 46153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 46568 46332 gene locus_tag LOCUS_00550 46568 46332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 47739 46513 gene locus_tag LOCUS_00560 47739 46513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 48736 47732 gene locus_tag LOCUS_00570 48736 47732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 50068 48833 gene locus_tag LOCUS_00580 50068 48833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 51188 50061 gene locus_tag LOCUS_00590 51188 50061 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977524.1 protein_id gnl|my_center|LOCUS_00590 52587 51256 gene locus_tag LOCUS_00600 52587 51256 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038543.1 protein_id gnl|my_center|LOCUS_00600 52957 52691 gene locus_tag LOCUS_00610 52957 52691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 53875 52970 gene locus_tag LOCUS_00620 53875 52970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 54490 53876 gene locus_tag LOCUS_00630 54490 53876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 54685 54491 gene locus_tag LOCUS_00640 54685 54491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 55703 54663 gene locus_tag LOCUS_00650 55703 54663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 55981 55703 gene locus_tag LOCUS_00660 55981 55703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 56135 55941 gene locus_tag LOCUS_00670 56135 55941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 56952 56206 gene locus_tag LOCUS_00680 56952 56206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 57522 57067 gene locus_tag LOCUS_00690 57522 57067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 58009 57509 gene locus_tag LOCUS_00700 58009 57509 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107679.1 protein_id gnl|my_center|LOCUS_00700 58451 58155 gene locus_tag LOCUS_00710 58451 58155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 59911 58538 gene locus_tag LOCUS_00720 59911 58538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 60292 60062 gene locus_tag LOCUS_00730 60292 60062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 60716 60282 gene locus_tag LOCUS_00740 60716 60282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 61241 61032 gene locus_tag LOCUS_00750 61241 61032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 61578 61384 gene locus_tag LOCUS_00760 61578 61384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 62354 61578 gene locus_tag LOCUS_00770 62354 61578 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183806887.1 protein_id gnl|my_center|LOCUS_00770 62533 62357 gene locus_tag LOCUS_00780 62533 62357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 62822 62523 gene locus_tag LOCUS_00790 62822 62523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 63218 62898 gene locus_tag LOCUS_00800 63218 62898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 63396 63223 gene locus_tag LOCUS_00810 63396 63223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 63761 63495 gene locus_tag LOCUS_00820 63761 63495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 64003 63812 gene locus_tag LOCUS_00830 64003 63812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 64219 64004 gene locus_tag LOCUS_00840 64219 64004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 64487 64209 gene locus_tag LOCUS_00850 64487 64209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 64755 64570 gene locus_tag LOCUS_00860 64755 64570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 64913 64755 gene locus_tag LOCUS_00870 64913 64755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 65396 65040 gene locus_tag LOCUS_00880 65396 65040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 65895 65671 gene locus_tag LOCUS_00890 65895 65671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 66164 65925 gene locus_tag LOCUS_00900 66164 65925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 66755 66546 gene locus_tag LOCUS_00910 66755 66546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 66901 66758 gene locus_tag LOCUS_00920 66901 66758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 67058 66873 gene locus_tag LOCUS_00930 67058 66873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 67396 67196 gene locus_tag LOCUS_00940 67396 67196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 67693 67544 gene locus_tag LOCUS_00950 67693 67544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 67953 67753 gene locus_tag LOCUS_00960 67953 67753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 68513 68061 gene locus_tag LOCUS_00970 68513 68061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 69289 69098 gene locus_tag LOCUS_00980 69289 69098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 69723 69535 gene locus_tag LOCUS_00990 69723 69535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 70293 70081 gene locus_tag LOCUS_01000 70293 70081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 70481 70290 gene locus_tag LOCUS_01010 70481 70290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 70726 70478 gene locus_tag LOCUS_01020 70726 70478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 70986 70723 gene locus_tag LOCUS_01030 70986 70723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 71233 70958 gene locus_tag LOCUS_01040 71233 70958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 71730 72074 gene locus_tag LOCUS_01050 71730 72074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 72152 72238 gene locus_tag LOCUS_t00010 72152 72238 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 72254 72649 gene locus_tag LOCUS_01060 72254 72649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 72651 72720 gene locus_tag LOCUS_t00020 72651 72720 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 72728 72802 gene locus_tag LOCUS_t00030 72728 72802 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 72818 72893 gene locus_tag LOCUS_t00040 72818 72893 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 72909 73172 gene locus_tag LOCUS_01070 72909 73172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 73162 73449 gene locus_tag LOCUS_01080 73162 73449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 73450 73526 gene locus_tag LOCUS_t00050 73450 73526 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 73623 73697 gene locus_tag LOCUS_t00060 73623 73697 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 73698 74057 gene locus_tag LOCUS_01090 73698 74057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 74058 74132 gene locus_tag LOCUS_t00070 74058 74132 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 74144 74440 gene locus_tag LOCUS_01100 74144 74440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 74431 74508 gene locus_tag LOCUS_t00080 74431 74508 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 74640 75041 gene locus_tag LOCUS_01110 74640 75041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 75019 75094 gene locus_tag LOCUS_t00090 75019 75094 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 75094 75675 gene locus_tag LOCUS_01120 75094 75675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 75638 75713 gene locus_tag LOCUS_t00100 75638 75713 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 75720 75944 gene locus_tag LOCUS_01130 75720 75944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 75935 76011 gene locus_tag LOCUS_t00110 75935 76011 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 76031 77137 gene locus_tag LOCUS_01140 76031 77137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 77138 77213 gene locus_tag LOCUS_t00120 77138 77213 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 77244 77447 gene locus_tag LOCUS_01150 77244 77447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 77395 77586 gene locus_tag LOCUS_01160 77395 77586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 77588 77662 gene locus_tag LOCUS_t00130 77588 77662 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 77664 77740 gene locus_tag LOCUS_t00140 77664 77740 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 77833 77907 gene locus_tag LOCUS_t00150 77833 77907 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 77907 78089 gene locus_tag LOCUS_01170 77907 78089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 78085 78159 gene locus_tag LOCUS_t00160 78085 78159 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 78235 78564 gene locus_tag LOCUS_01180 78235 78564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 78699 78772 gene locus_tag LOCUS_t00170 78699 78772 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 78918 78995 gene locus_tag LOCUS_t00180 78918 78995 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 79076 79153 gene locus_tag LOCUS_t00190 79076 79153 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 79157 79234 gene locus_tag LOCUS_t00200 79157 79234 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 79244 79510 gene locus_tag LOCUS_01190 79244 79510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 79510 79585 gene locus_tag LOCUS_t00210 79510 79585 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 79811 81412 gene locus_tag LOCUS_01200 79811 81412 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727486.1 protein_id gnl|my_center|LOCUS_01200 81689 81762 gene locus_tag LOCUS_t00220 81689 81762 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 81786 81974 gene locus_tag LOCUS_01210 81786 81974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 81982 82057 gene locus_tag LOCUS_t00230 81982 82057 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 82061 82142 gene locus_tag LOCUS_t00240 82061 82142 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 82146 82236 gene locus_tag LOCUS_t00250 82146 82236 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 82256 82729 gene locus_tag LOCUS_01220 82256 82729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 82732 83058 gene locus_tag LOCUS_01230 82732 83058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 83060 83236 gene locus_tag LOCUS_01240 83060 83236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 83358 83849 gene locus_tag LOCUS_01250 83358 83849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 83877 84191 gene locus_tag LOCUS_01260 83877 84191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 84188 84448 gene locus_tag LOCUS_01270 84188 84448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 84463 84648 gene locus_tag LOCUS_01280 84463 84648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 84572 84760 gene locus_tag LOCUS_01290 84572 84760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 84878 84963 gene locus_tag LOCUS_t00260 84878 84963 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 84980 85306 gene locus_tag LOCUS_01300 84980 85306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 85308 85393 gene locus_tag LOCUS_t00270 85308 85393 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 85673 85746 gene locus_tag LOCUS_t00280 85673 85746 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 85849 86190 gene locus_tag LOCUS_01310 85849 86190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 86192 86533 gene locus_tag LOCUS_01320 86192 86533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 86517 86711 gene locus_tag LOCUS_01330 86517 86711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 86868 87131 gene locus_tag LOCUS_01340 86868 87131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 87038 87289 gene locus_tag LOCUS_01350 87038 87289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 87276 89483 gene locus_tag LOCUS_01360 87276 89483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 89480 90271 gene locus_tag LOCUS_01370 89480 90271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 90264 91079 gene locus_tag LOCUS_01380 90264 91079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 91076 91681 gene locus_tag LOCUS_01390 91076 91681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 91653 92333 gene locus_tag LOCUS_01400 91653 92333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 92320 93150 gene locus_tag LOCUS_01410 92320 93150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 93141 93713 gene locus_tag LOCUS_01420 93141 93713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 93706 94419 gene locus_tag LOCUS_01430 93706 94419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 94400 95050 gene locus_tag LOCUS_01440 94400 95050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 95040 95630 gene locus_tag LOCUS_01450 95040 95630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 95632 96075 gene locus_tag LOCUS_01460 95632 96075 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183284.1 protein_id gnl|my_center|LOCUS_01460 96009 96725 gene locus_tag LOCUS_01470 96009 96725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 96718 96906 gene locus_tag LOCUS_01480 96718 96906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 96915 97241 gene locus_tag LOCUS_01490 96915 97241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 97624 97238 gene locus_tag LOCUS_01500 97624 97238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 98241 97624 gene locus_tag LOCUS_01510 98241 97624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 98714 98265 gene locus_tag LOCUS_01520 98714 98265 CDS product endonuclease VII domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027898.1 protein_id gnl|my_center|LOCUS_01520 99250 98801 gene locus_tag LOCUS_01530 99250 98801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 99611 99231 gene locus_tag LOCUS_01540 99611 99231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 100545 99748 gene locus_tag LOCUS_01550 100545 99748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 100651 100848 gene locus_tag LOCUS_01560 100651 100848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 100848 101159 gene locus_tag LOCUS_01570 100848 101159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 101161 101478 gene locus_tag LOCUS_01580 101161 101478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 101487 102086 gene locus_tag LOCUS_01590 101487 102086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 102086 104434 gene locus_tag LOCUS_01600 102086 104434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 104431 105147 gene locus_tag LOCUS_01610 104431 105147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 105147 106469 gene locus_tag LOCUS_01620 105147 106469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 106469 106987 gene locus_tag LOCUS_01630 106469 106987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 107048 107374 gene locus_tag LOCUS_01640 107048 107374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 107374 107754 gene locus_tag LOCUS_01650 107374 107754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 107754 109979 gene locus_tag LOCUS_01660 107754 109979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 109976 110158 gene locus_tag LOCUS_01670 109976 110158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 110263 110727 gene locus_tag LOCUS_01680 110263 110727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 110631 110843 gene locus_tag LOCUS_01690 110631 110843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 110843 111436 gene locus_tag LOCUS_01700 110843 111436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 111441 111824 gene locus_tag LOCUS_01710 111441 111824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 111834 113924 gene locus_tag LOCUS_01720 111834 113924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 113924 114250 gene locus_tag LOCUS_01730 113924 114250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 114250 114438 gene locus_tag LOCUS_01740 114250 114438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 114438 114980 gene locus_tag LOCUS_01750 114438 114980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 114984 115307 gene locus_tag LOCUS_01760 114984 115307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 115317 115601 gene locus_tag LOCUS_01770 115317 115601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 115585 115980 gene locus_tag LOCUS_01780 115585 115980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 115973 116161 gene locus_tag LOCUS_01790 115973 116161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 116402 117355 gene locus_tag LOCUS_01800 116402 117355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 117603 118280 gene locus_tag LOCUS_01810 117603 118280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 118350 119492 gene locus_tag LOCUS_01820 118350 119492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 >Feature sequence002 1 1884 gene locus_tag LOCUS_01830 1 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 1874 2242 gene locus_tag LOCUS_01840 1874 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 2169 2924 gene locus_tag LOCUS_01850 2169 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 3013 3936 gene locus_tag LOCUS_01860 3013 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 3961 4455 gene locus_tag LOCUS_01870 3961 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 4467 4769 gene locus_tag LOCUS_01880 4467 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 4766 5185 gene locus_tag LOCUS_01890 4766 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 5300 5998 gene locus_tag LOCUS_01900 5300 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 5998 6801 gene locus_tag LOCUS_01910 5998 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 6801 8606 gene locus_tag LOCUS_01920 6801 8606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 8771 9079 gene locus_tag LOCUS_01930 8771 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 9089 9439 gene locus_tag LOCUS_01940 9089 9439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 9436 9726 gene locus_tag LOCUS_01950 9436 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 9713 9988 gene locus_tag LOCUS_01960 9713 9988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 9963 10406 gene locus_tag LOCUS_01970 9963 10406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 10416 10958 gene locus_tag LOCUS_01980 10416 10958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 11101 11583 gene locus_tag LOCUS_01990 11101 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 11576 13327 gene locus_tag LOCUS_02000 11576 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 13312 13788 gene locus_tag LOCUS_02010 13312 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 13790 14692 gene locus_tag LOCUS_02020 13790 14692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 14705 16618 gene locus_tag LOCUS_02030 14705 16618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 16618 19398 gene locus_tag LOCUS_02040 16618 19398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 19388 19891 gene locus_tag LOCUS_02050 19388 19891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 19903 20094 gene locus_tag LOCUS_02060 19903 20094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 20091 20294 gene locus_tag LOCUS_02070 20091 20294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 20454 20684 gene locus_tag LOCUS_02080 20454 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 21371 20685 gene locus_tag LOCUS_02090 21371 20685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975426.1 protein_id gnl|my_center|LOCUS_02090 21574 21374 gene locus_tag LOCUS_02100 21574 21374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 21891 21571 gene locus_tag LOCUS_02110 21891 21571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 22502 21888 gene locus_tag LOCUS_02120 22502 21888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 23143 22409 gene locus_tag LOCUS_02130 23143 22409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 24101 23226 gene locus_tag LOCUS_02140 24101 23226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 24397 24098 gene locus_tag LOCUS_02150 24397 24098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 24937 24518 gene locus_tag LOCUS_02160 24937 24518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 26370 24937 gene locus_tag LOCUS_02170 26370 24937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 28033 26390 gene locus_tag LOCUS_02180 28033 26390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 28767 28057 gene locus_tag LOCUS_02190 28767 28057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 29150 28767 gene locus_tag LOCUS_02200 29150 28767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 31757 29190 gene locus_tag LOCUS_02210 31757 29190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 33276 31762 gene locus_tag LOCUS_02220 33276 31762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 33525 33277 gene locus_tag LOCUS_02230 33525 33277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 33829 33515 gene locus_tag LOCUS_02240 33829 33515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 34386 33919 gene locus_tag LOCUS_02250 34386 33919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 35202 34864 gene locus_tag LOCUS_02260 35202 34864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 35733 35470 gene locus_tag LOCUS_02270 35733 35470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 36184 35855 gene locus_tag LOCUS_02280 36184 35855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 37204 36503 gene locus_tag LOCUS_02290 37204 36503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 37281 37505 gene locus_tag LOCUS_02300 37281 37505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 38001 37690 gene locus_tag LOCUS_02310 38001 37690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 38238 38047 gene locus_tag LOCUS_02320 38238 38047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 38721 38395 gene locus_tag LOCUS_02330 38721 38395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 38970 38898 gene locus_tag LOCUS_t00290 38970 38898 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 39962 39216 gene locus_tag LOCUS_02340 39962 39216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 40073 40315 gene locus_tag LOCUS_02350 40073 40315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 40632 40375 gene locus_tag LOCUS_02360 40632 40375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 41148 40837 gene locus_tag LOCUS_02370 41148 40837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 41502 41257 gene locus_tag LOCUS_02380 41502 41257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 41797 41639 gene locus_tag LOCUS_02390 41797 41639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 42753 43244 gene locus_tag LOCUS_02400 42753 43244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 43228 43506 gene locus_tag LOCUS_02410 43228 43506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 43552 45012 gene locus_tag LOCUS_02420 43552 45012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 >Feature sequence003 2156 1419 gene locus_tag LOCUS_02430 2156 1419 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947498.1 protein_id gnl|my_center|LOCUS_02430 3296 2172 gene locus_tag LOCUS_02440 3296 2172 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_02440 3507 4808 gene locus_tag LOCUS_02450 3507 4808 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_02450 4842 7499 gene locus_tag LOCUS_02460 gene ppdK 4842 7499 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_02460 7530 8774 gene locus_tag LOCUS_02470 7530 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 9498 8800 gene locus_tag LOCUS_02480 gene radC 9498 8800 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545736.1 protein_id gnl|my_center|LOCUS_02480 9881 9468 gene locus_tag LOCUS_02490 9881 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 10086 10355 gene locus_tag LOCUS_02500 10086 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 10581 14156 gene locus_tag LOCUS_02510 gene smc 10581 14156 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_02510 14763 14158 gene locus_tag LOCUS_02520 14763 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 15261 14785 gene locus_tag LOCUS_02530 15261 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 15643 15254 gene locus_tag LOCUS_02540 15643 15254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 18611 15774 gene locus_tag LOCUS_02550 gene uvrA 18611 15774 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_02550 19122 18769 gene locus_tag LOCUS_02560 gene arsC 19122 18769 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208565.1 protein_id gnl|my_center|LOCUS_02560 20123 19146 gene locus_tag LOCUS_02570 20123 19146 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_02570 20637 20143 gene locus_tag LOCUS_02580 20637 20143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02580 21552 20638 gene locus_tag LOCUS_02590 21552 20638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02590 22499 21549 gene locus_tag LOCUS_02600 gene pdxA 22499 21549 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_02600 23126 22509 gene locus_tag LOCUS_02610 23126 22509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 24067 23123 gene locus_tag LOCUS_02620 24067 23123 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_02620 27532 24071 gene locus_tag LOCUS_02630 gene mfd 27532 24071 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_02630 27634 28653 gene locus_tag LOCUS_02640 27634 28653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 29017 28700 gene locus_tag LOCUS_02650 29017 28700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 29413 29030 gene locus_tag LOCUS_02660 gene hisI 29413 29030 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932151.1 protein_id gnl|my_center|LOCUS_02660 29628 31673 gene locus_tag LOCUS_02670 29628 31673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 35705 31680 gene locus_tag LOCUS_02680 35705 31680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 37241 35748 gene locus_tag LOCUS_02690 37241 35748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 37689 38756 gene locus_tag LOCUS_02700 37689 38756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 39463 38858 gene locus_tag LOCUS_02710 39463 38858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 40692 39535 gene locus_tag LOCUS_02720 40692 39535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 41585 40821 gene locus_tag LOCUS_02730 gene hisF 41585 40821 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_02730 42310 41585 gene locus_tag LOCUS_02740 gene hisA 42310 41585 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_02740 42404 43690 gene locus_tag LOCUS_02750 gene hisD 42404 43690 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_02750 >Feature sequence004 87 2768 gene locus_tag LOCUS_02760 gene acnA 87 2768 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_02760 3962 2781 gene locus_tag LOCUS_02770 gene hemW 3962 2781 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_02770 4105 4332 gene locus_tag LOCUS_02780 4105 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 5278 4397 gene locus_tag LOCUS_02790 5278 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 7513 5309 gene locus_tag LOCUS_02800 7513 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 11585 7818 gene locus_tag LOCUS_02810 11585 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 12396 14471 gene locus_tag LOCUS_02820 12396 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 14562 16448 gene locus_tag LOCUS_02830 14562 16448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 16691 20272 gene locus_tag LOCUS_02840 16691 20272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 20526 23027 gene locus_tag LOCUS_02850 20526 23027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 23199 24266 gene locus_tag LOCUS_02860 23199 24266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 24482 27850 gene locus_tag LOCUS_02870 24482 27850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 28126 29457 gene locus_tag LOCUS_02880 28126 29457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 29744 31522 gene locus_tag LOCUS_02890 29744 31522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 31742 33532 gene locus_tag LOCUS_02900 31742 33532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 33582 35477 gene locus_tag LOCUS_02910 33582 35477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 35531 37108 gene locus_tag LOCUS_02920 35531 37108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 >Feature sequence005 2406 1324 gene locus_tag LOCUS_02930 2406 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 2877 2428 gene locus_tag LOCUS_02940 2877 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 3734 2877 gene locus_tag LOCUS_02950 3734 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 5013 3718 gene locus_tag LOCUS_02960 5013 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 9846 5398 gene locus_tag LOCUS_02970 9846 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 10009 13032 gene locus_tag LOCUS_02980 10009 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 14886 13036 gene locus_tag LOCUS_02990 14886 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 15043 18138 gene locus_tag LOCUS_03000 15043 18138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 18135 21155 gene locus_tag LOCUS_03010 18135 21155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 21467 21156 gene locus_tag LOCUS_03020 21467 21156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 24188 21522 gene locus_tag LOCUS_03030 24188 21522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 24249 27299 gene locus_tag LOCUS_03040 24249 27299 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_03040 28942 27296 gene locus_tag LOCUS_03050 28942 27296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 28941 29783 gene locus_tag LOCUS_03060 28941 29783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 30709 29756 gene locus_tag LOCUS_03070 gene glcK 30709 29756 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_03070 32119 30710 gene locus_tag LOCUS_03080 32119 30710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence006 62 583 gene locus_tag LOCUS_03090 62 583 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256182.1 protein_id gnl|my_center|LOCUS_03090 716 643 gene locus_tag LOCUS_t00300 716 643 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 904 832 gene locus_tag LOCUS_t00310 904 832 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1329 1117 gene locus_tag LOCUS_03100 1329 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 1477 1791 gene locus_tag LOCUS_03110 1477 1791 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_03110 1870 2754 gene locus_tag LOCUS_03120 1870 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 2759 5332 gene locus_tag LOCUS_03130 gene topA 2759 5332 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_03130 5336 6250 gene locus_tag LOCUS_03140 gene xerC 5336 6250 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_03140 6451 6996 gene locus_tag LOCUS_03150 gene hslV 6451 6996 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932864.1 protein_id gnl|my_center|LOCUS_03150 7000 8391 gene locus_tag LOCUS_03160 gene hslU 7000 8391 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_03160 8398 9279 gene locus_tag LOCUS_03170 gene argB 8398 9279 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_03170 9291 10484 gene locus_tag LOCUS_03180 9291 10484 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940827.1 protein_id gnl|my_center|LOCUS_03180 10481 11383 gene locus_tag LOCUS_03190 gene argF 10481 11383 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143094.1 protein_id gnl|my_center|LOCUS_03190 11389 12615 gene locus_tag LOCUS_03200 11389 12615 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_03200 12612 13703 gene locus_tag LOCUS_03210 gene serC 12612 13703 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434814.1 protein_id gnl|my_center|LOCUS_03210 13765 15351 gene locus_tag LOCUS_03220 gene serA 13765 15351 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_03220 15351 16643 gene locus_tag LOCUS_03230 15351 16643 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_03230 16719 17777 gene locus_tag LOCUS_03240 gene pdhA 16719 17777 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_03240 17780 18775 gene locus_tag LOCUS_03250 17780 18775 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289463.1 protein_id gnl|my_center|LOCUS_03250 18897 20138 gene locus_tag LOCUS_03260 18897 20138 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943295.1 protein_id gnl|my_center|LOCUS_03260 20300 21715 gene locus_tag LOCUS_03270 gene lpdA 20300 21715 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_03270 22191 21712 gene locus_tag LOCUS_03280 22191 21712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 23163 22381 gene locus_tag LOCUS_03290 gene trmJ 23163 22381 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958024.1 protein_id gnl|my_center|LOCUS_03290 23156 24196 gene locus_tag LOCUS_03300 23156 24196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 24213 25808 gene locus_tag LOCUS_03310 24213 25808 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019218195.1 protein_id gnl|my_center|LOCUS_03310 26761 25805 gene locus_tag LOCUS_03320 26761 25805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 27674 26817 gene locus_tag LOCUS_03330 27674 26817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 27839 29086 gene locus_tag LOCUS_03340 27839 29086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 29135 29911 gene locus_tag LOCUS_03350 29135 29911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 29913 30233 gene locus_tag LOCUS_03360 29913 30233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 30755 30228 gene locus_tag LOCUS_03370 30755 30228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence007 612 325 gene locus_tag LOCUS_03380 612 325 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 protein_id gnl|my_center|LOCUS_03380 1587 673 gene locus_tag LOCUS_03390 1587 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 1821 2669 gene locus_tag LOCUS_03400 gene panC 1821 2669 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_03400 2911 5175 gene locus_tag LOCUS_03410 2911 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 6453 5239 gene locus_tag LOCUS_03420 6453 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 7232 6582 gene locus_tag LOCUS_03430 7232 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7620 8876 gene locus_tag LOCUS_03440 7620 8876 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_03440 8903 9508 gene locus_tag LOCUS_03450 8903 9508 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_03450 9574 11127 gene locus_tag LOCUS_03460 9574 11127 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926057.1 protein_id gnl|my_center|LOCUS_03460 11124 11978 gene locus_tag LOCUS_03470 11124 11978 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878705.1 protein_id gnl|my_center|LOCUS_03470 13195 12059 gene locus_tag LOCUS_03480 13195 12059 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965217.1 protein_id gnl|my_center|LOCUS_03480 13311 14324 gene locus_tag LOCUS_03490 13311 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 14372 14824 gene locus_tag LOCUS_03500 gene smpB 14372 14824 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_03500 14846 15556 gene locus_tag LOCUS_03510 14846 15556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 15573 16268 gene locus_tag LOCUS_03520 15573 16268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 17451 16306 gene locus_tag LOCUS_03530 17451 16306 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_03530 17964 17572 gene locus_tag LOCUS_03540 17964 17572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 18084 19076 gene locus_tag LOCUS_03550 18084 19076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 20750 19101 gene locus_tag LOCUS_03560 20750 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 22423 20909 gene locus_tag LOCUS_03570 22423 20909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 22801 24168 gene locus_tag LOCUS_03580 22801 24168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 25399 24182 gene locus_tag LOCUS_03590 25399 24182 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020683.1 protein_id gnl|my_center|LOCUS_03590 >Feature sequence008 516 1241 gene locus_tag LOCUS_03600 516 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 2524 1250 gene locus_tag LOCUS_03610 2524 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 7001 2544 gene locus_tag LOCUS_03620 7001 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 7708 7217 gene locus_tag LOCUS_03630 7708 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 7910 8809 gene locus_tag LOCUS_03640 7910 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 8814 9224 gene locus_tag LOCUS_03650 8814 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 9302 10249 gene locus_tag LOCUS_03660 9302 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 10638 10255 gene locus_tag LOCUS_03670 gene apaG 10638 10255 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073443.1 protein_id gnl|my_center|LOCUS_03670 10755 11102 gene locus_tag LOCUS_03680 gene folX 10755 11102 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091897.1 protein_id gnl|my_center|LOCUS_03680 11103 11495 gene locus_tag LOCUS_03690 gene folK 11103 11495 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221222.1 protein_id gnl|my_center|LOCUS_03690 13967 11460 gene locus_tag LOCUS_03700 13967 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 14039 14512 gene locus_tag LOCUS_03710 gene sixA 14039 14512 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406129.1 protein_id gnl|my_center|LOCUS_03710 15745 14501 gene locus_tag LOCUS_03720 15745 14501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 16695 15793 gene locus_tag LOCUS_03730 16695 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 17293 16697 gene locus_tag LOCUS_03740 17293 16697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 18921 17293 gene locus_tag LOCUS_03750 18921 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 20343 18961 gene locus_tag LOCUS_03760 20343 18961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 21035 20343 gene locus_tag LOCUS_03770 21035 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 21538 21032 gene locus_tag LOCUS_03780 21538 21032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 22169 21522 gene locus_tag LOCUS_03790 22169 21522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 22581 22132 gene locus_tag LOCUS_03800 gene gspG 22581 22132 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_03800 23867 22635 gene locus_tag LOCUS_03810 gene gspF 23867 22635 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_03810 25620 23887 gene locus_tag LOCUS_03820 gene gspE 25620 23887 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_03820 28733 25737 gene locus_tag LOCUS_03830 28733 25737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 29577 28720 gene locus_tag LOCUS_03840 29577 28720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 29992 29756 gene locus_tag LOCUS_03850 29992 29756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 >Feature sequence009 708 1196 gene locus_tag LOCUS_03860 708 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 3083 1476 gene locus_tag LOCUS_03870 3083 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3245 3712 gene locus_tag LOCUS_03880 3245 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 4485 3808 gene locus_tag LOCUS_03890 4485 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 5175 4651 gene locus_tag LOCUS_03900 5175 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 6032 5190 gene locus_tag LOCUS_03910 6032 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 6258 7424 gene locus_tag LOCUS_03920 6258 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 7730 7512 gene locus_tag LOCUS_03930 7730 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 7878 8525 gene locus_tag LOCUS_03940 gene tmk 7878 8525 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_03940 8603 9568 gene locus_tag LOCUS_03950 gene holB 8603 9568 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_03950 9694 11619 gene locus_tag LOCUS_03960 gene metG 9694 11619 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458904.1 protein_id gnl|my_center|LOCUS_03960 11978 16399 gene locus_tag LOCUS_03970 11978 16399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 16896 16396 gene locus_tag LOCUS_03980 16896 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 17215 17373 gene locus_tag LOCUS_03990 17215 17373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 18357 17386 gene locus_tag LOCUS_04000 18357 17386 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_04000 19806 18367 gene locus_tag LOCUS_04010 19806 18367 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_04010 20451 19813 gene locus_tag LOCUS_04020 20451 19813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 21948 20476 gene locus_tag LOCUS_04030 21948 20476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 23375 21945 gene locus_tag LOCUS_04040 23375 21945 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396789.1 protein_id gnl|my_center|LOCUS_04040 25222 23372 gene locus_tag LOCUS_04050 25222 23372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 25526 25224 gene locus_tag LOCUS_04060 25526 25224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 26029 25523 gene locus_tag LOCUS_04070 26029 25523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 27640 26153 gene locus_tag LOCUS_04080 27640 26153 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_04080 29147 27642 gene locus_tag LOCUS_04090 29147 27642 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence010 1146 2048 gene locus_tag LOCUS_04100 gene dacZ 1146 2048 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870515.1 protein_id gnl|my_center|LOCUS_04100 2097 2336 gene locus_tag LOCUS_04110 2097 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 2983 2237 gene locus_tag LOCUS_04120 gene lipB 2983 2237 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765857.1 protein_id gnl|my_center|LOCUS_04120 4034 2952 gene locus_tag LOCUS_04130 4034 2952 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080989.1 protein_id gnl|my_center|LOCUS_04130 4611 4018 gene locus_tag LOCUS_04140 4611 4018 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545392.1 protein_id gnl|my_center|LOCUS_04140 5897 4608 gene locus_tag LOCUS_04150 gene hflX 5897 4608 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804682.1 protein_id gnl|my_center|LOCUS_04150 9408 5932 gene locus_tag LOCUS_04160 gene dnaE 9408 5932 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_04160 11057 9516 gene locus_tag LOCUS_04170 gene guaA 11057 9516 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_04170 12537 11065 gene locus_tag LOCUS_04180 gene guaB 12537 11065 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_04180 13314 12628 gene locus_tag LOCUS_04190 13314 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 13477 14301 gene locus_tag LOCUS_04200 13477 14301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 15097 14279 gene locus_tag LOCUS_04210 15097 14279 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930650.1 protein_id gnl|my_center|LOCUS_04210 16410 15097 gene locus_tag LOCUS_04220 gene der 16410 15097 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_04220 16558 16634 gene locus_tag LOCUS_t00320 16558 16634 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18230 16677 gene locus_tag LOCUS_04230 18230 16677 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_04230 18452 19531 gene locus_tag LOCUS_04240 18452 19531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 19664 20287 gene locus_tag LOCUS_04250 19664 20287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 20288 21175 gene locus_tag LOCUS_04260 20288 21175 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_04260 21651 21145 gene locus_tag LOCUS_04270 21651 21145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 21762 22160 gene locus_tag LOCUS_04280 21762 22160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 22170 22505 gene locus_tag LOCUS_04290 22170 22505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 22544 23257 gene locus_tag LOCUS_04300 22544 23257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 23334 23726 gene locus_tag LOCUS_04310 23334 23726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 23933 24640 gene locus_tag LOCUS_04320 23933 24640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 25038 24676 gene locus_tag LOCUS_04330 25038 24676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 25517 25035 gene locus_tag LOCUS_04340 25517 25035 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_04340 25852 25523 gene locus_tag LOCUS_04350 gene ihfB 25852 25523 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705691.1 protein_id gnl|my_center|LOCUS_04350 26676 25882 gene locus_tag LOCUS_04360 gene sppA 26676 25882 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_04360 28447 26789 gene locus_tag LOCUS_04370 28447 26789 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_04370 <29677 28741 gene locus_tag LOCUS_04380 <29677 28741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141040.1:3-phosphoshikimate 1-carboxyvinyltransferase >Feature sequence011 <1 2248 gene locus_tag LOCUS_04390 <1 2248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942693.1:preprotein translocase subunit SecA 2260 3495 gene locus_tag LOCUS_04400 gene argJ 2260 3495 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_04400 3583 5715 gene locus_tag LOCUS_04410 gene cdsV 3583 5715 CDS product SctV family type III secretion system export apparatus subunit CdsV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871438.1 protein_id gnl|my_center|LOCUS_04410 6831 5758 gene locus_tag LOCUS_04420 6831 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 8060 6831 gene locus_tag LOCUS_04430 8060 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 9139 8087 gene locus_tag LOCUS_04440 9139 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 9230 11413 gene locus_tag LOCUS_04450 9230 11413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 11523 11834 gene locus_tag LOCUS_04460 11523 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 11932 12453 gene locus_tag LOCUS_04470 11932 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 12567 12986 gene locus_tag LOCUS_04480 12567 12986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 12983 13972 gene locus_tag LOCUS_04490 12983 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 14004 14450 gene locus_tag LOCUS_04500 14004 14450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 14468 14785 gene locus_tag LOCUS_04510 14468 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 15013 15870 gene locus_tag LOCUS_04520 15013 15870 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_04520 15870 16367 gene locus_tag LOCUS_04530 15870 16367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 16374 17402 gene locus_tag LOCUS_04540 16374 17402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 17441 18109 gene locus_tag LOCUS_04550 17441 18109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 18111 19439 gene locus_tag LOCUS_04560 gene fliI 18111 19439 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_04560 19429 19926 gene locus_tag LOCUS_04570 19429 19926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 19935 20843 gene locus_tag LOCUS_04580 19935 20843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 20889 21818 gene locus_tag LOCUS_04590 20889 21818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 21818 22312 gene locus_tag LOCUS_04600 21818 22312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 22309 22647 gene locus_tag LOCUS_04610 22309 22647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 22650 23519 gene locus_tag LOCUS_04620 gene vscR 22650 23519 CDS product SctR family type III secretion system export apparatus subunit VscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377232.1 protein_id gnl|my_center|LOCUS_04620 23520 23786 gene locus_tag LOCUS_04630 gene fliQ 23520 23786 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874036.1 protein_id gnl|my_center|LOCUS_04630 23795 24613 gene locus_tag LOCUS_04640 gene sctT 23795 24613 CDS product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176680.1 protein_id gnl|my_center|LOCUS_04640 24725 26767 gene locus_tag LOCUS_04650 24725 26767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 27013 28578 gene locus_tag LOCUS_04660 27013 28578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence012 3480 757 gene locus_tag LOCUS_04670 3480 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 4527 3490 gene locus_tag LOCUS_04680 4527 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 5929 5252 gene locus_tag LOCUS_04690 5929 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 7537 8223 gene locus_tag LOCUS_04700 7537 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 8629 9522 gene locus_tag LOCUS_04710 8629 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 9556 9930 gene locus_tag LOCUS_04720 9556 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 11122 10034 gene locus_tag LOCUS_04730 11122 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 14115 11179 gene locus_tag LOCUS_04740 14115 11179 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_04740 15011 14112 gene locus_tag LOCUS_04750 15011 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 17737 15500 gene locus_tag LOCUS_04760 17737 15500 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870191.1 protein_id gnl|my_center|LOCUS_04760 19719 17734 gene locus_tag LOCUS_04770 19719 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 20076 20336 gene locus_tag LOCUS_04780 20076 20336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 20663 20851 gene locus_tag LOCUS_04790 20663 20851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 20903 21127 gene locus_tag LOCUS_04800 20903 21127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 21093 21953 gene locus_tag LOCUS_04810 21093 21953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 22168 22875 gene locus_tag LOCUS_04820 22168 22875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 22832 23590 gene locus_tag LOCUS_04830 22832 23590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 23822 24727 gene locus_tag LOCUS_04840 23822 24727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 24739 24927 gene locus_tag LOCUS_04850 24739 24927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 25025 26152 gene locus_tag LOCUS_04860 25025 26152 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_04860 26316 26232 gene locus_tag LOCUS_t00330 26316 26232 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27011 26358 gene locus_tag LOCUS_04870 27011 26358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence013 2213 1806 gene locus_tag LOCUS_04880 2213 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 2954 2277 gene locus_tag LOCUS_04890 2954 2277 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_04890 3213 3287 gene locus_tag LOCUS_t00340 3213 3287 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5239 3323 gene locus_tag LOCUS_04900 gene rpoD 5239 3323 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_04900 7061 5262 gene locus_tag LOCUS_04910 gene dnaG 7061 5262 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_04910 7601 7137 gene locus_tag LOCUS_04920 7601 7137 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245774.1 protein_id gnl|my_center|LOCUS_04920 7788 7591 gene locus_tag LOCUS_04930 gene rpsU 7788 7591 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943714.1 protein_id gnl|my_center|LOCUS_04930 8026 9636 gene locus_tag LOCUS_04940 8026 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 9749 11338 gene locus_tag LOCUS_04950 9749 11338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 11923 11339 gene locus_tag LOCUS_04960 11923 11339 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_04960 12918 12049 gene locus_tag LOCUS_04970 12918 12049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 13449 12994 gene locus_tag LOCUS_04980 13449 12994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 13613 14482 gene locus_tag LOCUS_04990 13613 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 15295 14486 gene locus_tag LOCUS_05000 15295 14486 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941117.1 protein_id gnl|my_center|LOCUS_05000 16409 15297 gene locus_tag LOCUS_05010 16409 15297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 16641 16892 gene locus_tag LOCUS_05020 gene grxC 16641 16892 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_05020 17317 16889 gene locus_tag LOCUS_05030 17317 16889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 18575 17499 gene locus_tag LOCUS_05040 18575 17499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 19392 18583 gene locus_tag LOCUS_05050 19392 18583 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065067.1 protein_id gnl|my_center|LOCUS_05050 20314 19373 gene locus_tag LOCUS_05060 20314 19373 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_05060 21886 20318 gene locus_tag LOCUS_05070 21886 20318 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_05070 21984 23279 gene locus_tag LOCUS_05080 gene dacB 21984 23279 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091272.1 protein_id gnl|my_center|LOCUS_05080 23288 24760 gene locus_tag LOCUS_05090 23288 24760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 >Feature sequence014 2093 1362 gene locus_tag LOCUS_05100 gene pdxJ 2093 1362 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695556.1 protein_id gnl|my_center|LOCUS_05100 3448 2099 gene locus_tag LOCUS_05110 gene glmM 3448 2099 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_05110 4329 3514 gene locus_tag LOCUS_05120 gene folP 4329 3514 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_05120 6283 4364 gene locus_tag LOCUS_05130 gene ftsH 6283 4364 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_05130 7308 6280 gene locus_tag LOCUS_05140 7308 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 7786 7265 gene locus_tag LOCUS_05150 7786 7265 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940698.1 protein_id gnl|my_center|LOCUS_05150 8253 7864 gene locus_tag LOCUS_05160 8253 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 8780 8256 gene locus_tag LOCUS_05170 8780 8256 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_05170 10096 8777 gene locus_tag LOCUS_05180 gene miaB 10096 8777 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_05180 10489 10172 gene locus_tag LOCUS_05190 10489 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 10808 10566 gene locus_tag LOCUS_05200 10808 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 13510 10805 gene locus_tag LOCUS_05210 gene glnD 13510 10805 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_05210 14391 13519 gene locus_tag LOCUS_05220 14391 13519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 15281 14391 gene locus_tag LOCUS_05230 gene era 15281 14391 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_05230 16018 15278 gene locus_tag LOCUS_05240 gene rnc 16018 15278 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_05240 17336 16008 gene locus_tag LOCUS_05250 gene mtaB 17336 16008 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_05250 18466 17333 gene locus_tag LOCUS_05260 gene mnmA 18466 17333 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_05260 18586 20511 gene locus_tag LOCUS_05270 18586 20511 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138655632.1 protein_id gnl|my_center|LOCUS_05270 20714 20914 gene locus_tag LOCUS_05280 20714 20914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 21501 20911 gene locus_tag LOCUS_05290 21501 20911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 22406 21498 gene locus_tag LOCUS_05300 gene ldeG 22406 21498 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231525.1 protein_id gnl|my_center|LOCUS_05300 23603 22413 gene locus_tag LOCUS_05310 23603 22413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05310 24110 23694 gene locus_tag LOCUS_05320 24110 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05320 24980 24198 gene locus_tag LOCUS_05330 24980 24198 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039999.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence015 228 1319 gene locus_tag LOCUS_05340 228 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 2947 1349 gene locus_tag LOCUS_05350 2947 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3658 2990 gene locus_tag LOCUS_05360 gene mtgA 3658 2990 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842177.1 protein_id gnl|my_center|LOCUS_05360 4371 3655 gene locus_tag LOCUS_05370 4371 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4514 5482 gene locus_tag LOCUS_05380 4514 5482 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_05380 6284 5487 gene locus_tag LOCUS_05390 gene cntI 6284 5487 CDS product pseudopaline transport inner membrane protein CntI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104336.1 protein_id gnl|my_center|LOCUS_05390 6785 7066 gene locus_tag LOCUS_05400 6785 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 7114 7518 gene locus_tag LOCUS_05410 7114 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 7666 8853 gene locus_tag LOCUS_05420 7666 8853 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_05420 9682 8876 gene locus_tag LOCUS_05430 9682 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 9865 10671 gene locus_tag LOCUS_05440 9865 10671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 10751 12637 gene locus_tag LOCUS_05450 10751 12637 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104597.1 protein_id gnl|my_center|LOCUS_05450 12798 12870 gene locus_tag LOCUS_t00350 12798 12870 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 13990 12809 gene locus_tag LOCUS_05460 13990 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 14192 13923 gene locus_tag LOCUS_05470 14192 13923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 14712 14560 gene locus_tag LOCUS_05480 14712 14560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 14983 14786 gene locus_tag LOCUS_05490 14983 14786 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 protein_id gnl|my_center|LOCUS_05490 16361 15210 gene locus_tag LOCUS_05500 16361 15210 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208032.1 protein_id gnl|my_center|LOCUS_05500 17323 16361 gene locus_tag LOCUS_05510 gene hflC 17323 16361 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655940.1 protein_id gnl|my_center|LOCUS_05510 18380 17310 gene locus_tag LOCUS_05520 gene hflK 18380 17310 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_05520 19325 18426 gene locus_tag LOCUS_05530 19325 18426 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_05530 19513 19343 gene locus_tag LOCUS_05540 19513 19343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 19910 19707 gene locus_tag LOCUS_05550 19910 19707 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 protein_id gnl|my_center|LOCUS_05550 20104 21057 gene locus_tag LOCUS_05560 gene nhaR 20104 21057 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457134.1 protein_id gnl|my_center|LOCUS_05560 22211 21054 gene locus_tag LOCUS_05570 22211 21054 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242252.1 protein_id gnl|my_center|LOCUS_05570 22907 22407 gene locus_tag LOCUS_05580 22907 22407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 24347 24144 gene locus_tag LOCUS_05590 24347 24144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 24312 24623 gene locus_tag LOCUS_05600 24312 24623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence016 1898 2629 gene locus_tag LOCUS_05610 1898 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 2626 4944 gene locus_tag LOCUS_05620 2626 4944 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_05620 5139 6563 gene locus_tag LOCUS_05630 5139 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 6697 8322 gene locus_tag LOCUS_05640 6697 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 8335 9183 gene locus_tag LOCUS_05650 8335 9183 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_05650 9669 9226 gene locus_tag LOCUS_05660 gene trmL 9669 9226 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_05660 9768 11417 gene locus_tag LOCUS_05670 9768 11417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 11414 13474 gene locus_tag LOCUS_05680 11414 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 13491 14915 gene locus_tag LOCUS_05690 13491 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 14905 16047 gene locus_tag LOCUS_05700 14905 16047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 16044 17327 gene locus_tag LOCUS_05710 gene gshA 16044 17327 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 protein_id gnl|my_center|LOCUS_05710 17745 17362 gene locus_tag LOCUS_05720 gene dksA 17745 17362 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 protein_id gnl|my_center|LOCUS_05720 17849 18163 gene locus_tag LOCUS_05730 17849 18163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 19470 18160 gene locus_tag LOCUS_05740 19470 18160 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_05740 20126 19467 gene locus_tag LOCUS_05750 20126 19467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 20629 20129 gene locus_tag LOCUS_05760 gene purE 20629 20129 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_05760 21958 20705 gene locus_tag LOCUS_05770 gene purD 21958 20705 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_05770 22369 22010 gene locus_tag LOCUS_05780 22369 22010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence017 601 1548 gene locus_tag LOCUS_05790 gene gshB 601 1548 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529770.1 protein_id gnl|my_center|LOCUS_05790 1541 2311 gene locus_tag LOCUS_05800 gene gloB 1541 2311 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391018.1 protein_id gnl|my_center|LOCUS_05800 2378 3997 gene locus_tag LOCUS_05810 2378 3997 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_05810 4055 5500 gene locus_tag LOCUS_05820 4055 5500 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 protein_id gnl|my_center|LOCUS_05820 5494 6492 gene locus_tag LOCUS_05830 5494 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 6493 8169 gene locus_tag LOCUS_05840 gene ggt 6493 8169 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_05840 8308 8670 gene locus_tag LOCUS_05850 8308 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 9821 8667 gene locus_tag LOCUS_05860 9821 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 9927 10121 gene locus_tag LOCUS_05870 9927 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 10197 11414 gene locus_tag LOCUS_05880 10197 11414 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_05880 11467 12126 gene locus_tag LOCUS_05890 11467 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 13256 12123 gene locus_tag LOCUS_05900 13256 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 14273 13365 gene locus_tag LOCUS_05910 14273 13365 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707407.1 protein_id gnl|my_center|LOCUS_05910 14363 15541 gene locus_tag LOCUS_05920 14363 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 17089 15875 gene locus_tag LOCUS_05930 17089 15875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071315.1 protein_id gnl|my_center|LOCUS_05930 17709 17104 gene locus_tag LOCUS_05940 17709 17104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 18477 17875 gene locus_tag LOCUS_05950 18477 17875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 18965 19675 gene locus_tag LOCUS_05960 18965 19675 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_05960 19788 21659 gene locus_tag LOCUS_05970 19788 21659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 21674 22198 gene locus_tag LOCUS_05980 21674 22198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 23270 22275 gene locus_tag LOCUS_05990 23270 22275 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence018 169 1617 gene locus_tag LOCUS_06000 169 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 1965 1666 gene locus_tag LOCUS_06010 1965 1666 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918540.1 protein_id gnl|my_center|LOCUS_06010 2139 3818 gene locus_tag LOCUS_06020 gene ilvD 2139 3818 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_06020 4570 3902 gene locus_tag LOCUS_06030 4570 3902 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706961.1 protein_id gnl|my_center|LOCUS_06030 4697 5491 gene locus_tag LOCUS_06040 4697 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 5538 6377 gene locus_tag LOCUS_06050 5538 6377 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_06050 8280 6418 gene locus_tag LOCUS_06060 8280 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 8373 9377 gene locus_tag LOCUS_06070 gene akrN 8373 9377 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_06070 10298 9438 gene locus_tag LOCUS_06080 10298 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 10947 10309 gene locus_tag LOCUS_06090 10947 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 10997 12241 gene locus_tag LOCUS_06100 10997 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 12768 12151 gene locus_tag LOCUS_06110 12768 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 14227 12770 gene locus_tag LOCUS_06120 14227 12770 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_06120 14913 14218 gene locus_tag LOCUS_06130 14913 14218 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237713.1 protein_id gnl|my_center|LOCUS_06130 15845 14910 gene locus_tag LOCUS_06140 15845 14910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_06140 16640 15861 gene locus_tag LOCUS_06150 gene ybgF 16640 15861 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926896.1 protein_id gnl|my_center|LOCUS_06150 17184 16741 gene locus_tag LOCUS_06160 17184 16741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 17359 17808 gene locus_tag LOCUS_06170 17359 17808 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_06170 18891 17917 gene locus_tag LOCUS_06180 18891 17917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 22293 18964 gene locus_tag LOCUS_06190 22293 18964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence019 976 524 gene locus_tag LOCUS_06200 976 524 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933365.1 protein_id gnl|my_center|LOCUS_06200 2837 1236 gene locus_tag LOCUS_06210 2837 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3939 3010 gene locus_tag LOCUS_06220 3939 3010 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869082.1 protein_id gnl|my_center|LOCUS_06220 4374 4015 gene locus_tag LOCUS_06230 4374 4015 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_06230 4565 5287 gene locus_tag LOCUS_06240 4565 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5954 5373 gene locus_tag LOCUS_06250 5954 5373 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300417.1 protein_id gnl|my_center|LOCUS_06250 7520 6063 gene locus_tag LOCUS_06260 7520 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 7739 11398 gene locus_tag LOCUS_06270 7739 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 11656 11886 gene locus_tag LOCUS_06280 11656 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 13349 12015 gene locus_tag LOCUS_06290 13349 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 15446 13380 gene locus_tag LOCUS_06300 15446 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 16808 15606 gene locus_tag LOCUS_06310 16808 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 16976 17446 gene locus_tag LOCUS_06320 16976 17446 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_06320 17911 17504 gene locus_tag LOCUS_06330 17911 17504 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_06330 18017 18658 gene locus_tag LOCUS_06340 18017 18658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 18664 19122 gene locus_tag LOCUS_06350 18664 19122 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence020 13 693 gene locus_tag LOCUS_06360 13 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 831 2933 gene locus_tag LOCUS_06370 831 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 3343 2930 gene locus_tag LOCUS_06380 3343 2930 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093139.1 protein_id gnl|my_center|LOCUS_06380 5172 3421 gene locus_tag LOCUS_06390 5172 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 5776 5363 gene locus_tag LOCUS_06400 5776 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 6024 6299 gene locus_tag LOCUS_06410 6024 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 6292 7083 gene locus_tag LOCUS_06420 6292 7083 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 protein_id gnl|my_center|LOCUS_06420 7084 8205 gene locus_tag LOCUS_06430 7084 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 8231 9346 gene locus_tag LOCUS_06440 8231 9346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 9349 10596 gene locus_tag LOCUS_06450 9349 10596 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_06450 11648 10593 gene locus_tag LOCUS_06460 11648 10593 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315709.1 protein_id gnl|my_center|LOCUS_06460 11752 12627 gene locus_tag LOCUS_06470 11752 12627 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_06470 12624 13373 gene locus_tag LOCUS_06480 gene fabG 12624 13373 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566240.1 protein_id gnl|my_center|LOCUS_06480 13830 13384 gene locus_tag LOCUS_06490 13830 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 13988 16462 gene locus_tag LOCUS_06500 13988 16462 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421594.1 protein_id gnl|my_center|LOCUS_06500 16551 16847 gene locus_tag LOCUS_06510 16551 16847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 16844 17509 gene locus_tag LOCUS_06520 16844 17509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 18253 17525 gene locus_tag LOCUS_06530 gene fetB 18253 17525 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937792.1 protein_id gnl|my_center|LOCUS_06530 18342 18959 gene locus_tag LOCUS_06540 18342 18959 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106714032.1 protein_id gnl|my_center|LOCUS_06540 19156 21243 gene locus_tag LOCUS_06550 19156 21243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence021 63 151 gene locus_tag LOCUS_t00360 63 151 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 162 236 gene locus_tag LOCUS_t00370 162 236 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 258 455 gene locus_tag LOCUS_06560 258 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 467 540 gene locus_tag LOCUS_t00380 467 540 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 555 794 gene locus_tag LOCUS_06570 555 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 891 965 gene locus_tag LOCUS_t00390 891 965 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1010 1083 gene locus_tag LOCUS_t00400 1010 1083 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1141 1216 gene locus_tag LOCUS_t00410 1141 1216 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1261 1584 gene locus_tag LOCUS_06580 1261 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 1588 1662 gene locus_tag LOCUS_t00420 1588 1662 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1699 1953 gene locus_tag LOCUS_06590 1699 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 1916 2083 gene locus_tag LOCUS_06600 1916 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2219 2887 gene locus_tag LOCUS_06610 2219 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 2907 2978 gene locus_tag LOCUS_t00430 2907 2978 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2983 3058 gene locus_tag LOCUS_t00440 2983 3058 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3095 3670 gene locus_tag LOCUS_06620 3095 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 3673 4059 gene locus_tag LOCUS_06630 3673 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 4059 4454 gene locus_tag LOCUS_06640 4059 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 4441 4689 gene locus_tag LOCUS_06650 4441 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 4686 4895 gene locus_tag LOCUS_06660 4686 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 4909 6336 gene locus_tag LOCUS_06670 4909 6336 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107794.1 protein_id gnl|my_center|LOCUS_06670 6412 6810 gene locus_tag LOCUS_06680 6412 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 7106 7543 gene locus_tag LOCUS_06690 7106 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 7561 12057 gene locus_tag LOCUS_06700 7561 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 12249 12893 gene locus_tag LOCUS_06710 12249 12893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 12890 13345 gene locus_tag LOCUS_06720 12890 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 13605 13952 gene locus_tag LOCUS_06730 13605 13952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 13956 14246 gene locus_tag LOCUS_06740 13956 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 14259 14525 gene locus_tag LOCUS_06750 14259 14525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 14497 14886 gene locus_tag LOCUS_06760 14497 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 14938 15867 gene locus_tag LOCUS_06770 14938 15867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 15871 16260 gene locus_tag LOCUS_06780 15871 16260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 16247 16897 gene locus_tag LOCUS_06790 16247 16897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 16887 17582 gene locus_tag LOCUS_06800 16887 17582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 17587 18642 gene locus_tag LOCUS_06810 17587 18642 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_06810 18621 18983 gene locus_tag LOCUS_06820 18621 18983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 18983 19474 gene locus_tag LOCUS_06830 18983 19474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 19481 19765 gene locus_tag LOCUS_06840 19481 19765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 19765 21180 gene locus_tag LOCUS_06850 19765 21180 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_06850 21183 21665 gene locus_tag LOCUS_06860 21183 21665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 21667 22113 gene locus_tag LOCUS_06870 21667 22113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence022 539 907 gene locus_tag LOCUS_06880 539 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 954 1832 gene locus_tag LOCUS_06890 954 1832 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_06890 2526 1822 gene locus_tag LOCUS_06900 gene rph 2526 1822 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_06900 2655 3455 gene locus_tag LOCUS_06910 2655 3455 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_06910 3466 4635 gene locus_tag LOCUS_06920 3466 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470532.1 protein_id gnl|my_center|LOCUS_06920 5480 4632 gene locus_tag LOCUS_06930 5480 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 5540 7381 gene locus_tag LOCUS_06940 5540 7381 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002749.1 protein_id gnl|my_center|LOCUS_06940 8009 7347 gene locus_tag LOCUS_06950 8009 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 9436 8006 gene locus_tag LOCUS_06960 9436 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 10047 9436 gene locus_tag LOCUS_06970 10047 9436 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391567.1 protein_id gnl|my_center|LOCUS_06970 10608 10048 gene locus_tag LOCUS_06980 10608 10048 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_06980 11771 10713 gene locus_tag LOCUS_06990 11771 10713 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_06990 12782 11784 gene locus_tag LOCUS_07000 gene arsS 12782 11784 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_07000 13443 12775 gene locus_tag LOCUS_07010 13443 12775 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_07010 13636 14229 gene locus_tag LOCUS_07020 13636 14229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 14306 15049 gene locus_tag LOCUS_07030 14306 15049 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928794.1 protein_id gnl|my_center|LOCUS_07030 16991 15123 gene locus_tag LOCUS_07040 16991 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 17294 17617 gene locus_tag LOCUS_07050 17294 17617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 17829 17745 gene locus_tag LOCUS_t00450 17829 17745 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17927 19393 gene locus_tag LOCUS_07060 17927 19393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 19387 21180 gene locus_tag LOCUS_07070 19387 21180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 21226 21504 gene locus_tag LOCUS_07080 21226 21504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence023 825 1937 gene locus_tag LOCUS_07090 825 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 2019 3146 gene locus_tag LOCUS_07100 2019 3146 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388691.1 protein_id gnl|my_center|LOCUS_07100 3148 3588 gene locus_tag LOCUS_07110 3148 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 3581 4702 gene locus_tag LOCUS_07120 gene per 3581 4702 CDS product GDP-perosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918896.1 protein_id gnl|my_center|LOCUS_07120 4713 5483 gene locus_tag LOCUS_07130 4713 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 5480 6652 gene locus_tag LOCUS_07140 5480 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 6659 7570 gene locus_tag LOCUS_07150 6659 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 7573 8850 gene locus_tag LOCUS_07160 7573 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 8864 9976 gene locus_tag LOCUS_07170 8864 9976 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973530.1 protein_id gnl|my_center|LOCUS_07170 9983 11248 gene locus_tag LOCUS_07180 9983 11248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_07180 11238 11999 gene locus_tag LOCUS_07190 11238 11999 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242619.1 protein_id gnl|my_center|LOCUS_07190 12055 13047 gene locus_tag LOCUS_07200 12055 13047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 13075 14496 gene locus_tag LOCUS_07210 13075 14496 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937999.1 protein_id gnl|my_center|LOCUS_07210 14493 15395 gene locus_tag LOCUS_07220 14493 15395 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_07220 16780 15410 gene locus_tag LOCUS_07230 16780 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 18542 17115 gene locus_tag LOCUS_07240 18542 17115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 19630 18674 gene locus_tag LOCUS_07250 19630 18674 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055221127.1 protein_id gnl|my_center|LOCUS_07250 19761 21395 gene locus_tag LOCUS_07260 19761 21395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 <22006 21456 gene locus_tag LOCUS_07270 <22006 21456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762240.1:inositol-3-phosphate synthase >Feature sequence024 1331 321 gene locus_tag LOCUS_07280 1331 321 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081611101.1 protein_id gnl|my_center|LOCUS_07280 2392 1403 gene locus_tag LOCUS_07290 2392 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3968 2799 gene locus_tag LOCUS_07300 3968 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 5147 4026 gene locus_tag LOCUS_07310 5147 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 5385 5119 gene locus_tag LOCUS_07320 5385 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 6475 5570 gene locus_tag LOCUS_07330 6475 5570 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257650.1 protein_id gnl|my_center|LOCUS_07330 6577 6753 gene locus_tag LOCUS_07340 6577 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 6792 7370 gene locus_tag LOCUS_07350 gene sodB 6792 7370 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007299.1 protein_id gnl|my_center|LOCUS_07350 7396 8388 gene locus_tag LOCUS_07360 7396 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 8617 8925 gene locus_tag LOCUS_07370 8617 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 8959 9495 gene locus_tag LOCUS_07380 8959 9495 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388086.1 protein_id gnl|my_center|LOCUS_07380 9604 12003 gene locus_tag LOCUS_07390 9604 12003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 12818 12009 gene locus_tag LOCUS_07400 12818 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 12988 13578 gene locus_tag LOCUS_07410 12988 13578 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_07410 13660 14013 gene locus_tag LOCUS_07420 13660 14013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 14241 14071 gene locus_tag LOCUS_07430 gene rpmG 14241 14071 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205031.1 protein_id gnl|my_center|LOCUS_07430 14479 14252 gene locus_tag LOCUS_07440 gene rpsR 14479 14252 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143052.1 protein_id gnl|my_center|LOCUS_07440 14624 14908 gene locus_tag LOCUS_07450 14624 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 15087 16217 gene locus_tag LOCUS_07460 15087 16217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881423.1 protein_id gnl|my_center|LOCUS_07460 16246 17139 gene locus_tag LOCUS_07470 16246 17139 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_07470 17136 17951 gene locus_tag LOCUS_07480 17136 17951 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463336.1 protein_id gnl|my_center|LOCUS_07480 18382 17948 gene locus_tag LOCUS_07490 18382 17948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 18516 18956 gene locus_tag LOCUS_07500 18516 18956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 18975 20288 gene locus_tag LOCUS_07510 18975 20288 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898106.1 protein_id gnl|my_center|LOCUS_07510 20732 20346 gene locus_tag LOCUS_07520 20732 20346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence025 1269 241 gene locus_tag LOCUS_07530 1269 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 1844 1389 gene locus_tag LOCUS_07540 1844 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 2233 2613 gene locus_tag LOCUS_07550 2233 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3597 2629 gene locus_tag LOCUS_07560 gene bioB 3597 2629 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206558.1 protein_id gnl|my_center|LOCUS_07560 4646 3675 gene locus_tag LOCUS_07570 4646 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 4842 6080 gene locus_tag LOCUS_07580 4842 6080 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_07580 6191 7363 gene locus_tag LOCUS_07590 6191 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 protein_id gnl|my_center|LOCUS_07590 7508 7365 gene locus_tag LOCUS_07600 7508 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 8035 7496 gene locus_tag LOCUS_07610 8035 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 8606 8082 gene locus_tag LOCUS_07620 8606 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 10201 8798 gene locus_tag LOCUS_07630 10201 8798 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_07630 11813 10191 gene locus_tag LOCUS_07640 11813 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 14401 11816 gene locus_tag LOCUS_07650 14401 11816 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836865.1 protein_id gnl|my_center|LOCUS_07650 14524 14931 gene locus_tag LOCUS_07660 14524 14931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 15010 15858 gene locus_tag LOCUS_07670 15010 15858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 15879 16727 gene locus_tag LOCUS_07680 15879 16727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 18412 16829 gene locus_tag LOCUS_07690 18412 16829 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence026 673 1011 gene locus_tag LOCUS_07700 673 1011 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_07700 1063 2475 gene locus_tag LOCUS_07710 gene glnA 1063 2475 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_07710 2676 3710 gene locus_tag LOCUS_07720 2676 3710 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_07720 3714 4985 gene locus_tag LOCUS_07730 gene serS 3714 4985 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_07730 5132 5047 gene locus_tag LOCUS_t00460 5132 5047 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5293 5206 gene locus_tag LOCUS_t00470 5293 5206 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5614 6057 gene locus_tag LOCUS_07740 5614 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 6054 6398 gene locus_tag LOCUS_07750 6054 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 7499 6384 gene locus_tag LOCUS_07760 7499 6384 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731107.1 protein_id gnl|my_center|LOCUS_07760 8398 7496 gene locus_tag LOCUS_07770 8398 7496 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897588.1 protein_id gnl|my_center|LOCUS_07770 8929 8399 gene locus_tag LOCUS_07780 gene phaR 8929 8399 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192676.1 protein_id gnl|my_center|LOCUS_07780 9154 8933 gene locus_tag LOCUS_07790 9154 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 9943 9284 gene locus_tag LOCUS_07800 gene rpe 9943 9284 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_07800 10893 9940 gene locus_tag LOCUS_07810 gene fmt 10893 9940 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_07810 11547 10987 gene locus_tag LOCUS_07820 gene def 11547 10987 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_07820 13599 11560 gene locus_tag LOCUS_07830 13599 11560 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958461.1 protein_id gnl|my_center|LOCUS_07830 13699 13773 gene locus_tag LOCUS_t00480 13699 13773 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15167 13815 gene locus_tag LOCUS_07840 15167 13815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 15755 15249 gene locus_tag LOCUS_07850 15755 15249 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544998.1 protein_id gnl|my_center|LOCUS_07850 15966 16277 gene locus_tag LOCUS_07860 15966 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 16924 16361 gene locus_tag LOCUS_07870 16924 16361 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272666.1 protein_id gnl|my_center|LOCUS_07870 17655 16963 gene locus_tag LOCUS_07880 17655 16963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 18425 17670 gene locus_tag LOCUS_07890 18425 17670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 18828 18415 gene locus_tag LOCUS_07900 18828 18415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 <19950 18891 gene locus_tag LOCUS_07910 <19950 18891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546286.1:PBP1A family penicillin-binding protein >Feature sequence027 <1 1687 gene locus_tag LOCUS_07920 <1 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948536.1:class I SAM-dependent methyltransferase 1886 4036 gene locus_tag LOCUS_07930 1886 4036 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_07930 4221 6419 gene locus_tag LOCUS_07940 4221 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 6636 8774 gene locus_tag LOCUS_07950 6636 8774 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_07950 9090 8881 gene locus_tag LOCUS_07960 9090 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 11337 9145 gene locus_tag LOCUS_07970 11337 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 11720 11974 gene locus_tag LOCUS_07980 11720 11974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 12081 14906 gene locus_tag LOCUS_07990 12081 14906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 15352 17361 gene locus_tag LOCUS_08000 15352 17361 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 protein_id gnl|my_center|LOCUS_08000 19880 17484 gene locus_tag LOCUS_08010 19880 17484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence028 584 4681 gene locus_tag LOCUS_08020 584 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 4774 5268 gene locus_tag LOCUS_08030 4774 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08030 5368 6468 gene locus_tag LOCUS_08040 5368 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08040 6580 8067 gene locus_tag LOCUS_08050 gene rpoN 6580 8067 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_08050 8124 8417 gene locus_tag LOCUS_08060 8124 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 8436 8897 gene locus_tag LOCUS_08070 8436 8897 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_08070 8894 9841 gene locus_tag LOCUS_08080 gene hprK 8894 9841 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_08080 9851 10246 gene locus_tag LOCUS_08090 9851 10246 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639920.1 protein_id gnl|my_center|LOCUS_08090 10254 10538 gene locus_tag LOCUS_08100 10254 10538 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218178.1 protein_id gnl|my_center|LOCUS_08100 10667 11827 gene locus_tag LOCUS_08110 gene metK 10667 11827 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_08110 11917 13269 gene locus_tag LOCUS_08120 gene ahcY 11917 13269 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327756.1 protein_id gnl|my_center|LOCUS_08120 13603 16128 gene locus_tag LOCUS_08130 13603 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 16931 16125 gene locus_tag LOCUS_08140 gene truA 16931 16125 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_08140 19465 16931 gene locus_tag LOCUS_08150 19465 16931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence029 1878 1228 gene locus_tag LOCUS_08160 1878 1228 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_08160 2081 3385 gene locus_tag LOCUS_08170 2081 3385 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972423.1 protein_id gnl|my_center|LOCUS_08170 3927 3388 gene locus_tag LOCUS_08180 3927 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 4514 3933 gene locus_tag LOCUS_08190 4514 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 5293 4511 gene locus_tag LOCUS_08200 5293 4511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883970.1 protein_id gnl|my_center|LOCUS_08200 6288 5290 gene locus_tag LOCUS_08210 6288 5290 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897464.1 protein_id gnl|my_center|LOCUS_08210 7138 6290 gene locus_tag LOCUS_08220 7138 6290 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705594.1 protein_id gnl|my_center|LOCUS_08220 8591 7179 gene locus_tag LOCUS_08230 8591 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 9795 8593 gene locus_tag LOCUS_08240 9795 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 11831 9816 gene locus_tag LOCUS_08250 11831 9816 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517762.1 protein_id gnl|my_center|LOCUS_08250 12881 12204 gene locus_tag LOCUS_08260 12881 12204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 12991 13497 gene locus_tag LOCUS_08270 12991 13497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 13494 14324 gene locus_tag LOCUS_08280 13494 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 14944 14345 gene locus_tag LOCUS_08290 14944 14345 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_08290 15100 17022 gene locus_tag LOCUS_08300 15100 17022 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 protein_id gnl|my_center|LOCUS_08300 17512 16973 gene locus_tag LOCUS_08310 17512 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 17700 17879 gene locus_tag LOCUS_08320 17700 17879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 17884 18735 gene locus_tag LOCUS_08330 17884 18735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 18732 19796 gene locus_tag LOCUS_08340 18732 19796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence030 1542 61 gene locus_tag LOCUS_08350 gene glpK 1542 61 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_08350 1686 2660 gene locus_tag LOCUS_08360 1686 2660 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_08360 2808 3032 gene locus_tag LOCUS_08370 2808 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 3046 3339 gene locus_tag LOCUS_08380 3046 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 4964 3438 gene locus_tag LOCUS_08390 4964 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5264 6421 gene locus_tag LOCUS_08400 5264 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 6437 9688 gene locus_tag LOCUS_08410 6437 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 10616 9693 gene locus_tag LOCUS_08420 10616 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 10997 14860 gene locus_tag LOCUS_08430 10997 14860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 15606 14893 gene locus_tag LOCUS_08440 15606 14893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 15810 17111 gene locus_tag LOCUS_08450 gene hemL 15810 17111 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167257.1 protein_id gnl|my_center|LOCUS_08450 17120 17389 gene locus_tag LOCUS_08460 17120 17389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 17473 17844 gene locus_tag LOCUS_08470 17473 17844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 17888 18583 gene locus_tag LOCUS_08480 17888 18583 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_08480 18722 19051 gene locus_tag LOCUS_08490 18722 19051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 19140 19214 gene locus_tag LOCUS_t00490 19140 19214 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence031 15128 14859 gene locus_tag LOCUS_08500 15128 14859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 15264 15818 gene locus_tag LOCUS_08510 15264 15818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 15926 16744 gene locus_tag LOCUS_08520 15926 16744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 17006 16755 gene locus_tag LOCUS_08530 17006 16755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 17524 17003 gene locus_tag LOCUS_08540 17524 17003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 17625 18269 gene locus_tag LOCUS_08550 17625 18269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 18370 >19342 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctactcggcagtgaac >Feature sequence032 228 479 gene locus_tag LOCUS_08560 228 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 691 1620 gene locus_tag LOCUS_08570 691 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1660 2892 gene locus_tag LOCUS_08580 1660 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 2916 3131 gene locus_tag LOCUS_08590 2916 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 3144 4457 gene locus_tag LOCUS_08600 3144 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 4417 4659 gene locus_tag LOCUS_08610 4417 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 4656 5375 gene locus_tag LOCUS_08620 4656 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180938000.1 protein_id gnl|my_center|LOCUS_08620 5375 6886 gene locus_tag LOCUS_08630 5375 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975957.1 protein_id gnl|my_center|LOCUS_08630 6887 7330 gene locus_tag LOCUS_08640 6887 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 7314 8405 gene locus_tag LOCUS_08650 7314 8405 CDS product tail fiber domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531595.1 protein_id gnl|my_center|LOCUS_08650 8402 9613 gene locus_tag LOCUS_08660 8402 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 9610 11115 gene locus_tag LOCUS_08670 9610 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 11340 12515 gene locus_tag LOCUS_08680 11340 12515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 12519 12770 gene locus_tag LOCUS_08690 12519 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 12783 13949 gene locus_tag LOCUS_08700 12783 13949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 13946 14218 gene locus_tag LOCUS_08710 13946 14218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 14334 14639 gene locus_tag LOCUS_08720 14334 14639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 14641 15066 gene locus_tag LOCUS_08730 14641 15066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 15063 15344 gene locus_tag LOCUS_08740 15063 15344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 15379 15864 gene locus_tag LOCUS_08750 15379 15864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 15861 16109 gene locus_tag LOCUS_08760 15861 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 16424 16233 gene locus_tag LOCUS_08770 16424 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 16633 16424 gene locus_tag LOCUS_08780 16633 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 16818 16630 gene locus_tag LOCUS_08790 16818 16630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 17262 16843 gene locus_tag LOCUS_08800 17262 16843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 17775 17290 gene locus_tag LOCUS_08810 17775 17290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 17869 17657 gene locus_tag LOCUS_08820 17869 17657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 18195 17866 gene locus_tag LOCUS_08830 18195 17866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 18454 18212 gene locus_tag LOCUS_08840 18454 18212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 19057 18590 gene locus_tag LOCUS_08850 19057 18590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 19160 19029 gene locus_tag LOCUS_08860 19160 19029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence033 1480 1779 gene locus_tag LOCUS_08870 1480 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2751 1861 gene locus_tag LOCUS_08880 2751 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 3765 2845 gene locus_tag LOCUS_08890 3765 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3968 4231 gene locus_tag LOCUS_08900 3968 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 6054 4252 gene locus_tag LOCUS_08910 gene typA 6054 4252 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_08910 6575 6135 gene locus_tag LOCUS_08920 6575 6135 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_08920 6811 7131 gene locus_tag LOCUS_08930 6811 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 7132 8094 gene locus_tag LOCUS_08940 7132 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 8512 8096 gene locus_tag LOCUS_08950 8512 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 8602 8528 gene locus_tag LOCUS_t00500 8602 8528 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8814 8890 gene locus_tag LOCUS_t00510 8814 8890 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9195 10253 gene locus_tag LOCUS_08960 gene hflK 9195 10253 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_08960 10246 11205 gene locus_tag LOCUS_08970 gene hflC 10246 11205 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655940.1 protein_id gnl|my_center|LOCUS_08970 11255 11650 gene locus_tag LOCUS_08980 11255 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 11836 12315 gene locus_tag LOCUS_08990 11836 12315 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_08990 12467 13768 gene locus_tag LOCUS_09000 12467 13768 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860275.1 protein_id gnl|my_center|LOCUS_09000 13798 14853 gene locus_tag LOCUS_09010 13798 14853 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021055.1 protein_id gnl|my_center|LOCUS_09010 15699 14878 gene locus_tag LOCUS_09020 15699 14878 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_09020 16061 16552 gene locus_tag LOCUS_09030 16061 16552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence034 382 1188 gene locus_tag LOCUS_09040 382 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1749 1219 gene locus_tag LOCUS_09050 1749 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2328 1819 gene locus_tag LOCUS_09060 2328 1819 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_09060 3693 2458 gene locus_tag LOCUS_09070 3693 2458 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536367.1 protein_id gnl|my_center|LOCUS_09070 3844 5271 gene locus_tag LOCUS_09080 3844 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 6225 5296 gene locus_tag LOCUS_09090 6225 5296 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462061.1 protein_id gnl|my_center|LOCUS_09090 6691 6209 gene locus_tag LOCUS_09100 6691 6209 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017896.1 protein_id gnl|my_center|LOCUS_09100 6914 7312 gene locus_tag LOCUS_09110 6914 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 7372 8019 gene locus_tag LOCUS_09120 7372 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 8228 10285 gene locus_tag LOCUS_09130 8228 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 10637 10290 gene locus_tag LOCUS_09140 10637 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 10751 10679 gene locus_tag LOCUS_t00520 10751 10679 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13786 10853 gene locus_tag LOCUS_09150 13786 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 14142 15029 gene locus_tag LOCUS_09160 gene cysK 14142 15029 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941203.1 protein_id gnl|my_center|LOCUS_09160 15026 16255 gene locus_tag LOCUS_09170 gene thrC 15026 16255 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546459.1 protein_id gnl|my_center|LOCUS_09170 16296 16592 gene locus_tag LOCUS_09180 16296 16592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence035 2335 980 gene locus_tag LOCUS_09190 2335 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 2625 4571 gene locus_tag LOCUS_09200 2625 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 4632 5777 gene locus_tag LOCUS_09210 4632 5777 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337305.1 protein_id gnl|my_center|LOCUS_09210 5865 7622 gene locus_tag LOCUS_09220 5865 7622 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729678.1 protein_id gnl|my_center|LOCUS_09220 15003 7633 gene locus_tag LOCUS_09230 15003 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 15254 15631 gene locus_tag LOCUS_09240 15254 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence036 <1 732 gene locus_tag LOCUS_09250 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256896.1:alpha/beta fold hydrolase 2878 842 gene locus_tag LOCUS_09260 2878 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3950 2892 gene locus_tag LOCUS_09270 gene dcm 3950 2892 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690264.1 protein_id gnl|my_center|LOCUS_09270 4096 4950 gene locus_tag LOCUS_09280 4096 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 5746 4985 gene locus_tag LOCUS_09290 5746 4985 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028154.1 protein_id gnl|my_center|LOCUS_09290 6548 5754 gene locus_tag LOCUS_09300 6548 5754 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732812.1 protein_id gnl|my_center|LOCUS_09300 7516 6545 gene locus_tag LOCUS_09310 7516 6545 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519569.1 protein_id gnl|my_center|LOCUS_09310 7976 7530 gene locus_tag LOCUS_09320 7976 7530 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_09320 8919 7993 gene locus_tag LOCUS_09330 8919 7993 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467730.1 protein_id gnl|my_center|LOCUS_09330 10033 8912 gene locus_tag LOCUS_09340 gene ispG 10033 8912 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812233.1 protein_id gnl|my_center|LOCUS_09340 10323 10667 gene locus_tag LOCUS_09350 10323 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 10683 11282 gene locus_tag LOCUS_09360 gene folE 10683 11282 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 protein_id gnl|my_center|LOCUS_09360 11282 11695 gene locus_tag LOCUS_09370 11282 11695 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_09370 11692 12567 gene locus_tag LOCUS_09380 11692 12567 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227952.1 protein_id gnl|my_center|LOCUS_09380 12600 13292 gene locus_tag LOCUS_09390 12600 13292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 14431 13298 gene locus_tag LOCUS_09400 14431 13298 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583661.1 protein_id gnl|my_center|LOCUS_09400 14584 15375 gene locus_tag LOCUS_09410 14584 15375 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_09410 16175 15417 gene locus_tag LOCUS_09420 16175 15417 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727639.1 protein_id gnl|my_center|LOCUS_09420 <17488 16186 gene locus_tag LOCUS_09430 <17488 16186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223039.1:ATP-dependent DNA helicase >Feature sequence037 1117 593 gene locus_tag LOCUS_09440 1117 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 13543 1247 gene locus_tag LOCUS_09450 13543 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 13985 14725 gene locus_tag LOCUS_09460 13985 14725 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564613.1 protein_id gnl|my_center|LOCUS_09460 16213 14750 gene locus_tag LOCUS_09470 16213 14750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 16381 16454 gene locus_tag LOCUS_t00530 16381 16454 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16808 17002 gene locus_tag LOCUS_09480 16808 17002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 17462 16962 gene locus_tag LOCUS_09490 17462 16962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence038 1067 1597 gene locus_tag LOCUS_09500 1067 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1793 2290 gene locus_tag LOCUS_09510 1793 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 4512 2299 gene locus_tag LOCUS_09520 4512 2299 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944022.1 protein_id gnl|my_center|LOCUS_09520 6364 4526 gene locus_tag LOCUS_09530 gene glmS 6364 4526 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_09530 7792 6386 gene locus_tag LOCUS_09540 7792 6386 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940944.1 protein_id gnl|my_center|LOCUS_09540 7844 8575 gene locus_tag LOCUS_09550 7844 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 8625 10004 gene locus_tag LOCUS_09560 8625 10004 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027210.1 protein_id gnl|my_center|LOCUS_09560 10565 10014 gene locus_tag LOCUS_09570 10565 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 10695 11108 gene locus_tag LOCUS_09580 10695 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 11273 12625 gene locus_tag LOCUS_09590 gene mgtE 11273 12625 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225872.1 protein_id gnl|my_center|LOCUS_09590 13165 12755 gene locus_tag LOCUS_09600 13165 12755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 13283 14305 gene locus_tag LOCUS_09610 gene mutY 13283 14305 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269294.1 protein_id gnl|my_center|LOCUS_09610 14417 16150 gene locus_tag LOCUS_09620 14417 16150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence039 <1 737 gene locus_tag LOCUS_09630 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403573.1:mechanosensitive ion channel family protein 741 941 gene locus_tag LOCUS_09640 741 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1855 950 gene locus_tag LOCUS_09650 1855 950 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965435.1 protein_id gnl|my_center|LOCUS_09650 2890 2174 gene locus_tag LOCUS_09660 2890 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 3141 4082 gene locus_tag LOCUS_09670 3141 4082 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_09670 4222 4149 gene locus_tag LOCUS_t00540 4222 4149 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4384 5241 gene locus_tag LOCUS_09680 4384 5241 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_09680 5238 5882 gene locus_tag LOCUS_09690 5238 5882 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948142.1 protein_id gnl|my_center|LOCUS_09690 6301 5879 gene locus_tag LOCUS_09700 6301 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 6605 6303 gene locus_tag LOCUS_09710 6605 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 7216 6620 gene locus_tag LOCUS_09720 7216 6620 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_09720 8975 7239 gene locus_tag LOCUS_09730 8975 7239 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_09730 9787 8972 gene locus_tag LOCUS_09740 9787 8972 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969990.1 protein_id gnl|my_center|LOCUS_09740 11270 9984 gene locus_tag LOCUS_09750 11270 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 11584 13485 gene locus_tag LOCUS_09760 11584 13485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 13588 14478 gene locus_tag LOCUS_09770 13588 14478 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083991.1 protein_id gnl|my_center|LOCUS_09770 14487 14912 gene locus_tag LOCUS_09780 14487 14912 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326238.1 protein_id gnl|my_center|LOCUS_09780 16167 14983 gene locus_tag LOCUS_09790 16167 14983 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence040 1886 1071 gene locus_tag LOCUS_09800 1886 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2347 1898 gene locus_tag LOCUS_09810 gene tolR 2347 1898 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_09810 3111 2359 gene locus_tag LOCUS_09820 gene tolQ 3111 2359 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_09820 3336 3812 gene locus_tag LOCUS_09830 3336 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3820 4674 gene locus_tag LOCUS_09840 gene murI 3820 4674 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_09840 6391 4700 gene locus_tag LOCUS_09850 6391 4700 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546388.1 protein_id gnl|my_center|LOCUS_09850 6791 8002 gene locus_tag LOCUS_09860 6791 8002 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_09860 8057 8704 gene locus_tag LOCUS_09870 8057 8704 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_09870 8719 9633 gene locus_tag LOCUS_09880 8719 9633 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072295.1 protein_id gnl|my_center|LOCUS_09880 9646 10482 gene locus_tag LOCUS_09890 9646 10482 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261699.1 protein_id gnl|my_center|LOCUS_09890 10574 12124 gene locus_tag LOCUS_09900 10574 12124 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_09900 12211 16332 gene locus_tag LOCUS_09910 12211 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 17000 16329 gene locus_tag LOCUS_09920 17000 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence041 5310 3709 gene locus_tag LOCUS_09930 5310 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6168 5314 gene locus_tag LOCUS_09940 6168 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 6584 6165 gene locus_tag LOCUS_09950 6584 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 6933 7649 gene locus_tag LOCUS_09960 6933 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 7782 8891 gene locus_tag LOCUS_09970 7782 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 8903 9262 gene locus_tag LOCUS_09980 8903 9262 CDS product DUF3768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331421.1 protein_id gnl|my_center|LOCUS_09980 9624 10949 gene locus_tag LOCUS_09990 9624 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 10936 11874 gene locus_tag LOCUS_10000 10936 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 12484 12693 gene locus_tag LOCUS_10010 12484 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 14643 16142 gene locus_tag LOCUS_10020 14643 16142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 16154 16801 gene locus_tag LOCUS_10030 16154 16801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence042 689 387 gene locus_tag LOCUS_10040 689 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 738 1397 gene locus_tag LOCUS_10050 738 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1943 2149 gene locus_tag LOCUS_10060 1943 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2886 2332 gene locus_tag LOCUS_10070 2886 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 3021 3215 gene locus_tag LOCUS_10080 3021 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3212 3973 gene locus_tag LOCUS_10090 3212 3973 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_10090 3960 4400 gene locus_tag LOCUS_10100 3960 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4948 6285 gene locus_tag LOCUS_10110 4948 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 7143 6925 gene locus_tag LOCUS_10120 7143 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 7362 7610 gene locus_tag LOCUS_10130 7362 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 7777 8082 gene locus_tag LOCUS_10140 7777 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 8317 9744 gene locus_tag LOCUS_10150 8317 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 9821 10030 gene locus_tag LOCUS_10160 9821 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 10307 10831 gene locus_tag LOCUS_10170 10307 10831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 11104 10892 gene locus_tag LOCUS_10180 11104 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 11928 11203 gene locus_tag LOCUS_10190 11928 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 12068 13510 gene locus_tag LOCUS_10200 12068 13510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 13806 14528 gene locus_tag LOCUS_10210 13806 14528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 14530 15264 gene locus_tag LOCUS_10220 14530 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 15355 15567 gene locus_tag LOCUS_10230 15355 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 15670 16845 gene locus_tag LOCUS_10240 15670 16845 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_10240 16964 16891 gene locus_tag LOCUS_t00550 16964 16891 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence043 1275 1736 gene locus_tag LOCUS_10250 gene bcp 1275 1736 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_10250 1809 2012 gene locus_tag LOCUS_10260 1809 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3506 2106 gene locus_tag LOCUS_10270 3506 2106 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943126.1 protein_id gnl|my_center|LOCUS_10270 3663 4127 gene locus_tag LOCUS_10280 3663 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 4124 5041 gene locus_tag LOCUS_10290 4124 5041 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027134.1 protein_id gnl|my_center|LOCUS_10290 5234 5146 gene locus_tag LOCUS_t00560 5234 5146 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5402 6046 gene locus_tag LOCUS_10300 5402 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 6153 7181 gene locus_tag LOCUS_10310 6153 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 7596 7159 gene locus_tag LOCUS_10320 7596 7159 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_10320 7893 7609 gene locus_tag LOCUS_10330 7893 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 8882 8151 gene locus_tag LOCUS_10340 8882 8151 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_10340 9257 8892 gene locus_tag LOCUS_10350 9257 8892 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765183.1 protein_id gnl|my_center|LOCUS_10350 9707 9267 gene locus_tag LOCUS_10360 9707 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 9832 10305 gene locus_tag LOCUS_10370 9832 10305 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_10370 10431 11141 gene locus_tag LOCUS_10380 10431 11141 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210775.1 protein_id gnl|my_center|LOCUS_10380 11152 11970 gene locus_tag LOCUS_10390 11152 11970 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002078886.1 protein_id gnl|my_center|LOCUS_10390 12135 13205 gene locus_tag LOCUS_10400 12135 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 14322 13207 gene locus_tag LOCUS_10410 14322 13207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 14612 14697 gene locus_tag LOCUS_t00570 14612 14697 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15607 14792 gene locus_tag LOCUS_10420 15607 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 16823 15609 gene locus_tag LOCUS_10430 16823 15609 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464097.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence044 918 1298 gene locus_tag LOCUS_10440 918 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1394 2476 gene locus_tag LOCUS_10450 1394 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 2618 3607 gene locus_tag LOCUS_10460 2618 3607 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107839.1 protein_id gnl|my_center|LOCUS_10460 3690 5252 gene locus_tag LOCUS_10470 3690 5252 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_10470 5415 6500 gene locus_tag LOCUS_10480 5415 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 6591 7493 gene locus_tag LOCUS_10490 6591 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 7611 8453 gene locus_tag LOCUS_10500 7611 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 15890 8463 gene locus_tag LOCUS_10510 15890 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence045 <1 632 gene locus_tag LOCUS_10520 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772105.1:Holliday junction branch migration DNA helicase RuvB 703 1008 gene locus_tag LOCUS_10530 703 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1105 1395 gene locus_tag LOCUS_10540 1105 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2482 1475 gene locus_tag LOCUS_10550 2482 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2542 2862 gene locus_tag LOCUS_10560 2542 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 3373 2909 gene locus_tag LOCUS_10570 3373 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 4549 3524 gene locus_tag LOCUS_10580 4549 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 4941 4612 gene locus_tag LOCUS_10590 4941 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 6867 4957 gene locus_tag LOCUS_10600 6867 4957 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869266.1 protein_id gnl|my_center|LOCUS_10600 7436 6882 gene locus_tag LOCUS_10610 7436 6882 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 protein_id gnl|my_center|LOCUS_10610 9478 7607 gene locus_tag LOCUS_10620 9478 7607 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024232.1 protein_id gnl|my_center|LOCUS_10620 10105 9677 gene locus_tag LOCUS_10630 10105 9677 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582775.1 protein_id gnl|my_center|LOCUS_10630 10260 11900 gene locus_tag LOCUS_10640 10260 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 11973 13214 gene locus_tag LOCUS_10650 11973 13214 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545993.1 protein_id gnl|my_center|LOCUS_10650 13211 16255 gene locus_tag LOCUS_10660 13211 16255 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947422.1 protein_id gnl|my_center|LOCUS_10660 16656 16252 gene locus_tag LOCUS_10670 16656 16252 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence046 263 2218 gene locus_tag LOCUS_10680 263 2218 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 protein_id gnl|my_center|LOCUS_10680 2218 2778 gene locus_tag LOCUS_10690 gene pnuC 2218 2778 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206028.1 protein_id gnl|my_center|LOCUS_10690 2787 3752 gene locus_tag LOCUS_10700 gene nadR 2787 3752 CDS product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209221.1 protein_id gnl|my_center|LOCUS_10700 3902 5974 gene locus_tag LOCUS_10710 3902 5974 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137396889.1 protein_id gnl|my_center|LOCUS_10710 6730 6849 gene locus_tag LOCUS_10720 6730 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 6836 7093 gene locus_tag LOCUS_10730 6836 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 7077 7466 gene locus_tag LOCUS_10740 7077 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 7485 7937 gene locus_tag LOCUS_10750 7485 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 7945 8142 gene locus_tag LOCUS_10760 7945 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 8255 8980 gene locus_tag LOCUS_10770 8255 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 8988 9215 gene locus_tag LOCUS_10780 8988 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 9351 9581 gene locus_tag LOCUS_10790 9351 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 9733 9806 gene locus_tag LOCUS_t00580 9733 9806 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9980 10056 gene locus_tag LOCUS_t00590 9980 10056 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10106 10188 gene locus_tag LOCUS_t00600 10106 10188 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10239 10314 gene locus_tag LOCUS_t00610 10239 10314 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10328 11602 gene locus_tag LOCUS_10800 10328 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 11608 11928 gene locus_tag LOCUS_10810 11608 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 12031 12567 gene locus_tag LOCUS_10820 12031 12567 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124954.1 protein_id gnl|my_center|LOCUS_10820 12634 12717 gene locus_tag LOCUS_t00620 12634 12717 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12725 12816 gene locus_tag LOCUS_t00630 12725 12816 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12884 13318 gene locus_tag LOCUS_10830 12884 13318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 13324 13406 gene locus_tag LOCUS_t00640 13324 13406 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13548 13632 gene locus_tag LOCUS_t00650 13548 13632 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13781 14041 gene locus_tag LOCUS_10840 13781 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 14290 14372 gene locus_tag LOCUS_t00660 14290 14372 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14750 15019 gene locus_tag LOCUS_10850 14750 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 15027 15115 gene locus_tag LOCUS_t00670 15027 15115 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15120 15193 gene locus_tag LOCUS_t00680 15120 15193 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15231 15314 gene locus_tag LOCUS_t00690 15231 15314 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15319 15392 gene locus_tag LOCUS_t00700 15319 15392 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15446 15949 gene locus_tag LOCUS_10860 15446 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 15976 16389 gene locus_tag LOCUS_10870 15976 16389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence047 792 1022 gene locus_tag LOCUS_10880 792 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1133 1618 gene locus_tag LOCUS_10890 gene bfr 1133 1618 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_10890 1710 2636 gene locus_tag LOCUS_10900 1710 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3904 2669 gene locus_tag LOCUS_10910 3904 2669 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_10910 4441 3980 gene locus_tag LOCUS_10920 4441 3980 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940818.1 protein_id gnl|my_center|LOCUS_10920 5595 4438 gene locus_tag LOCUS_10930 gene proB 5595 4438 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546492.1 protein_id gnl|my_center|LOCUS_10930 6647 5592 gene locus_tag LOCUS_10940 gene cgtA 6647 5592 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210181.1 protein_id gnl|my_center|LOCUS_10940 6998 6732 gene locus_tag LOCUS_10950 gene rpmA 6998 6732 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194025.1 protein_id gnl|my_center|LOCUS_10950 7323 7012 gene locus_tag LOCUS_10960 gene rplU 7323 7012 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964569.1 protein_id gnl|my_center|LOCUS_10960 8953 7433 gene locus_tag LOCUS_10970 gene rng 8953 7433 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_10970 9125 9784 gene locus_tag LOCUS_10980 gene pyrE 9125 9784 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132758.1 protein_id gnl|my_center|LOCUS_10980 10803 9781 gene locus_tag LOCUS_10990 10803 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 11374 10862 gene locus_tag LOCUS_11000 11374 10862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 13886 11430 gene locus_tag LOCUS_11010 gene gyrB 13886 11430 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209642.1 protein_id gnl|my_center|LOCUS_11010 15132 14002 gene locus_tag LOCUS_11020 gene dnaN 15132 14002 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_11020 <16425 15520 gene locus_tag LOCUS_11030 <16425 15520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947895.1:chromosomal replication initiator protein DnaA >Feature sequence048 410 1228 gene locus_tag LOCUS_11040 410 1228 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_11040 1453 1662 gene locus_tag LOCUS_11050 1453 1662 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_11050 1759 2925 gene locus_tag LOCUS_11060 gene aroC 1759 2925 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_11060 2954 3445 gene locus_tag LOCUS_11070 2954 3445 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_11070 3447 4544 gene locus_tag LOCUS_11080 gene aroB 3447 4544 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_11080 4550 5080 gene locus_tag LOCUS_11090 4550 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 5077 5514 gene locus_tag LOCUS_11100 gene aroQ 5077 5514 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_11100 5526 6911 gene locus_tag LOCUS_11110 5526 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 7663 6908 gene locus_tag LOCUS_11120 7663 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 8714 7701 gene locus_tag LOCUS_11130 8714 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 8826 10064 gene locus_tag LOCUS_11140 gene hisS 8826 10064 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_11140 10066 11016 gene locus_tag LOCUS_11150 10066 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 11124 12911 gene locus_tag LOCUS_11160 gene aspS 11124 12911 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_11160 14661 12919 gene locus_tag LOCUS_11170 14661 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 15915 14905 gene locus_tag LOCUS_11180 15915 14905 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence049 114 704 gene locus_tag LOCUS_11190 114 704 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_11190 694 969 gene locus_tag LOCUS_11200 694 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1218 946 gene locus_tag LOCUS_11210 1218 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1272 2411 gene locus_tag LOCUS_11220 1272 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 3049 2417 gene locus_tag LOCUS_11230 3049 2417 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_11230 3185 3580 gene locus_tag LOCUS_11240 3185 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 4057 3671 gene locus_tag LOCUS_11250 4057 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 4755 4132 gene locus_tag LOCUS_11260 4755 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 5949 4864 gene locus_tag LOCUS_11270 5949 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 7280 5928 gene locus_tag LOCUS_11280 7280 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 8868 7351 gene locus_tag LOCUS_11290 8868 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 9218 9673 gene locus_tag LOCUS_11300 9218 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 10777 9746 gene locus_tag LOCUS_11310 10777 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 10947 11780 gene locus_tag LOCUS_11320 gene nhaR 10947 11780 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_11320 12827 12573 gene locus_tag LOCUS_11330 12827 12573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 13495 13104 gene locus_tag LOCUS_tm00010 13495 13104 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13925 13554 gene locus_tag LOCUS_11340 13925 13554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 14639 14064 gene locus_tag LOCUS_11350 14639 14064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 16236 14659 gene locus_tag LOCUS_11360 16236 14659 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence050 1210 746 gene locus_tag LOCUS_11370 1210 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1617 1255 gene locus_tag LOCUS_11380 1617 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2522 1623 gene locus_tag LOCUS_11390 2522 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3447 2500 gene locus_tag LOCUS_11400 3447 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 4627 3410 gene locus_tag LOCUS_11410 4627 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 5627 4773 gene locus_tag LOCUS_11420 5627 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5879 5703 gene locus_tag LOCUS_11430 5879 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 6592 5879 gene locus_tag LOCUS_11440 6592 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 6874 6674 gene locus_tag LOCUS_11450 6874 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 8496 6874 gene locus_tag LOCUS_11460 8496 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 9437 8562 gene locus_tag LOCUS_11470 9437 8562 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646256.1 protein_id gnl|my_center|LOCUS_11470 10471 9437 gene locus_tag LOCUS_11480 gene gmd 10471 9437 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965479.1 protein_id gnl|my_center|LOCUS_11480 11655 10471 gene locus_tag LOCUS_11490 11655 10471 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_11490 12630 11707 gene locus_tag LOCUS_11500 12630 11707 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_11500 13219 12617 gene locus_tag LOCUS_11510 13219 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 14029 13223 gene locus_tag LOCUS_11520 14029 13223 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202928.1 protein_id gnl|my_center|LOCUS_11520 15024 14026 gene locus_tag LOCUS_11530 gene galE 15024 14026 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_11530 <16029 15021 gene locus_tag LOCUS_11540 <16029 15021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205203.1:dTDP-L-rhamnose 4-epimerase >Feature sequence051 1150 2 gene locus_tag LOCUS_11550 1150 2 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_11550 1987 1247 gene locus_tag LOCUS_11560 1987 1247 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942366.1 protein_id gnl|my_center|LOCUS_11560 2541 1987 gene locus_tag LOCUS_11570 2541 1987 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146506.1 protein_id gnl|my_center|LOCUS_11570 3239 2538 gene locus_tag LOCUS_11580 gene queC 3239 2538 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024084.1 protein_id gnl|my_center|LOCUS_11580 3932 3285 gene locus_tag LOCUS_11590 3932 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4795 4187 gene locus_tag LOCUS_11600 4795 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 6681 4945 gene locus_tag LOCUS_11610 gene recJ 6681 4945 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_11610 7589 6678 gene locus_tag LOCUS_11620 gene secF 7589 6678 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_11620 9348 7630 gene locus_tag LOCUS_11630 gene secD 9348 7630 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546364.1 protein_id gnl|my_center|LOCUS_11630 9742 9353 gene locus_tag LOCUS_11640 9742 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 10865 9714 gene locus_tag LOCUS_11650 gene tgt 10865 9714 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768200.1 protein_id gnl|my_center|LOCUS_11650 12089 10971 gene locus_tag LOCUS_11660 12089 10971 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_11660 12300 12070 gene locus_tag LOCUS_11670 12300 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 12886 13440 gene locus_tag LOCUS_11680 12886 13440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 13437 14981 gene locus_tag LOCUS_11690 13437 14981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence052 <1 513 gene locus_tag LOCUS_11700 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096663.1:phosphate ABC transporter ATP-binding protein PstB 513 1178 gene locus_tag LOCUS_11710 gene phoU 513 1178 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_11710 2743 1184 gene locus_tag LOCUS_11720 2743 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 3135 2743 gene locus_tag LOCUS_11730 gene crcB 3135 2743 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_11730 3193 3840 gene locus_tag LOCUS_11740 3193 3840 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930580.1 protein_id gnl|my_center|LOCUS_11740 3833 4420 gene locus_tag LOCUS_11750 3833 4420 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_11750 4847 5722 gene locus_tag LOCUS_11760 4847 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5733 6584 gene locus_tag LOCUS_11770 5733 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 6588 7892 gene locus_tag LOCUS_11780 gene mgtE 6588 7892 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_11780 9075 8038 gene locus_tag LOCUS_11790 9075 8038 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261387.1 protein_id gnl|my_center|LOCUS_11790 10295 9084 gene locus_tag LOCUS_11800 10295 9084 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337623.1 protein_id gnl|my_center|LOCUS_11800 10676 11365 gene locus_tag LOCUS_11810 10676 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 13132 11537 gene locus_tag LOCUS_11820 13132 11537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 protein_id gnl|my_center|LOCUS_11820 <15579 13116 gene locus_tag LOCUS_11830 <15579 13116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989571.1:2-hydroxyacyl-CoA dehydratase >Feature sequence053 990 28 gene locus_tag LOCUS_11840 990 28 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957757.1 protein_id gnl|my_center|LOCUS_11840 1184 1933 gene locus_tag LOCUS_11850 1184 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 2162 3493 gene locus_tag LOCUS_11860 2162 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3594 4586 gene locus_tag LOCUS_11870 3594 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 4718 7621 gene locus_tag LOCUS_11880 4718 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 8288 7638 gene locus_tag LOCUS_11890 8288 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 9163 8285 gene locus_tag LOCUS_11900 9163 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 9834 9295 gene locus_tag LOCUS_11910 9834 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 9992 10825 gene locus_tag LOCUS_11920 9992 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 12243 11005 gene locus_tag LOCUS_11930 12243 11005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 12477 13616 gene locus_tag LOCUS_11940 12477 13616 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_11940 13631 14140 gene locus_tag LOCUS_11950 13631 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence054 3409 44 gene locus_tag LOCUS_11960 3409 44 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143960588.1 protein_id gnl|my_center|LOCUS_11960 3751 3482 gene locus_tag LOCUS_11970 3751 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 5075 3939 gene locus_tag LOCUS_11980 5075 3939 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957890.1 protein_id gnl|my_center|LOCUS_11980 6108 5167 gene locus_tag LOCUS_11990 6108 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 9303 6148 gene locus_tag LOCUS_12000 9303 6148 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839353.1 protein_id gnl|my_center|LOCUS_12000 9290 9469 gene locus_tag LOCUS_12010 9290 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 10050 9523 gene locus_tag LOCUS_12020 gene hpt 10050 9523 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_12020 10694 10047 gene locus_tag LOCUS_12030 10694 10047 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393814.1 protein_id gnl|my_center|LOCUS_12030 10815 11441 gene locus_tag LOCUS_12040 10815 11441 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755401.1 protein_id gnl|my_center|LOCUS_12040 12369 11431 gene locus_tag LOCUS_12050 12369 11431 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411960.1 protein_id gnl|my_center|LOCUS_12050 13825 12389 gene locus_tag LOCUS_12060 gene astD 13825 12389 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946665.1 protein_id gnl|my_center|LOCUS_12060 14959 13970 gene locus_tag LOCUS_12070 14959 13970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence055 4665 1690 gene locus_tag LOCUS_12080 4665 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 6092 4662 gene locus_tag LOCUS_12090 6092 4662 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_12090 7188 6115 gene locus_tag LOCUS_12100 7188 6115 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_12100 8084 7188 gene locus_tag LOCUS_12110 8084 7188 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_12110 8336 9190 gene locus_tag LOCUS_12120 8336 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 9187 10260 gene locus_tag LOCUS_12130 9187 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 10370 11053 gene locus_tag LOCUS_12140 10370 11053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 11435 12322 gene locus_tag LOCUS_12150 gene hisG 11435 12322 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_12150 12322 12867 gene locus_tag LOCUS_12160 12322 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 12867 13166 gene locus_tag LOCUS_12170 12867 13166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 13163 13480 gene locus_tag LOCUS_12180 gene mnhG 13163 13480 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902380.1 protein_id gnl|my_center|LOCUS_12180 13477 13722 gene locus_tag LOCUS_12190 13477 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 13719 14006 gene locus_tag LOCUS_12200 13719 14006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12200 13999 14436 gene locus_tag LOCUS_12210 13999 14436 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867848.1 protein_id gnl|my_center|LOCUS_12210 14433 14789 gene locus_tag LOCUS_12220 14433 14789 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence056 1254 160 gene locus_tag LOCUS_12230 1254 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1614 1366 gene locus_tag LOCUS_12240 1614 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1725 2345 gene locus_tag LOCUS_12250 1725 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2393 3001 gene locus_tag LOCUS_12260 2393 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202392502.1 protein_id gnl|my_center|LOCUS_12260 2998 3180 gene locus_tag LOCUS_12270 2998 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3161 3439 gene locus_tag LOCUS_12280 3161 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 3444 3695 gene locus_tag LOCUS_12290 3444 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 3692 3895 gene locus_tag LOCUS_12300 3692 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 5681 3975 gene locus_tag LOCUS_12310 5681 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 7016 5745 gene locus_tag LOCUS_12320 7016 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 7760 7092 gene locus_tag LOCUS_12330 7760 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 8597 7860 gene locus_tag LOCUS_12340 8597 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 9177 8659 gene locus_tag LOCUS_12350 9177 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 10111 9281 gene locus_tag LOCUS_12360 10111 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 10246 12567 gene locus_tag LOCUS_12370 10246 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 13954 12617 gene locus_tag LOCUS_12380 13954 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 14388 14080 gene locus_tag LOCUS_12390 14388 14080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence057 <1 1574 gene locus_tag LOCUS_12400 <1 1574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943700.1:penicillin-binding protein 1643 3115 gene locus_tag LOCUS_12410 1643 3115 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_12410 3112 4503 gene locus_tag LOCUS_12420 3112 4503 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_12420 4503 5579 gene locus_tag LOCUS_12430 gene mraY 4503 5579 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_12430 5597 6970 gene locus_tag LOCUS_12440 gene murD 5597 6970 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_12440 6963 8081 gene locus_tag LOCUS_12450 gene ftsW 6963 8081 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_12450 8081 9151 gene locus_tag LOCUS_12460 gene murG 8081 9151 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_12460 9195 10583 gene locus_tag LOCUS_12470 gene murC 9195 10583 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_12470 10590 11513 gene locus_tag LOCUS_12480 gene murB 10590 11513 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437038.1 protein_id gnl|my_center|LOCUS_12480 11623 12546 gene locus_tag LOCUS_12490 11623 12546 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_12490 12543 13385 gene locus_tag LOCUS_12500 12543 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 13504 14730 gene locus_tag LOCUS_12510 gene ftsA 13504 14730 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence058 2766 838 gene locus_tag LOCUS_12520 2766 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3366 2773 gene locus_tag LOCUS_12530 3366 2773 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800555.1 protein_id gnl|my_center|LOCUS_12530 4193 3363 gene locus_tag LOCUS_12540 4193 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4245 5144 gene locus_tag LOCUS_12550 4245 5144 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_12550 5977 5141 gene locus_tag LOCUS_12560 gene nadC 5977 5141 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 protein_id gnl|my_center|LOCUS_12560 8710 6059 gene locus_tag LOCUS_12570 8710 6059 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_12570 9660 8836 gene locus_tag LOCUS_12580 9660 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 10537 9665 gene locus_tag LOCUS_12590 10537 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 10690 11817 gene locus_tag LOCUS_12600 10690 11817 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_12600 12766 11888 gene locus_tag LOCUS_12610 12766 11888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 13396 12821 gene locus_tag LOCUS_12620 13396 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence059 3 3641 gene locus_tag LOCUS_12630 3 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3747 5465 gene locus_tag LOCUS_12640 3747 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 6110 5502 gene locus_tag LOCUS_12650 6110 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 7606 6116 gene locus_tag LOCUS_12660 7606 6116 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706587.1 protein_id gnl|my_center|LOCUS_12660 7685 9202 gene locus_tag LOCUS_12670 gene ppcA 7685 9202 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980180.1 protein_id gnl|my_center|LOCUS_12670 10693 9227 gene locus_tag LOCUS_12680 gene nuoN 10693 9227 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815945.1 protein_id gnl|my_center|LOCUS_12680 12198 10690 gene locus_tag LOCUS_12690 gene nuoM 12198 10690 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365593.1 protein_id gnl|my_center|LOCUS_12690 <13848 12223 gene locus_tag LOCUS_12700 <13848 12223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097681.1:NADH-quinone oxidoreductase subunit L >Feature sequence060 383 1309 gene locus_tag LOCUS_12710 383 1309 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027134.1 protein_id gnl|my_center|LOCUS_12710 2514 1306 gene locus_tag LOCUS_12720 2514 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3438 2599 gene locus_tag LOCUS_12730 3438 2599 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789270.1 protein_id gnl|my_center|LOCUS_12730 3557 4501 gene locus_tag LOCUS_12740 gene hemC 3557 4501 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_12740 4485 6011 gene locus_tag LOCUS_12750 gene cobA 4485 6011 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_12750 7674 6004 gene locus_tag LOCUS_12760 gene mnmC 7674 6004 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114497.1 protein_id gnl|my_center|LOCUS_12760 8749 7697 gene locus_tag LOCUS_12770 gene argC 8749 7697 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_12770 9373 8978 gene locus_tag LOCUS_12780 gene rpsI 9373 8978 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_12780 9855 9403 gene locus_tag LOCUS_12790 gene rplM 9855 9403 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_12790 10112 11179 gene locus_tag LOCUS_12800 10112 11179 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227928.1 protein_id gnl|my_center|LOCUS_12800 11179 12180 gene locus_tag LOCUS_12810 11179 12180 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_12810 12765 12283 gene locus_tag LOCUS_12820 12765 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 13459 12938 gene locus_tag LOCUS_12830 13459 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence061 632 144 gene locus_tag LOCUS_12840 632 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 855 5528 gene locus_tag LOCUS_12850 855 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 6469 5534 gene locus_tag LOCUS_12860 6469 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 6694 7305 gene locus_tag LOCUS_12870 6694 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 8023 7343 gene locus_tag LOCUS_12880 8023 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8783 8028 gene locus_tag LOCUS_12890 8783 8028 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946295.1 protein_id gnl|my_center|LOCUS_12890 9694 8831 gene locus_tag LOCUS_12900 gene rpoH 9694 8831 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941316.1 protein_id gnl|my_center|LOCUS_12900 9935 10378 gene locus_tag LOCUS_12910 9935 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 10375 11835 gene locus_tag LOCUS_12920 10375 11835 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence062 <1 986 gene locus_tag LOCUS_12930 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926891.1:DEAD/DEAH box helicase 1007 1639 gene locus_tag LOCUS_12940 1007 1639 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096936.1 protein_id gnl|my_center|LOCUS_12940 4787 1659 gene locus_tag LOCUS_12950 gene ileS 4787 1659 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873497.1 protein_id gnl|my_center|LOCUS_12950 4964 6346 gene locus_tag LOCUS_12960 4964 6346 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_12960 8259 6352 gene locus_tag LOCUS_12970 8259 6352 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089263.1 protein_id gnl|my_center|LOCUS_12970 8462 8244 gene locus_tag LOCUS_12980 8462 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 9317 8529 gene locus_tag LOCUS_12990 9317 8529 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489429.1 protein_id gnl|my_center|LOCUS_12990 9724 9326 gene locus_tag LOCUS_13000 9724 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 9833 10462 gene locus_tag LOCUS_13010 9833 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 10449 11189 gene locus_tag LOCUS_13020 10449 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 11271 12086 gene locus_tag LOCUS_13030 11271 12086 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706954.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence063 279 76 gene locus_tag LOCUS_13040 279 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 909 289 gene locus_tag LOCUS_13050 gene pgsA 909 289 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_13050 1040 2632 gene locus_tag LOCUS_13060 gene nadB 1040 2632 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_13060 3243 2620 gene locus_tag LOCUS_13070 3243 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 4086 3244 gene locus_tag LOCUS_13080 4086 3244 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142701.1 protein_id gnl|my_center|LOCUS_13080 5170 4073 gene locus_tag LOCUS_13090 gene dnaJ 5170 4073 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940501.1 protein_id gnl|my_center|LOCUS_13090 5395 7293 gene locus_tag LOCUS_13100 gene dnaK 5395 7293 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557108.1 protein_id gnl|my_center|LOCUS_13100 7307 8077 gene locus_tag LOCUS_13110 7307 8077 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_13110 8125 9213 gene locus_tag LOCUS_13120 gene mqnC 8125 9213 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_13120 9217 11487 gene locus_tag LOCUS_13130 gene ptsP 9217 11487 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941826.1 protein_id gnl|my_center|LOCUS_13130 11675 12535 gene locus_tag LOCUS_13140 11675 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence064 <1 3585 gene locus_tag LOCUS_13150 <1 3585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:type I polyketide synthase 4311 3598 gene locus_tag LOCUS_13160 4311 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 4707 5462 gene locus_tag LOCUS_13170 4707 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 6957 5545 gene locus_tag LOCUS_13180 6957 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 7201 9711 gene locus_tag LOCUS_13190 7201 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 12084 9739 gene locus_tag LOCUS_13200 12084 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 13389 12118 gene locus_tag LOCUS_13210 gene ftsZ 13389 12118 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence065 895 1314 gene locus_tag LOCUS_13220 895 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1497 2546 gene locus_tag LOCUS_13230 1497 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 2646 3254 gene locus_tag LOCUS_13240 2646 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3322 4302 gene locus_tag LOCUS_13250 3322 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 4382 7348 gene locus_tag LOCUS_13260 gene aceE 4382 7348 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_13260 7577 10609 gene locus_tag LOCUS_13270 7577 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 10768 11709 gene locus_tag LOCUS_13280 10768 11709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 11760 12890 gene locus_tag LOCUS_13290 11760 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence066 231 995 gene locus_tag LOCUS_13300 gene rplC 231 995 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184218.1 protein_id gnl|my_center|LOCUS_13300 995 1615 gene locus_tag LOCUS_13310 gene rplD 995 1615 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966411.1 protein_id gnl|my_center|LOCUS_13310 1603 1899 gene locus_tag LOCUS_13320 1603 1899 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_13320 1918 2745 gene locus_tag LOCUS_13330 gene rplB 1918 2745 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_13330 2748 3005 gene locus_tag LOCUS_13340 gene rpsS 2748 3005 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_13340 3021 3353 gene locus_tag LOCUS_13350 gene rplV 3021 3353 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943481.1 protein_id gnl|my_center|LOCUS_13350 3360 4016 gene locus_tag LOCUS_13360 gene rpsC 3360 4016 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_13360 4022 4444 gene locus_tag LOCUS_13370 gene rplP 4022 4444 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_13370 4434 4643 gene locus_tag LOCUS_13380 4434 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 4621 4935 gene locus_tag LOCUS_13390 gene rpsQ 4621 4935 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_13390 4932 5300 gene locus_tag LOCUS_13400 gene rplN 4932 5300 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205457.1 protein_id gnl|my_center|LOCUS_13400 5302 5607 gene locus_tag LOCUS_13410 gene rplX 5302 5607 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427723.1 protein_id gnl|my_center|LOCUS_13410 5611 6150 gene locus_tag LOCUS_13420 gene rplE 5611 6150 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_13420 6156 6341 gene locus_tag LOCUS_13430 6156 6341 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943473.1 protein_id gnl|my_center|LOCUS_13430 6355 6753 gene locus_tag LOCUS_13440 gene rpsH 6355 6753 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055949.1 protein_id gnl|my_center|LOCUS_13440 6769 7305 gene locus_tag LOCUS_13450 gene rplF 6769 7305 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_13450 7327 7683 gene locus_tag LOCUS_13460 gene rplR 7327 7683 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421141.1 protein_id gnl|my_center|LOCUS_13460 7707 8225 gene locus_tag LOCUS_13470 gene rpsE 7707 8225 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_13470 8238 8678 gene locus_tag LOCUS_13480 gene rplO 8238 8678 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_13480 8683 9984 gene locus_tag LOCUS_13490 gene secY 8683 9984 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_13490 9984 10565 gene locus_tag LOCUS_13500 9984 10565 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789400.1 protein_id gnl|my_center|LOCUS_13500 10569 11315 gene locus_tag LOCUS_13510 gene map 10569 11315 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_13510 11443 11826 gene locus_tag LOCUS_13520 gene rpsM 11443 11826 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_13520 11847 12281 gene locus_tag LOCUS_13530 gene rpsK 11847 12281 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_13530 12293 12922 gene locus_tag LOCUS_13540 gene rpsD 12293 12922 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence067 3031 1382 gene locus_tag LOCUS_13550 3031 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 3308 3123 gene locus_tag LOCUS_13560 3308 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 3744 3394 gene locus_tag LOCUS_13570 3744 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 4189 5235 gene locus_tag LOCUS_13580 4189 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 5246 5872 gene locus_tag LOCUS_13590 5246 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 7227 6352 gene locus_tag LOCUS_13600 7227 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 8691 7249 gene locus_tag LOCUS_13610 8691 7249 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_13610 8809 9018 gene locus_tag LOCUS_13620 8809 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 9290 9015 gene locus_tag LOCUS_13630 9290 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 9453 10028 gene locus_tag LOCUS_13640 9453 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 10034 10294 gene locus_tag LOCUS_13650 10034 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 10284 12560 gene locus_tag LOCUS_13660 10284 12560 CDS product type B DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878196.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence068 2636 1203 gene locus_tag LOCUS_13670 2636 1203 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_13670 4033 2633 gene locus_tag LOCUS_13680 4033 2633 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_13680 5178 4045 gene locus_tag LOCUS_13690 5178 4045 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939667.1 protein_id gnl|my_center|LOCUS_13690 5396 6430 gene locus_tag LOCUS_13700 gene purM 5396 6430 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_13700 6427 7038 gene locus_tag LOCUS_13710 gene purN 6427 7038 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938037.1 protein_id gnl|my_center|LOCUS_13710 7035 7628 gene locus_tag LOCUS_13720 7035 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 7672 9123 gene locus_tag LOCUS_13730 7672 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 9771 9139 gene locus_tag LOCUS_13740 9771 9139 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_13740 10183 9776 gene locus_tag LOCUS_13750 gene rplS 10183 9776 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_13750 10969 10286 gene locus_tag LOCUS_13760 gene trmD 10969 10286 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545349.1 protein_id gnl|my_center|LOCUS_13760 11273 11043 gene locus_tag LOCUS_13770 11273 11043 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_13770 11545 11300 gene locus_tag LOCUS_13780 gene rpsP 11545 11300 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813195.1 protein_id gnl|my_center|LOCUS_13780 12514 11840 gene locus_tag LOCUS_13790 12514 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence069 328 1488 gene locus_tag LOCUS_13800 328 1488 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_13800 1663 1938 gene locus_tag LOCUS_13810 1663 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1977 3215 gene locus_tag LOCUS_13820 1977 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 5588 3972 gene locus_tag LOCUS_13830 5588 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 8722 6014 gene locus_tag LOCUS_13840 8722 6014 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063890.1 protein_id gnl|my_center|LOCUS_13840 9861 8719 gene locus_tag LOCUS_13850 9861 8719 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931043.1 protein_id gnl|my_center|LOCUS_13850 10054 11160 gene locus_tag LOCUS_13860 10054 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 11183 12112 gene locus_tag LOCUS_13870 11183 12112 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_13870 12441 12653 gene locus_tag LOCUS_13880 12441 12653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence070 417 145 gene locus_tag LOCUS_13890 417 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1509 616 gene locus_tag LOCUS_13900 1509 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2524 1655 gene locus_tag LOCUS_13910 2524 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3905 2676 gene locus_tag LOCUS_13920 3905 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4151 5530 gene locus_tag LOCUS_13930 4151 5530 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015207390.1 protein_id gnl|my_center|LOCUS_13930 6414 5425 gene locus_tag LOCUS_13940 6414 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 7823 6597 gene locus_tag LOCUS_13950 7823 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 8515 7820 gene locus_tag LOCUS_13960 8515 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 8637 9758 gene locus_tag LOCUS_13970 gene alr 8637 9758 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_13970 9751 10542 gene locus_tag LOCUS_13980 9751 10542 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880179.1 protein_id gnl|my_center|LOCUS_13980 10546 11283 gene locus_tag LOCUS_13990 10546 11283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_13990 11280 12644 gene locus_tag LOCUS_14000 11280 12644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence071 92 1102 gene locus_tag LOCUS_14010 92 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1295 2584 gene locus_tag LOCUS_14020 gene gatB 1295 2584 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_14020 2594 3637 gene locus_tag LOCUS_14030 gene mtnA 2594 3637 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_14030 3647 4570 gene locus_tag LOCUS_14040 3647 4570 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_14040 4817 11173 gene locus_tag LOCUS_14050 4817 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 12187 11177 gene locus_tag LOCUS_14060 12187 11177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 12690 12415 gene locus_tag LOCUS_14070 12690 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence072 3116 1914 gene locus_tag LOCUS_14080 3116 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 5126 3471 gene locus_tag LOCUS_14090 gene groL 5126 3471 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_14090 5449 5141 gene locus_tag LOCUS_14100 gene groES 5449 5141 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_14100 6185 5613 gene locus_tag LOCUS_14110 6185 5613 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881136.1 protein_id gnl|my_center|LOCUS_14110 6342 7352 gene locus_tag LOCUS_14120 gene gap 6342 7352 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_14120 7357 8544 gene locus_tag LOCUS_14130 7357 8544 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_14130 8541 9299 gene locus_tag LOCUS_14140 gene tpiA 8541 9299 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927032.1 protein_id gnl|my_center|LOCUS_14140 9309 9677 gene locus_tag LOCUS_14150 9309 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 9921 9838 gene locus_tag LOCUS_t00710 9921 9838 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10053 10805 gene locus_tag LOCUS_14160 10053 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 11812 10811 gene locus_tag LOCUS_14170 gene hpnH 11812 10811 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_14170 11914 12657 gene locus_tag LOCUS_14180 11914 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence073 1164 724 gene locus_tag LOCUS_14190 gene rpiB 1164 724 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722019.1 protein_id gnl|my_center|LOCUS_14190 1400 1164 gene locus_tag LOCUS_14200 gene acpP 1400 1164 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_14200 2195 1650 gene locus_tag LOCUS_14210 2195 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 2366 2758 gene locus_tag LOCUS_14220 2366 2758 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948614.1 protein_id gnl|my_center|LOCUS_14220 2848 3903 gene locus_tag LOCUS_14230 gene ilvC 2848 3903 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388228.1 protein_id gnl|my_center|LOCUS_14230 4062 5735 gene locus_tag LOCUS_14240 4062 5735 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_14240 5738 7126 gene locus_tag LOCUS_14250 gene gltX 5738 7126 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_14250 7177 7746 gene locus_tag LOCUS_14260 7177 7746 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876985.1 protein_id gnl|my_center|LOCUS_14260 8748 7750 gene locus_tag LOCUS_14270 8748 7750 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_14270 8890 9393 gene locus_tag LOCUS_14280 8890 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 9413 11332 gene locus_tag LOCUS_14290 9413 11332 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_14290 11308 12357 gene locus_tag LOCUS_14300 11308 12357 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence074 1819 1424 gene locus_tag LOCUS_14310 gene clpS 1819 1424 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279894.1 protein_id gnl|my_center|LOCUS_14310 2447 1803 gene locus_tag LOCUS_14320 gene aat 2447 1803 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_14320 3091 2450 gene locus_tag LOCUS_14330 3091 2450 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940859.1 protein_id gnl|my_center|LOCUS_14330 3184 3648 gene locus_tag LOCUS_14340 3184 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037360.1 protein_id gnl|my_center|LOCUS_14340 3932 3645 gene locus_tag LOCUS_14350 3932 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 4941 3964 gene locus_tag LOCUS_14360 4941 3964 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_14360 6133 4946 gene locus_tag LOCUS_14370 6133 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 6957 6130 gene locus_tag LOCUS_14380 6957 6130 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_14380 7274 6954 gene locus_tag LOCUS_14390 gene bolA 7274 6954 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 protein_id gnl|my_center|LOCUS_14390 7891 7277 gene locus_tag LOCUS_14400 7891 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 8321 7905 gene locus_tag LOCUS_14410 8321 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 8465 8686 gene locus_tag LOCUS_14420 gene infA 8465 8686 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939491.1 protein_id gnl|my_center|LOCUS_14420 8744 8830 gene locus_tag LOCUS_t00720 8744 8830 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8873 8946 gene locus_tag LOCUS_t00730 8873 8946 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8985 9617 gene locus_tag LOCUS_14430 8985 9617 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996462.1 protein_id gnl|my_center|LOCUS_14430 10854 9739 gene locus_tag LOCUS_14440 10854 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 12155 11187 gene locus_tag LOCUS_14450 12155 11187 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024160.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence075 1284 433 gene locus_tag LOCUS_14460 1284 433 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_14460 1900 1364 gene locus_tag LOCUS_14470 1900 1364 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405616.1 protein_id gnl|my_center|LOCUS_14470 3180 1939 gene locus_tag LOCUS_14480 gene ccrA 3180 1939 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078168.1 protein_id gnl|my_center|LOCUS_14480 3417 5804 gene locus_tag LOCUS_14490 3417 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 5801 6670 gene locus_tag LOCUS_14500 5801 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 6823 8619 gene locus_tag LOCUS_14510 gene recQ 6823 8619 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198363.1 protein_id gnl|my_center|LOCUS_14510 9151 8642 gene locus_tag LOCUS_14520 9151 8642 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876409.1 protein_id gnl|my_center|LOCUS_14520 10355 9174 gene locus_tag LOCUS_14530 10355 9174 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161599.1 protein_id gnl|my_center|LOCUS_14530 12014 10371 gene locus_tag LOCUS_14540 12014 10371 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_14540 <12642 12113 gene locus_tag LOCUS_14550 <12642 12113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000041092.1:aldolase/citrate lyase family protein >Feature sequence076 359 1045 gene locus_tag LOCUS_14560 359 1045 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_14560 1049 1861 gene locus_tag LOCUS_14570 gene proC 1049 1861 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_14570 2250 2735 gene locus_tag LOCUS_14580 2250 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2732 5341 gene locus_tag LOCUS_14590 2732 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 5361 6758 gene locus_tag LOCUS_14600 5361 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 7368 6769 gene locus_tag LOCUS_14610 7368 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 8302 7409 gene locus_tag LOCUS_14620 8302 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 8973 8302 gene locus_tag LOCUS_14630 8973 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 10789 9071 gene locus_tag LOCUS_14640 10789 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence077 3480 7697 gene locus_tag LOCUS_14650 3480 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 7720 8856 gene locus_tag LOCUS_14660 7720 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 8874 10376 gene locus_tag LOCUS_14670 8874 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 10424 11539 gene locus_tag LOCUS_14680 10424 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 11716 11543 gene locus_tag LOCUS_14690 11716 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence078 262 1209 gene locus_tag LOCUS_14700 262 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 2146 1271 gene locus_tag LOCUS_14710 2146 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2393 3034 gene locus_tag LOCUS_14720 2393 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3130 4278 gene locus_tag LOCUS_14730 3130 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4356 5234 gene locus_tag LOCUS_14740 gene cntI 4356 5234 CDS product pseudopaline transport inner membrane protein CntI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104336.1 protein_id gnl|my_center|LOCUS_14740 5434 10032 gene locus_tag LOCUS_14750 gene gltB 5434 10032 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_14750 10034 11518 gene locus_tag LOCUS_14760 10034 11518 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_14760 11803 12045 gene locus_tag LOCUS_14770 11803 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 12236 12598 gene locus_tag LOCUS_14780 12236 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence079 3 3539 gene locus_tag LOCUS_14790 3 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3552 9947 gene locus_tag LOCUS_14800 3552 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence080 <1 2601 gene locus_tag LOCUS_14810 <1 2601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000271582.1:methionine synthase 3004 3273 gene locus_tag LOCUS_14820 3004 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 3702 3289 gene locus_tag LOCUS_14830 3702 3289 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018517.1 protein_id gnl|my_center|LOCUS_14830 4342 3695 gene locus_tag LOCUS_14840 4342 3695 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245835.1 protein_id gnl|my_center|LOCUS_14840 4907 4383 gene locus_tag LOCUS_14850 4907 4383 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880804.1 protein_id gnl|my_center|LOCUS_14850 6253 4985 gene locus_tag LOCUS_14860 6253 4985 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_14860 6582 6358 gene locus_tag LOCUS_14870 6582 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 6680 7675 gene locus_tag LOCUS_14880 6680 7675 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583459.1 protein_id gnl|my_center|LOCUS_14880 7672 8175 gene locus_tag LOCUS_14890 7672 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 8636 8172 gene locus_tag LOCUS_14900 8636 8172 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_14900 9222 8695 gene locus_tag LOCUS_14910 9222 8695 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_14910 10826 9375 gene locus_tag LOCUS_14920 10826 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 11422 10838 gene locus_tag LOCUS_14930 11422 10838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 <12413 11451 gene locus_tag LOCUS_14940 <12413 11451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943459.1:DNA-directed RNA polymerase subunit alpha >Feature sequence081 2591 1203 gene locus_tag LOCUS_14950 2591 1203 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_14950 3445 2762 gene locus_tag LOCUS_14960 3445 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 4323 3619 gene locus_tag LOCUS_14970 4323 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5057 4344 gene locus_tag LOCUS_14980 5057 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 5395 6453 gene locus_tag LOCUS_14990 5395 6453 CDS product GSU2403 family nucleotidyltransferase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918827.1 protein_id gnl|my_center|LOCUS_14990 6541 7032 gene locus_tag LOCUS_15000 6541 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 8253 7099 gene locus_tag LOCUS_15010 gene sat 8253 7099 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_15010 8769 8302 gene locus_tag LOCUS_15020 8769 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 10213 8771 gene locus_tag LOCUS_15030 10213 8771 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876425.1 protein_id gnl|my_center|LOCUS_15030 11385 10216 gene locus_tag LOCUS_15040 11385 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 11667 11389 gene locus_tag LOCUS_15050 11667 11389 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_15050 12171 11683 gene locus_tag LOCUS_15060 12171 11683 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106151.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence082 271 1221 gene locus_tag LOCUS_15070 271 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1249 2700 gene locus_tag LOCUS_15080 gene mnmE 1249 2700 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379284.1 protein_id gnl|my_center|LOCUS_15080 2840 3601 gene locus_tag LOCUS_15090 2840 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4127 3621 gene locus_tag LOCUS_15100 4127 3621 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_15100 4252 5202 gene locus_tag LOCUS_15110 4252 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 5262 7148 gene locus_tag LOCUS_15120 gene mnmG 5262 7148 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_15120 7148 7861 gene locus_tag LOCUS_15130 gene rsmG 7148 7861 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121443.1 protein_id gnl|my_center|LOCUS_15130 8517 7864 gene locus_tag LOCUS_15140 8517 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 9973 8951 gene locus_tag LOCUS_15150 9973 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 11081 10200 gene locus_tag LOCUS_15160 11081 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 11144 12142 gene locus_tag LOCUS_15170 11144 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence083 <1 561 gene locus_tag LOCUS_15180 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405370.1:thioredoxin-disulfide reductase 1104 3410 gene locus_tag LOCUS_15190 1104 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3468 5117 gene locus_tag LOCUS_15200 3468 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 5433 7151 gene locus_tag LOCUS_15210 5433 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 7426 9111 gene locus_tag LOCUS_15220 7426 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 9272 10804 gene locus_tag LOCUS_15230 9272 10804 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_15230 11180 10863 gene locus_tag LOCUS_15240 11180 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence084 41 1498 gene locus_tag LOCUS_15250 41 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1495 1932 gene locus_tag LOCUS_15260 1495 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1947 3206 gene locus_tag LOCUS_15270 1947 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 4000 3203 gene locus_tag LOCUS_15280 4000 3203 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_15280 4134 4532 gene locus_tag LOCUS_15290 4134 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 5569 4529 gene locus_tag LOCUS_15300 5569 4529 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488759.1 protein_id gnl|my_center|LOCUS_15300 5820 6758 gene locus_tag LOCUS_15310 5820 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 8028 6829 gene locus_tag LOCUS_15320 8028 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 8112 8828 gene locus_tag LOCUS_15330 8112 8828 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_15330 8908 9708 gene locus_tag LOCUS_15340 8908 9708 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266764.1 protein_id gnl|my_center|LOCUS_15340 9817 10140 gene locus_tag LOCUS_15350 9817 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 11042 10137 gene locus_tag LOCUS_15360 11042 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 11191 11505 gene locus_tag LOCUS_15370 11191 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence085 <1 581 gene locus_tag LOCUS_15380 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082015.1:OmpA family protein 1243 566 gene locus_tag LOCUS_15390 1243 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1897 1319 gene locus_tag LOCUS_15400 1897 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2054 3751 gene locus_tag LOCUS_15410 2054 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 4097 5854 gene locus_tag LOCUS_15420 4097 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 5899 7284 gene locus_tag LOCUS_15430 5899 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 8077 7274 gene locus_tag LOCUS_15440 gene rsmA 8077 7274 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294004.1 protein_id gnl|my_center|LOCUS_15440 9120 8074 gene locus_tag LOCUS_15450 gene tsaD 9120 8074 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_15450 9896 9117 gene locus_tag LOCUS_15460 9896 9117 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_15460 10429 9893 gene locus_tag LOCUS_15470 10429 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence086 286 41 gene locus_tag LOCUS_15480 286 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3386 354 gene locus_tag LOCUS_15490 3386 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 5335 3398 gene locus_tag LOCUS_15500 5335 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 6771 5347 gene locus_tag LOCUS_15510 6771 5347 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939433.1 protein_id gnl|my_center|LOCUS_15510 8898 6775 gene locus_tag LOCUS_15520 8898 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 11300 8913 gene locus_tag LOCUS_15530 11300 8913 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_15530 11534 11340 gene locus_tag LOCUS_15540 11534 11340 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263390.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence087 94 531 gene locus_tag LOCUS_15550 94 531 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_15550 547 1170 gene locus_tag LOCUS_15560 547 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440252.1 protein_id gnl|my_center|LOCUS_15560 1295 2032 gene locus_tag LOCUS_15570 1295 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2675 2070 gene locus_tag LOCUS_15580 2675 2070 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117499.1 protein_id gnl|my_center|LOCUS_15580 3238 2693 gene locus_tag LOCUS_15590 3238 2693 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930802.1 protein_id gnl|my_center|LOCUS_15590 4180 3251 gene locus_tag LOCUS_15600 gene thpD 4180 3251 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063968.1 protein_id gnl|my_center|LOCUS_15600 4590 4186 gene locus_tag LOCUS_15610 4590 4186 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810601.1 protein_id gnl|my_center|LOCUS_15610 5891 4596 gene locus_tag LOCUS_15620 gene ectB 5891 4596 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040099.1 protein_id gnl|my_center|LOCUS_15620 6424 5900 gene locus_tag LOCUS_15630 gene ectA 6424 5900 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810598.1 protein_id gnl|my_center|LOCUS_15630 6965 6597 gene locus_tag LOCUS_15640 6965 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 7259 6969 gene locus_tag LOCUS_15650 7259 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 7921 7274 gene locus_tag LOCUS_15660 7921 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 8419 9804 gene locus_tag LOCUS_15670 8419 9804 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114563.1 protein_id gnl|my_center|LOCUS_15670 9844 10518 gene locus_tag LOCUS_15680 9844 10518 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183863.1 protein_id gnl|my_center|LOCUS_15680 11882 10494 gene locus_tag LOCUS_15690 11882 10494 CDS product DUF2330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072721720.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence088 >Feature sequence089 802 104 gene locus_tag LOCUS_15700 802 104 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_15700 1492 821 gene locus_tag LOCUS_15710 1492 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2655 1525 gene locus_tag LOCUS_15720 2655 1525 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706804.1 protein_id gnl|my_center|LOCUS_15720 2969 4351 gene locus_tag LOCUS_15730 2969 4351 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941561.1 protein_id gnl|my_center|LOCUS_15730 4607 7126 gene locus_tag LOCUS_15740 4607 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 7424 10804 gene locus_tag LOCUS_15750 7424 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 11487 10822 gene locus_tag LOCUS_15760 11487 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence090 756 349 gene locus_tag LOCUS_15770 gene mce 756 349 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_15770 841 2214 gene locus_tag LOCUS_15780 841 2214 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398731.1 protein_id gnl|my_center|LOCUS_15780 3045 2275 gene locus_tag LOCUS_15790 3045 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 3254 4093 gene locus_tag LOCUS_15800 3254 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 4495 4097 gene locus_tag LOCUS_15810 4495 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 4715 5428 gene locus_tag LOCUS_15820 4715 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 6145 5432 gene locus_tag LOCUS_15830 6145 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 6175 7140 gene locus_tag LOCUS_15840 gene queG 6175 7140 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_15840 7205 7570 gene locus_tag LOCUS_15850 gene erpA 7205 7570 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649956.1 protein_id gnl|my_center|LOCUS_15850 7616 7954 gene locus_tag LOCUS_15860 7616 7954 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 protein_id gnl|my_center|LOCUS_15860 7972 8367 gene locus_tag LOCUS_15870 7972 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 9359 8442 gene locus_tag LOCUS_15880 9359 8442 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943100.1 protein_id gnl|my_center|LOCUS_15880 9458 10006 gene locus_tag LOCUS_15890 9458 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 10053 10538 gene locus_tag LOCUS_15900 10053 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence091 518 2548 gene locus_tag LOCUS_15910 518 2548 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206943.1 protein_id gnl|my_center|LOCUS_15910 2600 3007 gene locus_tag LOCUS_15920 2600 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3171 3788 gene locus_tag LOCUS_15930 3171 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 4814 3801 gene locus_tag LOCUS_15940 4814 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 5789 4902 gene locus_tag LOCUS_15950 gene bphC 5789 4902 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894252.1 protein_id gnl|my_center|LOCUS_15950 6370 7254 gene locus_tag LOCUS_15960 6370 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 7391 7903 gene locus_tag LOCUS_15970 7391 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 7941 9041 gene locus_tag LOCUS_15980 7941 9041 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_15980 9047 10408 gene locus_tag LOCUS_15990 9047 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15990 10600 10319 gene locus_tag LOCUS_16000 10600 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence092 1059 4574 gene locus_tag LOCUS_16010 1059 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 4848 6317 gene locus_tag LOCUS_16020 4848 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 6372 7199 gene locus_tag LOCUS_16030 6372 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 7473 7829 gene locus_tag LOCUS_16040 7473 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 7826 8194 gene locus_tag LOCUS_16050 7826 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 8245 9090 gene locus_tag LOCUS_16060 8245 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 9183 9884 gene locus_tag LOCUS_16070 9183 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 <11117 9910 gene locus_tag LOCUS_16080 <11117 9910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256980.1:HYR domain-containing protein >Feature sequence093 831 493 gene locus_tag LOCUS_16090 831 493 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 protein_id gnl|my_center|LOCUS_16090 1090 2652 gene locus_tag LOCUS_16100 1090 2652 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881164.1 protein_id gnl|my_center|LOCUS_16100 3200 2685 gene locus_tag LOCUS_16110 3200 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4216 3203 gene locus_tag LOCUS_16120 4216 3203 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_16120 5043 4213 gene locus_tag LOCUS_16130 5043 4213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_16130 5902 5048 gene locus_tag LOCUS_16140 5902 5048 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_16140 6909 5902 gene locus_tag LOCUS_16150 6909 5902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_16150 8432 6906 gene locus_tag LOCUS_16160 8432 6906 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_16160 9232 8504 gene locus_tag LOCUS_16170 9232 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 10880 9264 gene locus_tag LOCUS_16180 10880 9264 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence094 <1 949 gene locus_tag LOCUS_16190 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003529677.1:3-isopropylmalate dehydratase large subunit 952 1611 gene locus_tag LOCUS_16200 gene leuD 952 1611 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330456.1 protein_id gnl|my_center|LOCUS_16200 1613 1966 gene locus_tag LOCUS_16210 1613 1966 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265541.1 protein_id gnl|my_center|LOCUS_16210 2591 2025 gene locus_tag LOCUS_16220 2591 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 3113 2607 gene locus_tag LOCUS_16230 3113 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582786.1 protein_id gnl|my_center|LOCUS_16230 4564 3146 gene locus_tag LOCUS_16240 4564 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 5401 4580 gene locus_tag LOCUS_16250 5401 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 6255 5398 gene locus_tag LOCUS_16260 6255 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 6952 6413 gene locus_tag LOCUS_16270 6952 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 7158 7757 gene locus_tag LOCUS_16280 7158 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 8586 7876 gene locus_tag LOCUS_16290 8586 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 9154 8681 gene locus_tag LOCUS_16300 9154 8681 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971129.1 protein_id gnl|my_center|LOCUS_16300 9657 9289 gene locus_tag LOCUS_16310 9657 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence095 509 1723 gene locus_tag LOCUS_16320 509 1723 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260957.1 protein_id gnl|my_center|LOCUS_16320 1824 2519 gene locus_tag LOCUS_16330 1824 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_16330 2516 4429 gene locus_tag LOCUS_16340 2516 4429 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_16340 4429 5172 gene locus_tag LOCUS_16350 4429 5172 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_16350 5273 5755 gene locus_tag LOCUS_16360 gene msrB 5273 5755 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943090.1 protein_id gnl|my_center|LOCUS_16360 5804 6721 gene locus_tag LOCUS_16370 5804 6721 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_16370 8283 6718 gene locus_tag LOCUS_16380 8283 6718 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384516.1 protein_id gnl|my_center|LOCUS_16380 9617 8280 gene locus_tag LOCUS_16390 9617 8280 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143837.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence096 2 970 gene locus_tag LOCUS_16400 2 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 984 1370 gene locus_tag LOCUS_16410 984 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 6513 1534 gene locus_tag LOCUS_16420 6513 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 7169 6825 gene locus_tag LOCUS_16430 7169 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 8799 7177 gene locus_tag LOCUS_16440 gene cimA 8799 7177 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_16440 10022 8799 gene locus_tag LOCUS_16450 10022 8799 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_16450 10600 10151 gene locus_tag LOCUS_16460 gene tsaE 10600 10151 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931832.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence097 1043 1741 gene locus_tag LOCUS_16470 1043 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2087 1815 gene locus_tag LOCUS_16480 2087 1815 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_16480 2466 4931 gene locus_tag LOCUS_16490 gene gyrA 2466 4931 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_16490 4993 5700 gene locus_tag LOCUS_16500 4993 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 5697 6164 gene locus_tag LOCUS_16510 5697 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 7140 6220 gene locus_tag LOCUS_16520 7140 6220 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813874.1 protein_id gnl|my_center|LOCUS_16520 7271 7699 gene locus_tag LOCUS_16530 gene ruvX 7271 7699 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 protein_id gnl|my_center|LOCUS_16530 7704 8699 gene locus_tag LOCUS_16540 gene mltG 7704 8699 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_16540 9608 8709 gene locus_tag LOCUS_16550 9608 8709 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294811.1 protein_id gnl|my_center|LOCUS_16550 10136 9819 gene locus_tag LOCUS_16560 10136 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence098 1406 81 gene locus_tag LOCUS_16570 1406 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1689 2549 gene locus_tag LOCUS_16580 1689 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2550 3362 gene locus_tag LOCUS_16590 2550 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3827 5227 gene locus_tag LOCUS_16600 3827 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5425 8607 gene locus_tag LOCUS_16610 5425 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 8676 9875 gene locus_tag LOCUS_16620 8676 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 9965 10273 gene locus_tag LOCUS_16630 9965 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence099 <1 581 gene locus_tag LOCUS_16640 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase 654 1592 gene locus_tag LOCUS_16650 654 1592 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_16650 1699 2634 gene locus_tag LOCUS_16660 1699 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2646 3026 gene locus_tag LOCUS_16670 2646 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 3037 3438 gene locus_tag LOCUS_16680 3037 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3442 3696 gene locus_tag LOCUS_16690 3442 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 3698 4741 gene locus_tag LOCUS_16700 3698 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 4912 4742 gene locus_tag LOCUS_16710 4912 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 5040 5318 gene locus_tag LOCUS_16720 5040 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 5315 6715 gene locus_tag LOCUS_16730 5315 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 6758 6952 gene locus_tag LOCUS_16740 6758 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 7040 8689 gene locus_tag LOCUS_16750 7040 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 9095 8676 gene locus_tag LOCUS_16760 9095 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 9796 9095 gene locus_tag LOCUS_16770 9796 9095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence100 1 558 gene locus_tag LOCUS_16780 1 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 618 2906 gene locus_tag LOCUS_16790 gene infB 618 2906 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_16790 2906 3277 gene locus_tag LOCUS_16800 2906 3277 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769039.1 protein_id gnl|my_center|LOCUS_16800 3252 3968 gene locus_tag LOCUS_16810 3252 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4071 4340 gene locus_tag LOCUS_16820 gene rpsO 4071 4340 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_16820 4512 6608 gene locus_tag LOCUS_16830 gene pnp 4512 6608 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_16830 7204 6605 gene locus_tag LOCUS_16840 gene coaE 7204 6605 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219305.1 protein_id gnl|my_center|LOCUS_16840 7670 7197 gene locus_tag LOCUS_16850 7670 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 9106 7676 gene locus_tag LOCUS_16860 9106 7676 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_16860 10091 9060 gene locus_tag LOCUS_16870 10091 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence101 34 107 gene locus_tag LOCUS_t00740 34 107 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 115 198 gene locus_tag LOCUS_t00750 115 198 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 204 290 gene locus_tag LOCUS_t00760 204 290 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 430 503 gene locus_tag LOCUS_t00770 430 503 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 561 758 gene locus_tag LOCUS_16880 561 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 742 1392 gene locus_tag LOCUS_16890 742 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1382 1603 gene locus_tag LOCUS_16900 1382 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1627 2289 gene locus_tag LOCUS_16910 1627 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2289 2801 gene locus_tag LOCUS_16920 2289 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2801 3166 gene locus_tag LOCUS_16930 2801 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 3413 3486 gene locus_tag LOCUS_t00780 3413 3486 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3676 3750 gene locus_tag LOCUS_t00790 3676 3750 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3930 4005 gene locus_tag LOCUS_t00800 3930 4005 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4094 4188 gene locus_tag LOCUS_t00810 4094 4188 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4306 4378 gene locus_tag LOCUS_t00820 4306 4378 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4393 4464 gene locus_tag LOCUS_t00830 4393 4464 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4477 4653 gene locus_tag LOCUS_16940 4477 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4595 4867 gene locus_tag LOCUS_16950 4595 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4933 5008 gene locus_tag LOCUS_t00840 4933 5008 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5012 5084 gene locus_tag LOCUS_t00850 5012 5084 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5094 5167 gene locus_tag LOCUS_t00860 5094 5167 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5231 5318 gene locus_tag LOCUS_t00870 5231 5318 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5340 5415 gene locus_tag LOCUS_t00880 5340 5415 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5872 5459 gene locus_tag LOCUS_16960 5872 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 6408 6130 gene locus_tag LOCUS_16970 6408 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 6542 6454 gene locus_tag LOCUS_t00890 6542 6454 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 7048 6620 gene locus_tag LOCUS_16980 7048 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 7490 7002 gene locus_tag LOCUS_16990 7490 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 7733 8983 gene locus_tag LOCUS_17000 7733 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 9068 9412 gene locus_tag LOCUS_17010 9068 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 9699 9869 gene locus_tag LOCUS_17020 9699 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence102 359 1123 gene locus_tag LOCUS_17030 359 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1460 1125 gene locus_tag LOCUS_17040 1460 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1891 1463 gene locus_tag LOCUS_17050 1891 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2905 1940 gene locus_tag LOCUS_17060 gene glpX 2905 1940 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442341.1 protein_id gnl|my_center|LOCUS_17060 4051 2990 gene locus_tag LOCUS_17070 gene thrC 4051 2990 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_17070 5346 4060 gene locus_tag LOCUS_17080 5346 4060 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_17080 6516 5350 gene locus_tag LOCUS_17090 gene alaC 6516 5350 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_17090 7423 6509 gene locus_tag LOCUS_17100 gene lipA 7423 6509 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652627.1 protein_id gnl|my_center|LOCUS_17100 7670 9304 gene locus_tag LOCUS_17110 7670 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 <10510 9311 gene locus_tag LOCUS_17120 <10510 9311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941980.1:ATP-dependent DNA helicase RecG >Feature sequence103 2535 754 gene locus_tag LOCUS_17130 2535 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3371 2859 gene locus_tag LOCUS_17140 3371 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4142 3531 gene locus_tag LOCUS_17150 4142 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 5050 4139 gene locus_tag LOCUS_17160 5050 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 6806 5283 gene locus_tag LOCUS_17170 6806 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 7051 7599 gene locus_tag LOCUS_17180 7051 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 9320 7863 gene locus_tag LOCUS_17190 9320 7863 CDS product choice-of-anchor Q domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256176.1 protein_id gnl|my_center|LOCUS_17190 10265 9528 gene locus_tag LOCUS_17200 10265 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence104 268 675 gene locus_tag LOCUS_17210 268 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 3873 685 gene locus_tag LOCUS_17220 3873 685 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_17220 8676 4066 gene locus_tag LOCUS_17230 8676 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 8972 9718 gene locus_tag LOCUS_17240 8972 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence105 402 2834 gene locus_tag LOCUS_17250 402 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 6028 2846 gene locus_tag LOCUS_17260 6028 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 6774 6106 gene locus_tag LOCUS_17270 6774 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence106 1178 351 gene locus_tag LOCUS_17280 1178 351 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929069.1 protein_id gnl|my_center|LOCUS_17280 1933 1175 gene locus_tag LOCUS_17290 1933 1175 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_17290 2591 1980 gene locus_tag LOCUS_17300 gene cysC 2591 1980 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_17300 2735 3658 gene locus_tag LOCUS_17310 2735 3658 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 protein_id gnl|my_center|LOCUS_17310 5364 3655 gene locus_tag LOCUS_17320 5364 3655 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546696.1 protein_id gnl|my_center|LOCUS_17320 5468 6292 gene locus_tag LOCUS_17330 gene mutM 5468 6292 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338891.1 protein_id gnl|my_center|LOCUS_17330 6910 6293 gene locus_tag LOCUS_17340 gene thrH 6910 6293 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_17340 7268 7795 gene locus_tag LOCUS_17350 7268 7795 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_17350 7801 8562 gene locus_tag LOCUS_17360 7801 8562 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855402.1 protein_id gnl|my_center|LOCUS_17360 8559 8894 gene locus_tag LOCUS_17370 8559 8894 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_17370 9039 9719 gene locus_tag LOCUS_17380 9039 9719 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence107 2928 22 gene locus_tag LOCUS_17390 2928 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 4908 3010 gene locus_tag LOCUS_17400 4908 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 5326 4919 gene locus_tag LOCUS_17410 5326 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 5401 6870 gene locus_tag LOCUS_17420 5401 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 7321 6839 gene locus_tag LOCUS_17430 7321 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 7556 7326 gene locus_tag LOCUS_17440 7556 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 8601 7642 gene locus_tag LOCUS_17450 8601 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 8842 8603 gene locus_tag LOCUS_17460 8842 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 9260 8844 gene locus_tag LOCUS_17470 9260 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence108 120 344 gene locus_tag LOCUS_17480 120 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 341 859 gene locus_tag LOCUS_17490 gene coaD 341 859 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218149.1 protein_id gnl|my_center|LOCUS_17490 852 1430 gene locus_tag LOCUS_17500 852 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1650 1459 gene locus_tag LOCUS_17510 1650 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1649 1945 gene locus_tag LOCUS_17520 1649 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2229 2459 gene locus_tag LOCUS_17530 2229 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2540 2875 gene locus_tag LOCUS_17540 2540 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3075 3383 gene locus_tag LOCUS_17550 3075 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 3389 3694 gene locus_tag LOCUS_17560 3389 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3694 4053 gene locus_tag LOCUS_17570 3694 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4107 4376 gene locus_tag LOCUS_17580 4107 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 4567 4839 gene locus_tag LOCUS_17590 4567 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 4829 5035 gene locus_tag LOCUS_17600 4829 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 5032 5286 gene locus_tag LOCUS_17610 5032 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 5261 5632 gene locus_tag LOCUS_17620 5261 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 5616 6074 gene locus_tag LOCUS_17630 5616 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 6176 6988 gene locus_tag LOCUS_17640 6176 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 7020 7292 gene locus_tag LOCUS_17650 7020 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 7325 7732 gene locus_tag LOCUS_17660 7325 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 7729 7956 gene locus_tag LOCUS_17670 7729 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 7953 8342 gene locus_tag LOCUS_17680 7953 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 8348 8809 gene locus_tag LOCUS_17690 8348 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 8806 9333 gene locus_tag LOCUS_17700 8806 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence109 2773 629 gene locus_tag LOCUS_17710 2773 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2939 4144 gene locus_tag LOCUS_17720 2939 4144 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_17720 4157 4840 gene locus_tag LOCUS_17730 gene ubiE 4157 4840 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_17730 4837 5391 gene locus_tag LOCUS_17740 4837 5391 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391642.1 protein_id gnl|my_center|LOCUS_17740 5464 6318 gene locus_tag LOCUS_17750 gene ubiA 5464 6318 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_17750 6860 6315 gene locus_tag LOCUS_17760 6860 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 7626 6898 gene locus_tag LOCUS_17770 7626 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 8227 7628 gene locus_tag LOCUS_17780 8227 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 8888 8355 gene locus_tag LOCUS_17790 8888 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 8953 9618 gene locus_tag LOCUS_17800 8953 9618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence110 2556 2122 gene locus_tag LOCUS_17810 2556 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3763 2558 gene locus_tag LOCUS_17820 gene thiI 3763 2558 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_17820 5077 3779 gene locus_tag LOCUS_17830 5077 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 5968 5141 gene locus_tag LOCUS_17840 5968 5141 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_17840 6205 7041 gene locus_tag LOCUS_17850 6205 7041 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024060.1 protein_id gnl|my_center|LOCUS_17850 7912 7019 gene locus_tag LOCUS_17860 7912 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 9552 8053 gene locus_tag LOCUS_17870 9552 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence111 276 203 gene locus_tag LOCUS_t00900 276 203 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 457 383 gene locus_tag LOCUS_t00910 457 383 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 649 564 gene locus_tag LOCUS_t00920 649 564 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 832 759 gene locus_tag LOCUS_t00930 832 759 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1790 1059 gene locus_tag LOCUS_17880 gene rlmB 1790 1059 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887393.1 protein_id gnl|my_center|LOCUS_17880 2301 1852 gene locus_tag LOCUS_17890 2301 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3057 2356 gene locus_tag LOCUS_17900 gene pyrF 3057 2356 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_17900 4766 3054 gene locus_tag LOCUS_17910 4766 3054 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_17910 5857 4823 gene locus_tag LOCUS_17920 5857 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 7011 5887 gene locus_tag LOCUS_17930 gene ispG 7011 5887 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 protein_id gnl|my_center|LOCUS_17930 8376 7108 gene locus_tag LOCUS_17940 8376 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 9001 8369 gene locus_tag LOCUS_17950 9001 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 9402 9010 gene locus_tag LOCUS_17960 9402 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence112 1740 2297 gene locus_tag LOCUS_17970 gene dcd 1740 2297 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_17970 2297 2596 gene locus_tag LOCUS_17980 2297 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2775 4130 gene locus_tag LOCUS_17990 2775 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 4137 4532 gene locus_tag LOCUS_18000 4137 4532 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880408.1 protein_id gnl|my_center|LOCUS_18000 5356 4538 gene locus_tag LOCUS_18010 5356 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5908 5378 gene locus_tag LOCUS_18020 5908 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 6319 5912 gene locus_tag LOCUS_18030 gene nusB 6319 5912 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_18030 6832 6344 gene locus_tag LOCUS_18040 gene ribE 6832 6344 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694466.1 protein_id gnl|my_center|LOCUS_18040 8033 6807 gene locus_tag LOCUS_18050 8033 6807 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_18050 8692 8066 gene locus_tag LOCUS_18060 8692 8066 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301612.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence113 <1 5003 gene locus_tag LOCUS_18070 <1 5003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484145.1:type I polyketide synthase >Feature sequence114 1586 681 gene locus_tag LOCUS_18080 1586 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3417 2080 gene locus_tag LOCUS_18090 3417 2080 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731195.1 protein_id gnl|my_center|LOCUS_18090 3927 3514 gene locus_tag LOCUS_18100 gene mscL 3927 3514 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_18100 4785 4039 gene locus_tag LOCUS_18110 4785 4039 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195790.1 protein_id gnl|my_center|LOCUS_18110 4972 7179 gene locus_tag LOCUS_18120 4972 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence115 508 1131 gene locus_tag LOCUS_18130 508 1131 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266341.1 protein_id gnl|my_center|LOCUS_18130 3371 1158 gene locus_tag LOCUS_18140 3371 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 4373 3489 gene locus_tag LOCUS_18150 gene speE 4373 3489 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393316.1 protein_id gnl|my_center|LOCUS_18150 4827 4363 gene locus_tag LOCUS_18160 4827 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 5209 5589 gene locus_tag LOCUS_18170 gene ndhC 5209 5589 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944055.1 protein_id gnl|my_center|LOCUS_18170 5586 6275 gene locus_tag LOCUS_18180 gene nuoB 5586 6275 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386728.1 protein_id gnl|my_center|LOCUS_18180 6278 8029 gene locus_tag LOCUS_18190 gene nuoC 6278 8029 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619059.1 protein_id gnl|my_center|LOCUS_18190 8071 8541 gene locus_tag LOCUS_18200 gene nuoE 8071 8541 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944053.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence116 1351 191 gene locus_tag LOCUS_18210 1351 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1811 1446 gene locus_tag LOCUS_18220 1811 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 2560 1925 gene locus_tag LOCUS_18230 2560 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2734 2564 gene locus_tag LOCUS_18240 2734 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3527 2721 gene locus_tag LOCUS_18250 3527 2721 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660650.1 protein_id gnl|my_center|LOCUS_18250 4533 3562 gene locus_tag LOCUS_18260 4533 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 5141 4587 gene locus_tag LOCUS_18270 5141 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 6025 5141 gene locus_tag LOCUS_18280 6025 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 6936 6028 gene locus_tag LOCUS_18290 6936 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 7348 6929 gene locus_tag LOCUS_18300 7348 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 7659 7315 gene locus_tag LOCUS_18310 7659 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 7701 7628 gene locus_tag LOCUS_t00940 7701 7628 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7977 7903 gene locus_tag LOCUS_t00950 7977 7903 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8203 7979 gene locus_tag LOCUS_18320 8203 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 8589 8305 gene locus_tag LOCUS_18330 8589 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 8738 8664 gene locus_tag LOCUS_t00960 8738 8664 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8873 8784 gene locus_tag LOCUS_t00970 8873 8784 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8968 8885 gene locus_tag LOCUS_t00980 8968 8885 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence117 338 640 gene locus_tag LOCUS_18340 338 640 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_18340 637 849 gene locus_tag LOCUS_18350 637 849 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_18350 1703 855 gene locus_tag LOCUS_18360 gene panB 1703 855 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_18360 2349 1714 gene locus_tag LOCUS_18370 2349 1714 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_18370 2479 4569 gene locus_tag LOCUS_18380 2479 4569 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_18380 5943 4582 gene locus_tag LOCUS_18390 5943 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 7062 6034 gene locus_tag LOCUS_18400 7062 6034 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256958.1 protein_id gnl|my_center|LOCUS_18400 8285 7098 gene locus_tag LOCUS_18410 8285 7098 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_18410 8780 8295 gene locus_tag LOCUS_18420 gene coaD 8780 8295 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200601.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence118 4244 2745 gene locus_tag LOCUS_18430 4244 2745 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142605.1 protein_id gnl|my_center|LOCUS_18430 4334 5074 gene locus_tag LOCUS_18440 4334 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 5071 5532 gene locus_tag LOCUS_18450 5071 5532 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092109.1 protein_id gnl|my_center|LOCUS_18450 6003 7142 gene locus_tag LOCUS_18460 6003 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 7676 7323 gene locus_tag LOCUS_18470 7676 7323 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_18470 7768 8679 gene locus_tag LOCUS_18480 7768 8679 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257492.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence119 2704 1406 gene locus_tag LOCUS_18490 gene eno 2704 1406 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_18490 2871 3977 gene locus_tag LOCUS_18500 2871 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3983 4474 gene locus_tag LOCUS_18510 3983 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 4641 4471 gene locus_tag LOCUS_18520 4641 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 4773 5618 gene locus_tag LOCUS_18530 4773 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 7712 5718 gene locus_tag LOCUS_18540 7712 5718 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060907.1 protein_id gnl|my_center|LOCUS_18540 7887 8267 gene locus_tag LOCUS_18550 7887 8267 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440098.1 protein_id gnl|my_center|LOCUS_18550 8721 8239 gene locus_tag LOCUS_18560 8721 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence120 1657 1995 gene locus_tag LOCUS_18570 1657 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 1992 2387 gene locus_tag LOCUS_18580 1992 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2368 4185 gene locus_tag LOCUS_18590 2368 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 4310 4735 gene locus_tag LOCUS_18600 4310 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 4751 5086 gene locus_tag LOCUS_18610 4751 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 5086 5460 gene locus_tag LOCUS_18620 5086 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 5773 5859 gene locus_tag LOCUS_t00990 5773 5859 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6028 6100 gene locus_tag LOCUS_t01000 6028 6100 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6105 6178 gene locus_tag LOCUS_t01010 6105 6178 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6190 6261 gene locus_tag LOCUS_t01020 6190 6261 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6270 6354 gene locus_tag LOCUS_t01030 6270 6354 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6366 6438 gene locus_tag LOCUS_t01040 6366 6438 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6444 6527 gene locus_tag LOCUS_t01050 6444 6527 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6589 6661 gene locus_tag LOCUS_t01060 6589 6661 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6763 6847 gene locus_tag LOCUS_t01070 6763 6847 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7016 7097 gene locus_tag LOCUS_t01080 7016 7097 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7150 7238 gene locus_tag LOCUS_t01090 7150 7238 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8286 8371 gene locus_tag LOCUS_t01100 8286 8371 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8374 8447 gene locus_tag LOCUS_t01110 8374 8447 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8452 8525 gene locus_tag LOCUS_t01120 8452 8525 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence121 569 1372 gene locus_tag LOCUS_18630 569 1372 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_18630 1359 2318 gene locus_tag LOCUS_18640 1359 2318 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_18640 2321 2755 gene locus_tag LOCUS_18650 2321 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2971 3417 gene locus_tag LOCUS_18660 2971 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 3417 3920 gene locus_tag LOCUS_18670 3417 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3920 4462 gene locus_tag LOCUS_18680 3920 4462 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083275.1 protein_id gnl|my_center|LOCUS_18680 4485 5996 gene locus_tag LOCUS_18690 gene atpA 4485 5996 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_18690 6037 6936 gene locus_tag LOCUS_18700 gene atpG 6037 6936 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_18700 6991 8412 gene locus_tag LOCUS_18710 gene atpD 6991 8412 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence122 2961 1393 gene locus_tag LOCUS_18720 gene murJ 2961 1393 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_18720 3114 3401 gene locus_tag LOCUS_18730 gene rpsT 3114 3401 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292188.1 protein_id gnl|my_center|LOCUS_18730 4316 3372 gene locus_tag LOCUS_18740 gene holA 4316 3372 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_18740 6789 4321 gene locus_tag LOCUS_18750 gene leuS 6789 4321 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_18750 7583 6801 gene locus_tag LOCUS_18760 gene trpA 7583 6801 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_18760 <8668 7626 gene locus_tag LOCUS_18770 <8668 7626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528977.1:tryptophan synthase subunit beta >Feature sequence123 1199 678 gene locus_tag LOCUS_18780 1199 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1403 1951 gene locus_tag LOCUS_18790 1403 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2750 1971 gene locus_tag LOCUS_18800 2750 1971 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262133.1 protein_id gnl|my_center|LOCUS_18800 3540 2779 gene locus_tag LOCUS_18810 3540 2779 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_18810 3619 4158 gene locus_tag LOCUS_18820 3619 4158 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_18820 4175 4765 gene locus_tag LOCUS_18830 4175 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 4765 5421 gene locus_tag LOCUS_18840 4765 5421 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616977.1 protein_id gnl|my_center|LOCUS_18840 5418 5852 gene locus_tag LOCUS_18850 5418 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 6068 5853 gene locus_tag LOCUS_18860 6068 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 6113 6730 gene locus_tag LOCUS_18870 6113 6730 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524311.1 protein_id gnl|my_center|LOCUS_18870 7768 6752 gene locus_tag LOCUS_18880 7768 6752 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_18880 <8574 7809 gene locus_tag LOCUS_18890 <8574 7809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546336.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence124 3656 2694 gene locus_tag LOCUS_18900 gene cas1f 3656 2694 CDS product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 protein_id gnl|my_center|LOCUS_18900 4246 3869 gene locus_tag LOCUS_18910 4246 3869 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730888.1 protein_id gnl|my_center|LOCUS_18910 4348 4914 gene locus_tag LOCUS_18920 4348 4914 CDS product heme-binding beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 protein_id gnl|my_center|LOCUS_18920 4982 5242 gene locus_tag LOCUS_18930 4982 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 5391 7085 gene locus_tag LOCUS_18940 5391 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 7481 7113 gene locus_tag LOCUS_18950 7481 7113 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530023.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence125 1091 375 gene locus_tag LOCUS_18960 1091 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 2190 1216 gene locus_tag LOCUS_18970 2190 1216 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_18970 2349 3158 gene locus_tag LOCUS_18980 2349 3158 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_18980 4088 3180 gene locus_tag LOCUS_18990 4088 3180 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444129.1 protein_id gnl|my_center|LOCUS_18990 5790 4099 gene locus_tag LOCUS_19000 5790 4099 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_19000 6621 5908 gene locus_tag LOCUS_19010 6621 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 6826 7539 gene locus_tag LOCUS_19020 6826 7539 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965176.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence126 1913 30 gene locus_tag LOCUS_19030 gene uvrC 1913 30 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_19030 2845 1952 gene locus_tag LOCUS_19040 2845 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4955 2946 gene locus_tag LOCUS_19050 gene uvrB 4955 2946 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_19050 5452 5024 gene locus_tag LOCUS_19060 5452 5024 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085192.1 protein_id gnl|my_center|LOCUS_19060 5619 6464 gene locus_tag LOCUS_19070 5619 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 6452 7075 gene locus_tag LOCUS_19080 6452 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence127 1173 34 gene locus_tag LOCUS_19090 gene pimD 1173 34 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_19090 2380 1178 gene locus_tag LOCUS_19100 2380 1178 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_19100 3257 2421 gene locus_tag LOCUS_19110 3257 2421 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047906135.1 protein_id gnl|my_center|LOCUS_19110 3596 4126 gene locus_tag LOCUS_19120 3596 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 4833 4360 gene locus_tag LOCUS_19130 4833 4360 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704258.1 protein_id gnl|my_center|LOCUS_19130 5028 6014 gene locus_tag LOCUS_19140 5028 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19140 5971 6687 gene locus_tag LOCUS_19150 5971 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19150 <8503 7068 gene locus_tag LOCUS_19160 <8503 7068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390223.1:Fe(2+) transporter permease subunit FeoB >Feature sequence128 48 500 gene locus_tag LOCUS_19170 48 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 965 1651 gene locus_tag LOCUS_19180 965 1651 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 protein_id gnl|my_center|LOCUS_19180 2990 3142 gene locus_tag LOCUS_19190 2990 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3135 5129 gene locus_tag LOCUS_19200 3135 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5134 5403 gene locus_tag LOCUS_19210 5134 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 5403 5813 gene locus_tag LOCUS_19220 5403 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 5843 6073 gene locus_tag LOCUS_19230 5843 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 6077 6421 gene locus_tag LOCUS_19240 6077 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 6414 6716 gene locus_tag LOCUS_19250 6414 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 6709 7689 gene locus_tag LOCUS_19260 6709 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 7702 7971 gene locus_tag LOCUS_19270 7702 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence129 1916 2998 gene locus_tag LOCUS_19280 gene queA 1916 2998 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354028.1 protein_id gnl|my_center|LOCUS_19280 3655 3053 gene locus_tag LOCUS_19290 3655 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 5009 3768 gene locus_tag LOCUS_19300 5009 3768 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_19300 5286 5846 gene locus_tag LOCUS_19310 5286 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 5852 6691 gene locus_tag LOCUS_19320 5852 6691 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030302.1 protein_id gnl|my_center|LOCUS_19320 6684 7244 gene locus_tag LOCUS_19330 6684 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195773.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence130 270 638 gene locus_tag LOCUS_19340 270 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 638 2575 gene locus_tag LOCUS_19350 638 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2639 3517 gene locus_tag LOCUS_19360 2639 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 3896 3585 gene locus_tag LOCUS_19370 3896 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 4023 4928 gene locus_tag LOCUS_19380 4023 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 4928 5164 gene locus_tag LOCUS_19390 4928 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 5169 5828 gene locus_tag LOCUS_19400 5169 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 5881 6171 gene locus_tag LOCUS_19410 5881 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 6158 6607 gene locus_tag LOCUS_19420 6158 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 6611 7375 gene locus_tag LOCUS_19430 6611 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 7878 7372 gene locus_tag LOCUS_19440 7878 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence131 2327 2070 gene locus_tag LOCUS_19450 2327 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 4348 2327 gene locus_tag LOCUS_19460 4348 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 6151 4400 gene locus_tag LOCUS_19470 6151 4400 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143988.1 protein_id gnl|my_center|LOCUS_19470 6506 6198 gene locus_tag LOCUS_19480 6506 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 7495 6542 gene locus_tag LOCUS_19490 7495 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence132 1013 1159 gene locus_tag LOCUS_19500 1013 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 1162 1521 gene locus_tag LOCUS_19510 1162 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1491 1736 gene locus_tag LOCUS_19520 1491 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1733 2890 gene locus_tag LOCUS_19530 1733 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 3021 3650 gene locus_tag LOCUS_19540 3021 3650 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_19540 3660 3965 gene locus_tag LOCUS_19550 3660 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 3977 4438 gene locus_tag LOCUS_19560 3977 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 4442 5179 gene locus_tag LOCUS_19570 4442 5179 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056496.1 protein_id gnl|my_center|LOCUS_19570 5469 6101 gene locus_tag LOCUS_19580 5469 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 6505 6098 gene locus_tag LOCUS_19590 6505 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 8011 6515 gene locus_tag LOCUS_19600 8011 6515 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_19600 8316 8089 gene locus_tag LOCUS_19610 8316 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence133 2328 1159 gene locus_tag LOCUS_19620 2328 1159 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_19620 2670 2341 gene locus_tag LOCUS_19630 2670 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3052 2720 gene locus_tag LOCUS_19640 3052 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 3476 3096 gene locus_tag LOCUS_19650 3476 3096 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_19650 5297 3510 gene locus_tag LOCUS_19660 5297 3510 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_19660 5756 5382 gene locus_tag LOCUS_19670 5756 5382 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_19670 7954 5759 gene locus_tag LOCUS_19680 7954 5759 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence134 806 57 gene locus_tag LOCUS_19690 806 57 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_19690 936 2189 gene locus_tag LOCUS_19700 936 2189 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_19700 2186 2557 gene locus_tag LOCUS_19710 gene rsfS 2186 2557 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721994.1 protein_id gnl|my_center|LOCUS_19710 2554 4104 gene locus_tag LOCUS_19720 gene gpmI 2554 4104 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_19720 4115 4600 gene locus_tag LOCUS_19730 4115 4600 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_19730 6021 4597 gene locus_tag LOCUS_19740 6021 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 6523 6011 gene locus_tag LOCUS_19750 6523 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 7501 6731 gene locus_tag LOCUS_19760 7501 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 <8145 7542 gene locus_tag LOCUS_19770 <8145 7542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228275.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein >Feature sequence135 857 468 gene locus_tag LOCUS_19780 857 468 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061577.1 protein_id gnl|my_center|LOCUS_19780 1611 847 gene locus_tag LOCUS_19790 1611 847 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225182.1 protein_id gnl|my_center|LOCUS_19790 2442 1735 gene locus_tag LOCUS_19800 2442 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2610 3281 gene locus_tag LOCUS_19810 2610 3281 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179719124.1 protein_id gnl|my_center|LOCUS_19810 3364 3291 gene locus_tag LOCUS_t01130 3364 3291 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4159 3431 gene locus_tag LOCUS_19820 gene hisN 4159 3431 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081049.1 protein_id gnl|my_center|LOCUS_19820 7170 4213 gene locus_tag LOCUS_19830 7170 4213 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479509.1 protein_id gnl|my_center|LOCUS_19830 7247 7993 gene locus_tag LOCUS_19840 7247 7993 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence136 832 1833 gene locus_tag LOCUS_19850 832 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2561 1839 gene locus_tag LOCUS_19860 2561 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2725 3321 gene locus_tag LOCUS_19870 2725 3321 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531304.1 protein_id gnl|my_center|LOCUS_19870 3403 3531 gene locus_tag LOCUS_19880 3403 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 4142 6481 gene locus_tag LOCUS_19890 4142 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 6478 7287 gene locus_tag LOCUS_19900 6478 7287 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393238.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence137 93 605 gene locus_tag LOCUS_19910 93 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19910 602 1258 gene locus_tag LOCUS_19920 602 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19920 2204 7225 gene locus_tag LOCUS_19930 2204 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence138 <1 703 gene locus_tag LOCUS_19940 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942288.1:diguanylate cyclase 1274 759 gene locus_tag LOCUS_19950 1274 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1406 3787 gene locus_tag LOCUS_19960 1406 3787 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_19960 3790 4437 gene locus_tag LOCUS_19970 gene lolA 3790 4437 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958062.1 protein_id gnl|my_center|LOCUS_19970 4611 5108 gene locus_tag LOCUS_19980 4611 5108 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444136.1 protein_id gnl|my_center|LOCUS_19980 5249 5944 gene locus_tag LOCUS_19990 5249 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 7694 6429 gene locus_tag LOCUS_20000 7694 6429 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence139 1623 970 gene locus_tag LOCUS_20010 1623 970 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963065.1 protein_id gnl|my_center|LOCUS_20010 1882 3027 gene locus_tag LOCUS_20020 1882 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 3587 3024 gene locus_tag LOCUS_20030 3587 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3622 4578 gene locus_tag LOCUS_20040 3622 4578 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839953.1 protein_id gnl|my_center|LOCUS_20040 5569 4802 gene locus_tag LOCUS_20050 5569 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 6093 5725 gene locus_tag LOCUS_20060 6093 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 6160 6498 gene locus_tag LOCUS_20070 6160 6498 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705759.1 protein_id gnl|my_center|LOCUS_20070 7220 6483 gene locus_tag LOCUS_20080 7220 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 7378 7305 gene locus_tag LOCUS_t01140 7378 7305 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 <8010 7465 gene locus_tag LOCUS_20090 <8010 7465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005088586.1:class II fumarate hydratase >Feature sequence140 <1 3809 gene locus_tag LOCUS_20100 <1 3809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942141.1:sigma-54 dependent transcriptional regulator 3826 4284 gene locus_tag LOCUS_20110 3826 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 4384 5691 gene locus_tag LOCUS_20120 4384 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence141 1323 1589 gene locus_tag LOCUS_20130 1323 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 1724 3391 gene locus_tag LOCUS_20140 1724 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 3769 3841 gene locus_tag LOCUS_t01150 3769 3841 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3861 3946 gene locus_tag LOCUS_t01160 3861 3946 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4749 4042 gene locus_tag LOCUS_20150 gene sfsA 4749 4042 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_20150 4961 5416 gene locus_tag LOCUS_20160 4961 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 5702 7876 gene locus_tag LOCUS_20170 5702 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence142 190 2433 gene locus_tag LOCUS_20180 190 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 3206 2418 gene locus_tag LOCUS_20190 3206 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 3926 3219 gene locus_tag LOCUS_20200 3926 3219 CDS product TIGR04290 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533206.1 protein_id gnl|my_center|LOCUS_20200 4653 3913 gene locus_tag LOCUS_20210 4653 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 6539 4650 gene locus_tag LOCUS_20220 6539 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 7261 6536 gene locus_tag LOCUS_20230 7261 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 7333 7779 gene locus_tag LOCUS_20240 7333 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence143 1964 255 gene locus_tag LOCUS_20250 gene recN 1964 255 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_20250 2929 2039 gene locus_tag LOCUS_20260 2929 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 3156 4232 gene locus_tag LOCUS_20270 3156 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 4281 5321 gene locus_tag LOCUS_20280 4281 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 6475 5360 gene locus_tag LOCUS_20290 6475 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 7547 6723 gene locus_tag LOCUS_20300 7547 6723 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_20300 7681 7605 gene locus_tag LOCUS_t01170 7681 7605 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7855 7781 gene locus_tag LOCUS_t01180 7855 7781 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence144 969 451 gene locus_tag LOCUS_20310 969 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 3077 1059 gene locus_tag LOCUS_20320 gene acs 3077 1059 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_20320 4437 3160 gene locus_tag LOCUS_20330 4437 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 5262 4585 gene locus_tag LOCUS_20340 5262 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 7316 5403 gene locus_tag LOCUS_20350 7316 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence145 1879 626 gene locus_tag LOCUS_20360 1879 626 CDS product RuBisCO large subunit C-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933432.1 protein_id gnl|my_center|LOCUS_20360 2334 1909 gene locus_tag LOCUS_20370 2334 1909 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932031.1 protein_id gnl|my_center|LOCUS_20370 3256 2336 gene locus_tag LOCUS_20380 3256 2336 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_20380 3485 3249 gene locus_tag LOCUS_20390 gene xseB 3485 3249 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157114.1 protein_id gnl|my_center|LOCUS_20390 4829 3642 gene locus_tag LOCUS_20400 gene xseA 4829 3642 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_20400 6221 4851 gene locus_tag LOCUS_20410 6221 4851 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259127.1 protein_id gnl|my_center|LOCUS_20410 7372 6293 gene locus_tag LOCUS_20420 7372 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence146 >Feature sequence147 781 1236 gene locus_tag LOCUS_20430 781 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1449 1952 gene locus_tag LOCUS_20440 1449 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2304 3203 gene locus_tag LOCUS_20450 2304 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 3734 3303 gene locus_tag LOCUS_20460 3734 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 4794 3844 gene locus_tag LOCUS_20470 4794 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 5505 5690 gene locus_tag LOCUS_20480 5505 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 6136 7200 gene locus_tag LOCUS_20490 6136 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 7402 7475 gene locus_tag LOCUS_t01190 7402 7475 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence148 349 2361 gene locus_tag LOCUS_20500 349 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2630 4063 gene locus_tag LOCUS_20510 gene gptM 2630 4063 CDS product geopeptide radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942092.1 protein_id gnl|my_center|LOCUS_20510 4282 5832 gene locus_tag LOCUS_20520 4282 5832 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_20520 5930 7675 gene locus_tag LOCUS_20530 5930 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence149 764 27 gene locus_tag LOCUS_20540 764 27 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_20540 1324 764 gene locus_tag LOCUS_20550 gene frr 1324 764 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_20550 1999 1346 gene locus_tag LOCUS_20560 gene pyrH 1999 1346 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_20560 2919 2062 gene locus_tag LOCUS_20570 gene tsf 2919 2062 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439509.1 protein_id gnl|my_center|LOCUS_20570 3820 2912 gene locus_tag LOCUS_20580 3820 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 4092 4565 gene locus_tag LOCUS_20590 4092 4565 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933541.1 protein_id gnl|my_center|LOCUS_20590 5690 4602 gene locus_tag LOCUS_20600 5690 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence150 1 198 gene locus_tag LOCUS_20610 1 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 855 202 gene locus_tag LOCUS_20620 855 202 CDS product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140169.1 protein_id gnl|my_center|LOCUS_20620 1414 1040 gene locus_tag LOCUS_20630 1414 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2468 1404 gene locus_tag LOCUS_20640 gene dusB 2468 1404 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_20640 2582 3157 gene locus_tag LOCUS_20650 2582 3157 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_20650 3364 3669 gene locus_tag LOCUS_20660 3364 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 5034 3748 gene locus_tag LOCUS_20670 5034 3748 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_20670 5402 5031 gene locus_tag LOCUS_20680 5402 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 6882 5497 gene locus_tag LOCUS_20690 6882 5497 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805011.1 protein_id gnl|my_center|LOCUS_20690 6944 7492 gene locus_tag LOCUS_20700 6944 7492 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461717.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence151 978 49 gene locus_tag LOCUS_20710 978 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1298 1080 gene locus_tag LOCUS_20720 1298 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 1593 2078 gene locus_tag LOCUS_20730 1593 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20730 2142 3551 gene locus_tag LOCUS_20740 2142 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20740 4966 3638 gene locus_tag LOCUS_20750 4966 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 5331 5549 gene locus_tag LOCUS_20760 5331 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 5561 7003 gene locus_tag LOCUS_20770 5561 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 <7589 7012 gene locus_tag LOCUS_20780 <7589 7012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922618.1:thioredoxin family protein >Feature sequence152 201 1895 gene locus_tag LOCUS_20790 201 1895 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_20790 1905 2594 gene locus_tag LOCUS_20800 1905 2594 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582678.1 protein_id gnl|my_center|LOCUS_20800 2591 3787 gene locus_tag LOCUS_20810 2591 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 4918 3788 gene locus_tag LOCUS_20820 gene ychF 4918 3788 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_20820 5018 6706 gene locus_tag LOCUS_20830 5018 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 6717 7067 gene locus_tag LOCUS_20840 6717 7067 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_20840 7149 7397 gene locus_tag LOCUS_20850 7149 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence153 2191 4224 gene locus_tag LOCUS_20860 2191 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 4266 4754 gene locus_tag LOCUS_20870 4266 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 4776 5300 gene locus_tag LOCUS_20880 4776 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 5313 6422 gene locus_tag LOCUS_20890 5313 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 6623 7162 gene locus_tag LOCUS_20900 6623 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence154 3980 2694 gene locus_tag LOCUS_20910 3980 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence155 3 356 gene locus_tag LOCUS_20920 3 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 429 668 gene locus_tag LOCUS_20930 429 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 891 652 gene locus_tag LOCUS_20940 891 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 808 1002 gene locus_tag LOCUS_20950 808 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1173 1457 gene locus_tag LOCUS_20960 1173 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1399 2898 gene locus_tag LOCUS_20970 1399 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 2891 3466 gene locus_tag LOCUS_20980 2891 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 4124 3474 gene locus_tag LOCUS_20990 4124 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 5008 4130 gene locus_tag LOCUS_21000 5008 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 4907 5104 gene locus_tag LOCUS_21010 4907 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 5452 5141 gene locus_tag LOCUS_21020 5452 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 5469 6137 gene locus_tag LOCUS_21030 5469 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 7021 6167 gene locus_tag LOCUS_21040 7021 6167 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082947.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence156 602 174 gene locus_tag LOCUS_21050 602 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 704 1504 gene locus_tag LOCUS_21060 704 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2065 1559 gene locus_tag LOCUS_21070 2065 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2192 3568 gene locus_tag LOCUS_21080 2192 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 3853 3620 gene locus_tag LOCUS_21090 3853 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 4193 3831 gene locus_tag LOCUS_21100 4193 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 5819 4305 gene locus_tag LOCUS_21110 5819 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 6662 5826 gene locus_tag LOCUS_21120 6662 5826 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_21120 6960 6706 gene locus_tag LOCUS_21130 6960 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence157 193 750 gene locus_tag LOCUS_21140 193 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 762 1208 gene locus_tag LOCUS_21150 762 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1368 1580 gene locus_tag LOCUS_21160 1368 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 1658 2431 gene locus_tag LOCUS_21170 1658 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 2431 2619 gene locus_tag LOCUS_21180 2431 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2613 3014 gene locus_tag LOCUS_21190 2613 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3021 3239 gene locus_tag LOCUS_21200 3021 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3236 3448 gene locus_tag LOCUS_21210 3236 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 3445 3669 gene locus_tag LOCUS_21220 3445 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3666 3863 gene locus_tag LOCUS_21230 3666 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 3874 4128 gene locus_tag LOCUS_21240 3874 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 4128 4394 gene locus_tag LOCUS_21250 4128 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 4385 4585 gene locus_tag LOCUS_21260 4385 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 4582 4854 gene locus_tag LOCUS_21270 4582 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 4851 5105 gene locus_tag LOCUS_21280 4851 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 5106 5306 gene locus_tag LOCUS_21290 5106 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 5321 5632 gene locus_tag LOCUS_21300 5321 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 5625 6164 gene locus_tag LOCUS_21310 5625 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence158 <1 1139 gene locus_tag LOCUS_21320 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001018338.1:(Fe-S)-binding protein 2187 1210 gene locus_tag LOCUS_21330 gene etfA 2187 1210 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 protein_id gnl|my_center|LOCUS_21330 3048 2269 gene locus_tag LOCUS_21340 3048 2269 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_21340 3662 3051 gene locus_tag LOCUS_21350 gene fadR 3662 3051 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_21350 5273 3828 gene locus_tag LOCUS_21360 5273 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 6037 5306 gene locus_tag LOCUS_21370 6037 5306 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_21370 <7353 6034 gene locus_tag LOCUS_21380 <7353 6034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941480.1:TolC family protein >Feature sequence159 <1 673 gene locus_tag LOCUS_21390 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088574.1:fumarylacetoacetate hydrolase family protein 1961 633 gene locus_tag LOCUS_21400 gene accC 1961 633 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884639.1 protein_id gnl|my_center|LOCUS_21400 2415 1975 gene locus_tag LOCUS_21410 gene accB 2415 1975 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110495.1 protein_id gnl|my_center|LOCUS_21410 2661 2458 gene locus_tag LOCUS_21420 2661 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2569 2778 gene locus_tag LOCUS_21430 2569 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 2779 2940 gene locus_tag LOCUS_21440 2779 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 3606 3058 gene locus_tag LOCUS_21450 3606 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 4087 3647 gene locus_tag LOCUS_21460 4087 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 4450 4737 gene locus_tag LOCUS_21470 gene groES 4450 4737 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_21470 4831 6465 gene locus_tag LOCUS_21480 gene groL 4831 6465 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence160 517 20 gene locus_tag LOCUS_21490 517 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 598 1668 gene locus_tag LOCUS_21500 598 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1669 3015 gene locus_tag LOCUS_21510 gene pabB 1669 3015 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438631.1 protein_id gnl|my_center|LOCUS_21510 3119 3988 gene locus_tag LOCUS_21520 gene ilvE 3119 3988 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_21520 4695 3955 gene locus_tag LOCUS_21530 gene thiD 4695 3955 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436492.1 protein_id gnl|my_center|LOCUS_21530 5379 4732 gene locus_tag LOCUS_21540 gene thiE 5379 4732 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_21540 6100 5366 gene locus_tag LOCUS_21550 6100 5366 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_21550 6390 6097 gene locus_tag LOCUS_21560 6390 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 <7272 6508 gene locus_tag LOCUS_21570 <7272 6508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein >Feature sequence161 1341 145 gene locus_tag LOCUS_21580 1341 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2669 1257 gene locus_tag LOCUS_21590 2669 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 5026 2720 gene locus_tag LOCUS_21600 5026 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 6411 5308 gene locus_tag LOCUS_21610 6411 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 <7258 6697 gene locus_tag LOCUS_21620 <7258 6697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000166475.1:response regulator transcription factor >Feature sequence162 2280 895 gene locus_tag LOCUS_21630 gene purF 2280 895 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_21630 4501 2285 gene locus_tag LOCUS_21640 gene purL 4501 2285 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_21640 5242 4586 gene locus_tag LOCUS_21650 gene purQ 5242 4586 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475857.1 protein_id gnl|my_center|LOCUS_21650 5491 5246 gene locus_tag LOCUS_21660 gene purS 5491 5246 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337254.1 protein_id gnl|my_center|LOCUS_21660 6211 5501 gene locus_tag LOCUS_21670 6211 5501 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_21670 <7224 6236 gene locus_tag LOCUS_21680 <7224 6236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942277.1:adenylosuccinate lyase >Feature sequence163 2876 1905 gene locus_tag LOCUS_21690 2876 1905 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_21690 3263 2880 gene locus_tag LOCUS_21700 3263 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 3404 4231 gene locus_tag LOCUS_21710 3404 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 4428 4796 gene locus_tag LOCUS_21720 4428 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 4944 5588 gene locus_tag LOCUS_21730 4944 5588 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 protein_id gnl|my_center|LOCUS_21730 5631 6308 gene locus_tag LOCUS_21740 5631 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence164 333 812 gene locus_tag LOCUS_21750 333 812 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_21750 809 3187 gene locus_tag LOCUS_21760 gene lon 809 3187 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_21760 3270 4001 gene locus_tag LOCUS_21770 3270 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 5574 4039 gene locus_tag LOCUS_21780 gene gcvPB 5574 4039 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393440.1 protein_id gnl|my_center|LOCUS_21780 6880 5522 gene locus_tag LOCUS_21790 gene gcvPA 6880 5522 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence165 891 1289 gene locus_tag LOCUS_21800 891 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 1635 1276 gene locus_tag LOCUS_21810 1635 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2061 1642 gene locus_tag LOCUS_21820 2061 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 2627 2139 gene locus_tag LOCUS_21830 2627 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2792 4033 gene locus_tag LOCUS_21840 2792 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 4053 6677 gene locus_tag LOCUS_21850 4053 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence166 1764 1456 gene locus_tag LOCUS_21860 gene nuoK 1764 1456 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_21860 2261 1761 gene locus_tag LOCUS_21870 2261 1761 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_21870 2777 2280 gene locus_tag LOCUS_21880 2777 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 3997 2789 gene locus_tag LOCUS_21890 gene nuoH 3997 2789 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_21890 5162 4020 gene locus_tag LOCUS_21900 gene nuoD 5162 4020 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_21900 5703 5179 gene locus_tag LOCUS_21910 5703 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 6194 5700 gene locus_tag LOCUS_21920 6194 5700 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_21920 6637 6215 gene locus_tag LOCUS_21930 gene ndhC 6637 6215 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence167 1311 2096 gene locus_tag LOCUS_21940 1311 2096 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505733.1 protein_id gnl|my_center|LOCUS_21940 3346 2183 gene locus_tag LOCUS_21950 3346 2183 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_21950 4149 3370 gene locus_tag LOCUS_21960 4149 3370 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_21960 5532 4354 gene locus_tag LOCUS_21970 5532 4354 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_21970 6828 5557 gene locus_tag LOCUS_21980 6828 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence168 <1 2672 gene locus_tag LOCUS_21990 <1 2672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024927297.1:OmpA family protein 3861 2713 gene locus_tag LOCUS_22000 3861 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 5736 4030 gene locus_tag LOCUS_22010 5736 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 5805 6029 gene locus_tag LOCUS_22020 5805 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 6520 6026 gene locus_tag LOCUS_22030 6520 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 6780 6526 gene locus_tag LOCUS_22040 6780 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence169 <1 1211 gene locus_tag LOCUS_22050 <1 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851405.1:cytochrome-c oxidase, cbb3-type subunit I 1227 1862 gene locus_tag LOCUS_22060 gene ccoO 1227 1862 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_22060 1834 2121 gene locus_tag LOCUS_22070 1834 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 2103 2333 gene locus_tag LOCUS_22080 2103 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 2350 2517 gene locus_tag LOCUS_22090 2350 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2532 3524 gene locus_tag LOCUS_22100 2532 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 3764 4819 gene locus_tag LOCUS_22110 3764 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 6210 4828 gene locus_tag LOCUS_22120 gene hemN 6210 4828 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003520.1 protein_id gnl|my_center|LOCUS_22120 6809 6264 gene locus_tag LOCUS_22130 6809 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence170 263 1816 gene locus_tag LOCUS_22140 263 1816 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 protein_id gnl|my_center|LOCUS_22140 2612 1941 gene locus_tag LOCUS_22150 2612 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 2826 3416 gene locus_tag LOCUS_22160 2826 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 5054 3510 gene locus_tag LOCUS_22170 5054 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence171 1288 4137 gene locus_tag LOCUS_22180 1288 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence172 641 2149 gene locus_tag LOCUS_22190 641 2149 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_22190 2146 3522 gene locus_tag LOCUS_22200 2146 3522 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_22200 3519 5222 gene locus_tag LOCUS_22210 gene argS 3519 5222 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869400.1 protein_id gnl|my_center|LOCUS_22210 5253 5855 gene locus_tag LOCUS_22220 5253 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 5869 6105 gene locus_tag LOCUS_22230 5869 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence173 848 96 gene locus_tag LOCUS_22240 848 96 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_22240 3215 885 gene locus_tag LOCUS_22250 3215 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 3455 3922 gene locus_tag LOCUS_22260 gene tadA 3455 3922 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325362.1 protein_id gnl|my_center|LOCUS_22260 4273 3959 gene locus_tag LOCUS_22270 gene grxD 4273 3959 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143330.1 protein_id gnl|my_center|LOCUS_22270 4541 4281 gene locus_tag LOCUS_22280 4541 4281 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_22280 5957 4617 gene locus_tag LOCUS_22290 5957 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 <6850 6147 gene locus_tag LOCUS_22300 <6850 6147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975676.1:PAS domain-containing sensor histidine kinase >Feature sequence174 <1 516 gene locus_tag LOCUS_22310 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942922.1:HDIG domain-containing protein 407 829 gene locus_tag LOCUS_22320 gene ybeY 407 829 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_22320 832 2370 gene locus_tag LOCUS_22330 gene lnt 832 2370 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_22330 2485 3468 gene locus_tag LOCUS_22340 gene prfB 2485 3468 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_22340 3865 6756 gene locus_tag LOCUS_22350 3865 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence175 2976 1342 gene locus_tag LOCUS_22360 2976 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 5999 3066 gene locus_tag LOCUS_22370 5999 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 6452 6655 gene locus_tag LOCUS_22380 6452 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence176 1967 1599 gene locus_tag LOCUS_22390 1967 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2410 2096 gene locus_tag LOCUS_22400 2410 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2745 2434 gene locus_tag LOCUS_22410 2745 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 4349 2742 gene locus_tag LOCUS_22420 4349 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 4643 4353 gene locus_tag LOCUS_22430 4643 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 5621 4737 gene locus_tag LOCUS_22440 5621 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence177 604 257 gene locus_tag LOCUS_22450 gene rplT 604 257 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_22450 807 610 gene locus_tag LOCUS_22460 gene rpmI 807 610 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393258.1 protein_id gnl|my_center|LOCUS_22460 1373 822 gene locus_tag LOCUS_22470 gene infC 1373 822 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_22470 3132 1387 gene locus_tag LOCUS_22480 gene thrS 3132 1387 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_22480 3267 3193 gene locus_tag LOCUS_t01200 3267 3193 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4737 3421 gene locus_tag LOCUS_22490 gene hemA 4737 3421 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 protein_id gnl|my_center|LOCUS_22490 5538 4741 gene locus_tag LOCUS_22500 gene ccsB 5538 4741 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944563.1 protein_id gnl|my_center|LOCUS_22500 5722 6051 gene locus_tag LOCUS_22510 gene trxA 5722 6051 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958643.1 protein_id gnl|my_center|LOCUS_22510 <6760 6107 gene locus_tag LOCUS_22520 <6760 6107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942720.1:rod shape-determining protein RodA >Feature sequence178 4795 4334 gene locus_tag LOCUS_22530 4795 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 <6757 4832 gene locus_tag LOCUS_22540 <6757 4832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383510.1:DUF2793 domain-containing protein >Feature sequence179 840 1391 gene locus_tag LOCUS_22550 840 1391 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_22550 1392 2345 gene locus_tag LOCUS_22560 gene htpX 1392 2345 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989629.1 protein_id gnl|my_center|LOCUS_22560 2841 2332 gene locus_tag LOCUS_22570 2841 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 3830 3270 gene locus_tag LOCUS_22580 3830 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 4174 4040 gene locus_tag LOCUS_22590 4174 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4441 6510 gene locus_tag LOCUS_22600 4441 6510 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence180 374 45 gene locus_tag LOCUS_22610 374 45 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208604.1 protein_id gnl|my_center|LOCUS_22610 1966 386 gene locus_tag LOCUS_22620 gene dnaX 1966 386 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_22620 2751 2038 gene locus_tag LOCUS_22630 2751 2038 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417513.1 protein_id gnl|my_center|LOCUS_22630 3469 2828 gene locus_tag LOCUS_22640 3469 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 4525 3524 gene locus_tag LOCUS_22650 4525 3524 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_22650 5484 4573 gene locus_tag LOCUS_22660 5484 4573 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence181 475 2649 gene locus_tag LOCUS_22670 475 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 2737 3864 gene locus_tag LOCUS_22680 2737 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence182 412 1593 gene locus_tag LOCUS_22690 412 1593 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496543.1 protein_id gnl|my_center|LOCUS_22690 1722 2159 gene locus_tag LOCUS_22700 1722 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2159 2860 gene locus_tag LOCUS_22710 2159 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2860 4647 gene locus_tag LOCUS_22720 2860 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22720 >Feature sequence183 649 1389 gene locus_tag LOCUS_22730 649 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1389 2078 gene locus_tag LOCUS_22740 1389 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2078 2980 gene locus_tag LOCUS_22750 2078 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2973 3863 gene locus_tag LOCUS_22760 2973 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 3844 4647 gene locus_tag LOCUS_22770 3844 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 4644 5345 gene locus_tag LOCUS_22780 4644 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 5348 6037 gene locus_tag LOCUS_22790 5348 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence184 <1 835 gene locus_tag LOCUS_22800 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962445.1:NADP-specific glutamate dehydrogenase 886 1527 gene locus_tag LOCUS_22810 gene nth 886 1527 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_22810 2186 1524 gene locus_tag LOCUS_22820 2186 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2993 2190 gene locus_tag LOCUS_22830 gene lgt 2993 2190 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_22830 3546 3007 gene locus_tag LOCUS_22840 gene lspA 3546 3007 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266581.1 protein_id gnl|my_center|LOCUS_22840 4067 3558 gene locus_tag LOCUS_22850 4067 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 4864 4064 gene locus_tag LOCUS_22860 gene lgt 4864 4064 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_22860 5161 4871 gene locus_tag LOCUS_22870 5161 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 <6396 5378 gene locus_tag LOCUS_22880 <6396 5378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546673.1:outer membrane protein assembly factor >Feature sequence185 555 346 gene locus_tag LOCUS_22890 555 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 1209 1394 gene locus_tag LOCUS_22900 1209 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1800 1570 gene locus_tag LOCUS_22910 1800 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2519 2280 gene locus_tag LOCUS_22920 2519 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2623 4203 gene locus_tag LOCUS_22930 2623 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 4669 4271 gene locus_tag LOCUS_22940 4669 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 5598 4711 gene locus_tag LOCUS_22950 5598 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 >Feature sequence186 <1 983 gene locus_tag LOCUS_22960 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942709.1:replication-associated recombination protein A 1202 3583 gene locus_tag LOCUS_22970 1202 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 3590 5863 gene locus_tag LOCUS_22980 3590 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence187 2238 1567 gene locus_tag LOCUS_22990 gene bioD 2238 1567 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398591.1 protein_id gnl|my_center|LOCUS_22990 3591 2245 gene locus_tag LOCUS_23000 gene bioA 3591 2245 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655595.1 protein_id gnl|my_center|LOCUS_23000 4729 3602 gene locus_tag LOCUS_23010 gene bioF 4729 3602 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_23010 4929 5264 gene locus_tag LOCUS_23020 4929 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 5320 5550 gene locus_tag LOCUS_23030 gene rpmE 5320 5550 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768737.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence188 138 1631 gene locus_tag LOCUS_23040 gene lysS 138 1631 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_23040 1643 2875 gene locus_tag LOCUS_23050 1643 2875 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_23050 2888 4075 gene locus_tag LOCUS_23060 2888 4075 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545027.1 protein_id gnl|my_center|LOCUS_23060 4075 4746 gene locus_tag LOCUS_23070 4075 4746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence189 971 1078 gene locus_tag LOCUS_r00010 971 1078 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1786 1259 gene locus_tag LOCUS_23080 1786 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3268 1904 gene locus_tag LOCUS_23090 3268 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 4023 3547 gene locus_tag LOCUS_23100 4023 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 5662 4097 gene locus_tag LOCUS_23110 5662 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence190 811 203 gene locus_tag LOCUS_23120 811 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1181 813 gene locus_tag LOCUS_23130 1181 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 1333 1178 gene locus_tag LOCUS_23140 1333 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 1775 1338 gene locus_tag LOCUS_23150 1775 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2041 1775 gene locus_tag LOCUS_23160 2041 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3027 2047 gene locus_tag LOCUS_23170 3027 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 3929 3306 gene locus_tag LOCUS_23180 3929 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 4388 3930 gene locus_tag LOCUS_23190 4388 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 4536 4381 gene locus_tag LOCUS_23200 4536 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 4858 4523 gene locus_tag LOCUS_23210 4858 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 5045 4845 gene locus_tag LOCUS_23220 5045 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 5701 5033 gene locus_tag LOCUS_23230 5701 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence191 263 51 gene locus_tag LOCUS_23240 263 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 522 265 gene locus_tag LOCUS_23250 522 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 612 538 gene locus_tag LOCUS_t01210 612 538 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 841 767 gene locus_tag LOCUS_t01220 841 767 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1285 842 gene locus_tag LOCUS_23260 1285 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1746 1381 gene locus_tag LOCUS_23270 1746 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2209 1739 gene locus_tag LOCUS_23280 2209 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 3218 2211 gene locus_tag LOCUS_23290 3218 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 4023 3229 gene locus_tag LOCUS_23300 4023 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 4046 4603 gene locus_tag LOCUS_23310 4046 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 4982 4587 gene locus_tag LOCUS_23320 4982 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 5283 4993 gene locus_tag LOCUS_23330 5283 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 5790 5413 gene locus_tag LOCUS_23340 5790 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence192 294 596 gene locus_tag LOCUS_23350 294 596 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_23350 921 727 gene locus_tag LOCUS_23360 921 727 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 protein_id gnl|my_center|LOCUS_23360 1400 978 gene locus_tag LOCUS_23370 1400 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 1988 1915 gene locus_tag LOCUS_t01230 1988 1915 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2775 2122 gene locus_tag LOCUS_23380 2775 2122 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_23380 3534 2782 gene locus_tag LOCUS_23390 3534 2782 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_23390 4648 3575 gene locus_tag LOCUS_23400 4648 3575 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 protein_id gnl|my_center|LOCUS_23400 4751 5332 gene locus_tag LOCUS_23410 4751 5332 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_23410 5329 5709 gene locus_tag LOCUS_23420 5329 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 5942 5694 gene locus_tag LOCUS_23430 5942 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence193 1401 442 gene locus_tag LOCUS_23440 gene rsbQ 1401 442 CDS product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 protein_id gnl|my_center|LOCUS_23440 1629 2546 gene locus_tag LOCUS_23450 gene ispE 1629 2546 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356061.1 protein_id gnl|my_center|LOCUS_23450 2592 2663 gene locus_tag LOCUS_t01240 2592 2663 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2780 3733 gene locus_tag LOCUS_23460 2780 3733 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_23460 3764 4420 gene locus_tag LOCUS_23470 3764 4420 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_23470 4426 4986 gene locus_tag LOCUS_23480 gene pth 4426 4986 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_23480 5003 5494 gene locus_tag LOCUS_23490 5003 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence194 >Feature sequence195 244 474 gene locus_tag LOCUS_23500 244 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 474 761 gene locus_tag LOCUS_23510 474 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 754 1038 gene locus_tag LOCUS_23520 754 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 1025 1216 gene locus_tag LOCUS_23530 1025 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1391 2026 gene locus_tag LOCUS_23540 1391 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 1947 3521 gene locus_tag LOCUS_23550 1947 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 3526 5646 gene locus_tag LOCUS_23560 3526 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence196 1609 1145 gene locus_tag LOCUS_23570 1609 1145 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_23570 3137 1713 gene locus_tag LOCUS_23580 gene terL 3137 1713 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 protein_id gnl|my_center|LOCUS_23580 3531 3127 gene locus_tag LOCUS_23590 3531 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 4873 3524 gene locus_tag LOCUS_23600 4873 3524 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_23600 5762 4977 gene locus_tag LOCUS_23610 5762 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence197 1116 532 gene locus_tag LOCUS_23620 1116 532 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789731.1 protein_id gnl|my_center|LOCUS_23620 4018 1151 gene locus_tag LOCUS_23630 4018 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 5292 4147 gene locus_tag LOCUS_23640 5292 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence198 3464 810 gene locus_tag LOCUS_23650 3464 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4312 3473 gene locus_tag LOCUS_23660 4312 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 5177 4374 gene locus_tag LOCUS_23670 5177 4374 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_23670 5742 5200 gene locus_tag LOCUS_23680 5742 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence199 332 877 gene locus_tag LOCUS_23690 332 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 919 1560 gene locus_tag LOCUS_23700 919 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1560 2963 gene locus_tag LOCUS_23710 1560 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2982 3719 gene locus_tag LOCUS_23720 2982 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 3719 3964 gene locus_tag LOCUS_23730 3719 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 3964 4419 gene locus_tag LOCUS_23740 3964 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 4416 4952 gene locus_tag LOCUS_23750 4416 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 4952 5317 gene locus_tag LOCUS_23760 4952 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence200 2720 1731 gene locus_tag LOCUS_23770 2720 1731 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_23770 3742 2690 gene locus_tag LOCUS_23780 gene gmd 3742 2690 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546080.1 protein_id gnl|my_center|LOCUS_23780 5076 3781 gene locus_tag LOCUS_23790 5076 3781 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_23790 <5866 5078 gene locus_tag LOCUS_23800 <5866 5078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942881.1:NAD-dependent epimerase >Feature sequence201 699 217 gene locus_tag LOCUS_23810 699 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2976 700 gene locus_tag LOCUS_23820 2976 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 4653 3295 gene locus_tag LOCUS_23830 4653 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 4904 4668 gene locus_tag LOCUS_23840 4904 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 5743 4901 gene locus_tag LOCUS_23850 5743 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence202 4238 1590 gene locus_tag LOCUS_23860 gene mutS 4238 1590 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_23860 4707 4243 gene locus_tag LOCUS_23870 4707 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 4849 5175 gene locus_tag LOCUS_23880 gene hspQ 4849 5175 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722172.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence203 3098 2178 gene locus_tag LOCUS_23890 gene hemB 3098 2178 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_23890 3912 3196 gene locus_tag LOCUS_23900 3912 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 4293 3946 gene locus_tag LOCUS_23910 4293 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 5594 4302 gene locus_tag LOCUS_23920 5594 4302 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355117.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence204 160 333 gene locus_tag LOCUS_23930 160 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 757 371 gene locus_tag LOCUS_23940 757 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 903 1538 gene locus_tag LOCUS_23950 903 1538 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109866564.1 protein_id gnl|my_center|LOCUS_23950 2441 1608 gene locus_tag LOCUS_23960 2441 1608 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896244.1 protein_id gnl|my_center|LOCUS_23960 4807 2471 gene locus_tag LOCUS_23970 4807 2471 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_23970 5641 5360 gene locus_tag LOCUS_23980 5641 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence205 562 260 gene locus_tag LOCUS_23990 562 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2718 565 gene locus_tag LOCUS_24000 2718 565 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070134174.1 protein_id gnl|my_center|LOCUS_24000 3962 2715 gene locus_tag LOCUS_24010 3962 2715 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976029.1 protein_id gnl|my_center|LOCUS_24010 4221 3934 gene locus_tag LOCUS_24020 4221 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 4487 4278 gene locus_tag LOCUS_24030 4487 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 4578 4763 gene locus_tag LOCUS_24040 4578 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 4845 5039 gene locus_tag LOCUS_24050 4845 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 5073 5324 gene locus_tag LOCUS_24060 5073 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence206 2604 2152 gene locus_tag LOCUS_24070 gene lysM 2604 2152 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528340.1 protein_id gnl|my_center|LOCUS_24070 2709 3875 gene locus_tag LOCUS_24080 2709 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 5183 3879 gene locus_tag LOCUS_24090 5183 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence207 1530 4589 gene locus_tag LOCUS_24100 1530 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 <5592 4661 gene locus_tag LOCUS_24110 <5592 4661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704281.1:adenosine deaminase >Feature sequence208 797 1306 gene locus_tag LOCUS_24120 797 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 1579 2145 gene locus_tag LOCUS_24130 1579 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2422 2733 gene locus_tag LOCUS_24140 2422 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 4261 5265 gene locus_tag LOCUS_24150 4261 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence209 421 1050 gene locus_tag LOCUS_24160 421 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 4323 1081 gene locus_tag LOCUS_24170 gene carB 4323 1081 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_24170 <5471 4329 gene locus_tag LOCUS_24180 <5471 4329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941928.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit >Feature sequence210 1354 917 gene locus_tag LOCUS_24190 1354 917 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_24190 1694 1332 gene locus_tag LOCUS_24200 1694 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2576 1800 gene locus_tag LOCUS_24210 2576 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 3339 3746 gene locus_tag LOCUS_24220 3339 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence211 351 1373 gene locus_tag LOCUS_24230 351 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 1649 2989 gene locus_tag LOCUS_24240 1649 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 4844 3009 gene locus_tag LOCUS_24250 4844 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence212 2893 1538 gene locus_tag LOCUS_24260 2893 1538 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_24260 3701 3252 gene locus_tag LOCUS_24270 3701 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 4897 3698 gene locus_tag LOCUS_24280 4897 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence213 1040 282 gene locus_tag LOCUS_24290 gene sdhB 1040 282 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808702.1 protein_id gnl|my_center|LOCUS_24290 2781 1042 gene locus_tag LOCUS_24300 gene sdhA 2781 1042 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808703.1 protein_id gnl|my_center|LOCUS_24300 3340 2783 gene locus_tag LOCUS_24310 gene sdhC 3340 2783 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678351.1 protein_id gnl|my_center|LOCUS_24310 4417 3488 gene locus_tag LOCUS_24320 gene mdh 4417 3488 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942112.1 protein_id gnl|my_center|LOCUS_24320 <5354 4452 gene locus_tag LOCUS_24330 <5354 4452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868777.1:isocitrate dehydrogenase (NADP(+)) >Feature sequence214 581 162 gene locus_tag LOCUS_24340 581 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 1084 578 gene locus_tag LOCUS_24350 1084 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2046 1153 gene locus_tag LOCUS_24360 2046 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2752 2210 gene locus_tag LOCUS_24370 2752 2210 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_24370 3486 2788 gene locus_tag LOCUS_24380 3486 2788 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391247.1 protein_id gnl|my_center|LOCUS_24380 4397 3483 gene locus_tag LOCUS_24390 4397 3483 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083528.1 protein_id gnl|my_center|LOCUS_24390 5247 4414 gene locus_tag LOCUS_24400 5247 4414 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence215 4202 939 gene locus_tag LOCUS_24410 4202 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 5049 4279 gene locus_tag LOCUS_24420 5049 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence216 647 1096 gene locus_tag LOCUS_24430 647 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 1243 2112 gene locus_tag LOCUS_24440 gene speB 1243 2112 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_24440 2383 2114 gene locus_tag LOCUS_24450 2383 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 4551 2596 gene locus_tag LOCUS_24460 gene speA 4551 2596 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_24460 4674 4988 gene locus_tag LOCUS_24470 4674 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence217 <1 548 gene locus_tag LOCUS_24480 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941610.1:inositol monophosphatase family protein 545 1195 gene locus_tag LOCUS_24490 545 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1968 1201 gene locus_tag LOCUS_24500 1968 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 3354 1969 gene locus_tag LOCUS_24510 gene hpnO 3354 1969 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_24510 <5224 3354 gene locus_tag LOCUS_24520 <5224 3354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941349.1:MMPL family transporter >Feature sequence218 2160 865 gene locus_tag LOCUS_24530 2160 865 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530017.1 protein_id gnl|my_center|LOCUS_24530 4628 2352 gene locus_tag LOCUS_24540 4628 2352 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268538.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence219 1197 523 gene locus_tag LOCUS_24550 1197 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 1386 1234 gene locus_tag LOCUS_24560 1386 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2612 1509 gene locus_tag LOCUS_24570 2612 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 2974 4221 gene locus_tag LOCUS_24580 2974 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 <5143 4268 gene locus_tag LOCUS_24590 <5143 4268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043791004.1:ISAs1 family transposase >Feature sequence220 782 405 gene locus_tag LOCUS_24600 782 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 1666 779 gene locus_tag LOCUS_24610 gene rsmH 1666 779 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_24610 2107 1730 gene locus_tag LOCUS_24620 2107 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2566 2126 gene locus_tag LOCUS_24630 gene mraZ 2566 2126 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence221 503 42 gene locus_tag LOCUS_24640 503 42 CDS product DUF5662 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116181623.1 protein_id gnl|my_center|LOCUS_24640 1058 579 gene locus_tag LOCUS_24650 1058 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1894 1076 gene locus_tag LOCUS_24660 gene artR 1894 1076 CDS product arginine ABC transporter ATP-binding protein ArtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398740.1 protein_id gnl|my_center|LOCUS_24660 2738 1899 gene locus_tag LOCUS_24670 2738 1899 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_24670 4648 2819 gene locus_tag LOCUS_24680 4648 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence222 363 244 gene locus_tag LOCUS_24690 363 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 694 413 gene locus_tag LOCUS_24700 694 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 1004 699 gene locus_tag LOCUS_24710 1004 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 1362 1036 gene locus_tag LOCUS_24720 1362 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 3487 1355 gene locus_tag LOCUS_24730 3487 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 4055 3600 gene locus_tag LOCUS_24740 4055 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 4514 4062 gene locus_tag LOCUS_24750 4514 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 5093 4668 gene locus_tag LOCUS_24760 5093 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence223 1431 574 gene locus_tag LOCUS_24770 1431 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 1978 1679 gene locus_tag LOCUS_24780 1978 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3523 2069 gene locus_tag LOCUS_24790 3523 2069 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_24790 4193 4999 gene locus_tag LOCUS_24800 4193 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence224 2149 1157 gene locus_tag LOCUS_24810 2149 1157 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_24810 2679 2146 gene locus_tag LOCUS_24820 gene pyrR 2679 2146 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460661.1 protein_id gnl|my_center|LOCUS_24820 2864 3658 gene locus_tag LOCUS_24830 2864 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4383 3655 gene locus_tag LOCUS_24840 4383 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 <5084 4405 gene locus_tag LOCUS_24850 <5084 4405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193305.1:translation elongation factor 4 >Feature sequence225 1656 1270 gene locus_tag LOCUS_24860 1656 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2223 1879 gene locus_tag LOCUS_24870 2223 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 2725 2252 gene locus_tag LOCUS_24880 2725 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 2791 2970 gene locus_tag LOCUS_24890 2791 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 3203 3003 gene locus_tag LOCUS_24900 3203 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 3388 3200 gene locus_tag LOCUS_24910 3388 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3735 3388 gene locus_tag LOCUS_24920 3735 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 3830 4402 gene locus_tag LOCUS_24930 3830 4402 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_24930 4389 4766 gene locus_tag LOCUS_24940 4389 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence226 440 237 gene locus_tag LOCUS_24950 440 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 627 466 gene locus_tag LOCUS_24960 627 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 1101 775 gene locus_tag LOCUS_24970 1101 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1374 1108 gene locus_tag LOCUS_24980 1374 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2128 1472 gene locus_tag LOCUS_24990 2128 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2531 2139 gene locus_tag LOCUS_25000 2531 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2849 2562 gene locus_tag LOCUS_25010 2849 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 3504 2878 gene locus_tag LOCUS_25020 3504 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 3795 3508 gene locus_tag LOCUS_25030 3795 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 4797 3973 gene locus_tag LOCUS_25040 4797 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence227 2375 1362 gene locus_tag LOCUS_25050 gene aruF 2375 1362 CDS product arginine/ornithine succinyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085950.1 protein_id gnl|my_center|LOCUS_25050 3703 2375 gene locus_tag LOCUS_25060 3703 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 <5056 3735 gene locus_tag LOCUS_25070 <5056 3735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964345.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence228 133 1257 gene locus_tag LOCUS_25080 133 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 1261 1545 gene locus_tag LOCUS_25090 1261 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 1604 2038 gene locus_tag LOCUS_25100 1604 2038 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547630.1 protein_id gnl|my_center|LOCUS_25100 2051 2488 gene locus_tag LOCUS_25110 2051 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2524 3084 gene locus_tag LOCUS_25120 2524 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 3068 4252 gene locus_tag LOCUS_25130 3068 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence229 537 16 gene locus_tag LOCUS_25140 537 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 917 534 gene locus_tag LOCUS_25150 917 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1283 939 gene locus_tag LOCUS_25160 1283 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 1792 1451 gene locus_tag LOCUS_25170 1792 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 2135 1803 gene locus_tag LOCUS_25180 2135 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2364 2119 gene locus_tag LOCUS_25190 2364 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2578 2357 gene locus_tag LOCUS_25200 2578 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 2815 2609 gene locus_tag LOCUS_25210 2815 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 3139 2819 gene locus_tag LOCUS_25220 3139 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 3355 3143 gene locus_tag LOCUS_25230 3355 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 3615 3355 gene locus_tag LOCUS_25240 3615 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 4465 4205 gene locus_tag LOCUS_25250 4465 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 4810 4478 gene locus_tag LOCUS_25260 4810 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 >Feature sequence230 <1 1483 gene locus_tag LOCUS_25270 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051000241.1:AMP-dependent synthetase/ligase 1505 2500 gene locus_tag LOCUS_25280 gene lipA 1505 2500 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522930.1 protein_id gnl|my_center|LOCUS_25280 2520 3191 gene locus_tag LOCUS_25290 2520 3191 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330705.1 protein_id gnl|my_center|LOCUS_25290 3958 3269 gene locus_tag LOCUS_25300 gene murU 3958 3269 CDS product N-acetylmuramate alpha-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099549.1 protein_id gnl|my_center|LOCUS_25300 <4966 3955 gene locus_tag LOCUS_25310 <4966 3955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269130.1:phosphotransferase >Feature sequence231 724 897 gene locus_tag LOCUS_25320 724 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 1612 1100 gene locus_tag LOCUS_25330 1612 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 2036 1614 gene locus_tag LOCUS_25340 2036 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2711 2037 gene locus_tag LOCUS_25350 2711 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 2907 2701 gene locus_tag LOCUS_25360 2907 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 3251 2904 gene locus_tag LOCUS_25370 3251 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 3460 3251 gene locus_tag LOCUS_25380 3460 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3598 3765 gene locus_tag LOCUS_25390 3598 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 3762 4364 gene locus_tag LOCUS_25400 3762 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 4361 4738 gene locus_tag LOCUS_25410 4361 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence232 339 1382 gene locus_tag LOCUS_25420 339 1382 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939034.1 protein_id gnl|my_center|LOCUS_25420 1386 3047 gene locus_tag LOCUS_25430 1386 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 3044 3568 gene locus_tag LOCUS_25440 3044 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 3786 3565 gene locus_tag LOCUS_25450 3786 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3881 4147 gene locus_tag LOCUS_25460 3881 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 4580 4507 gene locus_tag LOCUS_t01250 4580 4507 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4765 4690 gene locus_tag LOCUS_t01260 4765 4690 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence233 2389 1547 gene locus_tag LOCUS_25470 gene aroE 2389 1547 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_25470 3318 2386 gene locus_tag LOCUS_25480 3318 2386 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546739.1 protein_id gnl|my_center|LOCUS_25480 <4931 3325 gene locus_tag LOCUS_25490 <4931 3325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942416.1:S41 family peptidase >Feature sequence234 68 922 gene locus_tag LOCUS_25500 68 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 950 1582 gene locus_tag LOCUS_25510 950 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 1915 1685 gene locus_tag LOCUS_25520 1915 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2011 2949 gene locus_tag LOCUS_25530 2011 2949 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_25530 3231 2950 gene locus_tag LOCUS_25540 3231 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 <4899 3267 gene locus_tag LOCUS_25550 <4899 3267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197781.1:trimeric autotransporter adhesin BpaC >Feature sequence235 364 1680 gene locus_tag LOCUS_25560 364 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 1670 2275 gene locus_tag LOCUS_25570 1670 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 2409 2618 gene locus_tag LOCUS_25580 2409 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 2909 3229 gene locus_tag LOCUS_25590 2909 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3229 4059 gene locus_tag LOCUS_25600 3229 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence236 1919 2146 gene locus_tag LOCUS_25610 1919 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence237 4106 3153 gene locus_tag LOCUS_25620 4106 3153 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063757.1 protein_id gnl|my_center|LOCUS_25620 4579 4118 gene locus_tag LOCUS_25630 4579 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 >Feature sequence238 1188 46 gene locus_tag LOCUS_25640 gene anmK 1188 46 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_25640 1436 1185 gene locus_tag LOCUS_25650 1436 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 2427 1495 gene locus_tag LOCUS_25660 2427 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 3279 2446 gene locus_tag LOCUS_25670 3279 2446 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_25670 <4848 3304 gene locus_tag LOCUS_25680 <4848 3304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015881.1:D-lysine 5,6-aminomutase subunit alpha >Feature sequence239 2748 1567 gene locus_tag LOCUS_25690 2748 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 4826 2745 gene locus_tag LOCUS_25700 4826 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 >Feature sequence240 884 432 gene locus_tag LOCUS_25710 884 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 3345 3515 gene locus_tag LOCUS_25720 3345 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 4401 3751 gene locus_tag LOCUS_25730 4401 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence241 >Feature sequence242 789 1673 gene locus_tag LOCUS_25740 789 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2068 1670 gene locus_tag LOCUS_25750 2068 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2508 2071 gene locus_tag LOCUS_25760 2508 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3980 2508 gene locus_tag LOCUS_25770 3980 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 4149 3964 gene locus_tag LOCUS_25780 4149 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 4648 4190 gene locus_tag LOCUS_25790 4648 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence243 211 519 gene locus_tag LOCUS_25800 211 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 590 793 gene locus_tag LOCUS_25810 590 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 885 2900 gene locus_tag LOCUS_25820 885 2900 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765726.1 protein_id gnl|my_center|LOCUS_25820 2897 3436 gene locus_tag LOCUS_25830 2897 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 4255 3428 gene locus_tag LOCUS_25840 4255 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 4546 4259 gene locus_tag LOCUS_25850 4546 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence244 635 2098 gene locus_tag LOCUS_25860 635 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 2154 2972 gene locus_tag LOCUS_25870 2154 2972 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826360.1 protein_id gnl|my_center|LOCUS_25870 2995 3300 gene locus_tag LOCUS_25880 2995 3300 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197795.1 protein_id gnl|my_center|LOCUS_25880 3515 4633 gene locus_tag LOCUS_25890 3515 4633 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence245 1649 378 gene locus_tag LOCUS_25900 gene lysA 1649 378 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_25900 3054 1678 gene locus_tag LOCUS_25910 gene argH 3054 1678 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704829.1 protein_id gnl|my_center|LOCUS_25910 3275 4699 gene locus_tag LOCUS_25920 gene rho 3275 4699 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence246 649 425 gene locus_tag LOCUS_25930 649 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 1236 727 gene locus_tag LOCUS_25940 1236 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1847 3631 gene locus_tag LOCUS_25950 1847 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence247 844 509 gene locus_tag LOCUS_25960 844 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2094 937 gene locus_tag LOCUS_25970 2094 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 4533 2371 gene locus_tag LOCUS_25980 4533 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence248 637 299 gene locus_tag LOCUS_25990 637 299 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_25990 1038 649 gene locus_tag LOCUS_26000 1038 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946360.1 protein_id gnl|my_center|LOCUS_26000 1237 1046 gene locus_tag LOCUS_26010 1237 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2053 1682 gene locus_tag LOCUS_26020 2053 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 3815 2028 gene locus_tag LOCUS_26030 3815 2028 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920876.1 protein_id gnl|my_center|LOCUS_26030 4412 3996 gene locus_tag LOCUS_26040 4412 3996 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036503.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence249 1214 3199 gene locus_tag LOCUS_26050 1214 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 3278 3877 gene locus_tag LOCUS_26060 3278 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907591.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence250 1718 297 gene locus_tag LOCUS_26070 gene gatA 1718 297 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257583.1 protein_id gnl|my_center|LOCUS_26070 1832 2905 gene locus_tag LOCUS_26080 1832 2905 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616218.1 protein_id gnl|my_center|LOCUS_26080 3591 2908 gene locus_tag LOCUS_26090 3591 2908 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533388.1 protein_id gnl|my_center|LOCUS_26090 3998 3597 gene locus_tag LOCUS_26100 3998 3597 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence251 <1 1007 gene locus_tag LOCUS_26110 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937589.1:glycosyltransferase 3082 2285 gene locus_tag LOCUS_26120 3082 2285 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867618.1 protein_id gnl|my_center|LOCUS_26120 3373 3143 gene locus_tag LOCUS_26130 3373 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence252 <1 808 gene locus_tag LOCUS_26140 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816115.1:ATP-binding protein 805 1743 gene locus_tag LOCUS_26150 805 1743 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816114.1 protein_id gnl|my_center|LOCUS_26150 3103 1778 gene locus_tag LOCUS_26160 3103 1778 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705005.1 protein_id gnl|my_center|LOCUS_26160 3492 4049 gene locus_tag LOCUS_26170 3492 4049 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112313490.1 protein_id gnl|my_center|LOCUS_26170 >Feature sequence253 <1 1062 gene locus_tag LOCUS_26180 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958176.1:Fe-S cluster assembly protein SufD 1055 2308 gene locus_tag LOCUS_26190 1055 2308 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_26190 2402 2872 gene locus_tag LOCUS_26200 2402 2872 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_26200 2889 3311 gene locus_tag LOCUS_26210 2889 3311 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087115.1 protein_id gnl|my_center|LOCUS_26210 3383 3676 gene locus_tag LOCUS_26220 3383 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 4091 3726 gene locus_tag LOCUS_26230 4091 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence254 430 1596 gene locus_tag LOCUS_26240 430 1596 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_26240 1605 2282 gene locus_tag LOCUS_26250 1605 2282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence255 2935 1499 gene locus_tag LOCUS_26260 2935 1499 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_26260 3212 3367 gene locus_tag LOCUS_26270 3212 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 <4537 3605 gene locus_tag LOCUS_26280 <4537 3605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023630.1:thioredoxin domain-containing protein >Feature sequence256 1 195 gene locus_tag LOCUS_26290 1 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 814 260 gene locus_tag LOCUS_26300 814 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 1119 835 gene locus_tag LOCUS_26310 1119 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 1648 1830 gene locus_tag LOCUS_26320 1648 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 2086 3735 gene locus_tag LOCUS_26330 2086 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 4126 3713 gene locus_tag LOCUS_26340 4126 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence257 135 611 gene locus_tag LOCUS_26350 gene moaC 135 611 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_26350 1152 640 gene locus_tag LOCUS_26360 1152 640 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 protein_id gnl|my_center|LOCUS_26360 2107 1208 gene locus_tag LOCUS_26370 gene argF 2107 1208 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 protein_id gnl|my_center|LOCUS_26370 3324 2104 gene locus_tag LOCUS_26380 3324 2104 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931526.1 protein_id gnl|my_center|LOCUS_26380 3620 3961 gene locus_tag LOCUS_26390 gene clpS 3620 3961 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097649.1 protein_id gnl|my_center|LOCUS_26390 >Feature sequence258 174 494 gene locus_tag LOCUS_26400 174 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 607 3399 gene locus_tag LOCUS_26410 607 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 3466 3666 gene locus_tag LOCUS_26420 3466 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 3672 4055 gene locus_tag LOCUS_26430 3672 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence259 1998 979 gene locus_tag LOCUS_26440 1998 979 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324413.1 protein_id gnl|my_center|LOCUS_26440 3413 3192 gene locus_tag LOCUS_26450 3413 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 4018 4278 gene locus_tag LOCUS_26460 4018 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence260 1198 209 gene locus_tag LOCUS_26470 gene pstS 1198 209 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_26470 2384 1230 gene locus_tag LOCUS_26480 2384 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 3071 2664 gene locus_tag LOCUS_26490 3071 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 <4494 3119 gene locus_tag LOCUS_26500 <4494 3119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941762.1:phosphate regulon sensor histidine kinase PhoR >Feature sequence261 <1 1362 gene locus_tag LOCUS_26510 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001244955.1:recombinase family protein 1362 1793 gene locus_tag LOCUS_26520 1362 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 2235 3662 gene locus_tag LOCUS_26530 2235 3662 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396876.1 protein_id gnl|my_center|LOCUS_26530 3659 4096 gene locus_tag LOCUS_26540 3659 4096 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086163.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence262 359 748 gene locus_tag LOCUS_26550 359 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 772 1221 gene locus_tag LOCUS_26560 772 1221 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094294.1 protein_id gnl|my_center|LOCUS_26560 2413 1259 gene locus_tag LOCUS_26570 2413 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 3603 2458 gene locus_tag LOCUS_26580 3603 2458 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_26580 4227 3649 gene locus_tag LOCUS_26590 4227 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence263 662 1402 gene locus_tag LOCUS_26600 662 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 1402 1578 gene locus_tag LOCUS_26610 1402 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 1571 1807 gene locus_tag LOCUS_26620 1571 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 1812 2132 gene locus_tag LOCUS_26630 1812 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 2495 2884 gene locus_tag LOCUS_26640 2495 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 3086 3214 gene locus_tag LOCUS_26650 3086 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence264 96 878 gene locus_tag LOCUS_26660 96 878 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941055.1 protein_id gnl|my_center|LOCUS_26660 884 1348 gene locus_tag LOCUS_26670 884 1348 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_26670 1471 1674 gene locus_tag LOCUS_26680 1471 1674 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence265 1089 1940 gene locus_tag LOCUS_26690 1089 1940 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_26690 2024 2905 gene locus_tag LOCUS_26700 2024 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 <4422 2940 gene locus_tag LOCUS_26710 <4422 2940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111138.1:DNA polymerase I >Feature sequence266 71 769 gene locus_tag LOCUS_26720 71 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 766 945 gene locus_tag LOCUS_26730 766 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 938 1216 gene locus_tag LOCUS_26740 938 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 1213 1545 gene locus_tag LOCUS_26750 1213 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 1547 1930 gene locus_tag LOCUS_26760 1547 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2091 2360 gene locus_tag LOCUS_26770 2091 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 2365 2523 gene locus_tag LOCUS_26780 2365 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2498 2677 gene locus_tag LOCUS_26790 2498 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 2670 2819 gene locus_tag LOCUS_26800 2670 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2891 3100 gene locus_tag LOCUS_26810 2891 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3079 3249 gene locus_tag LOCUS_26820 3079 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 3239 3493 gene locus_tag LOCUS_26830 3239 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 3486 3770 gene locus_tag LOCUS_26840 3486 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 3770 3982 gene locus_tag LOCUS_26850 3770 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 3979 4170 gene locus_tag LOCUS_26860 3979 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 4167 4394 gene locus_tag LOCUS_26870 4167 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence267 2131 782 gene locus_tag LOCUS_26880 2131 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 2596 2444 gene locus_tag LOCUS_26890 2596 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 2949 3878 gene locus_tag LOCUS_26900 2949 3878 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_26900 4312 3905 gene locus_tag LOCUS_26910 gene mce 4312 3905 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531105.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence268 <1 1151 gene locus_tag LOCUS_26920 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001172341.1:AMP-binding protein 1144 1926 gene locus_tag LOCUS_26930 1144 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2605 1934 gene locus_tag LOCUS_26940 2605 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence269 320 1282 gene locus_tag LOCUS_26950 gene nadA 320 1282 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_26950 3233 1308 gene locus_tag LOCUS_26960 gene ligA 3233 1308 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 protein_id gnl|my_center|LOCUS_26960 3928 3230 gene locus_tag LOCUS_26970 3928 3230 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256529.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence270 525 875 gene locus_tag LOCUS_26980 525 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 996 1559 gene locus_tag LOCUS_26990 996 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 1697 3979 gene locus_tag LOCUS_27000 1697 3979 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385733.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence271 282 1364 gene locus_tag LOCUS_27010 282 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2418 1597 gene locus_tag LOCUS_27020 gene rssA 2418 1597 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169303.1 protein_id gnl|my_center|LOCUS_27020 3991 2954 gene locus_tag LOCUS_27030 3991 2954 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135179749.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence272 1576 2331 gene locus_tag LOCUS_27040 1576 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 2386 3645 gene locus_tag LOCUS_27050 2386 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence273 <1 2093 gene locus_tag LOCUS_27060 <1 2093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583743.1:DNA polymerase III subunit alpha 2104 2529 gene locus_tag LOCUS_27070 2104 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256549.1 protein_id gnl|my_center|LOCUS_27070 2532 3020 gene locus_tag LOCUS_27080 gene rnhA 2532 3020 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044664291.1 protein_id gnl|my_center|LOCUS_27080 3390 2983 gene locus_tag LOCUS_27090 3390 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 3568 3395 gene locus_tag LOCUS_27100 3568 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 3674 4159 gene locus_tag LOCUS_27110 3674 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence274 <1 2133 gene locus_tag LOCUS_27120 <1 2133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969823.1:FAD-dependent oxidoreductase 2996 2130 gene locus_tag LOCUS_27130 gene mmsB 2996 2130 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338027.1 protein_id gnl|my_center|LOCUS_27130 3934 2996 gene locus_tag LOCUS_27140 3934 2996 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705825.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence275 43 669 gene locus_tag LOCUS_27150 43 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 689 1051 gene locus_tag LOCUS_27160 689 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 1048 1251 gene locus_tag LOCUS_27170 1048 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 1282 1887 gene locus_tag LOCUS_27180 1282 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 1884 3272 gene locus_tag LOCUS_27190 gene asnS 1884 3272 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964340.1 protein_id gnl|my_center|LOCUS_27190 3283 3801 gene locus_tag LOCUS_27200 3283 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 3798 4157 gene locus_tag LOCUS_27210 3798 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 >Feature sequence276 544 1116 gene locus_tag LOCUS_27220 544 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 1174 2400 gene locus_tag LOCUS_27230 1174 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 2425 3627 gene locus_tag LOCUS_27240 2425 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence277 499 762 gene locus_tag LOCUS_27250 499 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 749 1498 gene locus_tag LOCUS_27260 749 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 1988 1488 gene locus_tag LOCUS_27270 1988 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 3484 1985 gene locus_tag LOCUS_27280 gene accC 3484 1985 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107789.1 protein_id gnl|my_center|LOCUS_27280 <4236 3490 gene locus_tag LOCUS_27290 <4236 3490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005800651.1:acyl-CoA carboxylase subunit beta >Feature sequence278 1349 1110 gene locus_tag LOCUS_27300 1349 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3539 2154 gene locus_tag LOCUS_27310 3539 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence279 2265 841 gene locus_tag LOCUS_27320 2265 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 3292 2417 gene locus_tag LOCUS_27330 3292 2417 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941786.1 protein_id gnl|my_center|LOCUS_27330 3410 4153 gene locus_tag LOCUS_27340 3410 4153 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence280 640 2259 gene locus_tag LOCUS_27350 640 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2256 3647 gene locus_tag LOCUS_27360 2256 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence281 712 62 gene locus_tag LOCUS_27370 712 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 1026 712 gene locus_tag LOCUS_27380 1026 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 1317 1120 gene locus_tag LOCUS_27390 1317 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 1863 1378 gene locus_tag LOCUS_27400 1863 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 2203 1931 gene locus_tag LOCUS_27410 2203 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 <4193 2181 gene locus_tag LOCUS_27420 <4193 2181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769973.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase >Feature sequence282 589 158 gene locus_tag LOCUS_27430 589 158 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946364.1 protein_id gnl|my_center|LOCUS_27430 <4191 688 gene locus_tag LOCUS_27440 <4191 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:PilC/PilY family type IV pilus protein >Feature sequence283 <1 1131 gene locus_tag LOCUS_27450 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118084.1:group II intron reverse transcriptase/maturase 1124 1465 gene locus_tag LOCUS_27460 1124 1465 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144028.1 protein_id gnl|my_center|LOCUS_27460 1476 1868 gene locus_tag LOCUS_27470 1476 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 1861 2403 gene locus_tag LOCUS_27480 1861 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 2514 2780 gene locus_tag LOCUS_27490 2514 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 2770 3927 gene locus_tag LOCUS_27500 2770 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 >Feature sequence284 <1 3514 gene locus_tag LOCUS_27510 <1 3514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205034.1:YadA-like family protein 3713 3549 gene locus_tag LOCUS_27520 3713 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence285 2076 1303 gene locus_tag LOCUS_27530 2076 1303 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479696.1 protein_id gnl|my_center|LOCUS_27530 2905 2069 gene locus_tag LOCUS_27540 2905 2069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209343.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence286 1201 545 gene locus_tag LOCUS_27550 1201 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1307 1798 gene locus_tag LOCUS_27560 1307 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 1795 2517 gene locus_tag LOCUS_27570 1795 2517 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267336.1 protein_id gnl|my_center|LOCUS_27570 2939 2523 gene locus_tag LOCUS_27580 2939 2523 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927170.1 protein_id gnl|my_center|LOCUS_27580 3771 2980 gene locus_tag LOCUS_27590 3771 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27590 >Feature sequence287 704 486 gene locus_tag LOCUS_27600 704 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1367 708 gene locus_tag LOCUS_27610 1367 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 1651 1364 gene locus_tag LOCUS_27620 1651 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 2247 1876 gene locus_tag LOCUS_27630 2247 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 2533 2204 gene locus_tag LOCUS_27640 2533 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 2844 2533 gene locus_tag LOCUS_27650 2844 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 3135 2851 gene locus_tag LOCUS_27660 3135 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 3352 3128 gene locus_tag LOCUS_27670 3352 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3806 3384 gene locus_tag LOCUS_27680 3806 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 3979 3794 gene locus_tag LOCUS_27690 3979 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence288 229 20 gene locus_tag LOCUS_27700 229 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 449 1111 gene locus_tag LOCUS_27710 449 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 1284 1424 gene locus_tag LOCUS_27720 1284 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 1678 2079 gene locus_tag LOCUS_27730 1678 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 3323 2946 gene locus_tag LOCUS_27740 3323 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 >Feature sequence289 1822 1031 gene locus_tag LOCUS_27750 gene imuA 1822 1031 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040022.1 protein_id gnl|my_center|LOCUS_27750 2855 2052 gene locus_tag LOCUS_27760 2855 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 4036 2867 gene locus_tag LOCUS_27770 4036 2867 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724359.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence290 2160 1405 gene locus_tag LOCUS_27780 2160 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2534 2157 gene locus_tag LOCUS_27790 2534 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 3503 2574 gene locus_tag LOCUS_27800 3503 2574 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_27800 >Feature sequence291 4032 3181 gene locus_tag LOCUS_27810 4032 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 >Feature sequence292 <1 1540 gene locus_tag LOCUS_27820 <1 1540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030248.1:alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase 1566 3353 gene locus_tag LOCUS_27830 gene treS 1566 3353 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973556.1 protein_id gnl|my_center|LOCUS_27830 3672 3597 gene locus_tag LOCUS_t01270 3672 3597 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence293 309 1844 gene locus_tag LOCUS_27840 309 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615582.1 protein_id gnl|my_center|LOCUS_27840 1874 2587 gene locus_tag LOCUS_27850 1874 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 2671 3417 gene locus_tag LOCUS_27860 2671 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence294 162 1226 gene locus_tag LOCUS_27870 162 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 1404 2258 gene locus_tag LOCUS_27880 gene rpoH 1404 2258 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704351.1 protein_id gnl|my_center|LOCUS_27880 3412 2519 gene locus_tag LOCUS_27890 gene cyoE 3412 2519 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946161.1 protein_id gnl|my_center|LOCUS_27890 <4018 3409 gene locus_tag LOCUS_27900 <4018 3409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115033.1:COX15/CtaA family protein >Feature sequence295 <1 681 gene locus_tag LOCUS_27910 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583612.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 756 1412 gene locus_tag LOCUS_27920 756 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 1430 1810 gene locus_tag LOCUS_27930 1430 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 2050 2607 gene locus_tag LOCUS_27940 2050 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 2609 3682 gene locus_tag LOCUS_27950 2609 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence296 2093 1002 gene locus_tag LOCUS_27960 2093 1002 CDS product GumC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930608.1 protein_id gnl|my_center|LOCUS_27960 3236 2100 gene locus_tag LOCUS_27970 3236 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 3438 3968 gene locus_tag LOCUS_27980 3438 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence297 3338 1755 gene locus_tag LOCUS_27990 3338 1755 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626412.1 protein_id gnl|my_center|LOCUS_27990 3543 3319 gene locus_tag LOCUS_28000 3543 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence298 2671 1451 gene locus_tag LOCUS_28010 2671 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 3781 2681 gene locus_tag LOCUS_28020 3781 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 >Feature sequence299 292 1422 gene locus_tag LOCUS_28030 292 1422 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_28030 1512 1441 gene locus_tag LOCUS_t01280 1512 1441 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2212 1565 gene locus_tag LOCUS_28040 gene fabR 2212 1565 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308043.1 protein_id gnl|my_center|LOCUS_28040 2341 3513 gene locus_tag LOCUS_28050 2341 3513 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080953.1 protein_id gnl|my_center|LOCUS_28050 >Feature sequence300 3064 938 gene locus_tag LOCUS_28060 gene scpA 3064 938 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_28060 <3998 3066 gene locus_tag LOCUS_28070 <3998 3066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203449.1:methylmalonyl-CoA mutase small subunit >Feature sequence301 1678 638 gene locus_tag LOCUS_28080 1678 638 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444878.1 protein_id gnl|my_center|LOCUS_28080 2049 1675 gene locus_tag LOCUS_28090 2049 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 2676 2083 gene locus_tag LOCUS_28100 2676 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 3641 3027 gene locus_tag LOCUS_28110 3641 3027 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958173.1 protein_id gnl|my_center|LOCUS_28110 >Feature sequence302 1561 2259 gene locus_tag LOCUS_28120 1561 2259 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986980.1 protein_id gnl|my_center|LOCUS_28120 2249 2461 gene locus_tag LOCUS_28130 2249 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 2458 3414 gene locus_tag LOCUS_28140 2458 3414 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965618.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence303 1322 396 gene locus_tag LOCUS_28150 1322 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 2392 1439 gene locus_tag LOCUS_28160 2392 1439 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_28160 3038 2478 gene locus_tag LOCUS_28170 gene efp 3038 2478 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence304 <1 826 gene locus_tag LOCUS_28180 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001829473.1:succinate--CoA ligase subunit alpha 883 1317 gene locus_tag LOCUS_28190 gene ndk 883 1317 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020029.1 protein_id gnl|my_center|LOCUS_28190 1434 1769 gene locus_tag LOCUS_28200 1434 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 1750 2187 gene locus_tag LOCUS_28210 gene hemJ 1750 2187 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120291.1 protein_id gnl|my_center|LOCUS_28210 2193 3200 gene locus_tag LOCUS_28220 gene hemH 2193 3200 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957341.1 protein_id gnl|my_center|LOCUS_28220 <3959 3197 gene locus_tag LOCUS_28230 <3959 3197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258456.1:uroporphyrinogen decarboxylase >Feature sequence305 76 468 gene locus_tag LOCUS_28240 76 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 1880 426 gene locus_tag LOCUS_28250 gene zwf 1880 426 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335201.1 protein_id gnl|my_center|LOCUS_28250 2803 2015 gene locus_tag LOCUS_28260 2803 2015 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525325.1 protein_id gnl|my_center|LOCUS_28260 2875 3612 gene locus_tag LOCUS_28270 2875 3612 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973577.1 protein_id gnl|my_center|LOCUS_28270 >Feature sequence306 2224 1124 gene locus_tag LOCUS_28280 gene ribD 2224 1124 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_28280 2673 2281 gene locus_tag LOCUS_28290 2673 2281 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876264.1 protein_id gnl|my_center|LOCUS_28290 2898 2680 gene locus_tag LOCUS_28300 2898 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 3395 2940 gene locus_tag LOCUS_28310 gene nrdR 3395 2940 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_28310 3949 3491 gene locus_tag LOCUS_28320 3949 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence307 2398 1592 gene locus_tag LOCUS_28330 2398 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 2735 2583 gene locus_tag LOCUS_28340 2735 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 2945 2745 gene locus_tag LOCUS_28350 2945 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence308 378 1196 gene locus_tag LOCUS_28360 378 1196 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_28360 2025 1189 gene locus_tag LOCUS_28370 2025 1189 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_28370 2255 3385 gene locus_tag LOCUS_28380 2255 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 <3939 3387 gene locus_tag LOCUS_28390 <3939 3387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444002.1:alpha/beta hydrolase >Feature sequence309 512 27 gene locus_tag LOCUS_28400 512 27 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769725.1 protein_id gnl|my_center|LOCUS_28400 1412 549 gene locus_tag LOCUS_28410 1412 549 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_28410 1873 1472 gene locus_tag LOCUS_28420 gene msrB 1873 1472 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943090.1 protein_id gnl|my_center|LOCUS_28420 1988 3841 gene locus_tag LOCUS_28430 1988 3841 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence310 395 467 gene locus_tag LOCUS_t01290 395 467 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 844 1017 gene locus_tag LOCUS_28440 844 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 1014 1211 gene locus_tag LOCUS_28450 1014 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1192 1986 gene locus_tag LOCUS_28460 1192 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 2728 2024 gene locus_tag LOCUS_28470 2728 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 2931 2713 gene locus_tag LOCUS_28480 2931 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3154 2957 gene locus_tag LOCUS_28490 3154 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence311 139 954 gene locus_tag LOCUS_28500 139 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 951 1184 gene locus_tag LOCUS_28510 951 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 1866 1177 gene locus_tag LOCUS_28520 1866 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 1942 2430 gene locus_tag LOCUS_28530 1942 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 2503 3222 gene locus_tag LOCUS_28540 2503 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 3227 3634 gene locus_tag LOCUS_28550 3227 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence312 89 2095 gene locus_tag LOCUS_28560 89 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 2067 2471 gene locus_tag LOCUS_28570 2067 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2511 2978 gene locus_tag LOCUS_28580 2511 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 2980 3462 gene locus_tag LOCUS_28590 2980 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence313 783 1001 gene locus_tag LOCUS_28600 783 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 1049 2266 gene locus_tag LOCUS_28610 gene pncB 1049 2266 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203338.1 protein_id gnl|my_center|LOCUS_28610 2307 2729 gene locus_tag LOCUS_28620 2307 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 2710 3372 gene locus_tag LOCUS_28630 2710 3372 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096593.1 protein_id gnl|my_center|LOCUS_28630 >Feature sequence314 70 417 gene locus_tag LOCUS_28640 70 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 1939 473 gene locus_tag LOCUS_28650 gene gatA 1939 473 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_28650 2226 1942 gene locus_tag LOCUS_28660 gene gatC 2226 1942 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722233.1 protein_id gnl|my_center|LOCUS_28660 >Feature sequence315 2013 133 gene locus_tag LOCUS_28670 gene mrdA 2013 133 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_28670 2506 2003 gene locus_tag LOCUS_28680 2506 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 3357 2503 gene locus_tag LOCUS_28690 gene mreC 3357 2503 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228502.1 protein_id gnl|my_center|LOCUS_28690 <3909 3361 gene locus_tag LOCUS_28700 <3909 3361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942731.1:rod shape-determining protein >Feature sequence316 292 1377 gene locus_tag LOCUS_28710 292 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence317 191 1195 gene locus_tag LOCUS_28720 191 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 1188 1439 gene locus_tag LOCUS_28730 1188 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence318 265 756 gene locus_tag LOCUS_28740 265 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 746 1069 gene locus_tag LOCUS_28750 746 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 1066 1296 gene locus_tag LOCUS_28760 1066 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 1296 1595 gene locus_tag LOCUS_28770 1296 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 1680 3434 gene locus_tag LOCUS_28780 1680 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence319 1137 538 gene locus_tag LOCUS_28790 1137 538 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_28790 1232 2113 gene locus_tag LOCUS_28800 1232 2113 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460655.1 protein_id gnl|my_center|LOCUS_28800 2560 2105 gene locus_tag LOCUS_28810 gene rimI 2560 2105 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_28810 3824 2550 gene locus_tag LOCUS_28820 3824 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence320 1959 1330 gene locus_tag LOCUS_28830 1959 1330 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976086.1 protein_id gnl|my_center|LOCUS_28830 2979 2038 gene locus_tag LOCUS_28840 2979 2038 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214826.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence321 309 773 gene locus_tag LOCUS_28850 309 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 773 988 gene locus_tag LOCUS_28860 773 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 1117 1284 gene locus_tag LOCUS_28870 1117 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1355 1687 gene locus_tag LOCUS_28880 1355 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 1688 1936 gene locus_tag LOCUS_28890 1688 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 1939 2952 gene locus_tag LOCUS_28900 1939 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 2949 3248 gene locus_tag LOCUS_28910 2949 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 3257 3628 gene locus_tag LOCUS_28920 3257 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 >Feature sequence322 2019 814 gene locus_tag LOCUS_28930 2019 814 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252963.1 protein_id gnl|my_center|LOCUS_28930 2963 2016 gene locus_tag LOCUS_28940 2963 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence323 3394 2543 gene locus_tag LOCUS_28950 3394 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence324 666 1487 gene locus_tag LOCUS_28960 666 1487 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088380.1 protein_id gnl|my_center|LOCUS_28960 1602 2123 gene locus_tag LOCUS_28970 1602 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 <3815 2366 gene locus_tag LOCUS_28980 <3815 2366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921767.1:protein translocase subunit SecD >Feature sequence325 2217 544 gene locus_tag LOCUS_28990 gene glpA 2217 544 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857238.1 protein_id gnl|my_center|LOCUS_28990 2294 2551 gene locus_tag LOCUS_29000 2294 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 2536 3732 gene locus_tag LOCUS_29010 2536 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence326 616 146 gene locus_tag LOCUS_29020 gene rpsG 616 146 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_29020 999 628 gene locus_tag LOCUS_29030 gene rpsL 999 628 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393942.1 protein_id gnl|my_center|LOCUS_29030 <3788 1131 gene locus_tag LOCUS_29040 <3788 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943492.1:DNA-directed RNA polymerase subunit beta' >Feature sequence327 <1 2232 gene locus_tag LOCUS_29050 <1 2232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401734.1:(Fe-S)-binding protein 2204 3259 gene locus_tag LOCUS_29060 2204 3259 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222262.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence328 90 1505 gene locus_tag LOCUS_29070 gene cysS 90 1505 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_29070 1560 1886 gene locus_tag LOCUS_29080 1560 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 1876 3366 gene locus_tag LOCUS_29090 1876 3366 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908534.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence329 433 104 gene locus_tag LOCUS_29100 433 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 611 393 gene locus_tag LOCUS_29110 611 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 1522 647 gene locus_tag LOCUS_29120 1522 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 2052 1579 gene locus_tag LOCUS_29130 2052 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 2309 2103 gene locus_tag LOCUS_29140 2309 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 2895 2311 gene locus_tag LOCUS_29150 2895 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 3055 2876 gene locus_tag LOCUS_29160 3055 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 3397 3092 gene locus_tag LOCUS_29170 3397 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence330 <1 535 gene locus_tag LOCUS_29180 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259329.1:molybdopterin-synthase adenylyltransferase MoeB 631 1173 gene locus_tag LOCUS_29190 gene ahpA 631 1173 CDS product biofilm-specific peroxidase AhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245371.1 protein_id gnl|my_center|LOCUS_29190 1542 1222 gene locus_tag LOCUS_29200 1542 1222 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_29200 1683 2768 gene locus_tag LOCUS_29210 gene mqnE 1683 2768 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_29210 2778 3605 gene locus_tag LOCUS_29220 2778 3605 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930369.1 protein_id gnl|my_center|LOCUS_29220 3703 3776 gene locus_tag LOCUS_t01300 3703 3776 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence331 <1 513 gene locus_tag LOCUS_29230 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392090.1:NAD+ synthase 510 1193 gene locus_tag LOCUS_29240 gene rsmI 510 1193 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_29240 2181 1162 gene locus_tag LOCUS_29250 2181 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 2307 2813 gene locus_tag LOCUS_29260 gene rimP 2307 2813 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence332 428 895 gene locus_tag LOCUS_29270 428 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 2641 926 gene locus_tag LOCUS_29280 2641 926 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_29280 2843 2634 gene locus_tag LOCUS_29290 2843 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 <3752 2840 gene locus_tag LOCUS_29300 <3752 2840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064242829.1:monovalent cation/H+ antiporter subunit D family protein >Feature sequence333 <1 1619 gene locus_tag LOCUS_29310 <1 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943493.1:DNA-directed RNA polymerase subunit beta >Feature sequence334 300 860 gene locus_tag LOCUS_29320 300 860 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_29320 1026 2102 gene locus_tag LOCUS_29330 gene noc 1026 2102 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476458.1 protein_id gnl|my_center|LOCUS_29330 2480 2139 gene locus_tag LOCUS_29340 2480 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence335 <1 637 gene locus_tag LOCUS_29350 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393165.1:thiazole synthase 759 1772 gene locus_tag LOCUS_29360 gene thiH 759 1772 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210678.1 protein_id gnl|my_center|LOCUS_29360 1827 3704 gene locus_tag LOCUS_29370 gene thiC 1827 3704 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105255.1 protein_id gnl|my_center|LOCUS_29370 >Feature sequence336 <1 633 gene locus_tag LOCUS_29380 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002119889.1:benzoate 1,2-dioxygenase large subunit 732 1223 gene locus_tag LOCUS_29390 gene benB 732 1223 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206213.1 protein_id gnl|my_center|LOCUS_29390 1305 2651 gene locus_tag LOCUS_29400 gene benA 1305 2651 CDS product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119889.1 protein_id gnl|my_center|LOCUS_29400 2691 3185 gene locus_tag LOCUS_29410 gene benB 2691 3185 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190416.1 protein_id gnl|my_center|LOCUS_29410 >Feature sequence337 2603 564 gene locus_tag LOCUS_29420 2603 564 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428541.1 protein_id gnl|my_center|LOCUS_29420 >Feature sequence338 2936 1410 gene locus_tag LOCUS_29430 2936 1410 CDS product IS66-like element ISPsy5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409202.1 protein_id gnl|my_center|LOCUS_29430 3369 3019 gene locus_tag LOCUS_29440 gene tnpB 3369 3019 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence339 <1 1122 gene locus_tag LOCUS_29450 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_171602985.1:adenylate/guanylate cyclase domain-containing protein 2354 1407 gene locus_tag LOCUS_29460 2354 1407 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391305.1 protein_id gnl|my_center|LOCUS_29460 2657 3358 gene locus_tag LOCUS_29470 2657 3358 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528184.1 protein_id gnl|my_center|LOCUS_29470 >Feature sequence340 <1 1046 gene locus_tag LOCUS_29480 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:choice-of-anchor Q domain-containing protein 1156 3102 gene locus_tag LOCUS_29490 1156 3102 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839960.1 protein_id gnl|my_center|LOCUS_29490 >Feature sequence341 8 349 gene locus_tag LOCUS_29500 8 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 780 370 gene locus_tag LOCUS_29510 780 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 1022 780 gene locus_tag LOCUS_29520 1022 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 1315 1022 gene locus_tag LOCUS_29530 1315 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 1399 2058 gene locus_tag LOCUS_29540 1399 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2055 3188 gene locus_tag LOCUS_29550 2055 3188 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_29550 >Feature sequence342 1528 2634 gene locus_tag LOCUS_29560 gene rlmD 1528 2634 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 protein_id gnl|my_center|LOCUS_29560 2849 2694 gene locus_tag LOCUS_29570 2849 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 <3647 3110 gene locus_tag LOCUS_29580 <3647 3110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142387.1:saccharopine dehydrogenase NADP-binding domain-containing protein >Feature sequence343 722 564 gene locus_tag LOCUS_29590 722 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 1303 719 gene locus_tag LOCUS_29600 1303 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 1863 1300 gene locus_tag LOCUS_29610 1863 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 <3643 1860 gene locus_tag LOCUS_29620 <3643 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257612.1:glycosyltransferase >Feature sequence344 1559 2647 gene locus_tag LOCUS_29630 1559 2647 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049592283.1 protein_id gnl|my_center|LOCUS_29630 3584 2931 gene locus_tag LOCUS_29640 3584 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 >Feature sequence345 1264 332 gene locus_tag LOCUS_29650 1264 332 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256314.1 protein_id gnl|my_center|LOCUS_29650 2055 1273 gene locus_tag LOCUS_29660 2055 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3059 2265 gene locus_tag LOCUS_29670 3059 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence346 <1 530 gene locus_tag LOCUS_29680 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582642.1:alanine/ornithine racemase family PLP-dependent enzyme 575 1258 gene locus_tag LOCUS_29690 575 1258 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392755.1 protein_id gnl|my_center|LOCUS_29690 1255 1572 gene locus_tag LOCUS_29700 1255 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 1586 1882 gene locus_tag LOCUS_29710 1586 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 1995 2876 gene locus_tag LOCUS_29720 1995 2876 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence347 285 3365 gene locus_tag LOCUS_29730 285 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 >Feature sequence348 985 125 gene locus_tag LOCUS_29740 985 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 1381 1016 gene locus_tag LOCUS_29750 1381 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 1519 1878 gene locus_tag LOCUS_29760 1519 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 1862 2842 gene locus_tag LOCUS_29770 1862 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 2835 3476 gene locus_tag LOCUS_29780 2835 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 >Feature sequence349 1450 473 gene locus_tag LOCUS_29790 1450 473 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209769.1 protein_id gnl|my_center|LOCUS_29790 3254 1617 gene locus_tag LOCUS_29800 3254 1617 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113330.1 protein_id gnl|my_center|LOCUS_29800 >Feature sequence350 1324 569 gene locus_tag LOCUS_29810 1324 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 2041 1871 gene locus_tag LOCUS_29820 2041 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 2796 2407 gene locus_tag LOCUS_29830 2796 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 >Feature sequence351 336 956 gene locus_tag LOCUS_29840 gene folE 336 956 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_29840 1658 945 gene locus_tag LOCUS_29850 1658 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 1677 2597 gene locus_tag LOCUS_29860 gene xerD 1677 2597 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792251.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence352 122 742 gene locus_tag LOCUS_29870 122 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29870 777 1865 gene locus_tag LOCUS_29880 777 1865 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_29880 1961 2806 gene locus_tag LOCUS_29890 1961 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 3183 2947 gene locus_tag LOCUS_29900 3183 2947 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_29900 >Feature sequence353 2476 218 gene locus_tag LOCUS_29910 2476 218 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140631.1 protein_id gnl|my_center|LOCUS_29910 2866 2480 gene locus_tag LOCUS_29920 2866 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence354 1315 68 gene locus_tag LOCUS_29930 1315 68 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666936.1 protein_id gnl|my_center|LOCUS_29930 1629 2354 gene locus_tag LOCUS_29940 1629 2354 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_29940 2344 2805 gene locus_tag LOCUS_29950 2344 2805 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence355 1869 1396 gene locus_tag LOCUS_29960 1869 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 3075 1999 gene locus_tag LOCUS_29970 3075 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 3266 3400 gene locus_tag LOCUS_29980 3266 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 >Feature sequence356 2956 2579 gene locus_tag LOCUS_29990 gene rplL 2956 2579 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198366.1 protein_id gnl|my_center|LOCUS_29990 >Feature sequence357 1892 2098 gene locus_tag LOCUS_30000 gene rpoZ 1892 2098 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942877.1 protein_id gnl|my_center|LOCUS_30000 2948 2184 gene locus_tag LOCUS_30010 2948 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence358 2712 1957 gene locus_tag LOCUS_30020 2712 1957 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224844.1 protein_id gnl|my_center|LOCUS_30020 <3497 2754 gene locus_tag LOCUS_30030 <3497 2754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099797673.1:penicillin-binding protein 1A >Feature sequence359 <1 1404 gene locus_tag LOCUS_30040 <1 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082541.1:recombinase family protein 1638 2594 gene locus_tag LOCUS_30050 gene pip 1638 2594 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_30050 3192 3103 gene locus_tag LOCUS_t01310 3192 3103 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence360 452 279 gene locus_tag LOCUS_30060 452 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 628 449 gene locus_tag LOCUS_30070 628 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 1099 629 gene locus_tag LOCUS_30080 1099 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30080 1340 1167 gene locus_tag LOCUS_30090 1340 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 1744 1337 gene locus_tag LOCUS_30100 1744 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 2441 1767 gene locus_tag LOCUS_30110 gene mnoR 2441 1767 CDS product two-component system response regulator MnoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897657.1 protein_id gnl|my_center|LOCUS_30110 <3490 2438 gene locus_tag LOCUS_30120 <3490 2438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731147.1:two-component system sensor histidine kinase MnoS >Feature sequence361 <1 955 gene locus_tag LOCUS_30130 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208443.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ 991 1941 gene locus_tag LOCUS_30140 991 1941 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_30140 2068 2985 gene locus_tag LOCUS_30150 gene glyQ 2068 2985 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002044989.1 protein_id gnl|my_center|LOCUS_30150 >Feature sequence362 1411 233 gene locus_tag LOCUS_30160 1411 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 2608 1427 gene locus_tag LOCUS_30170 2608 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 2981 2894 gene locus_tag LOCUS_t01320 2981 2894 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence363 333 420 gene locus_tag LOCUS_t01330 333 420 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 717 1841 gene locus_tag LOCUS_30180 gene tyrS 717 1841 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881135.1 protein_id gnl|my_center|LOCUS_30180 2881 1838 gene locus_tag LOCUS_30190 2881 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence364 125 649 gene locus_tag LOCUS_30200 125 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 717 1283 gene locus_tag LOCUS_30210 717 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 1252 1800 gene locus_tag LOCUS_30220 1252 1800 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204889.1 protein_id gnl|my_center|LOCUS_30220 1797 2303 gene locus_tag LOCUS_30230 1797 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 2300 3025 gene locus_tag LOCUS_30240 2300 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 3029 3235 gene locus_tag LOCUS_30250 3029 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence365 283 765 gene locus_tag LOCUS_30260 283 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 804 1229 gene locus_tag LOCUS_30270 804 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 1233 1415 gene locus_tag LOCUS_30280 1233 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 1417 1668 gene locus_tag LOCUS_30290 1417 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 1670 1906 gene locus_tag LOCUS_30300 1670 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 1903 2445 gene locus_tag LOCUS_30310 1903 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 2449 2784 gene locus_tag LOCUS_30320 2449 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 2777 3004 gene locus_tag LOCUS_30330 2777 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 >Feature sequence366 839 39 gene locus_tag LOCUS_30340 839 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 1498 845 gene locus_tag LOCUS_30350 1498 845 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549852.1 protein_id gnl|my_center|LOCUS_30350 1649 2353 gene locus_tag LOCUS_30360 1649 2353 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_30360 2429 3124 gene locus_tag LOCUS_30370 2429 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3233 3306 gene locus_tag LOCUS_t01340 3233 3306 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence367 208 576 gene locus_tag LOCUS_30380 208 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 922 1368 gene locus_tag LOCUS_30390 922 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 1600 2424 gene locus_tag LOCUS_30400 1600 2424 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_30400 2591 2457 gene locus_tag LOCUS_30410 2591 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 >Feature sequence368 77 1153 gene locus_tag LOCUS_30420 77 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 1755 1225 gene locus_tag LOCUS_30430 1755 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 3079 1757 gene locus_tag LOCUS_30440 3079 1757 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211158.1 protein_id gnl|my_center|LOCUS_30440 >Feature sequence369 734 1033 gene locus_tag LOCUS_30450 734 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 1054 2709 gene locus_tag LOCUS_30460 1054 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 2785 3291 gene locus_tag LOCUS_30470 2785 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence370 738 46 gene locus_tag LOCUS_30480 gene rplA 738 46 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832314.1 protein_id gnl|my_center|LOCUS_30480 1173 742 gene locus_tag LOCUS_30490 gene rplK 1173 742 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940184.1 protein_id gnl|my_center|LOCUS_30490 1711 1175 gene locus_tag LOCUS_30500 gene nusG 1711 1175 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_30500 2101 1724 gene locus_tag LOCUS_30510 2101 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 2200 2127 gene locus_tag LOCUS_t01350 2200 2127 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3415 2225 gene locus_tag LOCUS_30520 gene tuf 3415 2225 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_30520 >Feature sequence371 430 2196 gene locus_tag LOCUS_30530 430 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 >Feature sequence372 >Feature sequence373 <1 984 gene locus_tag LOCUS_30540 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099262600.1:GGDEF domain-containing protein 2594 981 gene locus_tag LOCUS_30550 2594 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence374 424 1152 gene locus_tag LOCUS_30560 424 1152 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815414.1 protein_id gnl|my_center|LOCUS_30560 1251 1628 gene locus_tag LOCUS_30570 1251 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 1678 2610 gene locus_tag LOCUS_30580 1678 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence375 <1 522 gene locus_tag LOCUS_30590 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529209.1:5-(carboxyamino)imidazole ribonucleotide mutase 550 1626 gene locus_tag LOCUS_30600 550 1626 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089852.1 protein_id gnl|my_center|LOCUS_30600 2299 1640 gene locus_tag LOCUS_30610 2299 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 2695 2333 gene locus_tag LOCUS_30620 2695 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3390 2737 gene locus_tag LOCUS_30630 gene fsa 3390 2737 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067139.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence376 796 485 gene locus_tag LOCUS_30640 796 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 996 2258 gene locus_tag LOCUS_30650 996 2258 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_30650 >Feature sequence377 1301 1669 gene locus_tag LOCUS_30660 1301 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 2044 2415 gene locus_tag LOCUS_30670 2044 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 3131 2475 gene locus_tag LOCUS_30680 3131 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence378 1053 598 gene locus_tag LOCUS_30690 1053 598 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_30690 1454 1281 gene locus_tag LOCUS_30700 1454 1281 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868015.1 protein_id gnl|my_center|LOCUS_30700 2598 1690 gene locus_tag LOCUS_30710 2598 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 <3351 2782 gene locus_tag LOCUS_30720 <3351 2782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033534649.1:DNA-deoxyinosine glycosylase >Feature sequence379 >Feature sequence380 <1 912 gene locus_tag LOCUS_30730 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014876667.1:acyl-CoA dehydrogenase family protein 2025 952 gene locus_tag LOCUS_30740 gene bioB 2025 952 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199838974.1 protein_id gnl|my_center|LOCUS_30740 2752 2087 gene locus_tag LOCUS_30750 2752 2087 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726863.1 protein_id gnl|my_center|LOCUS_30750 >Feature sequence381 1541 2344 gene locus_tag LOCUS_30760 1541 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence382 <1 1896 gene locus_tag LOCUS_30770 <1 1896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531829.1:DNA gyrase subunit A 2589 1957 gene locus_tag LOCUS_30780 2589 1957 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529595.1 protein_id gnl|my_center|LOCUS_30780 2714 3226 gene locus_tag LOCUS_30790 gene coaD 2714 3226 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919455.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence383 719 234 gene locus_tag LOCUS_30800 719 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 1915 716 gene locus_tag LOCUS_30810 1915 716 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080633.1 protein_id gnl|my_center|LOCUS_30810 2401 1928 gene locus_tag LOCUS_30820 2401 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 2676 2398 gene locus_tag LOCUS_30830 2676 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence384 417 262 gene locus_tag LOCUS_30840 417 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 1405 431 gene locus_tag LOCUS_30850 1405 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 2001 1459 gene locus_tag LOCUS_30860 2001 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 2553 2014 gene locus_tag LOCUS_30870 2553 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 <3293 2564 gene locus_tag LOCUS_30880 <3293 2564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144086.1:phage tail sheath subtilisin-like domain-containing protein >Feature sequence385 2797 32 gene locus_tag LOCUS_30890 2797 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 >Feature sequence386 1 918 gene locus_tag LOCUS_30900 1 918 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_30900 918 2336 gene locus_tag LOCUS_30910 918 2336 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_30910 3036 2329 gene locus_tag LOCUS_30920 3036 2329 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942543.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence387 2053 2904 gene locus_tag LOCUS_30930 2053 2904 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921324.1 protein_id gnl|my_center|LOCUS_30930 >Feature sequence388 215 63 gene locus_tag LOCUS_30940 215 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 440 2113 gene locus_tag LOCUS_30950 440 2113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928959.1 protein_id gnl|my_center|LOCUS_30950 2097 2975 gene locus_tag LOCUS_30960 2097 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 >Feature sequence389 3 701 gene locus_tag LOCUS_30970 3 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 698 1645 gene locus_tag LOCUS_30980 gene nuoH 698 1645 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_30980 1653 2174 gene locus_tag LOCUS_30990 gene nuoI 1653 2174 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405112.1 protein_id gnl|my_center|LOCUS_30990 2171 2653 gene locus_tag LOCUS_31000 2171 2653 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944043.1 protein_id gnl|my_center|LOCUS_31000 2650 2964 gene locus_tag LOCUS_31010 gene nuoK 2650 2964 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159229.1 protein_id gnl|my_center|LOCUS_31010 >Feature sequence390 1117 410 gene locus_tag LOCUS_31020 1117 410 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614886.1 protein_id gnl|my_center|LOCUS_31020 1474 1136 gene locus_tag LOCUS_31030 1474 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 2004 1471 gene locus_tag LOCUS_31040 2004 1471 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_31040 2450 2001 gene locus_tag LOCUS_31050 2450 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 2887 2447 gene locus_tag LOCUS_31060 2887 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 >Feature sequence391 1143 280 gene locus_tag LOCUS_31070 gene galU 1143 280 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_31070 2207 1149 gene locus_tag LOCUS_31080 2207 1149 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095359.1 protein_id gnl|my_center|LOCUS_31080 2310 2897 gene locus_tag LOCUS_31090 2310 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 >Feature sequence392 3167 2958 gene locus_tag LOCUS_31100 3167 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 >Feature sequence393 2674 827 gene locus_tag LOCUS_31110 2674 827 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895630.1 protein_id gnl|my_center|LOCUS_31110 3079 2705 gene locus_tag LOCUS_31120 3079 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence394 491 1246 gene locus_tag LOCUS_31130 491 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 >Feature sequence395 765 61 gene locus_tag LOCUS_31140 gene ispD 765 61 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_31140 1444 947 gene locus_tag LOCUS_31150 1444 947 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_31150 1817 1890 gene locus_tag LOCUS_t01360 1817 1890 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2649 2323 gene locus_tag LOCUS_31160 2649 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 3007 2678 gene locus_tag LOCUS_31170 3007 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 >Feature sequence396 544 383 gene locus_tag LOCUS_31180 544 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 926 537 gene locus_tag LOCUS_31190 926 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 1003 1251 gene locus_tag LOCUS_31200 1003 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 1353 1637 gene locus_tag LOCUS_31210 1353 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 1956 1621 gene locus_tag LOCUS_31220 1956 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 <3084 2190 gene locus_tag LOCUS_31230 <3084 2190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964169.1:NAD(+) synthase >Feature sequence397 >Feature sequence398 <3066 319 gene locus_tag LOCUS_31240 <3066 319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706761.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence399 <1 566 gene locus_tag LOCUS_31250 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398810.1:citrate synthase 650 2344 gene locus_tag LOCUS_31260 650 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 >Feature sequence400 720 1475 gene locus_tag LOCUS_31270 720 1475 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_31270 1494 1982 gene locus_tag LOCUS_31280 gene ruvC 1494 1982 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_31280 2012 2629 gene locus_tag LOCUS_31290 gene ruvA 2012 2629 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_31290 >Feature sequence401 840 1895 gene locus_tag LOCUS_31300 840 1895 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_31300 1892 2815 gene locus_tag LOCUS_31310 1892 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 >Feature sequence402 303 130 gene locus_tag LOCUS_31320 303 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 886 542 gene locus_tag LOCUS_31330 886 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 1273 1410 gene locus_tag LOCUS_31340 1273 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 2138 2491 gene locus_tag LOCUS_31350 2138 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence403 526 888 gene locus_tag LOCUS_31360 526 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 860 1489 gene locus_tag LOCUS_31370 860 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 1792 1493 gene locus_tag LOCUS_31380 1792 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence404 <2994 2478 gene locus_tag LOCUS_31390 <2994 2478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933314.1:leucine--tRNA ligase >Feature sequence405 264 1532 gene locus_tag LOCUS_31400 264 1532 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_31400 1522 2091 gene locus_tag LOCUS_31410 1522 2091 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_31410 <2994 2234 gene locus_tag LOCUS_31420 <2994 2234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869162.1:CaiB/BaiF CoA-transferase family protein >Feature sequence406 92 241 gene locus_tag LOCUS_31430 92 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 284 925 gene locus_tag LOCUS_31440 284 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 1047 1355 gene locus_tag LOCUS_31450 1047 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 1437 2144 gene locus_tag LOCUS_31460 1437 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 2222 2812 gene locus_tag LOCUS_31470 2222 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668752.1 protein_id gnl|my_center|LOCUS_31470 >Feature sequence407 613 1314 gene locus_tag LOCUS_31480 613 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 1316 1954 gene locus_tag LOCUS_31490 1316 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 1955 2614 gene locus_tag LOCUS_31500 1955 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence408 826 263 gene locus_tag LOCUS_31510 826 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 2401 1049 gene locus_tag LOCUS_31520 2401 1049 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258069.1 protein_id gnl|my_center|LOCUS_31520 >Feature sequence409 385 642 gene locus_tag LOCUS_31530 385 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 643 843 gene locus_tag LOCUS_31540 643 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 844 1065 gene locus_tag LOCUS_31550 844 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 1058 1735 gene locus_tag LOCUS_31560 1058 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 1732 1968 gene locus_tag LOCUS_31570 1732 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 1973 2434 gene locus_tag LOCUS_31580 1973 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 2436 2600 gene locus_tag LOCUS_31590 2436 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence410 1730 384 gene locus_tag LOCUS_31600 1730 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 2044 1706 gene locus_tag LOCUS_31610 2044 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 <2976 2028 gene locus_tag LOCUS_31620 <2976 2028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000963128.1:recombinase RecA >Feature sequence411 356 1180 gene locus_tag LOCUS_31630 356 1180 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_31630 >Feature sequence412 409 92 gene locus_tag LOCUS_31640 409 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 907 425 gene locus_tag LOCUS_31650 907 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 2432 918 gene locus_tag LOCUS_31660 2432 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 2875 2435 gene locus_tag LOCUS_31670 2875 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 >Feature sequence413 241 2133 gene locus_tag LOCUS_31680 241 2133 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_31680 >Feature sequence414 899 1846 gene locus_tag LOCUS_31690 gene dmeF 899 1846 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383337.1 protein_id gnl|my_center|LOCUS_31690 1899 2612 gene locus_tag LOCUS_31700 1899 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 >Feature sequence415 <1 750 gene locus_tag LOCUS_31710 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480443.1:3-dehydroquinate synthase 763 1902 gene locus_tag LOCUS_31720 763 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 <2953 1941 gene locus_tag LOCUS_31730 <2953 1941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037738.1:YhdP family protein >Feature sequence416 <1 824 gene locus_tag LOCUS_31740 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481009.1:alanine--glyoxylate aminotransferase family protein 1603 941 gene locus_tag LOCUS_31750 1603 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 1762 1607 gene locus_tag LOCUS_31760 1762 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 2451 1816 gene locus_tag LOCUS_31770 2451 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence417 809 453 gene locus_tag LOCUS_31780 809 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 1915 821 gene locus_tag LOCUS_31790 gene rlmN 1915 821 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_31790 2057 2827 gene locus_tag LOCUS_31800 2057 2827 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085820.1 protein_id gnl|my_center|LOCUS_31800 >Feature sequence418 2417 1410 gene locus_tag LOCUS_31810 2417 1410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385787.1 protein_id gnl|my_center|LOCUS_31810 >Feature sequence419 2252 927 gene locus_tag LOCUS_31820 2252 927 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence420 135 668 gene locus_tag LOCUS_31830 135 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1491 2021 gene locus_tag LOCUS_31840 1491 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 >Feature sequence421 538 182 gene locus_tag LOCUS_31850 538 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 919 542 gene locus_tag LOCUS_31860 919 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 1454 954 gene locus_tag LOCUS_31870 1454 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 1648 1460 gene locus_tag LOCUS_31880 1648 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 2117 1620 gene locus_tag LOCUS_31890 2117 1620 CDS product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_31890 2372 2130 gene locus_tag LOCUS_31900 2372 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence422 <1 1560 gene locus_tag LOCUS_31910 <1 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022778.1:tetratricopeptide repeat protein 1906 2742 gene locus_tag LOCUS_31920 1906 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 >Feature sequence423 769 50 gene locus_tag LOCUS_31930 769 50 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_31930 1495 875 gene locus_tag LOCUS_31940 1495 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 1810 2727 gene locus_tag LOCUS_31950 1810 2727 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_31950 >Feature sequence424 <1 1186 gene locus_tag LOCUS_31960 <1 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986875.1:BatD family protein 1183 1941 gene locus_tag LOCUS_31970 1183 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 2072 1985 gene locus_tag LOCUS_t01370 2072 1985 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2275 2544 gene locus_tag LOCUS_31980 2275 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence425 553 218 gene locus_tag LOCUS_31990 553 218 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140931.1 protein_id gnl|my_center|LOCUS_31990 1592 564 gene locus_tag LOCUS_32000 1592 564 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 protein_id gnl|my_center|LOCUS_32000 >Feature sequence426 1218 2525 gene locus_tag LOCUS_32010 1218 2525 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053435486.1 protein_id gnl|my_center|LOCUS_32010 >Feature sequence427 664 437 gene locus_tag LOCUS_32020 664 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 2559 949 gene locus_tag LOCUS_32030 2559 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 2764 2678 gene locus_tag LOCUS_t01380 2764 2678 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence428 >Feature sequence429 <1 1893 gene locus_tag LOCUS_32040 <1 1893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964576.1:ribonuclease R 1912 2238 gene locus_tag LOCUS_32050 1912 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 2231 2689 gene locus_tag LOCUS_32060 2231 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence430 >Feature sequence431 132 425 gene locus_tag LOCUS_32070 132 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 543 1088 gene locus_tag LOCUS_32080 543 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 >Feature sequence432 54 129 gene locus_tag LOCUS_t01390 54 129 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 179 254 gene locus_tag LOCUS_t01400 179 254 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1433 2110 gene locus_tag LOCUS_32090 1433 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 2723 2799 gene locus_tag LOCUS_t01410 2723 2799 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence433 320 1864 gene locus_tag LOCUS_32100 gene istA 320 1864 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_32100 1876 2622 gene locus_tag LOCUS_32110 gene istB 1876 2622 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_32110 >Feature sequence434 911 1099 gene locus_tag LOCUS_32120 911 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 1133 2134 gene locus_tag LOCUS_32130 1133 2134 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328062.1 protein_id gnl|my_center|LOCUS_32130 >Feature sequence435 943 1125 gene locus_tag LOCUS_32140 943 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 1187 2011 gene locus_tag LOCUS_32150 1187 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 2109 2675 gene locus_tag LOCUS_32160 2109 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 >Feature sequence436 450 214 gene locus_tag LOCUS_32170 450 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 1046 1954 gene locus_tag LOCUS_32180 1046 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 >Feature sequence437 <1 749 gene locus_tag LOCUS_32190 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228360.1:response regulator 1526 780 gene locus_tag LOCUS_32200 1526 780 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_32200 <2755 1557 gene locus_tag LOCUS_32210 <2755 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037468799.1:nodulation protein NfeD >Feature sequence438 1863 511 gene locus_tag LOCUS_32220 1863 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence439 2291 585 gene locus_tag LOCUS_32230 2291 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 >Feature sequence440 >Feature sequence441 2594 231 gene locus_tag LOCUS_32240 2594 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 >Feature sequence442 1167 880 gene locus_tag LOCUS_32250 1167 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 1473 1171 gene locus_tag LOCUS_32260 1473 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 1778 1464 gene locus_tag LOCUS_32270 1778 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 2059 1727 gene locus_tag LOCUS_32280 2059 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 2418 2056 gene locus_tag LOCUS_32290 2418 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 2531 2447 gene locus_tag LOCUS_t01420 2531 2447 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence443 413 1024 gene locus_tag LOCUS_32300 gene hisH 413 1024 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_32300 2302 1046 gene locus_tag LOCUS_32310 gene murA 2302 1046 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_32310 >Feature sequence444 574 350 gene locus_tag LOCUS_32320 574 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 1975 761 gene locus_tag LOCUS_32330 1975 761 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754218.1 protein_id gnl|my_center|LOCUS_32330 2248 2556 gene locus_tag LOCUS_32340 2248 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence445 127 1245 gene locus_tag LOCUS_32350 127 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 1838 1512 gene locus_tag LOCUS_32360 1838 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 2356 1976 gene locus_tag LOCUS_32370 2356 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32370 >Feature sequence446 289 1599 gene locus_tag LOCUS_32380 289 1599 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084112.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence447 109 1419 gene locus_tag LOCUS_32390 gene ugpB 109 1419 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703703.1 protein_id gnl|my_center|LOCUS_32390 1890 2624 gene locus_tag LOCUS_32400 gene ugpA 1890 2624 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529414.1 protein_id gnl|my_center|LOCUS_32400 >Feature sequence448 252 1718 gene locus_tag LOCUS_32410 252 1718 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_32410 >Feature sequence449 1924 2010 gene locus_tag LOCUS_t01430 1924 2010 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2451 2188 gene locus_tag LOCUS_32420 2451 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 >Feature sequence450 149 841 gene locus_tag LOCUS_32430 149 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 1298 2047 gene locus_tag LOCUS_32440 1298 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 2272 2460 gene locus_tag LOCUS_32450 2272 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence451 <2658 1882 gene locus_tag LOCUS_32460 <2658 1882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461057.1:thiolase family protein >Feature sequence452 >Feature sequence453 358 936 gene locus_tag LOCUS_32470 358 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 1961 933 gene locus_tag LOCUS_32480 1961 933 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228739.1 protein_id gnl|my_center|LOCUS_32480 <2640 1958 gene locus_tag LOCUS_32490 <2640 1958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008665703.1:TIGR01777 family oxidoreductase >Feature sequence454 295 645 gene locus_tag LOCUS_32500 295 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 642 968 gene locus_tag LOCUS_32510 642 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 1488 2420 gene locus_tag LOCUS_32520 1488 2420 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_32520 >Feature sequence455 <1 1202 gene locus_tag LOCUS_32530 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385254.1:TRAP transporter large permease subunit >Feature sequence456 72 695 gene locus_tag LOCUS_32540 72 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 1960 737 gene locus_tag LOCUS_32550 1960 737 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_32550 >Feature sequence457 1085 192 gene locus_tag LOCUS_32560 1085 192 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_32560 1735 1082 gene locus_tag LOCUS_32570 1735 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 2253 1732 gene locus_tag LOCUS_32580 2253 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 2368 2210 gene locus_tag LOCUS_32590 2368 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence458 1296 538 gene locus_tag LOCUS_32600 1296 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 2227 1301 gene locus_tag LOCUS_32610 2227 1301 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_32610 >Feature sequence459 1812 706 gene locus_tag LOCUS_32620 1812 706 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337224.1 protein_id gnl|my_center|LOCUS_32620 2084 1809 gene locus_tag LOCUS_32630 2084 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence460 <1 711 gene locus_tag LOCUS_32640 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791915.1:NAD-dependent deacylase 708 971 gene locus_tag LOCUS_32650 708 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 983 1840 gene locus_tag LOCUS_32660 983 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 1846 2298 gene locus_tag LOCUS_32670 1846 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence461 623 3 gene locus_tag LOCUS_32680 gene tmk 623 3 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 protein_id gnl|my_center|LOCUS_32680 1624 620 gene locus_tag LOCUS_32690 gene mltG 1624 620 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_32690 <2578 1656 gene locus_tag LOCUS_32700 <2578 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193086.1:beta-ketoacyl-ACP synthase II >Feature sequence462 >Feature sequence463 192 575 gene locus_tag LOCUS_32710 192 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 586 2328 gene locus_tag LOCUS_32720 586 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence464 125 679 gene locus_tag LOCUS_32730 125 679 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_32730 680 1171 gene locus_tag LOCUS_32740 680 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 1188 1505 gene locus_tag LOCUS_32750 1188 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 >Feature sequence465 587 1768 gene locus_tag LOCUS_32760 587 1768 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372834.1 protein_id gnl|my_center|LOCUS_32760 2362 2171 gene locus_tag LOCUS_32770 2362 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 >Feature sequence466 <1 873 gene locus_tag LOCUS_32780 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256113.1:2-phospho-L-lactate transferase 870 1583 gene locus_tag LOCUS_32790 870 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 <2543 1587 gene locus_tag LOCUS_32800 <2543 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013564.1:GDP-mannose 4,6-dehydratase >Feature sequence467 245 1285 gene locus_tag LOCUS_32810 245 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 1373 1522 gene locus_tag LOCUS_32820 1373 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 1954 1652 gene locus_tag LOCUS_32830 1954 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 2077 2415 gene locus_tag LOCUS_32840 2077 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 >Feature sequence468 <1 739 gene locus_tag LOCUS_32850 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004554743.1:phytoene/squalene synthase family protein 1121 690 gene locus_tag LOCUS_32860 1121 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 1791 1108 gene locus_tag LOCUS_32870 1791 1108 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230527.1 protein_id gnl|my_center|LOCUS_32870 2364 1795 gene locus_tag LOCUS_32880 2364 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence469 >Feature sequence470 239 1096 gene locus_tag LOCUS_32890 239 1096 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_32890 1083 1931 gene locus_tag LOCUS_32900 1083 1931 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_32900 >Feature sequence471 338 799 gene locus_tag LOCUS_32910 338 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 796 1197 gene locus_tag LOCUS_32920 796 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 1194 1415 gene locus_tag LOCUS_32930 1194 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 1422 2084 gene locus_tag LOCUS_32940 1422 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 >Feature sequence472 330 1724 gene locus_tag LOCUS_32950 330 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 1842 1767 gene locus_tag LOCUS_t01440 1842 1767 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence473 >Feature sequence474 889 1923 gene locus_tag LOCUS_32960 889 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960