>Feature sequence01 488 1453 gene locus_tag LOCUS_00010 488 1453 CDS product PATAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942118.1 protein_id gnl|my_center|LOCUS_00010 1560 2309 gene locus_tag LOCUS_00020 1560 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942119.1 protein_id gnl|my_center|LOCUS_00020 2375 4468 gene locus_tag LOCUS_00030 gene omcB 2375 4468 CDS product C-type polyheme cytochrome OmcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943369.1 protein_id gnl|my_center|LOCUS_00030 4511 5992 gene locus_tag LOCUS_00040 4511 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6055 6420 gene locus_tag LOCUS_00050 6055 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7459 6500 gene locus_tag LOCUS_00060 7459 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9391 7547 gene locus_tag LOCUS_00070 9391 7547 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942342.1 protein_id gnl|my_center|LOCUS_00070 9652 10671 gene locus_tag LOCUS_00080 9652 10671 CDS product PATAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942118.1 protein_id gnl|my_center|LOCUS_00080 10710 11345 gene locus_tag LOCUS_00090 10710 11345 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942120.1 protein_id gnl|my_center|LOCUS_00090 11525 12187 gene locus_tag LOCUS_00100 11525 12187 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_00100 12184 12474 gene locus_tag LOCUS_00110 12184 12474 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942122.1 protein_id gnl|my_center|LOCUS_00110 12491 13084 gene locus_tag LOCUS_00120 12491 13084 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942123.1 protein_id gnl|my_center|LOCUS_00120 13113 13988 gene locus_tag LOCUS_00130 13113 13988 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942124.1 protein_id gnl|my_center|LOCUS_00130 13994 14626 gene locus_tag LOCUS_00140 13994 14626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942125.1 protein_id gnl|my_center|LOCUS_00140 16150 14747 gene locus_tag LOCUS_00150 gene ltrA 16150 14747 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_00150 16840 17070 gene locus_tag LOCUS_00160 16840 17070 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 protein_id gnl|my_center|LOCUS_00160 17073 17477 gene locus_tag LOCUS_00170 17073 17477 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 protein_id gnl|my_center|LOCUS_00170 17483 18829 gene locus_tag LOCUS_00180 gene xseA 17483 18829 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_00180 18878 19108 gene locus_tag LOCUS_00190 18878 19108 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_00190 19150 20043 gene locus_tag LOCUS_00200 19150 20043 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_00200 20211 22088 gene locus_tag LOCUS_00210 gene dxs 20211 22088 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_00210 22085 23395 gene locus_tag LOCUS_00220 22085 23395 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942406.1 protein_id gnl|my_center|LOCUS_00220 23497 23994 gene locus_tag LOCUS_00230 23497 23994 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941938.1 protein_id gnl|my_center|LOCUS_00230 24089 24574 gene locus_tag LOCUS_00240 24089 24574 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941913.1 protein_id gnl|my_center|LOCUS_00240 24597 24899 gene locus_tag LOCUS_00250 24597 24899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941914.1 protein_id gnl|my_center|LOCUS_00250 24883 26019 gene locus_tag LOCUS_00260 24883 26019 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_00260 26022 26750 gene locus_tag LOCUS_00270 26022 26750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_00270 26747 27745 gene locus_tag LOCUS_00280 26747 27745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_00280 27817 28215 gene locus_tag LOCUS_00290 27817 28215 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_00290 28549 29397 gene locus_tag LOCUS_00300 28549 29397 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770085.1 protein_id gnl|my_center|LOCUS_00300 29397 30287 gene locus_tag LOCUS_00310 29397 30287 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073870.1 protein_id gnl|my_center|LOCUS_00310 30330 32801 gene locus_tag LOCUS_00320 gene rnr 30330 32801 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_00320 34220 32937 gene locus_tag LOCUS_00330 34220 32937 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_00330 34576 34229 gene locus_tag LOCUS_00340 34576 34229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35179 34874 gene locus_tag LOCUS_00350 35179 34874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 35268 35483 gene locus_tag LOCUS_00360 35268 35483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 35768 36610 gene locus_tag LOCUS_00370 gene tatC 35768 36610 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942132.1 protein_id gnl|my_center|LOCUS_00370 36836 37252 gene locus_tag LOCUS_00380 36836 37252 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_00380 37334 39076 gene locus_tag LOCUS_00390 gene cydD 37334 39076 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941872.1 protein_id gnl|my_center|LOCUS_00390 39073 40725 gene locus_tag LOCUS_00400 gene cydC 39073 40725 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941873.1 protein_id gnl|my_center|LOCUS_00400 40998 42344 gene locus_tag LOCUS_00410 40998 42344 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942285.1 protein_id gnl|my_center|LOCUS_00410 42348 43403 gene locus_tag LOCUS_00420 gene cydB 42348 43403 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942286.1 protein_id gnl|my_center|LOCUS_00420 43794 44285 gene locus_tag LOCUS_00430 43794 44285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44282 44794 gene locus_tag LOCUS_00440 44282 44794 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943008.1 protein_id gnl|my_center|LOCUS_00440 44897 47056 gene locus_tag LOCUS_00450 44897 47056 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943007.1 protein_id gnl|my_center|LOCUS_00450 47082 47885 gene locus_tag LOCUS_00460 gene trpA 47082 47885 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_00460 47972 48826 gene locus_tag LOCUS_00470 gene accD 47972 48826 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_00470 48828 50105 gene locus_tag LOCUS_00480 48828 50105 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_00480 50086 52209 gene locus_tag LOCUS_00490 gene lptD 50086 52209 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_00490 53435 52350 gene locus_tag LOCUS_00500 53435 52350 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941708.1 protein_id gnl|my_center|LOCUS_00500 54487 53657 gene locus_tag LOCUS_00510 54487 53657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_00510 54580 55257 gene locus_tag LOCUS_00520 gene queC 54580 55257 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_00520 56007 55411 gene locus_tag LOCUS_00530 gene ruvA 56007 55411 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_00530 56534 56004 gene locus_tag LOCUS_00540 gene ruvC 56534 56004 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_00540 57001 56534 gene locus_tag LOCUS_00550 gene msrA 57001 56534 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_00550 57788 57045 gene locus_tag LOCUS_00560 57788 57045 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_00560 57912 58280 gene locus_tag LOCUS_00570 57912 58280 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941734.1 protein_id gnl|my_center|LOCUS_00570 58331 58405 gene locus_tag LOCUS_t00010 58331 58405 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 58680 58604 gene locus_tag LOCUS_t00020 58680 58604 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 59530 58748 gene locus_tag LOCUS_00580 59530 58748 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942456.1 protein_id gnl|my_center|LOCUS_00580 61233 59542 gene locus_tag LOCUS_00590 gene argS 61233 59542 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648220.1 protein_id gnl|my_center|LOCUS_00590 61743 61441 gene locus_tag LOCUS_00600 61743 61441 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942459.1 protein_id gnl|my_center|LOCUS_00600 62686 61748 gene locus_tag LOCUS_00610 62686 61748 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_00610 64046 62688 gene locus_tag LOCUS_00620 64046 62688 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_00620 64960 64115 gene locus_tag LOCUS_00630 gene rsmI 64960 64115 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_00630 66064 64961 gene locus_tag LOCUS_00640 66064 64961 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942466.1 protein_id gnl|my_center|LOCUS_00640 68861 66249 gene locus_tag LOCUS_00650 gene mutS 68861 66249 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_00650 69054 71480 gene locus_tag LOCUS_00660 69054 71480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 71473 71787 gene locus_tag LOCUS_00670 71473 71787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 72876 71872 gene locus_tag LOCUS_00680 gene pta 72876 71872 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_00680 73174 73758 gene locus_tag LOCUS_00690 73174 73758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 74385 73828 gene locus_tag LOCUS_00700 74385 73828 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_00700 75208 74483 gene locus_tag LOCUS_00710 75208 74483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 76635 75205 gene locus_tag LOCUS_00720 76635 75205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 77845 76613 gene locus_tag LOCUS_00730 77845 76613 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_00730 79164 77842 gene locus_tag LOCUS_00740 79164 77842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 79413 79171 gene locus_tag LOCUS_00750 79413 79171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 80515 79442 gene locus_tag LOCUS_00760 80515 79442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 81690 80512 gene locus_tag LOCUS_00770 gene fabF 81690 80512 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644335.1 protein_id gnl|my_center|LOCUS_00770 82628 81687 gene locus_tag LOCUS_00780 82628 81687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 82930 82646 gene locus_tag LOCUS_00790 82930 82646 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_00790 83858 82959 gene locus_tag LOCUS_00800 83858 82959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 85035 83836 gene locus_tag LOCUS_00810 85035 83836 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964347.1 protein_id gnl|my_center|LOCUS_00810 86392 85022 gene locus_tag LOCUS_00820 86392 85022 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_00820 87474 86389 gene locus_tag LOCUS_00830 87474 86389 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_00830 87355 87648 gene locus_tag LOCUS_00840 87355 87648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 88331 87657 gene locus_tag LOCUS_00850 88331 87657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 89472 88342 gene locus_tag LOCUS_00860 89472 88342 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964359.1 protein_id gnl|my_center|LOCUS_00860 89945 89460 gene locus_tag LOCUS_00870 89945 89460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 90322 89942 gene locus_tag LOCUS_00880 90322 89942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 90984 90319 gene locus_tag LOCUS_00890 90984 90319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 93363 90985 gene locus_tag LOCUS_00900 93363 90985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 94003 93356 gene locus_tag LOCUS_00910 94003 93356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 95526 94039 gene locus_tag LOCUS_00920 95526 94039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 96827 95523 gene locus_tag LOCUS_00930 96827 95523 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_00930 97579 96824 gene locus_tag LOCUS_00940 97579 96824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 97848 97582 gene locus_tag LOCUS_00950 97848 97582 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_00950 99101 97875 gene locus_tag LOCUS_00960 99101 97875 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_00960 100594 99092 gene locus_tag LOCUS_00970 100594 99092 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_00970 101304 100645 gene locus_tag LOCUS_00980 gene fabG 101304 100645 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_00980 101797 103161 gene locus_tag LOCUS_00990 101797 103161 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_00990 104579 103206 gene locus_tag LOCUS_01000 gene hemW 104579 103206 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002410012.1 protein_id gnl|my_center|LOCUS_01000 105651 106277 gene locus_tag LOCUS_01010 105651 106277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 106421 106900 gene locus_tag LOCUS_01020 106421 106900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 108831 106939 gene locus_tag LOCUS_01030 108831 106939 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_01030 109423 109163 gene locus_tag LOCUS_01040 109423 109163 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943949.1 protein_id gnl|my_center|LOCUS_01040 109718 109431 gene locus_tag LOCUS_01050 109718 109431 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943948.1 protein_id gnl|my_center|LOCUS_01050 110116 111264 gene locus_tag LOCUS_01060 gene hemW 110116 111264 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_01060 111443 111519 gene locus_tag LOCUS_t00030 111443 111519 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 112031 111648 gene locus_tag LOCUS_01070 112031 111648 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963569.1 protein_id gnl|my_center|LOCUS_01070 112480 112151 gene locus_tag LOCUS_01080 112480 112151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941417.1 protein_id gnl|my_center|LOCUS_01080 113233 112655 gene locus_tag LOCUS_01090 113233 112655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 114073 113264 gene locus_tag LOCUS_01100 114073 113264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 115251 114847 gene locus_tag LOCUS_01110 115251 114847 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941050.1 protein_id gnl|my_center|LOCUS_01110 116495 115293 gene locus_tag LOCUS_01120 gene ccoG 116495 115293 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076153.1 protein_id gnl|my_center|LOCUS_01120 118270 116591 gene locus_tag LOCUS_01130 118270 116591 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941459.1 protein_id gnl|my_center|LOCUS_01130 118642 118334 gene locus_tag LOCUS_01140 118642 118334 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941460.1 protein_id gnl|my_center|LOCUS_01140 118875 118657 gene locus_tag LOCUS_01150 118875 118657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941352.1 protein_id gnl|my_center|LOCUS_01150 119983 118982 gene locus_tag LOCUS_01160 119983 118982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 120005 120136 gene locus_tag LOCUS_01170 120005 120136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 121569 120196 gene locus_tag LOCUS_01180 121569 120196 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942841.1 protein_id gnl|my_center|LOCUS_01180 122124 121744 gene locus_tag LOCUS_01190 122124 121744 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942061.1 protein_id gnl|my_center|LOCUS_01190 123363 122548 gene locus_tag LOCUS_01200 123363 122548 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392733.1 protein_id gnl|my_center|LOCUS_01200 124106 123360 gene locus_tag LOCUS_01210 gene cbiQ 124106 123360 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392734.1 protein_id gnl|my_center|LOCUS_01210 124435 124100 gene locus_tag LOCUS_01220 124435 124100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 125109 124432 gene locus_tag LOCUS_01230 125109 124432 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_01230 127605 125578 gene locus_tag LOCUS_01240 127605 125578 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943611.1 protein_id gnl|my_center|LOCUS_01240 128403 127660 gene locus_tag LOCUS_01250 128403 127660 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044914.1 protein_id gnl|my_center|LOCUS_01250 128804 128520 gene locus_tag LOCUS_01260 128804 128520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 130603 129239 gene locus_tag LOCUS_01270 130603 129239 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941138.1 protein_id gnl|my_center|LOCUS_01270 131844 130621 gene locus_tag LOCUS_01280 131844 130621 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941139.1 protein_id gnl|my_center|LOCUS_01280 132731 131847 gene locus_tag LOCUS_01290 132731 131847 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044954.1 protein_id gnl|my_center|LOCUS_01290 133258 132728 gene locus_tag LOCUS_01300 133258 132728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941136.1 protein_id gnl|my_center|LOCUS_01300 133635 133321 gene locus_tag LOCUS_01310 133635 133321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 134399 133809 gene locus_tag LOCUS_01320 134399 133809 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_01320 135131 134472 gene locus_tag LOCUS_01330 135131 134472 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943590.1 protein_id gnl|my_center|LOCUS_01330 135569 135168 gene locus_tag LOCUS_01340 135569 135168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 136634 135831 gene locus_tag LOCUS_01350 gene extS 136634 135831 CDS product selenite/tellurite reduction operon c-type cytochrome lipoprotein ExtS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943561.1 protein_id gnl|my_center|LOCUS_01350 137026 136616 gene locus_tag LOCUS_01360 gene extQ 137026 136616 CDS product selenite/tellurite reduction operon b-type cytochrome membrane protein ExtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044913.1 protein_id gnl|my_center|LOCUS_01360 137643 137023 gene locus_tag LOCUS_01370 137643 137023 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943563.1 protein_id gnl|my_center|LOCUS_01370 138232 138756 gene locus_tag LOCUS_01380 138232 138756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 139358 139531 gene locus_tag LOCUS_01390 139358 139531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 139464 141002 gene locus_tag LOCUS_01400 gene ltrA 139464 141002 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 protein_id gnl|my_center|LOCUS_01400 141701 141898 gene locus_tag LOCUS_01410 141701 141898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 142457 142215 gene locus_tag LOCUS_01420 142457 142215 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 protein_id gnl|my_center|LOCUS_01420 142966 142697 gene locus_tag LOCUS_01430 142966 142697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 143234 142956 gene locus_tag LOCUS_01440 143234 142956 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_01440 143533 144948 gene locus_tag LOCUS_01450 143533 144948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 145518 145120 gene locus_tag LOCUS_01460 145518 145120 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943564.1 protein_id gnl|my_center|LOCUS_01460 146666 145473 gene locus_tag LOCUS_01470 gene extO 146666 145473 CDS product selenite/tellurite reduction operon b-type cytochrome iron-sulfur cluster-binding subunit ExtO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943565.1 protein_id gnl|my_center|LOCUS_01470 148491 146614 gene locus_tag LOCUS_01480 gene extM 148491 146614 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_01480 150575 148578 gene locus_tag LOCUS_01490 150575 148578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 150929 150714 gene locus_tag LOCUS_01500 150929 150714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 151738 151022 gene locus_tag LOCUS_01510 151738 151022 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255934.1 protein_id gnl|my_center|LOCUS_01510 152890 151742 gene locus_tag LOCUS_01520 152890 151742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 155090 152892 gene locus_tag LOCUS_01530 155090 152892 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_01530 156613 155225 gene locus_tag LOCUS_01540 156613 155225 CDS product sulfur transferase selenocysteine-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546309.1 protein_id gnl|my_center|LOCUS_01540 156965 156642 gene locus_tag LOCUS_01550 156965 156642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942840.1 protein_id gnl|my_center|LOCUS_01550 158905 157097 gene locus_tag LOCUS_01560 158905 157097 CDS product DUF3373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942839.1 protein_id gnl|my_center|LOCUS_01560 161152 159407 gene locus_tag LOCUS_01570 161152 159407 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943759.1 protein_id gnl|my_center|LOCUS_01570 161693 161427 gene locus_tag LOCUS_01580 161693 161427 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943263.1 protein_id gnl|my_center|LOCUS_01580 162070 161696 gene locus_tag LOCUS_01590 162070 161696 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941066.1 protein_id gnl|my_center|LOCUS_01590 162314 162090 gene locus_tag LOCUS_01600 162314 162090 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_01600 162756 162331 gene locus_tag LOCUS_01610 162756 162331 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941063.1 protein_id gnl|my_center|LOCUS_01610 165977 162756 gene locus_tag LOCUS_01620 165977 162756 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_01620 167126 165981 gene locus_tag LOCUS_01630 167126 165981 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_01630 168463 167123 gene locus_tag LOCUS_01640 168463 167123 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044950.1 protein_id gnl|my_center|LOCUS_01640 168771 169751 gene locus_tag LOCUS_01650 168771 169751 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941981.1 protein_id gnl|my_center|LOCUS_01650 169933 170009 gene locus_tag LOCUS_t00040 169933 170009 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 170202 170579 gene locus_tag LOCUS_01660 gene hisI 170202 170579 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942178.1 protein_id gnl|my_center|LOCUS_01660 170576 171451 gene locus_tag LOCUS_01670 gene hisG 170576 171451 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_01670 171455 172351 gene locus_tag LOCUS_01680 171455 172351 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941331.1 protein_id gnl|my_center|LOCUS_01680 172378 173142 gene locus_tag LOCUS_01690 172378 173142 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940872.1 protein_id gnl|my_center|LOCUS_01690 173169 173669 gene locus_tag LOCUS_01700 173169 173669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 173901 175556 gene locus_tag LOCUS_01710 gene muiA 173901 175556 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_01710 175776 176021 gene locus_tag LOCUS_01720 175776 176021 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943075.1 protein_id gnl|my_center|LOCUS_01720 176011 176301 gene locus_tag LOCUS_01730 176011 176301 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943076.1 protein_id gnl|my_center|LOCUS_01730 178165 176657 gene locus_tag LOCUS_01740 178165 176657 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963679.1 protein_id gnl|my_center|LOCUS_01740 178854 178258 gene locus_tag LOCUS_01750 178854 178258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 179486 178851 gene locus_tag LOCUS_01760 179486 178851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 182008 179489 gene locus_tag LOCUS_01770 182008 179489 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209627475.1 protein_id gnl|my_center|LOCUS_01770 182385 182161 gene locus_tag LOCUS_01780 182385 182161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 182916 182533 gene locus_tag LOCUS_01790 182916 182533 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_01790 184047 183376 gene locus_tag LOCUS_01800 184047 183376 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_01800 184646 184062 gene locus_tag LOCUS_01810 184646 184062 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770403.1 protein_id gnl|my_center|LOCUS_01810 185880 184696 gene locus_tag LOCUS_01820 185880 184696 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_01820 186382 185960 gene locus_tag LOCUS_01830 186382 185960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01830 189032 186543 gene locus_tag LOCUS_01840 189032 186543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 189755 189546 gene locus_tag LOCUS_01850 189755 189546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 191175 190000 gene locus_tag LOCUS_01860 191175 190000 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_01860 191699 191172 gene locus_tag LOCUS_01870 191699 191172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 191857 192576 gene locus_tag LOCUS_01880 191857 192576 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942270.1 protein_id gnl|my_center|LOCUS_01880 192765 193595 gene locus_tag LOCUS_01890 192765 193595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 194294 193884 gene locus_tag LOCUS_01900 194294 193884 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_01900 196510 194315 gene locus_tag LOCUS_01910 196510 194315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 197378 196503 gene locus_tag LOCUS_01920 197378 196503 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_01920 197700 197365 gene locus_tag LOCUS_01930 197700 197365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941572.1 protein_id gnl|my_center|LOCUS_01930 198481 197765 gene locus_tag LOCUS_01940 198481 197765 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044976.1 protein_id gnl|my_center|LOCUS_01940 200632 198968 gene locus_tag LOCUS_01950 200632 198968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 201020 200799 gene locus_tag LOCUS_01960 201020 200799 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545978.1 protein_id gnl|my_center|LOCUS_01960 201522 201046 gene locus_tag LOCUS_01970 201522 201046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 203471 201519 gene locus_tag LOCUS_01980 gene hdrA 203471 201519 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_01980 203956 203468 gene locus_tag LOCUS_01990 203956 203468 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_01990 205449 203953 gene locus_tag LOCUS_02000 205449 203953 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_02000 206570 205446 gene locus_tag LOCUS_02010 206570 205446 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_02010 207059 206610 gene locus_tag LOCUS_02020 207059 206610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943364.1 protein_id gnl|my_center|LOCUS_02020 207305 207171 gene locus_tag LOCUS_02030 207305 207171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 208319 207390 gene locus_tag LOCUS_02040 208319 207390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 209594 208635 gene locus_tag LOCUS_02050 209594 208635 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193979.1 protein_id gnl|my_center|LOCUS_02050 211017 209716 gene locus_tag LOCUS_02060 211017 209716 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_02060 213063 211147 gene locus_tag LOCUS_02070 gene cysN 213063 211147 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503688.1 protein_id gnl|my_center|LOCUS_02070 213965 213063 gene locus_tag LOCUS_02080 gene cysD 213965 213063 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175227789.1 protein_id gnl|my_center|LOCUS_02080 215302 213995 gene locus_tag LOCUS_02090 215302 213995 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941036.1 protein_id gnl|my_center|LOCUS_02090 216102 216374 gene locus_tag LOCUS_02100 216102 216374 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140411.1 protein_id gnl|my_center|LOCUS_02100 216334 216606 gene locus_tag LOCUS_02110 216334 216606 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525420.1 protein_id gnl|my_center|LOCUS_02110 217177 216689 gene locus_tag LOCUS_02120 217177 216689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 217423 217223 gene locus_tag LOCUS_02130 217423 217223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 218416 217538 gene locus_tag LOCUS_02140 218416 217538 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 protein_id gnl|my_center|LOCUS_02140 218958 218572 gene locus_tag LOCUS_02150 218958 218572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 219644 219249 gene locus_tag LOCUS_02160 219644 219249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 220110 219751 gene locus_tag LOCUS_02170 220110 219751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 220214 220723 gene locus_tag LOCUS_02180 220214 220723 CDS product ead/Ea22-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072904.1 protein_id gnl|my_center|LOCUS_02180 221221 220796 gene locus_tag LOCUS_02190 221221 220796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 221864 221490 gene locus_tag LOCUS_02200 221864 221490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 224138 221877 gene locus_tag LOCUS_02210 224138 221877 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_02210 225737 224142 gene locus_tag LOCUS_02220 225737 224142 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257542.1 protein_id gnl|my_center|LOCUS_02220 226777 225740 gene locus_tag LOCUS_02230 gene cheB 226777 225740 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_02230 228471 226774 gene locus_tag LOCUS_02240 228471 226774 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081682.1 protein_id gnl|my_center|LOCUS_02240 >Feature sequence02 661 29 gene locus_tag LOCUS_02250 661 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 969 679 gene locus_tag LOCUS_02260 969 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 1676 999 gene locus_tag LOCUS_02270 1676 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 2547 1741 gene locus_tag LOCUS_02280 2547 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4045 2564 gene locus_tag LOCUS_02290 4045 2564 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_02290 4976 4071 gene locus_tag LOCUS_02300 4976 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 5189 6061 gene locus_tag LOCUS_02310 5189 6061 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626499.1 protein_id gnl|my_center|LOCUS_02310 6068 7279 gene locus_tag LOCUS_02320 6068 7279 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939122.1 protein_id gnl|my_center|LOCUS_02320 7347 7586 gene locus_tag LOCUS_02330 7347 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 8272 7514 gene locus_tag LOCUS_02340 8272 7514 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944065.1 protein_id gnl|my_center|LOCUS_02340 9204 8269 gene locus_tag LOCUS_02350 9204 8269 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940689.1 protein_id gnl|my_center|LOCUS_02350 10535 9201 gene locus_tag LOCUS_02360 10535 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943618.1 protein_id gnl|my_center|LOCUS_02360 11245 10532 gene locus_tag LOCUS_02370 11245 10532 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941739.1 protein_id gnl|my_center|LOCUS_02370 12270 11248 gene locus_tag LOCUS_02380 gene ruvB 12270 11248 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_02380 13113 12403 gene locus_tag LOCUS_02390 13113 12403 CDS product DUF4398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942110.1 protein_id gnl|my_center|LOCUS_02390 14912 13128 gene locus_tag LOCUS_02400 gene aspS 14912 13128 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_02400 15654 14992 gene locus_tag LOCUS_02410 gene lepB 15654 14992 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_02410 17477 15681 gene locus_tag LOCUS_02420 gene lepA 17477 15681 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_02420 18676 17576 gene locus_tag LOCUS_02430 gene rodA 18676 17576 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_02430 20591 18669 gene locus_tag LOCUS_02440 gene mrdA 20591 18669 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_02440 21076 20588 gene locus_tag LOCUS_02450 gene mreD 21076 20588 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942722.1 protein_id gnl|my_center|LOCUS_02450 21890 21069 gene locus_tag LOCUS_02460 gene mreC 21890 21069 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_02460 22852 21950 gene locus_tag LOCUS_02470 gene rfbA 22852 21950 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942725.1 protein_id gnl|my_center|LOCUS_02470 23480 22920 gene locus_tag LOCUS_02480 gene gmhB 23480 22920 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_02480 23664 24716 gene locus_tag LOCUS_02490 23664 24716 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942928.1 protein_id gnl|my_center|LOCUS_02490 27275 24738 gene locus_tag LOCUS_02500 gene hrpB 27275 24738 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_02500 28171 27272 gene locus_tag LOCUS_02510 28171 27272 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943251.1 protein_id gnl|my_center|LOCUS_02510 29882 28161 gene locus_tag LOCUS_02520 gene recJ 29882 28161 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_02520 30519 29944 gene locus_tag LOCUS_02530 30519 29944 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943253.1 protein_id gnl|my_center|LOCUS_02530 31470 30550 gene locus_tag LOCUS_02540 gene secF 31470 30550 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943254.1 protein_id gnl|my_center|LOCUS_02540 32967 31486 gene locus_tag LOCUS_02550 gene secD 32967 31486 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_02550 33451 33125 gene locus_tag LOCUS_02560 gene yajC 33451 33125 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_02560 34487 33456 gene locus_tag LOCUS_02570 gene tgt 34487 33456 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_02570 35626 34595 gene locus_tag LOCUS_02580 gene queA 35626 34595 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943258.1 protein_id gnl|my_center|LOCUS_02580 36738 35641 gene locus_tag LOCUS_02590 36738 35641 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_02590 37135 39225 gene locus_tag LOCUS_02600 37135 39225 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943260.1 protein_id gnl|my_center|LOCUS_02600 39767 40282 gene locus_tag LOCUS_02610 39767 40282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 40279 41277 gene locus_tag LOCUS_02620 40279 41277 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943262.1 protein_id gnl|my_center|LOCUS_02620 41364 41639 gene locus_tag LOCUS_02630 41364 41639 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943263.1 protein_id gnl|my_center|LOCUS_02630 42470 41643 gene locus_tag LOCUS_02640 gene bioC 42470 41643 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943265.1 protein_id gnl|my_center|LOCUS_02640 43269 42445 gene locus_tag LOCUS_02650 43269 42445 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_02650 44204 43269 gene locus_tag LOCUS_02660 gene bioF 44204 43269 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_02660 45512 44538 gene locus_tag LOCUS_02670 45512 44538 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941859.1 protein_id gnl|my_center|LOCUS_02670 46123 45626 gene locus_tag LOCUS_02680 46123 45626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 46520 46155 gene locus_tag LOCUS_02690 46520 46155 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943000.1 protein_id gnl|my_center|LOCUS_02690 47367 46531 gene locus_tag LOCUS_02700 gene rfbD 47367 46531 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_02700 48434 47364 gene locus_tag LOCUS_02710 gene rfbB 48434 47364 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943002.1 protein_id gnl|my_center|LOCUS_02710 48670 48745 gene locus_tag LOCUS_t00050 48670 48745 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 48897 49199 gene locus_tag LOCUS_02720 48897 49199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 49289 49215 gene locus_tag LOCUS_t00060 49289 49215 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 50743 49358 gene locus_tag LOCUS_02730 gene thrC 50743 49358 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_02730 51481 50867 gene locus_tag LOCUS_02740 51481 50867 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942873.1 protein_id gnl|my_center|LOCUS_02740 51848 51564 gene locus_tag LOCUS_02750 51848 51564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 52225 51845 gene locus_tag LOCUS_02760 52225 51845 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_02760 54372 52222 gene locus_tag LOCUS_02770 54372 52222 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_02770 54684 54475 gene locus_tag LOCUS_02780 gene rpoZ 54684 54475 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942877.1 protein_id gnl|my_center|LOCUS_02780 55349 54741 gene locus_tag LOCUS_02790 gene gmk 55349 54741 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_02790 55583 55443 gene locus_tag LOCUS_02800 55583 55443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 57825 55576 gene locus_tag LOCUS_02810 57825 55576 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_02810 58267 58079 gene locus_tag LOCUS_02820 58267 58079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 58661 58230 gene locus_tag LOCUS_02830 58661 58230 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941977.1 protein_id gnl|my_center|LOCUS_02830 59390 58662 gene locus_tag LOCUS_02840 59390 58662 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_02840 59934 59404 gene locus_tag LOCUS_02850 59934 59404 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_02850 61126 60158 gene locus_tag LOCUS_02860 61126 60158 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_02860 61311 62678 gene locus_tag LOCUS_02870 61311 62678 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941190.1 protein_id gnl|my_center|LOCUS_02870 63305 62664 gene locus_tag LOCUS_02880 gene ccsA 63305 62664 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943928.1 protein_id gnl|my_center|LOCUS_02880 63636 64361 gene locus_tag LOCUS_02890 63636 64361 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943279.1 protein_id gnl|my_center|LOCUS_02890 64371 65135 gene locus_tag LOCUS_02900 64371 65135 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943278.1 protein_id gnl|my_center|LOCUS_02900 66094 65213 gene locus_tag LOCUS_02910 66094 65213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 67207 66212 gene locus_tag LOCUS_02920 67207 66212 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942316.1 protein_id gnl|my_center|LOCUS_02920 67236 67499 gene locus_tag LOCUS_02930 67236 67499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 67805 68797 gene locus_tag LOCUS_02940 67805 68797 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_02940 68879 69550 gene locus_tag LOCUS_02950 68879 69550 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391424.1 protein_id gnl|my_center|LOCUS_02950 69547 70926 gene locus_tag LOCUS_02960 69547 70926 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391423.1 protein_id gnl|my_center|LOCUS_02960 72307 71066 gene locus_tag LOCUS_02970 72307 71066 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226185.1 protein_id gnl|my_center|LOCUS_02970 73220 72339 gene locus_tag LOCUS_02980 gene sppA 73220 72339 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_02980 73284 73754 gene locus_tag LOCUS_02990 73284 73754 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941889.1 protein_id gnl|my_center|LOCUS_02990 74601 73783 gene locus_tag LOCUS_03000 gene pssA 74601 73783 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_03000 75277 74618 gene locus_tag LOCUS_03010 75277 74618 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_03010 76363 75353 gene locus_tag LOCUS_03020 gene ilvC 76363 75353 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_03020 77203 76712 gene locus_tag LOCUS_03030 gene ilvN 77203 76712 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_03030 78936 77236 gene locus_tag LOCUS_03040 gene ilvB 78936 77236 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942556.1 protein_id gnl|my_center|LOCUS_03040 80634 78973 gene locus_tag LOCUS_03050 gene ilvD 80634 78973 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942557.1 protein_id gnl|my_center|LOCUS_03050 80978 83470 gene locus_tag LOCUS_03060 80978 83470 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_03060 83485 84846 gene locus_tag LOCUS_03070 83485 84846 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_03070 84917 85438 gene locus_tag LOCUS_03080 84917 85438 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941961.1 protein_id gnl|my_center|LOCUS_03080 85439 85669 gene locus_tag LOCUS_03090 85439 85669 CDS product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941962.1 protein_id gnl|my_center|LOCUS_03090 85795 85871 gene locus_tag LOCUS_t00070 85795 85871 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 86714 86037 gene locus_tag LOCUS_03100 86714 86037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 89612 86949 gene locus_tag LOCUS_03110 89612 86949 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530065.1 protein_id gnl|my_center|LOCUS_03110 90355 89612 gene locus_tag LOCUS_03120 90355 89612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875784.1 protein_id gnl|my_center|LOCUS_03120 91611 90445 gene locus_tag LOCUS_03130 91611 90445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_03130 93252 91618 gene locus_tag LOCUS_03140 93252 91618 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_03140 94472 93255 gene locus_tag LOCUS_03150 94472 93255 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_03150 95592 94495 gene locus_tag LOCUS_03160 95592 94495 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_03160 97311 95605 gene locus_tag LOCUS_03170 gene pilB 97311 95605 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_03170 98228 97383 gene locus_tag LOCUS_03180 gene aroE 98228 97383 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942136.1 protein_id gnl|my_center|LOCUS_03180 100115 98244 gene locus_tag LOCUS_03190 100115 98244 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942135.1 protein_id gnl|my_center|LOCUS_03190 100855 100112 gene locus_tag LOCUS_03200 100855 100112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 101873 100857 gene locus_tag LOCUS_03210 101873 100857 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_03210 102847 101870 gene locus_tag LOCUS_03220 102847 101870 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_03220 105201 102862 gene locus_tag LOCUS_03230 gene recG 105201 102862 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_03230 105630 105430 gene locus_tag LOCUS_03240 105630 105430 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941933.1 protein_id gnl|my_center|LOCUS_03240 106163 105687 gene locus_tag LOCUS_03250 gene greA 106163 105687 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941932.1 protein_id gnl|my_center|LOCUS_03250 109430 106191 gene locus_tag LOCUS_03260 gene carB 109430 106191 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_03260 110048 109632 gene locus_tag LOCUS_03270 110048 109632 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_03270 110463 110041 gene locus_tag LOCUS_03280 110463 110041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 111875 110811 gene locus_tag LOCUS_03290 111875 110811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 112307 111882 gene locus_tag LOCUS_03300 112307 111882 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094555.1 protein_id gnl|my_center|LOCUS_03300 113132 112803 gene locus_tag LOCUS_03310 113132 112803 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941930.1 protein_id gnl|my_center|LOCUS_03310 114035 113133 gene locus_tag LOCUS_03320 114035 113133 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_03320 115166 114039 gene locus_tag LOCUS_03330 gene carA 115166 114039 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_03330 116469 115192 gene locus_tag LOCUS_03340 116469 115192 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_03340 117590 116655 gene locus_tag LOCUS_03350 117590 116655 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_03350 118142 117606 gene locus_tag LOCUS_03360 gene pyrR 118142 117606 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941925.1 protein_id gnl|my_center|LOCUS_03360 119246 118368 gene locus_tag LOCUS_03370 119246 118368 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_03370 119719 119351 gene locus_tag LOCUS_03380 119719 119351 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940839.1 protein_id gnl|my_center|LOCUS_03380 120010 119816 gene locus_tag LOCUS_03390 120010 119816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 120321 120073 gene locus_tag LOCUS_03400 120321 120073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 120790 124011 gene locus_tag LOCUS_03410 gene recC 120790 124011 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_03410 124008 127577 gene locus_tag LOCUS_03420 gene recB 124008 127577 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942181.1 protein_id gnl|my_center|LOCUS_03420 128006 127869 gene locus_tag LOCUS_03430 128006 127869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 128367 128633 gene locus_tag LOCUS_03440 128367 128633 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_03440 129046 129600 gene locus_tag LOCUS_03450 129046 129600 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_03450 130382 129660 gene locus_tag LOCUS_03460 130382 129660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_03460 131203 131871 gene locus_tag LOCUS_03470 131203 131871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 132115 134280 gene locus_tag LOCUS_03480 132115 134280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 134528 134328 gene locus_tag LOCUS_03490 134528 134328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 135109 136251 gene locus_tag LOCUS_03500 135109 136251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 137027 136410 gene locus_tag LOCUS_03510 137027 136410 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941829.1 protein_id gnl|my_center|LOCUS_03510 137236 138852 gene locus_tag LOCUS_03520 137236 138852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 140273 138849 gene locus_tag LOCUS_03530 140273 138849 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_03530 140912 140397 gene locus_tag LOCUS_03540 140912 140397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 142277 140949 gene locus_tag LOCUS_03550 142277 140949 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_03550 144131 142494 gene locus_tag LOCUS_03560 144131 142494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 145539 144922 gene locus_tag LOCUS_03570 145539 144922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 149200 145616 gene locus_tag LOCUS_03580 149200 145616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 149798 149331 gene locus_tag LOCUS_03590 149798 149331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 151306 149855 gene locus_tag LOCUS_03600 151306 149855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 152588 151521 gene locus_tag LOCUS_03610 152588 151521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 154392 152812 gene locus_tag LOCUS_03620 154392 152812 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226507.1 protein_id gnl|my_center|LOCUS_03620 155151 154672 gene locus_tag LOCUS_03630 155151 154672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 155363 155503 gene locus_tag LOCUS_03640 155363 155503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 156281 156850 gene locus_tag LOCUS_03650 gene tssJ 156281 156850 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941097.1 protein_id gnl|my_center|LOCUS_03650 156847 158235 gene locus_tag LOCUS_03660 gene tssK 156847 158235 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941098.1 protein_id gnl|my_center|LOCUS_03660 158239 158919 gene locus_tag LOCUS_03670 158239 158919 CDS product DotU family type IV/VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044923.1 protein_id gnl|my_center|LOCUS_03670 158921 162136 gene locus_tag LOCUS_03680 158921 162136 CDS product type VI secretion protein IcmF/TssM N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943786.1 protein_id gnl|my_center|LOCUS_03680 162214 162462 gene locus_tag LOCUS_03690 162214 162462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 162750 165428 gene locus_tag LOCUS_03700 gene tssH 162750 165428 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941102.1 protein_id gnl|my_center|LOCUS_03700 165682 166068 gene locus_tag LOCUS_03710 165682 166068 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_03710 166209 167639 gene locus_tag LOCUS_03720 166209 167639 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_03720 169216 167648 gene locus_tag LOCUS_03730 169216 167648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 170099 169221 gene locus_tag LOCUS_03740 170099 169221 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942090.1 protein_id gnl|my_center|LOCUS_03740 171946 170096 gene locus_tag LOCUS_03750 171946 170096 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942091.1 protein_id gnl|my_center|LOCUS_03750 172186 173490 gene locus_tag LOCUS_03760 gene gptM 172186 173490 CDS product geopeptide radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942092.1 protein_id gnl|my_center|LOCUS_03760 174492 173827 gene locus_tag LOCUS_03770 174492 173827 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_03770 177029 174534 gene locus_tag LOCUS_03780 177029 174534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943051.1 protein_id gnl|my_center|LOCUS_03780 177702 177022 gene locus_tag LOCUS_03790 177702 177022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943050.1 protein_id gnl|my_center|LOCUS_03790 177941 178423 gene locus_tag LOCUS_03800 177941 178423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence03 250 462 gene locus_tag LOCUS_03810 250 462 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941132.1 protein_id gnl|my_center|LOCUS_03810 595 1617 gene locus_tag LOCUS_03820 gene hemE 595 1617 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_03820 1683 2036 gene locus_tag LOCUS_03830 1683 2036 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940795.1 protein_id gnl|my_center|LOCUS_03830 2038 2508 gene locus_tag LOCUS_03840 2038 2508 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094965.1 protein_id gnl|my_center|LOCUS_03840 2522 3130 gene locus_tag LOCUS_03850 2522 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940794.1 protein_id gnl|my_center|LOCUS_03850 3127 3900 gene locus_tag LOCUS_03860 3127 3900 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_03860 3995 4492 gene locus_tag LOCUS_03870 3995 4492 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943900.1 protein_id gnl|my_center|LOCUS_03870 4577 4894 gene locus_tag LOCUS_03880 4577 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 6144 4963 gene locus_tag LOCUS_03890 6144 4963 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943291.1 protein_id gnl|my_center|LOCUS_03890 6965 6558 gene locus_tag LOCUS_03900 6965 6558 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388492.1 protein_id gnl|my_center|LOCUS_03900 7528 6962 gene locus_tag LOCUS_03910 7528 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 8113 7553 gene locus_tag LOCUS_03920 gene msrA 8113 7553 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945865.1 protein_id gnl|my_center|LOCUS_03920 8213 8365 gene locus_tag LOCUS_03930 8213 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 8899 8561 gene locus_tag LOCUS_03940 8899 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 9497 9015 gene locus_tag LOCUS_03950 9497 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 10887 9877 gene locus_tag LOCUS_03960 10887 9877 CDS product GPMC system family 4 glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643499.1 protein_id gnl|my_center|LOCUS_03960 11325 10912 gene locus_tag LOCUS_03970 11325 10912 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941659.1 protein_id gnl|my_center|LOCUS_03970 11549 11474 gene locus_tag LOCUS_t00080 11549 11474 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12069 11596 gene locus_tag LOCUS_03980 12069 11596 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941052.1 protein_id gnl|my_center|LOCUS_03980 12572 12246 gene locus_tag LOCUS_03990 12572 12246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 12477 13268 gene locus_tag LOCUS_04000 12477 13268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 13892 13377 gene locus_tag LOCUS_04010 13892 13377 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941558.1 protein_id gnl|my_center|LOCUS_04010 14055 15233 gene locus_tag LOCUS_04020 14055 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 15272 15922 gene locus_tag LOCUS_04030 15272 15922 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941429.1 protein_id gnl|my_center|LOCUS_04030 16471 16043 gene locus_tag LOCUS_04040 16471 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 16753 18933 gene locus_tag LOCUS_04050 16753 18933 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_04050 19092 19589 gene locus_tag LOCUS_04060 19092 19589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 20336 19629 gene locus_tag LOCUS_04070 20336 19629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_04070 21124 20438 gene locus_tag LOCUS_04080 21124 20438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942024.1 protein_id gnl|my_center|LOCUS_04080 21612 21130 gene locus_tag LOCUS_04090 21612 21130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_04090 21725 22009 gene locus_tag LOCUS_04100 21725 22009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 22322 22056 gene locus_tag LOCUS_04110 22322 22056 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 protein_id gnl|my_center|LOCUS_04110 22717 22319 gene locus_tag LOCUS_04120 22717 22319 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942308.1 protein_id gnl|my_center|LOCUS_04120 23967 22720 gene locus_tag LOCUS_04130 23967 22720 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943072.1 protein_id gnl|my_center|LOCUS_04130 25082 24096 gene locus_tag LOCUS_04140 25082 24096 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_04140 26052 25075 gene locus_tag LOCUS_04150 gene pdhA 26052 25075 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_04150 26279 27364 gene locus_tag LOCUS_04160 26279 27364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943125.1 protein_id gnl|my_center|LOCUS_04160 27388 28278 gene locus_tag LOCUS_04170 gene rocF 27388 28278 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038039155.1 protein_id gnl|my_center|LOCUS_04170 28301 28738 gene locus_tag LOCUS_04180 28301 28738 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944056.1 transl_except (pos:28508..28510,aa:Sec) note codon on position 70 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_04180 29536 31815 gene locus_tag LOCUS_04190 29536 31815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 33395 31983 gene locus_tag LOCUS_04200 gene merA 33395 31983 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944034.1 protein_id gnl|my_center|LOCUS_04200 33852 33490 gene locus_tag LOCUS_04210 33852 33490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941583.1 protein_id gnl|my_center|LOCUS_04210 34082 34300 gene locus_tag LOCUS_04220 34082 34300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 34433 34921 gene locus_tag LOCUS_04230 34433 34921 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942833.1 protein_id gnl|my_center|LOCUS_04230 34943 35149 gene locus_tag LOCUS_04240 34943 35149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940754.1 protein_id gnl|my_center|LOCUS_04240 36702 35326 gene locus_tag LOCUS_04250 gene prsR 36702 35326 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_04250 38776 36716 gene locus_tag LOCUS_04260 gene prsK 38776 36716 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_04260 39824 38793 gene locus_tag LOCUS_04270 39824 38793 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_04270 40099 40296 gene locus_tag LOCUS_04280 40099 40296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 40401 41822 gene locus_tag LOCUS_04290 40401 41822 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_04290 41857 43275 gene locus_tag LOCUS_04300 41857 43275 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_04300 43577 45406 gene locus_tag LOCUS_04310 gene glmS 43577 45406 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_04310 45663 48548 gene locus_tag LOCUS_04320 45663 48548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 48937 48752 gene locus_tag LOCUS_04330 48937 48752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 48851 52054 gene locus_tag LOCUS_04340 48851 52054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 52803 52111 gene locus_tag LOCUS_04350 52803 52111 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942636.1 protein_id gnl|my_center|LOCUS_04350 54314 52830 gene locus_tag LOCUS_04360 54314 52830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 55059 56426 gene locus_tag LOCUS_04370 55059 56426 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_04370 56487 57290 gene locus_tag LOCUS_04380 56487 57290 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942629.1 protein_id gnl|my_center|LOCUS_04380 57335 58813 gene locus_tag LOCUS_04390 57335 58813 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_04390 58872 59675 gene locus_tag LOCUS_04400 58872 59675 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_04400 59763 60932 gene locus_tag LOCUS_04410 59763 60932 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044863.1 protein_id gnl|my_center|LOCUS_04410 60951 62177 gene locus_tag LOCUS_04420 60951 62177 CDS product TIGR03016 family PEP-CTERM system-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942625.1 protein_id gnl|my_center|LOCUS_04420 62188 63111 gene locus_tag LOCUS_04430 62188 63111 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176621.1 protein_id gnl|my_center|LOCUS_04430 63113 63961 gene locus_tag LOCUS_04440 63113 63961 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_04440 64049 65302 gene locus_tag LOCUS_04450 64049 65302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 65299 66303 gene locus_tag LOCUS_04460 65299 66303 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_04460 66300 67982 gene locus_tag LOCUS_04470 66300 67982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 68084 69130 gene locus_tag LOCUS_04480 68084 69130 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061733.1 protein_id gnl|my_center|LOCUS_04480 69153 70406 gene locus_tag LOCUS_04490 69153 70406 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257505.1 protein_id gnl|my_center|LOCUS_04490 70396 71061 gene locus_tag LOCUS_04500 70396 71061 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088734.1 protein_id gnl|my_center|LOCUS_04500 72248 71418 gene locus_tag LOCUS_04510 72248 71418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 72770 78553 gene locus_tag LOCUS_04520 72770 78553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 78608 81982 gene locus_tag LOCUS_04530 78608 81982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 82046 86857 gene locus_tag LOCUS_04540 82046 86857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 87314 88336 gene locus_tag LOCUS_04550 87314 88336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 88362 89366 gene locus_tag LOCUS_04560 88362 89366 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942606.1 protein_id gnl|my_center|LOCUS_04560 89620 90807 gene locus_tag LOCUS_04570 89620 90807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 90829 92457 gene locus_tag LOCUS_04580 gene acsA 90829 92457 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 protein_id gnl|my_center|LOCUS_04580 92459 92695 gene locus_tag LOCUS_04590 92459 92695 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291951.1 protein_id gnl|my_center|LOCUS_04590 92745 93626 gene locus_tag LOCUS_04600 92745 93626 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_04600 93751 95034 gene locus_tag LOCUS_04610 93751 95034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 95027 95728 gene locus_tag LOCUS_04620 95027 95728 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787336.1 protein_id gnl|my_center|LOCUS_04620 95774 96379 gene locus_tag LOCUS_04630 95774 96379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 96401 97576 gene locus_tag LOCUS_04640 96401 97576 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_04640 97561 98118 gene locus_tag LOCUS_04650 97561 98118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 98132 99226 gene locus_tag LOCUS_04660 gene bshA 98132 99226 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831222.1 protein_id gnl|my_center|LOCUS_04660 99538 101613 gene locus_tag LOCUS_04670 99538 101613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 102406 103041 gene locus_tag LOCUS_04680 102406 103041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 103076 104971 gene locus_tag LOCUS_04690 103076 104971 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_04690 104983 106104 gene locus_tag LOCUS_04700 104983 106104 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_04700 107146 106130 gene locus_tag LOCUS_04710 107146 106130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 107819 110584 gene locus_tag LOCUS_04720 107819 110584 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942590.1 protein_id gnl|my_center|LOCUS_04720 110662 110850 gene locus_tag LOCUS_04730 110662 110850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 111039 113018 gene locus_tag LOCUS_04740 111039 113018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 113433 114431 gene locus_tag LOCUS_04750 113433 114431 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257630.1 protein_id gnl|my_center|LOCUS_04750 114636 114851 gene locus_tag LOCUS_04760 114636 114851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 115062 116609 gene locus_tag LOCUS_04770 115062 116609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 116888 117040 gene locus_tag LOCUS_04780 116888 117040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 117055 117348 gene locus_tag LOCUS_04790 117055 117348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 117514 118524 gene locus_tag LOCUS_04800 117514 118524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 118689 118892 gene locus_tag LOCUS_04810 118689 118892 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940866.1 protein_id gnl|my_center|LOCUS_04810 119083 120255 gene locus_tag LOCUS_04820 119083 120255 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229037.1 protein_id gnl|my_center|LOCUS_04820 120255 121382 gene locus_tag LOCUS_04830 120255 121382 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_04830 122172 121513 gene locus_tag LOCUS_04840 122172 121513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 123179 122169 gene locus_tag LOCUS_04850 gene amrS 123179 122169 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_04850 124456 123422 gene locus_tag LOCUS_04860 124456 123422 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_04860 124849 125031 gene locus_tag LOCUS_04870 124849 125031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 125212 125598 gene locus_tag LOCUS_04880 125212 125598 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_04880 125817 126701 gene locus_tag LOCUS_04890 125817 126701 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_04890 126876 129554 gene locus_tag LOCUS_04900 126876 129554 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942970.1 protein_id gnl|my_center|LOCUS_04900 130321 129707 gene locus_tag LOCUS_04910 130321 129707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 132068 130416 gene locus_tag LOCUS_04920 gene pgi 132068 130416 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_04920 132806 132072 gene locus_tag LOCUS_04930 gene pgl 132806 132072 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_04930 134332 132824 gene locus_tag LOCUS_04940 gene zwf 134332 132824 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_04940 135418 134390 gene locus_tag LOCUS_04950 gene gnd 135418 134390 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_04950 135870 135403 gene locus_tag LOCUS_04960 gene rpiB 135870 135403 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_04960 136447 137028 gene locus_tag LOCUS_04970 136447 137028 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942047.1 protein_id gnl|my_center|LOCUS_04970 137025 138740 gene locus_tag LOCUS_04980 137025 138740 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942046.1 protein_id gnl|my_center|LOCUS_04980 138871 139536 gene locus_tag LOCUS_04990 gene fkpA 138871 139536 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174645.1 protein_id gnl|my_center|LOCUS_04990 139541 139975 gene locus_tag LOCUS_05000 139541 139975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 140057 145888 gene locus_tag LOCUS_05010 140057 145888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 148158 147988 gene locus_tag LOCUS_05020 148158 147988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 148123 148560 gene locus_tag LOCUS_05030 148123 148560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05030 149276 149001 gene locus_tag LOCUS_05040 149276 149001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 149652 149918 gene locus_tag LOCUS_05050 149652 149918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 149998 150669 gene locus_tag LOCUS_05060 149998 150669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 150677 152128 gene locus_tag LOCUS_05070 150677 152128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 152204 153439 gene locus_tag LOCUS_05080 152204 153439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 153426 154352 gene locus_tag LOCUS_05090 153426 154352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 154376 155524 gene locus_tag LOCUS_05100 154376 155524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 155645 156778 gene locus_tag LOCUS_05110 155645 156778 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_05110 158101 158736 gene locus_tag LOCUS_05120 158101 158736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 158729 159883 gene locus_tag LOCUS_05130 gene wlbF 158729 159883 CDS product O-antigen biosynthesis aminotransferase WlbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853419.1 protein_id gnl|my_center|LOCUS_05130 159880 160476 gene locus_tag LOCUS_05140 gene wlbG 159880 160476 CDS product O-antigen biosynthesis protein WlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929610.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence04 101 1729 gene locus_tag LOCUS_05150 101 1729 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_05150 1763 3220 gene locus_tag LOCUS_05160 1763 3220 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_05160 3606 3304 gene locus_tag LOCUS_05170 3606 3304 CDS product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943940.1 protein_id gnl|my_center|LOCUS_05170 4655 3675 gene locus_tag LOCUS_05180 4655 3675 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_05180 4915 4682 gene locus_tag LOCUS_05190 4915 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 5687 4932 gene locus_tag LOCUS_05200 5687 4932 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209713.1 protein_id gnl|my_center|LOCUS_05200 6008 5697 gene locus_tag LOCUS_05210 6008 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 6226 6711 gene locus_tag LOCUS_05220 6226 6711 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_05220 6788 7303 gene locus_tag LOCUS_05230 gene tpx 6788 7303 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_05230 9555 7342 gene locus_tag LOCUS_05240 9555 7342 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943091.1 protein_id gnl|my_center|LOCUS_05240 10632 9574 gene locus_tag LOCUS_05250 10632 9574 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943093.1 protein_id gnl|my_center|LOCUS_05250 11155 10640 gene locus_tag LOCUS_05260 11155 10640 CDS product UPF0158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943094.1 protein_id gnl|my_center|LOCUS_05260 11154 11879 gene locus_tag LOCUS_05270 11154 11879 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943095.1 protein_id gnl|my_center|LOCUS_05270 12974 11913 gene locus_tag LOCUS_05280 12974 11913 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943097.1 protein_id gnl|my_center|LOCUS_05280 14419 13391 gene locus_tag LOCUS_05290 14419 13391 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942549.1 protein_id gnl|my_center|LOCUS_05290 14643 16229 gene locus_tag LOCUS_05300 14643 16229 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942732.1 protein_id gnl|my_center|LOCUS_05300 16244 17134 gene locus_tag LOCUS_05310 16244 17134 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_05310 17286 17465 gene locus_tag LOCUS_05320 17286 17465 CDS product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941661.1 protein_id gnl|my_center|LOCUS_05320 17933 17526 gene locus_tag LOCUS_05330 17933 17526 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943560.1 protein_id gnl|my_center|LOCUS_05330 20392 17924 gene locus_tag LOCUS_05340 20392 17924 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_05340 21283 20450 gene locus_tag LOCUS_05350 21283 20450 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044986.1 protein_id gnl|my_center|LOCUS_05350 21334 23376 gene locus_tag LOCUS_05360 gene ligA 21334 23376 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_05360 23463 24365 gene locus_tag LOCUS_05370 23463 24365 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940966.1 protein_id gnl|my_center|LOCUS_05370 24451 24939 gene locus_tag LOCUS_05380 24451 24939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 25042 25764 gene locus_tag LOCUS_05390 25042 25764 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943939.1 protein_id gnl|my_center|LOCUS_05390 26076 27500 gene locus_tag LOCUS_05400 26076 27500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 27597 28598 gene locus_tag LOCUS_05410 gene ugpC 27597 28598 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867305.1 protein_id gnl|my_center|LOCUS_05410 28595 29515 gene locus_tag LOCUS_05420 28595 29515 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529761.1 protein_id gnl|my_center|LOCUS_05420 29560 30402 gene locus_tag LOCUS_05430 29560 30402 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529760.1 protein_id gnl|my_center|LOCUS_05430 30419 30979 gene locus_tag LOCUS_05440 30419 30979 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_05440 31323 31033 gene locus_tag LOCUS_05450 31323 31033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 31510 32526 gene locus_tag LOCUS_05460 gene dusB 31510 32526 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_05460 32566 33675 gene locus_tag LOCUS_05470 gene gnfL 32566 33675 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_05470 33751 35193 gene locus_tag LOCUS_05480 gene gnfM 33751 35193 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_05480 35222 35788 gene locus_tag LOCUS_05490 35222 35788 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_05490 35875 37092 gene locus_tag LOCUS_05500 35875 37092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 38483 37188 gene locus_tag LOCUS_05510 38483 37188 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943163.1 protein_id gnl|my_center|LOCUS_05510 39445 38492 gene locus_tag LOCUS_05520 gene cysK 39445 38492 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036918.1 protein_id gnl|my_center|LOCUS_05520 42602 39504 gene locus_tag LOCUS_05530 42602 39504 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_05530 43728 42616 gene locus_tag LOCUS_05540 43728 42616 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_05540 44226 43927 gene locus_tag LOCUS_05550 44226 43927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 44880 44398 gene locus_tag LOCUS_05560 44880 44398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 45190 46524 gene locus_tag LOCUS_05570 45190 46524 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_05570 46874 46620 gene locus_tag LOCUS_05580 46874 46620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 48018 47170 gene locus_tag LOCUS_05590 48018 47170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 48224 49657 gene locus_tag LOCUS_05600 48224 49657 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943740.1 protein_id gnl|my_center|LOCUS_05600 49667 50344 gene locus_tag LOCUS_05610 49667 50344 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943739.1 protein_id gnl|my_center|LOCUS_05610 50378 51664 gene locus_tag LOCUS_05620 50378 51664 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534674.1 protein_id gnl|my_center|LOCUS_05620 51661 54807 gene locus_tag LOCUS_05630 gene muxB 51661 54807 CDS product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_05630 54804 57923 gene locus_tag LOCUS_05640 gene mdtC 54804 57923 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667558.1 protein_id gnl|my_center|LOCUS_05640 57920 59350 gene locus_tag LOCUS_05650 57920 59350 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_05650 59412 59720 gene locus_tag LOCUS_05660 59412 59720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 59921 60406 gene locus_tag LOCUS_05670 59921 60406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 60599 61876 gene locus_tag LOCUS_05680 60599 61876 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_05680 62094 62708 gene locus_tag LOCUS_05690 gene wrbA 62094 62708 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_05690 62902 63789 gene locus_tag LOCUS_05700 62902 63789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 63852 65186 gene locus_tag LOCUS_05710 63852 65186 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941507.1 protein_id gnl|my_center|LOCUS_05710 65204 65593 gene locus_tag LOCUS_05720 65204 65593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 65781 66509 gene locus_tag LOCUS_05730 gene ric 65781 66509 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941513.1 protein_id gnl|my_center|LOCUS_05730 66566 67837 gene locus_tag LOCUS_05740 66566 67837 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941161.1 protein_id gnl|my_center|LOCUS_05740 68082 68546 gene locus_tag LOCUS_05750 gene nrfH 68082 68546 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943776.1 protein_id gnl|my_center|LOCUS_05750 68620 70017 gene locus_tag LOCUS_05760 68620 70017 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943775.1 protein_id gnl|my_center|LOCUS_05760 70078 71079 gene locus_tag LOCUS_05770 70078 71079 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943774.1 protein_id gnl|my_center|LOCUS_05770 71128 71658 gene locus_tag LOCUS_05780 71128 71658 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943771.1 protein_id gnl|my_center|LOCUS_05780 71677 72369 gene locus_tag LOCUS_05790 71677 72369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 72578 72799 gene locus_tag LOCUS_05800 72578 72799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943297.1 protein_id gnl|my_center|LOCUS_05800 72803 73258 gene locus_tag LOCUS_05810 72803 73258 CDS product iron-sulfur cluster-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943298.1 protein_id gnl|my_center|LOCUS_05810 73258 73806 gene locus_tag LOCUS_05820 73258 73806 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_05820 73828 73965 gene locus_tag LOCUS_05830 73828 73965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 75379 74201 gene locus_tag LOCUS_05840 75379 74201 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205325.1 protein_id gnl|my_center|LOCUS_05840 76764 75526 gene locus_tag LOCUS_05850 76764 75526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 77797 76805 gene locus_tag LOCUS_05860 77797 76805 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176672.1 protein_id gnl|my_center|LOCUS_05860 78867 77929 gene locus_tag LOCUS_05870 78867 77929 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023914.1 protein_id gnl|my_center|LOCUS_05870 79562 78885 gene locus_tag LOCUS_05880 79562 78885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 80586 79567 gene locus_tag LOCUS_05890 80586 79567 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943634.1 protein_id gnl|my_center|LOCUS_05890 81150 81815 gene locus_tag LOCUS_05900 81150 81815 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 protein_id gnl|my_center|LOCUS_05900 82019 81831 gene locus_tag LOCUS_05910 82019 81831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 83596 82307 gene locus_tag LOCUS_05920 83596 82307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 83820 83593 gene locus_tag LOCUS_05930 83820 83593 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_05930 84074 84799 gene locus_tag LOCUS_05940 84074 84799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 84911 85843 gene locus_tag LOCUS_05950 84911 85843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 85888 86298 gene locus_tag LOCUS_05960 85888 86298 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226054.1 protein_id gnl|my_center|LOCUS_05960 86890 88413 gene locus_tag LOCUS_05970 86890 88413 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941969.1 protein_id gnl|my_center|LOCUS_05970 88421 89107 gene locus_tag LOCUS_05980 88421 89107 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941968.1 protein_id gnl|my_center|LOCUS_05980 89132 89467 gene locus_tag LOCUS_05990 89132 89467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 90279 89818 gene locus_tag LOCUS_06000 90279 89818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 90616 91575 gene locus_tag LOCUS_06010 gene arsS 90616 91575 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272452.1 protein_id gnl|my_center|LOCUS_06010 91572 92216 gene locus_tag LOCUS_06020 91572 92216 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_06020 92727 92533 gene locus_tag LOCUS_06030 92727 92533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 93131 92796 gene locus_tag LOCUS_06040 93131 92796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943272.1 protein_id gnl|my_center|LOCUS_06040 94937 93567 gene locus_tag LOCUS_06050 94937 93567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 95204 95389 gene locus_tag LOCUS_06060 95204 95389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 95386 95676 gene locus_tag LOCUS_06070 95386 95676 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942407.1 protein_id gnl|my_center|LOCUS_06070 95866 96060 gene locus_tag LOCUS_06080 95866 96060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 96044 96523 gene locus_tag LOCUS_06090 96044 96523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 96513 97310 gene locus_tag LOCUS_06100 96513 97310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 97386 97613 gene locus_tag LOCUS_06110 97386 97613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 97600 98178 gene locus_tag LOCUS_06120 97600 98178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 98178 98858 gene locus_tag LOCUS_06130 98178 98858 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_06130 98855 99184 gene locus_tag LOCUS_06140 98855 99184 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214298.1 protein_id gnl|my_center|LOCUS_06140 99194 99484 gene locus_tag LOCUS_06150 99194 99484 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942407.1 protein_id gnl|my_center|LOCUS_06150 99686 99823 gene locus_tag LOCUS_06160 99686 99823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 101037 100962 gene locus_tag LOCUS_t00090 101037 100962 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 101608 102099 gene locus_tag LOCUS_06170 101608 102099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 102242 102562 gene locus_tag LOCUS_06180 102242 102562 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_06180 104136 102655 gene locus_tag LOCUS_06190 104136 102655 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_06190 108788 104196 gene locus_tag LOCUS_06200 gene gltB 108788 104196 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_06200 109152 109571 gene locus_tag LOCUS_06210 109152 109571 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_06210 109588 110691 gene locus_tag LOCUS_06220 109588 110691 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_06220 110709 111500 gene locus_tag LOCUS_06230 110709 111500 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942292.1 protein_id gnl|my_center|LOCUS_06230 112118 111750 gene locus_tag LOCUS_06240 112118 111750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 113523 112210 gene locus_tag LOCUS_06250 113523 112210 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942640.1 protein_id gnl|my_center|LOCUS_06250 114596 113520 gene locus_tag LOCUS_06260 114596 113520 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 protein_id gnl|my_center|LOCUS_06260 114894 114664 gene locus_tag LOCUS_06270 gene hfq 114894 114664 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942642.1 protein_id gnl|my_center|LOCUS_06270 115823 114891 gene locus_tag LOCUS_06280 gene miaA 115823 114891 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_06280 117658 115820 gene locus_tag LOCUS_06290 gene mutL 117658 115820 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_06290 118388 117813 gene locus_tag LOCUS_06300 118388 117813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941113.1 protein_id gnl|my_center|LOCUS_06300 119150 118404 gene locus_tag LOCUS_06310 119150 118404 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941114.1 protein_id gnl|my_center|LOCUS_06310 120076 119147 gene locus_tag LOCUS_06320 gene prmA 120076 119147 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_06320 120238 121050 gene locus_tag LOCUS_06330 120238 121050 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941117.1 protein_id gnl|my_center|LOCUS_06330 121121 121792 gene locus_tag LOCUS_06340 121121 121792 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_06340 121925 123325 gene locus_tag LOCUS_06350 121925 123325 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_06350 123383 124357 gene locus_tag LOCUS_06360 123383 124357 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940802.1 protein_id gnl|my_center|LOCUS_06360 124380 125549 gene locus_tag LOCUS_06370 gene rdgC 124380 125549 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940809.1 protein_id gnl|my_center|LOCUS_06370 125780 126772 gene locus_tag LOCUS_06380 gene obgE 125780 126772 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_06380 126772 127893 gene locus_tag LOCUS_06390 gene proB 126772 127893 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_06390 128420 127995 gene locus_tag LOCUS_06400 128420 127995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 129115 129762 gene locus_tag LOCUS_06410 129115 129762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 129832 130146 gene locus_tag LOCUS_06420 129832 130146 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 protein_id gnl|my_center|LOCUS_06420 130263 130412 gene locus_tag LOCUS_06430 130263 130412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 134576 130581 gene locus_tag LOCUS_06440 134576 130581 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113331.1 protein_id gnl|my_center|LOCUS_06440 136390 134573 gene locus_tag LOCUS_06450 136390 134573 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261137.1 protein_id gnl|my_center|LOCUS_06450 138854 136398 gene locus_tag LOCUS_06460 138854 136398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 140020 138917 gene locus_tag LOCUS_06470 140020 138917 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941518.1 protein_id gnl|my_center|LOCUS_06470 140721 140131 gene locus_tag LOCUS_06480 gene pal 140721 140131 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940702.1 protein_id gnl|my_center|LOCUS_06480 141051 140872 gene locus_tag LOCUS_06490 141051 140872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 >Feature sequence05 3433 389 gene locus_tag LOCUS_06500 3433 389 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165792415.1 protein_id gnl|my_center|LOCUS_06500 3759 3430 gene locus_tag LOCUS_06510 3759 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 5932 4505 gene locus_tag LOCUS_06520 5932 4505 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943353.1 protein_id gnl|my_center|LOCUS_06520 7411 6014 gene locus_tag LOCUS_06530 gene gltX 7411 6014 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_06530 7718 8431 gene locus_tag LOCUS_06540 7718 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 9369 8440 gene locus_tag LOCUS_06550 9369 8440 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941249.1 protein_id gnl|my_center|LOCUS_06550 10033 9398 gene locus_tag LOCUS_06560 gene thiE 10033 9398 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_06560 10808 10026 gene locus_tag LOCUS_06570 10808 10026 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_06570 11071 10853 gene locus_tag LOCUS_06580 gene thiS 11071 10853 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_06580 11495 11827 gene locus_tag LOCUS_06590 11495 11827 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941712.1 protein_id gnl|my_center|LOCUS_06590 11860 12951 gene locus_tag LOCUS_06600 11860 12951 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_06600 13127 13450 gene locus_tag LOCUS_06610 13127 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 13454 14203 gene locus_tag LOCUS_06620 13454 14203 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943654.1 protein_id gnl|my_center|LOCUS_06620 14210 14995 gene locus_tag LOCUS_06630 14210 14995 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943655.1 protein_id gnl|my_center|LOCUS_06630 15367 15227 gene locus_tag LOCUS_06640 15367 15227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 15471 15662 gene locus_tag LOCUS_06650 15471 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 16388 15591 gene locus_tag LOCUS_06660 gene ttcA 16388 15591 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940803.1 protein_id gnl|my_center|LOCUS_06660 17496 16393 gene locus_tag LOCUS_06670 17496 16393 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943101.1 protein_id gnl|my_center|LOCUS_06670 17825 18820 gene locus_tag LOCUS_06680 17825 18820 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943926.1 protein_id gnl|my_center|LOCUS_06680 19605 18901 gene locus_tag LOCUS_06690 gene cobI 19605 18901 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_06690 20822 19605 gene locus_tag LOCUS_06700 20822 19605 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_06700 21258 21614 gene locus_tag LOCUS_06710 21258 21614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 24604 21680 gene locus_tag LOCUS_06720 24604 21680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 26562 24757 gene locus_tag LOCUS_06730 gene typA 26562 24757 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_06730 27918 26662 gene locus_tag LOCUS_06740 27918 26662 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_06740 28887 28099 gene locus_tag LOCUS_06750 28887 28099 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_06750 28987 29907 gene locus_tag LOCUS_06760 28987 29907 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941786.1 protein_id gnl|my_center|LOCUS_06760 31135 29930 gene locus_tag LOCUS_06770 gene coaBC 31135 29930 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_06770 31948 31325 gene locus_tag LOCUS_06780 31948 31325 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_06780 32020 32208 gene locus_tag LOCUS_06790 32020 32208 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943805.1 protein_id gnl|my_center|LOCUS_06790 32232 32390 gene locus_tag LOCUS_06800 32232 32390 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943806.1 protein_id gnl|my_center|LOCUS_06800 32598 32419 gene locus_tag LOCUS_06810 32598 32419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943807.1 protein_id gnl|my_center|LOCUS_06810 33727 32654 gene locus_tag LOCUS_06820 33727 32654 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_06820 34476 36332 gene locus_tag LOCUS_06830 34476 36332 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_06830 38425 36614 gene locus_tag LOCUS_06840 38425 36614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 39772 38519 gene locus_tag LOCUS_06850 gene nrfD 39772 38519 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_06850 40575 39775 gene locus_tag LOCUS_06860 40575 39775 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_06860 41069 40572 gene locus_tag LOCUS_06870 41069 40572 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940746.1 protein_id gnl|my_center|LOCUS_06870 41360 42904 gene locus_tag LOCUS_06880 41360 42904 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_06880 43155 42991 gene locus_tag LOCUS_06890 43155 42991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 44116 43166 gene locus_tag LOCUS_06900 gene trxB 44116 43166 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941156.1 protein_id gnl|my_center|LOCUS_06900 44256 45461 gene locus_tag LOCUS_06910 gene ilvA 44256 45461 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941154.1 protein_id gnl|my_center|LOCUS_06910 45474 46871 gene locus_tag LOCUS_06920 45474 46871 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_06920 47279 46902 gene locus_tag LOCUS_06930 47279 46902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 47658 47260 gene locus_tag LOCUS_06940 47658 47260 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390484.1 protein_id gnl|my_center|LOCUS_06940 48293 47661 gene locus_tag LOCUS_06950 48293 47661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 49197 48382 gene locus_tag LOCUS_06960 49197 48382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 55997 49296 gene locus_tag LOCUS_06970 55997 49296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 59394 55990 gene locus_tag LOCUS_06980 59394 55990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06980 61921 59579 gene locus_tag LOCUS_06990 61921 59579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 63808 61958 gene locus_tag LOCUS_07000 63808 61958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 64944 63859 gene locus_tag LOCUS_07010 64944 63859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 66773 65091 gene locus_tag LOCUS_07020 66773 65091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 67655 66801 gene locus_tag LOCUS_07030 67655 66801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 68986 67652 gene locus_tag LOCUS_07040 68986 67652 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868275.1 protein_id gnl|my_center|LOCUS_07040 70199 69003 gene locus_tag LOCUS_07050 70199 69003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 71856 70216 gene locus_tag LOCUS_07060 71856 70216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 73042 71909 gene locus_tag LOCUS_07070 73042 71909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 75008 73068 gene locus_tag LOCUS_07080 75008 73068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 75665 75042 gene locus_tag LOCUS_07090 75665 75042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 76755 75712 gene locus_tag LOCUS_07100 76755 75712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 77864 76770 gene locus_tag LOCUS_07110 77864 76770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 79177 77921 gene locus_tag LOCUS_07120 79177 77921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 80782 79388 gene locus_tag LOCUS_07130 80782 79388 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_07130 82212 80782 gene locus_tag LOCUS_07140 82212 80782 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941041.1 protein_id gnl|my_center|LOCUS_07140 82319 83593 gene locus_tag LOCUS_07150 82319 83593 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941036.1 protein_id gnl|my_center|LOCUS_07150 85235 83628 gene locus_tag LOCUS_07160 85235 83628 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_07160 85800 86615 gene locus_tag LOCUS_07170 85800 86615 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943501.1 protein_id gnl|my_center|LOCUS_07170 86612 87937 gene locus_tag LOCUS_07180 86612 87937 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943423.1 protein_id gnl|my_center|LOCUS_07180 87948 89945 gene locus_tag LOCUS_07190 87948 89945 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943422.1 protein_id gnl|my_center|LOCUS_07190 90231 91139 gene locus_tag LOCUS_07200 90231 91139 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035416.1 protein_id gnl|my_center|LOCUS_07200 93084 91279 gene locus_tag LOCUS_07210 93084 91279 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550944.1 protein_id gnl|my_center|LOCUS_07210 93943 95112 gene locus_tag LOCUS_07220 93943 95112 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477243.1 protein_id gnl|my_center|LOCUS_07220 95096 96802 gene locus_tag LOCUS_07230 95096 96802 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 protein_id gnl|my_center|LOCUS_07230 96819 97610 gene locus_tag LOCUS_07240 96819 97610 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 protein_id gnl|my_center|LOCUS_07240 97595 99670 gene locus_tag LOCUS_07250 97595 99670 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815954.1 protein_id gnl|my_center|LOCUS_07250 99751 100665 gene locus_tag LOCUS_07260 99751 100665 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957633.1 protein_id gnl|my_center|LOCUS_07260 100796 102109 gene locus_tag LOCUS_07270 100796 102109 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901990.1 protein_id gnl|my_center|LOCUS_07270 102327 102830 gene locus_tag LOCUS_07280 102327 102830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 102861 103550 gene locus_tag LOCUS_07290 102861 103550 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244373.1 protein_id gnl|my_center|LOCUS_07290 103568 104224 gene locus_tag LOCUS_07300 103568 104224 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_07300 104490 105647 gene locus_tag LOCUS_07310 104490 105647 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_07310 105764 106729 gene locus_tag LOCUS_07320 105764 106729 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_07320 106732 107553 gene locus_tag LOCUS_07330 106732 107553 CDS product glutaconate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272325.1 protein_id gnl|my_center|LOCUS_07330 109153 109722 gene locus_tag LOCUS_07340 109153 109722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 109769 109963 gene locus_tag LOCUS_07350 109769 109963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 110196 111653 gene locus_tag LOCUS_07360 110196 111653 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_07360 111771 112505 gene locus_tag LOCUS_07370 111771 112505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 112610 112846 gene locus_tag LOCUS_07380 112610 112846 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490270.1 protein_id gnl|my_center|LOCUS_07380 112884 113363 gene locus_tag LOCUS_07390 112884 113363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 113543 113770 gene locus_tag LOCUS_07400 113543 113770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 114613 114179 gene locus_tag LOCUS_07410 114613 114179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 115261 115185 gene locus_tag LOCUS_t00100 115261 115185 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 115455 115751 gene locus_tag LOCUS_07420 115455 115751 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941748.1 protein_id gnl|my_center|LOCUS_07420 115755 117440 gene locus_tag LOCUS_07430 115755 117440 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_07430 117622 118050 gene locus_tag LOCUS_07440 117622 118050 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_07440 119735 118278 gene locus_tag LOCUS_07450 119735 118278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 121227 119932 gene locus_tag LOCUS_07460 121227 119932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 121486 121250 gene locus_tag LOCUS_07470 121486 121250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 123983 121581 gene locus_tag LOCUS_07480 123983 121581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 125597 124239 gene locus_tag LOCUS_07490 125597 124239 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943217.1 protein_id gnl|my_center|LOCUS_07490 127375 125594 gene locus_tag LOCUS_07500 127375 125594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence06 267 641 gene locus_tag LOCUS_07510 gene gcvH 267 641 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941044.1 protein_id gnl|my_center|LOCUS_07510 749 2095 gene locus_tag LOCUS_07520 gene gcvPA 749 2095 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941045.1 protein_id gnl|my_center|LOCUS_07520 2086 3534 gene locus_tag LOCUS_07530 gene gcvPB 2086 3534 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941046.1 protein_id gnl|my_center|LOCUS_07530 3648 4790 gene locus_tag LOCUS_07540 3648 4790 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_07540 4833 5420 gene locus_tag LOCUS_07550 4833 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 5444 6052 gene locus_tag LOCUS_07560 gene yfbR 5444 6052 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072449.1 protein_id gnl|my_center|LOCUS_07560 7145 6132 gene locus_tag LOCUS_07570 7145 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_07570 7708 7265 gene locus_tag LOCUS_07580 7708 7265 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943773.1 protein_id gnl|my_center|LOCUS_07580 7938 8465 gene locus_tag LOCUS_07590 7938 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 8478 9716 gene locus_tag LOCUS_07600 8478 9716 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_07600 9830 10594 gene locus_tag LOCUS_07610 gene kdsB 9830 10594 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_07610 10627 12234 gene locus_tag LOCUS_07620 10627 12234 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_07620 12238 13068 gene locus_tag LOCUS_07630 gene kdsA 12238 13068 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_07630 13065 14033 gene locus_tag LOCUS_07640 13065 14033 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_07640 14033 14548 gene locus_tag LOCUS_07650 14033 14548 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_07650 14701 15276 gene locus_tag LOCUS_07660 14701 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 15366 15914 gene locus_tag LOCUS_07670 gene lptA 15366 15914 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942534.1 protein_id gnl|my_center|LOCUS_07670 15874 16638 gene locus_tag LOCUS_07680 gene lptB 15874 16638 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_07680 16733 18172 gene locus_tag LOCUS_07690 gene rpoN 16733 18172 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_07690 18225 18773 gene locus_tag LOCUS_07700 gene raiA 18225 18773 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_07700 18785 19759 gene locus_tag LOCUS_07710 gene hprK 18785 19759 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_07710 19756 20625 gene locus_tag LOCUS_07720 gene rapZ 19756 20625 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_07720 20622 21014 gene locus_tag LOCUS_07730 20622 21014 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_07730 21069 21335 gene locus_tag LOCUS_07740 21069 21335 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_07740 21316 23079 gene locus_tag LOCUS_07750 gene ptsP 21316 23079 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_07750 23090 23878 gene locus_tag LOCUS_07760 23090 23878 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_07760 23882 25399 gene locus_tag LOCUS_07770 23882 25399 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942685.1 protein_id gnl|my_center|LOCUS_07770 25396 26769 gene locus_tag LOCUS_07780 25396 26769 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_07780 26978 27763 gene locus_tag LOCUS_07790 26978 27763 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_07790 27816 28115 gene locus_tag LOCUS_07800 27816 28115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 28209 34448 gene locus_tag LOCUS_07810 28209 34448 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942681.1 protein_id gnl|my_center|LOCUS_07810 34445 34951 gene locus_tag LOCUS_07820 34445 34951 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942680.1 protein_id gnl|my_center|LOCUS_07820 34929 35330 gene locus_tag LOCUS_07830 34929 35330 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942679.1 protein_id gnl|my_center|LOCUS_07830 35343 36665 gene locus_tag LOCUS_07840 35343 36665 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942678.1 protein_id gnl|my_center|LOCUS_07840 36667 37374 gene locus_tag LOCUS_07850 36667 37374 CDS product type IV pilus minor pilin PilX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942677.1 protein_id gnl|my_center|LOCUS_07850 37613 37813 gene locus_tag LOCUS_07860 37613 37813 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_07860 37832 38887 gene locus_tag LOCUS_07870 gene pilM 37832 38887 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_07870 38884 39465 gene locus_tag LOCUS_07880 38884 39465 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_07880 39494 40105 gene locus_tag LOCUS_07890 39494 40105 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_07890 40074 40625 gene locus_tag LOCUS_07900 40074 40625 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942672.1 protein_id gnl|my_center|LOCUS_07900 40637 43402 gene locus_tag LOCUS_07910 40637 43402 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942671.1 protein_id gnl|my_center|LOCUS_07910 43421 44098 gene locus_tag LOCUS_07920 43421 44098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 44242 44853 gene locus_tag LOCUS_07930 44242 44853 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_07930 44902 45240 gene locus_tag LOCUS_07940 44902 45240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 45392 48100 gene locus_tag LOCUS_07950 45392 48100 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_07950 48204 49760 gene locus_tag LOCUS_07960 48204 49760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943248.1 protein_id gnl|my_center|LOCUS_07960 49933 51384 gene locus_tag LOCUS_07970 49933 51384 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943247.1 protein_id gnl|my_center|LOCUS_07970 51481 53418 gene locus_tag LOCUS_07980 51481 53418 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_07980 53536 54021 gene locus_tag LOCUS_07990 gene rimP 53536 54021 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_07990 54052 55230 gene locus_tag LOCUS_08000 gene nusA 54052 55230 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_08000 55240 55851 gene locus_tag LOCUS_08010 55240 55851 CDS product DUF448 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942232.1 protein_id gnl|my_center|LOCUS_08010 55848 58517 gene locus_tag LOCUS_08020 gene infB 55848 58517 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_08020 58581 58952 gene locus_tag LOCUS_08030 58581 58952 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942234.1 protein_id gnl|my_center|LOCUS_08030 58924 59883 gene locus_tag LOCUS_08040 58924 59883 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_08040 59880 60791 gene locus_tag LOCUS_08050 gene truB 59880 60791 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_08050 60912 61178 gene locus_tag LOCUS_08060 gene rpsO 60912 61178 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_08060 61358 63463 gene locus_tag LOCUS_08070 gene pnp 61358 63463 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_08070 63697 63622 gene locus_tag LOCUS_t00110 63697 63622 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 66230 63864 gene locus_tag LOCUS_08080 gene ppk1 66230 63864 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943936.1 protein_id gnl|my_center|LOCUS_08080 66458 67402 gene locus_tag LOCUS_08090 66458 67402 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942295.1 protein_id gnl|my_center|LOCUS_08090 67405 67707 gene locus_tag LOCUS_08100 67405 67707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 68867 67821 gene locus_tag LOCUS_08110 68867 67821 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_08110 70689 68860 gene locus_tag LOCUS_08120 70689 68860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 70905 73316 gene locus_tag LOCUS_08130 70905 73316 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_08130 73419 74792 gene locus_tag LOCUS_08140 73419 74792 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942302.1 protein_id gnl|my_center|LOCUS_08140 74885 76126 gene locus_tag LOCUS_08150 gene hisS 74885 76126 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_08150 76197 76769 gene locus_tag LOCUS_08160 76197 76769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 76960 77553 gene locus_tag LOCUS_08170 76960 77553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 77723 78454 gene locus_tag LOCUS_08180 77723 78454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 78456 79256 gene locus_tag LOCUS_08190 78456 79256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 79258 80106 gene locus_tag LOCUS_08200 79258 80106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942146.1 protein_id gnl|my_center|LOCUS_08200 81712 80192 gene locus_tag LOCUS_08210 gene metG 81712 80192 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_08210 82821 81709 gene locus_tag LOCUS_08220 82821 81709 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942871.1 protein_id gnl|my_center|LOCUS_08220 83841 82861 gene locus_tag LOCUS_08230 gene holB 83841 82861 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_08230 84556 83828 gene locus_tag LOCUS_08240 gene tmk 84556 83828 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_08240 84685 85395 gene locus_tag LOCUS_08250 gene rnc 84685 85395 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942868.1 protein_id gnl|my_center|LOCUS_08250 85563 86450 gene locus_tag LOCUS_08260 85563 86450 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_08260 86454 87527 gene locus_tag LOCUS_08270 86454 87527 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_08270 87708 89012 gene locus_tag LOCUS_08280 87708 89012 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_08280 89424 89221 gene locus_tag LOCUS_08290 89424 89221 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942197.1 protein_id gnl|my_center|LOCUS_08290 90650 89436 gene locus_tag LOCUS_08300 90650 89436 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 protein_id gnl|my_center|LOCUS_08300 91838 91035 gene locus_tag LOCUS_08310 91838 91035 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938516.1 protein_id gnl|my_center|LOCUS_08310 92522 91941 gene locus_tag LOCUS_08320 92522 91941 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_08320 93065 92631 gene locus_tag LOCUS_08330 93065 92631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 93946 93101 gene locus_tag LOCUS_08340 93946 93101 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_08340 94537 93968 gene locus_tag LOCUS_08350 94537 93968 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941436.1 protein_id gnl|my_center|LOCUS_08350 95187 94606 gene locus_tag LOCUS_08360 95187 94606 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_08360 95495 96046 gene locus_tag LOCUS_08370 95495 96046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 97074 96421 gene locus_tag LOCUS_08380 97074 96421 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529947.1 protein_id gnl|my_center|LOCUS_08380 97575 97096 gene locus_tag LOCUS_08390 97575 97096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 97690 98643 gene locus_tag LOCUS_08400 97690 98643 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113809.1 protein_id gnl|my_center|LOCUS_08400 98781 99020 gene locus_tag LOCUS_08410 98781 99020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 99110 98901 gene locus_tag LOCUS_08420 99110 98901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942473.1 protein_id gnl|my_center|LOCUS_08420 99404 99126 gene locus_tag LOCUS_08430 99404 99126 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942472.1 protein_id gnl|my_center|LOCUS_08430 103552 99494 gene locus_tag LOCUS_08440 103552 99494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 105450 103852 gene locus_tag LOCUS_08450 gene nadB 105450 103852 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_08450 105619 106848 gene locus_tag LOCUS_08460 105619 106848 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545257.1 protein_id gnl|my_center|LOCUS_08460 106979 107542 gene locus_tag LOCUS_08470 gene rsmD 106979 107542 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_08470 107539 108024 gene locus_tag LOCUS_08480 gene coaD 107539 108024 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_08480 108186 108377 gene locus_tag LOCUS_08490 108186 108377 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941897.1 protein_id gnl|my_center|LOCUS_08490 108460 109536 gene locus_tag LOCUS_08500 108460 109536 CDS product DUF5634 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941896.1 protein_id gnl|my_center|LOCUS_08500 109790 110929 gene locus_tag LOCUS_08510 109790 110929 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940799.1 protein_id gnl|my_center|LOCUS_08510 110933 112630 gene locus_tag LOCUS_08520 110933 112630 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940798.1 protein_id gnl|my_center|LOCUS_08520 112724 113392 gene locus_tag LOCUS_08530 gene cybH 112724 113392 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_08530 113466 113966 gene locus_tag LOCUS_08540 113466 113966 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_08540 114403 113963 gene locus_tag LOCUS_08550 114403 113963 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942074.1 protein_id gnl|my_center|LOCUS_08550 114753 114418 gene locus_tag LOCUS_08560 114753 114418 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_08560 118024 114773 gene locus_tag LOCUS_08570 118024 114773 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942076.1 protein_id gnl|my_center|LOCUS_08570 118278 118021 gene locus_tag LOCUS_08580 118278 118021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942077.1 protein_id gnl|my_center|LOCUS_08580 119837 118272 gene locus_tag LOCUS_08590 119837 118272 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942078.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence07 1110 196 gene locus_tag LOCUS_08600 gene nadA 1110 196 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_08600 1595 1236 gene locus_tag LOCUS_08610 1595 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943209.1 protein_id gnl|my_center|LOCUS_08610 4069 1784 gene locus_tag LOCUS_08620 4069 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 4311 4387 gene locus_tag LOCUS_t00120 4311 4387 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4765 7329 gene locus_tag LOCUS_08630 4765 7329 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_08630 7456 9663 gene locus_tag LOCUS_08640 7456 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 9650 9922 gene locus_tag LOCUS_08650 9650 9922 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941037.1 protein_id gnl|my_center|LOCUS_08650 12011 10029 gene locus_tag LOCUS_08660 12011 10029 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_08660 12616 12101 gene locus_tag LOCUS_08670 12616 12101 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_08670 12772 13608 gene locus_tag LOCUS_08680 12772 13608 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940893.1 protein_id gnl|my_center|LOCUS_08680 13605 15248 gene locus_tag LOCUS_08690 gene ctaD 13605 15248 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940894.1 protein_id gnl|my_center|LOCUS_08690 15245 17962 gene locus_tag LOCUS_08700 15245 17962 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_08700 18036 18638 gene locus_tag LOCUS_08710 18036 18638 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940895.1 protein_id gnl|my_center|LOCUS_08710 18685 18972 gene locus_tag LOCUS_08720 18685 18972 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940896.1 protein_id gnl|my_center|LOCUS_08720 19006 19911 gene locus_tag LOCUS_08730 gene coxB 19006 19911 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940897.1 protein_id gnl|my_center|LOCUS_08730 19908 20738 gene locus_tag LOCUS_08740 19908 20738 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940898.1 protein_id gnl|my_center|LOCUS_08740 20867 21172 gene locus_tag LOCUS_08750 20867 21172 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941456.1 protein_id gnl|my_center|LOCUS_08750 21986 21249 gene locus_tag LOCUS_08760 21986 21249 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_08760 22446 22102 gene locus_tag LOCUS_08770 22446 22102 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943861.1 protein_id gnl|my_center|LOCUS_08770 22582 23094 gene locus_tag LOCUS_08780 22582 23094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 23081 24061 gene locus_tag LOCUS_08790 gene moaA 23081 24061 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943768.1 protein_id gnl|my_center|LOCUS_08790 24063 24506 gene locus_tag LOCUS_08800 24063 24506 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943767.1 protein_id gnl|my_center|LOCUS_08800 24673 26325 gene locus_tag LOCUS_08810 24673 26325 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039057.1 protein_id gnl|my_center|LOCUS_08810 26315 27586 gene locus_tag LOCUS_08820 26315 27586 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103419.1 protein_id gnl|my_center|LOCUS_08820 27626 29398 gene locus_tag LOCUS_08830 27626 29398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 29994 30608 gene locus_tag LOCUS_08840 29994 30608 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_08840 30601 31587 gene locus_tag LOCUS_08850 30601 31587 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_08850 31584 34730 gene locus_tag LOCUS_08860 31584 34730 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_08860 34910 37267 gene locus_tag LOCUS_08870 34910 37267 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_08870 37276 38052 gene locus_tag LOCUS_08880 37276 38052 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940707.1 protein_id gnl|my_center|LOCUS_08880 38124 38795 gene locus_tag LOCUS_08890 gene tolQ 38124 38795 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_08890 38799 39212 gene locus_tag LOCUS_08900 gene tolR 38799 39212 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_08900 39212 39991 gene locus_tag LOCUS_08910 39212 39991 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940704.1 protein_id gnl|my_center|LOCUS_08910 40012 41304 gene locus_tag LOCUS_08920 gene tolB 40012 41304 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_08920 41448 42032 gene locus_tag LOCUS_08930 gene pal 41448 42032 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940702.1 protein_id gnl|my_center|LOCUS_08930 42169 42477 gene locus_tag LOCUS_08940 42169 42477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 42582 42806 gene locus_tag LOCUS_08950 42582 42806 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_08950 42803 43636 gene locus_tag LOCUS_08960 42803 43636 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941065.1 protein_id gnl|my_center|LOCUS_08960 43921 45759 gene locus_tag LOCUS_08970 43921 45759 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_08970 46163 45828 gene locus_tag LOCUS_08980 gene hypA 46163 45828 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_08980 46477 46289 gene locus_tag LOCUS_08990 46477 46289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 47027 46695 gene locus_tag LOCUS_09000 47027 46695 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943945.1 protein_id gnl|my_center|LOCUS_09000 47907 47098 gene locus_tag LOCUS_09010 47907 47098 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_09010 47919 49001 gene locus_tag LOCUS_09020 47919 49001 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941541.1 protein_id gnl|my_center|LOCUS_09020 50175 48985 gene locus_tag LOCUS_09030 50175 48985 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941150.1 protein_id gnl|my_center|LOCUS_09030 50849 50193 gene locus_tag LOCUS_09040 50849 50193 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941248.1 protein_id gnl|my_center|LOCUS_09040 51989 50895 gene locus_tag LOCUS_09050 51989 50895 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_09050 52349 52068 gene locus_tag LOCUS_09060 52349 52068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 52611 52321 gene locus_tag LOCUS_09070 52611 52321 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_09070 52542 52718 gene locus_tag LOCUS_09080 52542 52718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 53260 52736 gene locus_tag LOCUS_09090 53260 52736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 54997 53477 gene locus_tag LOCUS_09100 gene gpmI 54997 53477 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_09100 55473 55015 gene locus_tag LOCUS_09110 55473 55015 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943826.1 protein_id gnl|my_center|LOCUS_09110 55889 55470 gene locus_tag LOCUS_09120 gene rsfS 55889 55470 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943827.1 protein_id gnl|my_center|LOCUS_09120 56530 55880 gene locus_tag LOCUS_09130 gene nadD 56530 55880 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_09130 57651 56527 gene locus_tag LOCUS_09140 57651 56527 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940982.1 protein_id gnl|my_center|LOCUS_09140 58550 57708 gene locus_tag LOCUS_09150 58550 57708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 59095 58547 gene locus_tag LOCUS_09160 59095 58547 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940988.1 protein_id gnl|my_center|LOCUS_09160 60405 59092 gene locus_tag LOCUS_09170 gene gspL 60405 59092 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940989.1 protein_id gnl|my_center|LOCUS_09170 61353 60427 gene locus_tag LOCUS_09180 gene gspK 61353 60427 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940990.1 protein_id gnl|my_center|LOCUS_09180 61979 61350 gene locus_tag LOCUS_09190 61979 61350 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940991.1 protein_id gnl|my_center|LOCUS_09190 62298 61954 gene locus_tag LOCUS_09200 62298 61954 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940992.1 protein_id gnl|my_center|LOCUS_09200 62795 62295 gene locus_tag LOCUS_09210 62795 62295 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940993.1 protein_id gnl|my_center|LOCUS_09210 63839 62799 gene locus_tag LOCUS_09220 63839 62799 CDS product bifunctional UDP-4-keto-pentose/UDP-xylose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193921.1 protein_id gnl|my_center|LOCUS_09220 64756 63836 gene locus_tag LOCUS_09230 64756 63836 CDS product formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192441.1 protein_id gnl|my_center|LOCUS_09230 65684 64749 gene locus_tag LOCUS_09240 65684 64749 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191549.1 protein_id gnl|my_center|LOCUS_09240 66842 65700 gene locus_tag LOCUS_09250 66842 65700 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_09250 67915 66839 gene locus_tag LOCUS_09260 gene mqnC 67915 66839 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044953.1 protein_id gnl|my_center|LOCUS_09260 68920 68255 gene locus_tag LOCUS_09270 gene rsmG 68920 68255 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944072.1 protein_id gnl|my_center|LOCUS_09270 70812 68917 gene locus_tag LOCUS_09280 gene mnmG 70812 68917 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_09280 72211 70844 gene locus_tag LOCUS_09290 gene mnmE 72211 70844 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_09290 73537 72215 gene locus_tag LOCUS_09300 gene yidC 73537 72215 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_09300 74913 76265 gene locus_tag LOCUS_09310 gene dnaA 74913 76265 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940678.1 protein_id gnl|my_center|LOCUS_09310 76474 77595 gene locus_tag LOCUS_09320 gene dnaN 76474 77595 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_09320 77605 78717 gene locus_tag LOCUS_09330 gene recF 77605 78717 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940680.1 protein_id gnl|my_center|LOCUS_09330 78710 81115 gene locus_tag LOCUS_09340 gene gyrB 78710 81115 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_09340 81149 83710 gene locus_tag LOCUS_09350 gene gyrA 81149 83710 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_09350 83730 85313 gene locus_tag LOCUS_09360 83730 85313 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940683.1 protein_id gnl|my_center|LOCUS_09360 85297 86316 gene locus_tag LOCUS_09370 85297 86316 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_09370 86330 86857 gene locus_tag LOCUS_09380 86330 86857 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940698.1 protein_id gnl|my_center|LOCUS_09380 88582 86909 gene locus_tag LOCUS_09390 88582 86909 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_09390 88986 88585 gene locus_tag LOCUS_09400 88986 88585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943735.1 protein_id gnl|my_center|LOCUS_09400 89175 88990 gene locus_tag LOCUS_09410 89175 88990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943736.1 protein_id gnl|my_center|LOCUS_09410 89878 89177 gene locus_tag LOCUS_09420 89878 89177 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_09420 90860 89979 gene locus_tag LOCUS_09430 90860 89979 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944036.1 protein_id gnl|my_center|LOCUS_09430 91618 90857 gene locus_tag LOCUS_09440 91618 90857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944035.1 protein_id gnl|my_center|LOCUS_09440 91939 92790 gene locus_tag LOCUS_09450 91939 92790 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044926.1 protein_id gnl|my_center|LOCUS_09450 92839 94119 gene locus_tag LOCUS_09460 92839 94119 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943814.1 protein_id gnl|my_center|LOCUS_09460 94116 94541 gene locus_tag LOCUS_09470 94116 94541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 94607 97648 gene locus_tag LOCUS_09480 gene pruA 94607 97648 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944006.1 protein_id gnl|my_center|LOCUS_09480 97959 97717 gene locus_tag LOCUS_09490 97959 97717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 98251 99459 gene locus_tag LOCUS_09500 98251 99459 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943766.1 protein_id gnl|my_center|LOCUS_09500 100640 99543 gene locus_tag LOCUS_09510 gene asd 100640 99543 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943507.1 protein_id gnl|my_center|LOCUS_09510 101761 100673 gene locus_tag LOCUS_09520 gene leuB 101761 100673 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_09520 103099 101933 gene locus_tag LOCUS_09530 gene metK 103099 101933 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_09530 103346 104209 gene locus_tag LOCUS_09540 gene mtnP 103346 104209 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_09540 104231 105148 gene locus_tag LOCUS_09550 104231 105148 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_09550 105244 105993 gene locus_tag LOCUS_09560 105244 105993 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941775.1 protein_id gnl|my_center|LOCUS_09560 106005 106868 gene locus_tag LOCUS_09570 106005 106868 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941776.1 protein_id gnl|my_center|LOCUS_09570 107018 107392 gene locus_tag LOCUS_09580 107018 107392 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941778.1 protein_id gnl|my_center|LOCUS_09580 107438 107890 gene locus_tag LOCUS_09590 107438 107890 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_09590 107926 109119 gene locus_tag LOCUS_09600 107926 109119 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941780.1 protein_id gnl|my_center|LOCUS_09600 109289 109687 gene locus_tag LOCUS_09610 109289 109687 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941781.1 protein_id gnl|my_center|LOCUS_09610 109694 111292 gene locus_tag LOCUS_09620 109694 111292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_09620 111321 112421 gene locus_tag LOCUS_09630 111321 112421 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_09630 113352 112501 gene locus_tag LOCUS_09640 113352 112501 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941197.1 protein_id gnl|my_center|LOCUS_09640 114571 113357 gene locus_tag LOCUS_09650 114571 113357 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_09650 114762 115196 gene locus_tag LOCUS_09660 114762 115196 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 protein_id gnl|my_center|LOCUS_09660 115189 115992 gene locus_tag LOCUS_09670 115189 115992 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013663.1 protein_id gnl|my_center|LOCUS_09670 116045 116872 gene locus_tag LOCUS_09680 116045 116872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 117104 117538 gene locus_tag LOCUS_09690 117104 117538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence08 132 662 gene locus_tag LOCUS_09700 132 662 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942768.1 protein_id gnl|my_center|LOCUS_09700 700 1368 gene locus_tag LOCUS_09710 700 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942769.1 protein_id gnl|my_center|LOCUS_09710 1340 2734 gene locus_tag LOCUS_09720 1340 2734 CDS product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942770.1 protein_id gnl|my_center|LOCUS_09720 2731 4158 gene locus_tag LOCUS_09730 2731 4158 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930439.1 protein_id gnl|my_center|LOCUS_09730 4143 4982 gene locus_tag LOCUS_09740 4143 4982 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942772.1 protein_id gnl|my_center|LOCUS_09740 5021 6505 gene locus_tag LOCUS_09750 5021 6505 CDS product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942773.1 protein_id gnl|my_center|LOCUS_09750 6528 6932 gene locus_tag LOCUS_09760 6528 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 7858 6938 gene locus_tag LOCUS_09770 7858 6938 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038232.1 protein_id gnl|my_center|LOCUS_09770 8630 7851 gene locus_tag LOCUS_09780 8630 7851 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038231.1 protein_id gnl|my_center|LOCUS_09780 9350 9658 gene locus_tag LOCUS_09790 9350 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 9728 10324 gene locus_tag LOCUS_09800 gene ybjG 9728 10324 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097424.1 protein_id gnl|my_center|LOCUS_09800 10356 10607 gene locus_tag LOCUS_09810 10356 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 10685 11479 gene locus_tag LOCUS_09820 10685 11479 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528749.1 protein_id gnl|my_center|LOCUS_09820 11532 12290 gene locus_tag LOCUS_09830 11532 12290 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706486.1 protein_id gnl|my_center|LOCUS_09830 12375 13037 gene locus_tag LOCUS_09840 12375 13037 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 protein_id gnl|my_center|LOCUS_09840 13034 14359 gene locus_tag LOCUS_09850 13034 14359 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931889.1 protein_id gnl|my_center|LOCUS_09850 14730 15539 gene locus_tag LOCUS_09860 14730 15539 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942484.1 protein_id gnl|my_center|LOCUS_09860 15570 16763 gene locus_tag LOCUS_09870 15570 16763 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 protein_id gnl|my_center|LOCUS_09870 16756 17226 gene locus_tag LOCUS_09880 16756 17226 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948159.1 protein_id gnl|my_center|LOCUS_09880 17969 18346 gene locus_tag LOCUS_09890 gene crcB 17969 18346 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_09890 18365 18715 gene locus_tag LOCUS_09900 18365 18715 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941172.1 protein_id gnl|my_center|LOCUS_09900 18732 18935 gene locus_tag LOCUS_09910 18732 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 19962 19102 gene locus_tag LOCUS_09920 19962 19102 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521810.1 protein_id gnl|my_center|LOCUS_09920 20197 20012 gene locus_tag LOCUS_09930 20197 20012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 20327 20145 gene locus_tag LOCUS_09940 20327 20145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 21560 20496 gene locus_tag LOCUS_09950 21560 20496 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_09950 21933 21598 gene locus_tag LOCUS_09960 21933 21598 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_09960 22526 21945 gene locus_tag LOCUS_09970 22526 21945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 23205 22639 gene locus_tag LOCUS_09980 23205 22639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 25612 23234 gene locus_tag LOCUS_09990 25612 23234 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105404.1 protein_id gnl|my_center|LOCUS_09990 26539 25691 gene locus_tag LOCUS_10000 gene ccsB 26539 25691 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_10000 27918 26536 gene locus_tag LOCUS_10010 27918 26536 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_10010 29140 28433 gene locus_tag LOCUS_10020 29140 28433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 29544 29167 gene locus_tag LOCUS_10030 29544 29167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 29905 29636 gene locus_tag LOCUS_10040 29905 29636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942776.1 protein_id gnl|my_center|LOCUS_10040 30213 29902 gene locus_tag LOCUS_10050 30213 29902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 30825 30235 gene locus_tag LOCUS_10060 30825 30235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044872.1 protein_id gnl|my_center|LOCUS_10060 31227 30886 gene locus_tag LOCUS_10070 31227 30886 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942779.1 protein_id gnl|my_center|LOCUS_10070 34394 31290 gene locus_tag LOCUS_10080 34394 31290 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_10080 35664 34441 gene locus_tag LOCUS_10090 35664 34441 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_10090 36947 35661 gene locus_tag LOCUS_10100 36947 35661 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942782.1 protein_id gnl|my_center|LOCUS_10100 37375 37049 gene locus_tag LOCUS_10110 37375 37049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044873.1 protein_id gnl|my_center|LOCUS_10110 37887 38906 gene locus_tag LOCUS_10120 37887 38906 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943634.1 protein_id gnl|my_center|LOCUS_10120 38959 39588 gene locus_tag LOCUS_10130 gene cbiQ 38959 39588 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058272.1 protein_id gnl|my_center|LOCUS_10130 39650 40522 gene locus_tag LOCUS_10140 39650 40522 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870600.1 protein_id gnl|my_center|LOCUS_10140 41372 40578 gene locus_tag LOCUS_10150 41372 40578 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_10150 41666 41379 gene locus_tag LOCUS_10160 41666 41379 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942407.1 protein_id gnl|my_center|LOCUS_10160 42001 41672 gene locus_tag LOCUS_10170 42001 41672 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214298.1 protein_id gnl|my_center|LOCUS_10170 42639 41998 gene locus_tag LOCUS_10180 42639 41998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 43261 42632 gene locus_tag LOCUS_10190 43261 42632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 43475 43248 gene locus_tag LOCUS_10200 43475 43248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 43871 43551 gene locus_tag LOCUS_10210 43871 43551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 44688 43873 gene locus_tag LOCUS_10220 44688 43873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 45861 44701 gene locus_tag LOCUS_10230 45861 44701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 46746 45946 gene locus_tag LOCUS_10240 46746 45946 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_10240 49046 46743 gene locus_tag LOCUS_10250 49046 46743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 50247 49060 gene locus_tag LOCUS_10260 50247 49060 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_10260 50982 50323 gene locus_tag LOCUS_10270 50982 50323 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906339.1 protein_id gnl|my_center|LOCUS_10270 54150 51112 gene locus_tag LOCUS_10280 54150 51112 CDS product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462223.1 protein_id gnl|my_center|LOCUS_10280 54815 54147 gene locus_tag LOCUS_10290 54815 54147 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809144.1 protein_id gnl|my_center|LOCUS_10290 55958 54888 gene locus_tag LOCUS_10300 55958 54888 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941533.1 protein_id gnl|my_center|LOCUS_10300 55896 56072 gene locus_tag LOCUS_10310 55896 56072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 56069 56281 gene locus_tag LOCUS_10320 56069 56281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 56366 57064 gene locus_tag LOCUS_10330 56366 57064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 57066 57587 gene locus_tag LOCUS_10340 57066 57587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942811.1 protein_id gnl|my_center|LOCUS_10340 57678 58136 gene locus_tag LOCUS_10350 57678 58136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 58133 58684 gene locus_tag LOCUS_10360 58133 58684 CDS product CHC2 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942812.1 protein_id gnl|my_center|LOCUS_10360 58766 59257 gene locus_tag LOCUS_10370 gene radC 58766 59257 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942813.1 protein_id gnl|my_center|LOCUS_10370 59363 59536 gene locus_tag LOCUS_10380 59363 59536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 59904 59668 gene locus_tag LOCUS_10390 59904 59668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 60238 60011 gene locus_tag LOCUS_10400 60238 60011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 60782 60267 gene locus_tag LOCUS_10410 60782 60267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 61899 60763 gene locus_tag LOCUS_10420 61899 60763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 62070 62297 gene locus_tag LOCUS_10430 62070 62297 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097013212.1 protein_id gnl|my_center|LOCUS_10430 62299 62913 gene locus_tag LOCUS_10440 62299 62913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 63099 62923 gene locus_tag LOCUS_10450 63099 62923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 63990 63121 gene locus_tag LOCUS_10460 63990 63121 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_10460 64640 63990 gene locus_tag LOCUS_10470 64640 63990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_10470 67898 64851 gene locus_tag LOCUS_10480 67898 64851 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480361.1 protein_id gnl|my_center|LOCUS_10480 69022 67886 gene locus_tag LOCUS_10490 69022 67886 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072763.1 protein_id gnl|my_center|LOCUS_10490 70255 69419 gene locus_tag LOCUS_10500 70255 69419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 72299 70245 gene locus_tag LOCUS_10510 72299 70245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 75869 72306 gene locus_tag LOCUS_10520 75869 72306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 77877 75916 gene locus_tag LOCUS_10530 77877 75916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 78049 78294 gene locus_tag LOCUS_10540 78049 78294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 78307 78597 gene locus_tag LOCUS_10550 78307 78597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 84544 78731 gene locus_tag LOCUS_10560 84544 78731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 86315 85344 gene locus_tag LOCUS_10570 86315 85344 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940727.1 protein_id gnl|my_center|LOCUS_10570 86587 86943 gene locus_tag LOCUS_10580 86587 86943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 87878 87531 gene locus_tag LOCUS_10590 87878 87531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 91499 87882 gene locus_tag LOCUS_10600 91499 87882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 92217 91477 gene locus_tag LOCUS_10610 92217 91477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 92478 92227 gene locus_tag LOCUS_10620 92478 92227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 92984 92490 gene locus_tag LOCUS_10630 92984 92490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 93354 92962 gene locus_tag LOCUS_10640 93354 92962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 94360 93377 gene locus_tag LOCUS_10650 94360 93377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 95358 94336 gene locus_tag LOCUS_10660 95358 94336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 95812 95342 gene locus_tag LOCUS_10670 95812 95342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 96465 95809 gene locus_tag LOCUS_10680 96465 95809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 98321 96462 gene locus_tag LOCUS_10690 gene traN 98321 96462 CDS product conjugal transfer protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087340.1 protein_id gnl|my_center|LOCUS_10690 98328 99224 gene locus_tag LOCUS_10700 98328 99224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 99292 99594 gene locus_tag LOCUS_10710 99292 99594 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_10710 99672 99857 gene locus_tag LOCUS_10720 99672 99857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 101201 99933 gene locus_tag LOCUS_10730 101201 99933 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940741.1 protein_id gnl|my_center|LOCUS_10730 101675 103273 gene locus_tag LOCUS_10740 101675 103273 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941694.1 protein_id gnl|my_center|LOCUS_10740 104570 103497 gene locus_tag LOCUS_10750 104570 103497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 105712 105134 gene locus_tag LOCUS_10760 105712 105134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 106187 105819 gene locus_tag LOCUS_10770 106187 105819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence09 267 191 gene locus_tag LOCUS_t00130 267 191 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 637 284 gene locus_tag LOCUS_10780 637 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 942 649 gene locus_tag LOCUS_10790 942 649 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_10790 3428 1026 gene locus_tag LOCUS_10800 gene pheT 3428 1026 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_10800 4510 3452 gene locus_tag LOCUS_10810 gene pheS 4510 3452 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_10810 4894 4541 gene locus_tag LOCUS_10820 gene rplT 4894 4541 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_10820 5168 4971 gene locus_tag LOCUS_10830 gene rpmI 5168 4971 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_10830 5724 5221 gene locus_tag LOCUS_10840 gene infC 5724 5221 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942163.1 protein_id gnl|my_center|LOCUS_10840 7707 5797 gene locus_tag LOCUS_10850 gene thrS 7707 5797 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_10850 7855 7781 gene locus_tag LOCUS_t00140 7855 7781 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9369 7900 gene locus_tag LOCUS_10860 gene rlmD 9369 7900 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942098.1 protein_id gnl|my_center|LOCUS_10860 9963 9370 gene locus_tag LOCUS_10870 9963 9370 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_10870 10676 9960 gene locus_tag LOCUS_10880 gene rph 10676 9960 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_10880 11470 11126 gene locus_tag LOCUS_10890 11470 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 13323 11755 gene locus_tag LOCUS_10900 gene cimA 13323 11755 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_10900 13597 14754 gene locus_tag LOCUS_10910 13597 14754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 14756 16759 gene locus_tag LOCUS_10920 14756 16759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 16848 20423 gene locus_tag LOCUS_10930 16848 20423 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941340.1 protein_id gnl|my_center|LOCUS_10930 20427 21782 gene locus_tag LOCUS_10940 20427 21782 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930455.1 protein_id gnl|my_center|LOCUS_10940 21779 23062 gene locus_tag LOCUS_10950 gene mtaB 21779 23062 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_10950 23141 25648 gene locus_tag LOCUS_10960 23141 25648 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_10960 27005 25698 gene locus_tag LOCUS_10970 27005 25698 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_10970 28752 27025 gene locus_tag LOCUS_10980 28752 27025 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_10980 29773 28802 gene locus_tag LOCUS_10990 gene ispG 29773 28802 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_10990 31404 29992 gene locus_tag LOCUS_11000 gene glnA 31404 29992 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_11000 31821 31483 gene locus_tag LOCUS_11010 31821 31483 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_11010 34167 32080 gene locus_tag LOCUS_11020 34167 32080 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_11020 35112 34399 gene locus_tag LOCUS_11030 35112 34399 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940813.1 protein_id gnl|my_center|LOCUS_11030 35233 36054 gene locus_tag LOCUS_11040 35233 36054 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942481.1 protein_id gnl|my_center|LOCUS_11040 36054 37217 gene locus_tag LOCUS_11050 36054 37217 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942830.1 protein_id gnl|my_center|LOCUS_11050 38204 37287 gene locus_tag LOCUS_11060 38204 37287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 39672 38215 gene locus_tag LOCUS_11070 39672 38215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 40666 39749 gene locus_tag LOCUS_11080 40666 39749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 43720 40679 gene locus_tag LOCUS_11090 43720 40679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 45990 44014 gene locus_tag LOCUS_11100 45990 44014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940971.1 protein_id gnl|my_center|LOCUS_11100 46811 45993 gene locus_tag LOCUS_11110 46811 45993 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943921.1 protein_id gnl|my_center|LOCUS_11110 47825 46854 gene locus_tag LOCUS_11120 47825 46854 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948166.1 protein_id gnl|my_center|LOCUS_11120 48092 47874 gene locus_tag LOCUS_11130 48092 47874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 49747 48254 gene locus_tag LOCUS_11140 49747 48254 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_11140 49861 50070 gene locus_tag LOCUS_11150 49861 50070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 50063 50458 gene locus_tag LOCUS_11160 50063 50458 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_11160 52072 50534 gene locus_tag LOCUS_11170 52072 50534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 52867 52217 gene locus_tag LOCUS_11180 52867 52217 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_11180 52841 53113 gene locus_tag LOCUS_11190 52841 53113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 55941 53050 gene locus_tag LOCUS_11200 55941 53050 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_11200 56332 56781 gene locus_tag LOCUS_11210 56332 56781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 58736 56928 gene locus_tag LOCUS_11220 58736 56928 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940906.1 protein_id gnl|my_center|LOCUS_11220 59510 58764 gene locus_tag LOCUS_11230 gene rlmB 59510 58764 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_11230 60229 59507 gene locus_tag LOCUS_11240 gene pyrF 60229 59507 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_11240 61087 60464 gene locus_tag LOCUS_11250 61087 60464 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072260.1 protein_id gnl|my_center|LOCUS_11250 61511 62692 gene locus_tag LOCUS_11260 61511 62692 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682062.1 protein_id gnl|my_center|LOCUS_11260 62692 63252 gene locus_tag LOCUS_11270 gene thpR 62692 63252 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_11270 64071 63319 gene locus_tag LOCUS_11280 64071 63319 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416261.1 protein_id gnl|my_center|LOCUS_11280 66255 64081 gene locus_tag LOCUS_11290 66255 64081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 67188 66292 gene locus_tag LOCUS_11300 67188 66292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 67522 68655 gene locus_tag LOCUS_11310 67522 68655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 68827 68660 gene locus_tag LOCUS_11320 68827 68660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 69081 68932 gene locus_tag LOCUS_11330 69081 68932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 69402 69235 gene locus_tag LOCUS_11340 69402 69235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 69331 70050 gene locus_tag LOCUS_11350 69331 70050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 71244 70402 gene locus_tag LOCUS_11360 71244 70402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 73265 72522 gene locus_tag LOCUS_11370 73265 72522 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_11370 74020 73265 gene locus_tag LOCUS_11380 74020 73265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_11380 74969 74013 gene locus_tag LOCUS_11390 74969 74013 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_11390 75854 74973 gene locus_tag LOCUS_11400 75854 74973 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_11400 77059 75920 gene locus_tag LOCUS_11410 77059 75920 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_11410 78237 77092 gene locus_tag LOCUS_11420 78237 77092 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942380.1 protein_id gnl|my_center|LOCUS_11420 78691 78260 gene locus_tag LOCUS_11430 78691 78260 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_11430 80023 78722 gene locus_tag LOCUS_11440 80023 78722 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_11440 80730 80113 gene locus_tag LOCUS_11450 80730 80113 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941475.1 protein_id gnl|my_center|LOCUS_11450 81310 80732 gene locus_tag LOCUS_11460 81310 80732 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_11460 83067 81307 gene locus_tag LOCUS_11470 gene iorA 83067 81307 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_11470 84131 83202 gene locus_tag LOCUS_11480 84131 83202 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_11480 85767 84121 gene locus_tag LOCUS_11490 85767 84121 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 protein_id gnl|my_center|LOCUS_11490 86106 85831 gene locus_tag LOCUS_11500 86106 85831 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_11500 87184 86162 gene locus_tag LOCUS_11510 87184 86162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 88513 87197 gene locus_tag LOCUS_11520 gene rlmD 88513 87197 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942393.1 protein_id gnl|my_center|LOCUS_11520 88900 88517 gene locus_tag LOCUS_11530 88900 88517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942394.1 protein_id gnl|my_center|LOCUS_11530 89616 88897 gene locus_tag LOCUS_11540 89616 88897 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942367.1 protein_id gnl|my_center|LOCUS_11540 90380 89613 gene locus_tag LOCUS_11550 90380 89613 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942366.1 protein_id gnl|my_center|LOCUS_11550 90723 90355 gene locus_tag LOCUS_11560 gene queD 90723 90355 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_11560 92203 90827 gene locus_tag LOCUS_11570 92203 90827 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_11570 93463 92306 gene locus_tag LOCUS_11580 93463 92306 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_11580 94151 93450 gene locus_tag LOCUS_11590 94151 93450 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_11590 95386 94169 gene locus_tag LOCUS_11600 95386 94169 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_11600 95574 96869 gene locus_tag LOCUS_11610 gene eno 95574 96869 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_11610 97101 98498 gene locus_tag LOCUS_11620 97101 98498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 99387 100088 gene locus_tag LOCUS_11630 99387 100088 CDS product CAAX prenyl protease-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942635.1 protein_id gnl|my_center|LOCUS_11630 100275 100973 gene locus_tag LOCUS_11640 100275 100973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence10 671 486 gene locus_tag LOCUS_11650 671 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1209 703 gene locus_tag LOCUS_11660 1209 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 10423 1244 gene locus_tag LOCUS_11670 10423 1244 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048273.1 protein_id gnl|my_center|LOCUS_11670 11328 10423 gene locus_tag LOCUS_11680 11328 10423 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546621.1 protein_id gnl|my_center|LOCUS_11680 11502 11341 gene locus_tag LOCUS_11690 11502 11341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 13658 11928 gene locus_tag LOCUS_11700 13658 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 14067 14870 gene locus_tag LOCUS_11710 14067 14870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 14871 17540 gene locus_tag LOCUS_11720 14871 17540 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545171.1 protein_id gnl|my_center|LOCUS_11720 19516 17729 gene locus_tag LOCUS_11730 19516 17729 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_11730 20519 19575 gene locus_tag LOCUS_11740 20519 19575 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245141.1 protein_id gnl|my_center|LOCUS_11740 20912 21076 gene locus_tag LOCUS_11750 20912 21076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 21237 21749 gene locus_tag LOCUS_11760 21237 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 21746 22876 gene locus_tag LOCUS_11770 21746 22876 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_11770 22984 23241 gene locus_tag LOCUS_11780 22984 23241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 23961 23584 gene locus_tag LOCUS_11790 23961 23584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 24221 24066 gene locus_tag LOCUS_11800 24221 24066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 25341 24295 gene locus_tag LOCUS_11810 25341 24295 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200942.1 protein_id gnl|my_center|LOCUS_11810 25737 25886 gene locus_tag LOCUS_11820 25737 25886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 26019 26309 gene locus_tag LOCUS_11830 26019 26309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 26379 26666 gene locus_tag LOCUS_11840 26379 26666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 26704 26922 gene locus_tag LOCUS_11850 26704 26922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 27013 27192 gene locus_tag LOCUS_11860 27013 27192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 27196 27792 gene locus_tag LOCUS_11870 27196 27792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 28677 28051 gene locus_tag LOCUS_11880 28677 28051 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507867.1 protein_id gnl|my_center|LOCUS_11880 29958 28723 gene locus_tag LOCUS_11890 29958 28723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 31133 30114 gene locus_tag LOCUS_11900 31133 30114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 32283 31888 gene locus_tag LOCUS_11910 32283 31888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 32715 32338 gene locus_tag LOCUS_11920 32715 32338 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_11920 33746 32817 gene locus_tag LOCUS_11930 33746 32817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 34995 33784 gene locus_tag LOCUS_11940 34995 33784 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039558.1 protein_id gnl|my_center|LOCUS_11940 36130 35375 gene locus_tag LOCUS_11950 36130 35375 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188337.1 protein_id gnl|my_center|LOCUS_11950 36367 36188 gene locus_tag LOCUS_11960 36367 36188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 38163 36814 gene locus_tag LOCUS_11970 38163 36814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 38491 38330 gene locus_tag LOCUS_11980 38491 38330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 39567 38608 gene locus_tag LOCUS_11990 39567 38608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189146.1 protein_id gnl|my_center|LOCUS_11990 40197 39646 gene locus_tag LOCUS_12000 40197 39646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 42049 40511 gene locus_tag LOCUS_12010 42049 40511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 42423 42046 gene locus_tag LOCUS_12020 42423 42046 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545378.1 protein_id gnl|my_center|LOCUS_12020 44937 42442 gene locus_tag LOCUS_12030 44937 42442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 45579 46454 gene locus_tag LOCUS_12040 45579 46454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 46563 46868 gene locus_tag LOCUS_12050 46563 46868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 48509 46956 gene locus_tag LOCUS_12060 48509 46956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 50830 48506 gene locus_tag LOCUS_12070 50830 48506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 53525 50886 gene locus_tag LOCUS_12080 53525 50886 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_12080 54032 55957 gene locus_tag LOCUS_12090 54032 55957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 56086 57630 gene locus_tag LOCUS_12100 56086 57630 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_12100 57708 57717 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58415 59812 gene locus_tag LOCUS_12110 58415 59812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 59971 61515 gene locus_tag LOCUS_12120 59971 61515 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_12120 62099 62407 gene locus_tag LOCUS_12130 62099 62407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 62511 63479 gene locus_tag LOCUS_12140 62511 63479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 63624 66098 gene locus_tag LOCUS_12150 63624 66098 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942320.1 protein_id gnl|my_center|LOCUS_12150 66183 67424 gene locus_tag LOCUS_12160 66183 67424 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529505.1 protein_id gnl|my_center|LOCUS_12160 67477 67752 gene locus_tag LOCUS_12170 67477 67752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 67709 67858 gene locus_tag LOCUS_12180 67709 67858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 67885 69159 gene locus_tag LOCUS_12190 67885 69159 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943329.1 protein_id gnl|my_center|LOCUS_12190 69173 69964 gene locus_tag LOCUS_12200 69173 69964 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943328.1 protein_id gnl|my_center|LOCUS_12200 70645 70181 gene locus_tag LOCUS_12210 70645 70181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 70912 70837 gene locus_tag LOCUS_t00150 70912 70837 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 71953 70970 gene locus_tag LOCUS_12220 71953 70970 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944064.1 protein_id gnl|my_center|LOCUS_12220 72275 72766 gene locus_tag LOCUS_12230 72275 72766 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_12230 72788 73375 gene locus_tag LOCUS_12240 72788 73375 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_12240 73438 73773 gene locus_tag LOCUS_12250 73438 73773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943272.1 protein_id gnl|my_center|LOCUS_12250 73869 73961 gene locus_tag LOCUS_t00160 73869 73961 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 73985 74479 gene locus_tag LOCUS_12260 73985 74479 CDS product DUF2155 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940716.1 protein_id gnl|my_center|LOCUS_12260 74956 74507 gene locus_tag LOCUS_12270 gene rnhA 74956 74507 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942713.1 protein_id gnl|my_center|LOCUS_12270 75593 74946 gene locus_tag LOCUS_12280 75593 74946 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942714.1 protein_id gnl|my_center|LOCUS_12280 75792 76334 gene locus_tag LOCUS_12290 75792 76334 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943966.1 protein_id gnl|my_center|LOCUS_12290 76327 76680 gene locus_tag LOCUS_12300 76327 76680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 76677 79031 gene locus_tag LOCUS_12310 76677 79031 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941215.1 protein_id gnl|my_center|LOCUS_12310 79156 79455 gene locus_tag LOCUS_12320 79156 79455 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942712.1 protein_id gnl|my_center|LOCUS_12320 79464 80093 gene locus_tag LOCUS_12330 79464 80093 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360256.1 protein_id gnl|my_center|LOCUS_12330 80647 81519 gene locus_tag LOCUS_12340 gene dapA 80647 81519 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_12340 81699 82514 gene locus_tag LOCUS_12350 gene dapB 81699 82514 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_12350 82714 83946 gene locus_tag LOCUS_12360 82714 83946 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_12360 83993 84226 gene locus_tag LOCUS_12370 83993 84226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 84294 84449 gene locus_tag LOCUS_12380 84294 84449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 84456 84674 gene locus_tag LOCUS_12390 84456 84674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 84790 85026 gene locus_tag LOCUS_12400 84790 85026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 85016 85393 gene locus_tag LOCUS_12410 85016 85393 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770889.1 protein_id gnl|my_center|LOCUS_12410 85530 85724 gene locus_tag LOCUS_12420 85530 85724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 86008 86172 gene locus_tag LOCUS_12430 86008 86172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 86883 86242 gene locus_tag LOCUS_12440 86883 86242 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_12440 88169 86880 gene locus_tag LOCUS_12450 88169 86880 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 protein_id gnl|my_center|LOCUS_12450 88612 88881 gene locus_tag LOCUS_12460 88612 88881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 88884 89159 gene locus_tag LOCUS_12470 88884 89159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 89182 89658 gene locus_tag LOCUS_12480 89182 89658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 89674 89856 gene locus_tag LOCUS_12490 89674 89856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 90532 89981 gene locus_tag LOCUS_12500 90532 89981 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_12500 90813 91271 gene locus_tag LOCUS_12510 90813 91271 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226555.1 protein_id gnl|my_center|LOCUS_12510 92593 91589 gene locus_tag LOCUS_12520 92593 91589 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943747.1 protein_id gnl|my_center|LOCUS_12520 92904 93041 gene locus_tag LOCUS_12530 92904 93041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 94827 93295 gene locus_tag LOCUS_12540 94827 93295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 96333 94852 gene locus_tag LOCUS_12550 96333 94852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 96769 97575 gene locus_tag LOCUS_12560 96769 97575 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_12560 97575 98321 gene locus_tag LOCUS_12570 97575 98321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 99416 98382 gene locus_tag LOCUS_12580 99416 98382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence11 401 327 gene locus_tag LOCUS_t00170 401 327 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1299 457 gene locus_tag LOCUS_12590 gene ispE 1299 457 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_12590 1529 2551 gene locus_tag LOCUS_12600 1529 2551 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_12600 2548 3510 gene locus_tag LOCUS_12610 2548 3510 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_12610 3514 4050 gene locus_tag LOCUS_12620 3514 4050 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941689.1 protein_id gnl|my_center|LOCUS_12620 4091 4876 gene locus_tag LOCUS_12630 4091 4876 CDS product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942519.1 protein_id gnl|my_center|LOCUS_12630 6155 4962 gene locus_tag LOCUS_12640 6155 4962 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_12640 6230 7111 gene locus_tag LOCUS_12650 6230 7111 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941707.1 protein_id gnl|my_center|LOCUS_12650 7230 7619 gene locus_tag LOCUS_12660 gene rpsF 7230 7619 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941326.1 protein_id gnl|my_center|LOCUS_12660 7641 7961 gene locus_tag LOCUS_12670 7641 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 7973 8941 gene locus_tag LOCUS_12680 7973 8941 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941328.1 protein_id gnl|my_center|LOCUS_12680 8965 9408 gene locus_tag LOCUS_12690 gene rplI 8965 9408 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_12690 9606 10946 gene locus_tag LOCUS_12700 9606 10946 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941517.1 protein_id gnl|my_center|LOCUS_12700 11009 14239 gene locus_tag LOCUS_12710 11009 14239 CDS product AsmA-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941537.1 protein_id gnl|my_center|LOCUS_12710 15234 14407 gene locus_tag LOCUS_12720 gene lpxC 15234 14407 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941392.1 protein_id gnl|my_center|LOCUS_12720 15912 15238 gene locus_tag LOCUS_12730 gene cysE 15912 15238 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_12730 16111 17736 gene locus_tag LOCUS_12740 16111 17736 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941660.1 protein_id gnl|my_center|LOCUS_12740 18153 17824 gene locus_tag LOCUS_12750 18153 17824 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942385.1 protein_id gnl|my_center|LOCUS_12750 18449 19651 gene locus_tag LOCUS_12760 gene rpsA 18449 19651 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_12760 19736 20242 gene locus_tag LOCUS_12770 19736 20242 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_12770 20389 21282 gene locus_tag LOCUS_12780 20389 21282 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940889.1 protein_id gnl|my_center|LOCUS_12780 22054 21386 gene locus_tag LOCUS_12790 22054 21386 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941429.1 protein_id gnl|my_center|LOCUS_12790 22271 22726 gene locus_tag LOCUS_12800 22271 22726 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942914.1 protein_id gnl|my_center|LOCUS_12800 24462 22816 gene locus_tag LOCUS_12810 24462 22816 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943604.1 protein_id gnl|my_center|LOCUS_12810 25928 24588 gene locus_tag LOCUS_12820 25928 24588 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_12820 26023 26241 gene locus_tag LOCUS_12830 26023 26241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 26354 26785 gene locus_tag LOCUS_12840 26354 26785 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_12840 26876 28861 gene locus_tag LOCUS_12850 gene feoB 26876 28861 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_12850 28959 29153 gene locus_tag LOCUS_12860 28959 29153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942030.1 protein_id gnl|my_center|LOCUS_12860 29153 29797 gene locus_tag LOCUS_12870 29153 29797 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942031.1 protein_id gnl|my_center|LOCUS_12870 29881 31074 gene locus_tag LOCUS_12880 29881 31074 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_12880 32855 31137 gene locus_tag LOCUS_12890 32855 31137 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943164.1 protein_id gnl|my_center|LOCUS_12890 33877 32993 gene locus_tag LOCUS_12900 gene nudC 33877 32993 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941705.1 protein_id gnl|my_center|LOCUS_12900 34109 34993 gene locus_tag LOCUS_12910 gene mltG 34109 34993 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_12910 35920 35075 gene locus_tag LOCUS_12920 35920 35075 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193057.1 protein_id gnl|my_center|LOCUS_12920 37848 35917 gene locus_tag LOCUS_12930 37848 35917 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_12930 38630 37983 gene locus_tag LOCUS_12940 38630 37983 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_12940 39043 38687 gene locus_tag LOCUS_12950 gene rplS 39043 38687 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941309.1 protein_id gnl|my_center|LOCUS_12950 39666 39091 gene locus_tag LOCUS_12960 39666 39091 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941308.1 protein_id gnl|my_center|LOCUS_12960 40393 39644 gene locus_tag LOCUS_12970 gene trmD 40393 39644 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_12970 40911 40390 gene locus_tag LOCUS_12980 gene rimM 40911 40390 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858943.1 protein_id gnl|my_center|LOCUS_12980 41142 40912 gene locus_tag LOCUS_12990 41142 40912 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941305.1 protein_id gnl|my_center|LOCUS_12990 41465 41199 gene locus_tag LOCUS_13000 gene rpsP 41465 41199 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642952.1 protein_id gnl|my_center|LOCUS_13000 42887 41526 gene locus_tag LOCUS_13010 gene ffh 42887 41526 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_13010 43633 43055 gene locus_tag LOCUS_13020 gene yedF 43633 43055 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943158.1 protein_id gnl|my_center|LOCUS_13020 43908 43630 gene locus_tag LOCUS_13030 43908 43630 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941302.1 protein_id gnl|my_center|LOCUS_13030 44002 44250 gene locus_tag LOCUS_13040 44002 44250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941301.1 protein_id gnl|my_center|LOCUS_13040 44252 44740 gene locus_tag LOCUS_13050 44252 44740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 46249 45176 gene locus_tag LOCUS_13060 46249 45176 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940905.1 protein_id gnl|my_center|LOCUS_13060 48076 46286 gene locus_tag LOCUS_13070 48076 46286 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940906.1 protein_id gnl|my_center|LOCUS_13070 49801 48122 gene locus_tag LOCUS_13080 gene ettA 49801 48122 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_13080 49979 50470 gene locus_tag LOCUS_13090 49979 50470 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942287.1 protein_id gnl|my_center|LOCUS_13090 50619 50798 gene locus_tag LOCUS_13100 50619 50798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 50868 51275 gene locus_tag LOCUS_13110 50868 51275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 51277 53070 gene locus_tag LOCUS_13120 51277 53070 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266274.1 protein_id gnl|my_center|LOCUS_13120 53129 53341 gene locus_tag LOCUS_13130 53129 53341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 54647 53322 gene locus_tag LOCUS_13140 54647 53322 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084725968.1 protein_id gnl|my_center|LOCUS_13140 57196 54644 gene locus_tag LOCUS_13150 57196 54644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 57471 58463 gene locus_tag LOCUS_13160 gene bioB 57471 58463 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_13160 58460 59176 gene locus_tag LOCUS_13170 gene bioD 58460 59176 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_13170 59173 60534 gene locus_tag LOCUS_13180 gene bioA 59173 60534 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_13180 60669 62066 gene locus_tag LOCUS_13190 60669 62066 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_13190 62432 62061 gene locus_tag LOCUS_13200 62432 62061 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941789.1 protein_id gnl|my_center|LOCUS_13200 62691 62615 gene locus_tag LOCUS_t00180 62691 62615 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 62820 62745 gene locus_tag LOCUS_t00190 62820 62745 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 62906 62830 gene locus_tag LOCUS_t00200 62906 62830 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 63215 62937 gene locus_tag LOCUS_13210 63215 62937 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_13210 64681 63425 gene locus_tag LOCUS_13220 gene clpX 64681 63425 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_13220 65277 64678 gene locus_tag LOCUS_13230 gene clpP 65277 64678 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_13230 66632 65322 gene locus_tag LOCUS_13240 gene tig 66632 65322 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_13240 66777 66693 gene locus_tag LOCUS_t00210 66777 66693 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 67252 66896 gene locus_tag LOCUS_13250 67252 66896 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941351.1 protein_id gnl|my_center|LOCUS_13250 68076 67255 gene locus_tag LOCUS_13260 68076 67255 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_13260 68927 68076 gene locus_tag LOCUS_13270 68927 68076 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_13270 69426 69016 gene locus_tag LOCUS_13280 69426 69016 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_13280 71162 69423 gene locus_tag LOCUS_13290 71162 69423 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942831.1 protein_id gnl|my_center|LOCUS_13290 71819 71169 gene locus_tag LOCUS_13300 71819 71169 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942832.1 protein_id gnl|my_center|LOCUS_13300 72136 71816 gene locus_tag LOCUS_13310 gene yhbY 72136 71816 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941918.1 protein_id gnl|my_center|LOCUS_13310 72388 74436 gene locus_tag LOCUS_13320 gene shc 72388 74436 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_13320 74610 75599 gene locus_tag LOCUS_13330 74610 75599 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_13330 75612 77480 gene locus_tag LOCUS_13340 gene dxs 75612 77480 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_13340 77504 78502 gene locus_tag LOCUS_13350 gene hpnH 77504 78502 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_13350 81678 78697 gene locus_tag LOCUS_13360 81678 78697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 83675 81729 gene locus_tag LOCUS_13370 83675 81729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 83882 83691 gene locus_tag LOCUS_13380 83882 83691 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941512.1 protein_id gnl|my_center|LOCUS_13380 85563 83929 gene locus_tag LOCUS_13390 85563 83929 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545510.1 protein_id gnl|my_center|LOCUS_13390 85728 85600 gene locus_tag LOCUS_13400 85728 85600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 86230 86730 gene locus_tag LOCUS_13410 86230 86730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 86886 87947 gene locus_tag LOCUS_13420 86886 87947 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113836.1 protein_id gnl|my_center|LOCUS_13420 88181 88639 gene locus_tag LOCUS_13430 88181 88639 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_13430 88754 88960 gene locus_tag LOCUS_13440 88754 88960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 88962 90389 gene locus_tag LOCUS_13450 88962 90389 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942926.1 protein_id gnl|my_center|LOCUS_13450 90391 91002 gene locus_tag LOCUS_13460 gene pncA 90391 91002 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942927.1 protein_id gnl|my_center|LOCUS_13460 92091 91081 gene locus_tag LOCUS_13470 92091 91081 CDS product DUF2950 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941869.1 protein_id gnl|my_center|LOCUS_13470 93404 92136 gene locus_tag LOCUS_13480 93404 92136 CDS product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941870.1 protein_id gnl|my_center|LOCUS_13480 93921 94493 gene locus_tag LOCUS_13490 93921 94493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13490 94742 96148 gene locus_tag LOCUS_13500 94742 96148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence12 198 674 gene locus_tag LOCUS_13510 198 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 717 1715 gene locus_tag LOCUS_13520 717 1715 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_13520 1925 2422 gene locus_tag LOCUS_13530 gene mraZ 1925 2422 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943703.1 protein_id gnl|my_center|LOCUS_13530 2423 3361 gene locus_tag LOCUS_13540 gene rsmH 2423 3361 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_13540 3407 3748 gene locus_tag LOCUS_13550 gene ftsL 3407 3748 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943701.1 protein_id gnl|my_center|LOCUS_13550 3745 5733 gene locus_tag LOCUS_13560 3745 5733 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_13560 5843 7366 gene locus_tag LOCUS_13570 5843 7366 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_13570 7367 8746 gene locus_tag LOCUS_13580 7367 8746 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_13580 8760 9836 gene locus_tag LOCUS_13590 gene mraY 8760 9836 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_13590 9855 11195 gene locus_tag LOCUS_13600 gene murD 9855 11195 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_13600 11207 12391 gene locus_tag LOCUS_13610 gene ftsW 11207 12391 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_13610 12388 13533 gene locus_tag LOCUS_13620 gene murG 12388 13533 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_13620 13523 14899 gene locus_tag LOCUS_13630 gene murC 13523 14899 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_13630 14903 15805 gene locus_tag LOCUS_13640 gene murB 14903 15805 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943692.1 protein_id gnl|my_center|LOCUS_13640 15809 16741 gene locus_tag LOCUS_13650 15809 16741 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_13650 16746 17570 gene locus_tag LOCUS_13660 16746 17570 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943690.1 protein_id gnl|my_center|LOCUS_13660 17603 18844 gene locus_tag LOCUS_13670 gene ftsA 17603 18844 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_13670 19007 20179 gene locus_tag LOCUS_13680 gene ftsZ 19007 20179 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943688.1 protein_id gnl|my_center|LOCUS_13680 20393 22018 gene locus_tag LOCUS_13690 20393 22018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 22038 22535 gene locus_tag LOCUS_13700 22038 22535 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940969.1 protein_id gnl|my_center|LOCUS_13700 22853 23557 gene locus_tag LOCUS_13710 22853 23557 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941332.1 protein_id gnl|my_center|LOCUS_13710 24283 23561 gene locus_tag LOCUS_13720 24283 23561 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941679.1 protein_id gnl|my_center|LOCUS_13720 25185 24283 gene locus_tag LOCUS_13730 25185 24283 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941678.1 protein_id gnl|my_center|LOCUS_13730 25636 25250 gene locus_tag LOCUS_13740 25636 25250 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941887.1 protein_id gnl|my_center|LOCUS_13740 26392 25946 gene locus_tag LOCUS_13750 26392 25946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941882.1 protein_id gnl|my_center|LOCUS_13750 27425 26517 gene locus_tag LOCUS_13760 27425 26517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941881.1 protein_id gnl|my_center|LOCUS_13760 27975 29336 gene locus_tag LOCUS_13770 27975 29336 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941159.1 protein_id gnl|my_center|LOCUS_13770 30451 29414 gene locus_tag LOCUS_13780 gene rlmN 30451 29414 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_13780 31403 30456 gene locus_tag LOCUS_13790 31403 30456 CDS product biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360258.1 protein_id gnl|my_center|LOCUS_13790 32605 31700 gene locus_tag LOCUS_13800 32605 31700 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545595.1 protein_id gnl|my_center|LOCUS_13800 35406 32740 gene locus_tag LOCUS_13810 35406 32740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 36390 36100 gene locus_tag LOCUS_13820 36390 36100 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940931.1 protein_id gnl|my_center|LOCUS_13820 36578 37153 gene locus_tag LOCUS_13830 36578 37153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 37229 37774 gene locus_tag LOCUS_13840 37229 37774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 38071 38571 gene locus_tag LOCUS_13850 38071 38571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 39877 38741 gene locus_tag LOCUS_13860 39877 38741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 41738 39912 gene locus_tag LOCUS_13870 41738 39912 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941997.1 protein_id gnl|my_center|LOCUS_13870 42485 41832 gene locus_tag LOCUS_13880 42485 41832 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941996.1 protein_id gnl|my_center|LOCUS_13880 42603 43481 gene locus_tag LOCUS_13890 42603 43481 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941995.1 protein_id gnl|my_center|LOCUS_13890 43954 43580 gene locus_tag LOCUS_13900 43954 43580 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102185.1 protein_id gnl|my_center|LOCUS_13900 44167 44081 gene locus_tag LOCUS_t00220 44167 44081 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44298 46778 gene locus_tag LOCUS_13910 44298 46778 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_13910 46820 48343 gene locus_tag LOCUS_13920 gene rng 46820 48343 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_13920 48634 48449 gene locus_tag LOCUS_13930 48634 48449 CDS product hydrogenase expression protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943975.1 protein_id gnl|my_center|LOCUS_13930 51124 48842 gene locus_tag LOCUS_13940 51124 48842 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943974.1 protein_id gnl|my_center|LOCUS_13940 51348 51656 gene locus_tag LOCUS_13950 gene rplU 51348 51656 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943851.1 protein_id gnl|my_center|LOCUS_13950 51690 51944 gene locus_tag LOCUS_13960 gene rpmA 51690 51944 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943850.1 protein_id gnl|my_center|LOCUS_13960 52129 54216 gene locus_tag LOCUS_13970 52129 54216 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941245.1 protein_id gnl|my_center|LOCUS_13970 54360 55187 gene locus_tag LOCUS_13980 54360 55187 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941877.1 protein_id gnl|my_center|LOCUS_13980 56084 55248 gene locus_tag LOCUS_13990 gene dapF 56084 55248 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_13990 56799 56449 gene locus_tag LOCUS_14000 56799 56449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 57603 56956 gene locus_tag LOCUS_14010 gene lepB 57603 56956 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_14010 57808 57629 gene locus_tag LOCUS_14020 57808 57629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 58358 57801 gene locus_tag LOCUS_14030 gene rpoE 58358 57801 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_14030 59300 58524 gene locus_tag LOCUS_14040 59300 58524 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_14040 59970 59359 gene locus_tag LOCUS_14050 59970 59359 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_14050 60616 60080 gene locus_tag LOCUS_14060 60616 60080 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_14060 62472 60670 gene locus_tag LOCUS_14070 62472 60670 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895584.1 protein_id gnl|my_center|LOCUS_14070 62920 62516 gene locus_tag LOCUS_14080 62920 62516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 64174 63731 gene locus_tag LOCUS_14090 64174 63731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 65236 64454 gene locus_tag LOCUS_14100 65236 64454 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064638.1 protein_id gnl|my_center|LOCUS_14100 65343 66137 gene locus_tag LOCUS_14110 65343 66137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 66199 66669 gene locus_tag LOCUS_14120 gene ispF 66199 66669 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_14120 67647 66739 gene locus_tag LOCUS_14130 67647 66739 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_14130 67818 69233 gene locus_tag LOCUS_14140 gene hemG 67818 69233 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_14140 69235 69411 gene locus_tag LOCUS_14150 69235 69411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 70110 69427 gene locus_tag LOCUS_14160 70110 69427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 70833 70144 gene locus_tag LOCUS_14170 gene radC 70833 70144 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941054.1 protein_id gnl|my_center|LOCUS_14170 71055 70837 gene locus_tag LOCUS_14180 71055 70837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 71286 74060 gene locus_tag LOCUS_14190 gene ileS 71286 74060 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_14190 74073 74576 gene locus_tag LOCUS_14200 gene lspA 74073 74576 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_14200 74692 76071 gene locus_tag LOCUS_14210 74692 76071 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_14210 76071 76931 gene locus_tag LOCUS_14220 gene ccsB 76071 76931 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_14220 77191 78126 gene locus_tag LOCUS_14230 77191 78126 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941752.1 protein_id gnl|my_center|LOCUS_14230 79555 78257 gene locus_tag LOCUS_14240 79555 78257 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_14240 81352 79679 gene locus_tag LOCUS_14250 gene panP 81352 79679 CDS product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942351.1 protein_id gnl|my_center|LOCUS_14250 82294 81443 gene locus_tag LOCUS_14260 gene panC 82294 81443 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_14260 83091 82291 gene locus_tag LOCUS_14270 gene panB 83091 82291 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_14270 85497 83521 gene locus_tag LOCUS_14280 85497 83521 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942348.1 protein_id gnl|my_center|LOCUS_14280 85891 85517 gene locus_tag LOCUS_14290 85891 85517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 86915 85938 gene locus_tag LOCUS_14300 86915 85938 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_14300 87178 88119 gene locus_tag LOCUS_14310 87178 88119 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_14310 88328 89413 gene locus_tag LOCUS_14320 88328 89413 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_14320 90229 89489 gene locus_tag LOCUS_14330 90229 89489 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941751.1 protein_id gnl|my_center|LOCUS_14330 91814 90348 gene locus_tag LOCUS_14340 gene rfaE1 91814 90348 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_14340 92827 92075 gene locus_tag LOCUS_14350 92827 92075 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943941.1 protein_id gnl|my_center|LOCUS_14350 94113 92827 gene locus_tag LOCUS_14360 94113 92827 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943942.1 protein_id gnl|my_center|LOCUS_14360 94599 94201 gene locus_tag LOCUS_14370 94599 94201 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393562.1 protein_id gnl|my_center|LOCUS_14370 94828 94592 gene locus_tag LOCUS_14380 94828 94592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence13 1635 193 gene locus_tag LOCUS_14390 gene pyk 1635 193 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943944.1 protein_id gnl|my_center|LOCUS_14390 3618 1648 gene locus_tag LOCUS_14400 3618 1648 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943084.1 protein_id gnl|my_center|LOCUS_14400 5080 3611 gene locus_tag LOCUS_14410 gene lpdA 5080 3611 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943085.1 protein_id gnl|my_center|LOCUS_14410 6602 5295 gene locus_tag LOCUS_14420 gene odhB 6602 5295 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943087.1 protein_id gnl|my_center|LOCUS_14420 7933 6758 gene locus_tag LOCUS_14430 gene nifS 7933 6758 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_14430 8802 7930 gene locus_tag LOCUS_14440 gene nifU 8802 7930 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942655.1 protein_id gnl|my_center|LOCUS_14440 10270 8852 gene locus_tag LOCUS_14450 10270 8852 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_14450 10442 10735 gene locus_tag LOCUS_14460 10442 10735 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942657.1 protein_id gnl|my_center|LOCUS_14460 10820 11275 gene locus_tag LOCUS_14470 10820 11275 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_14470 13653 11272 gene locus_tag LOCUS_14480 13653 11272 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942659.1 protein_id gnl|my_center|LOCUS_14480 14497 13658 gene locus_tag LOCUS_14490 14497 13658 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_14490 15975 14497 gene locus_tag LOCUS_14500 15975 14497 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_14500 16434 16048 gene locus_tag LOCUS_14510 gene gcvH 16434 16048 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942661.1 protein_id gnl|my_center|LOCUS_14510 17780 16440 gene locus_tag LOCUS_14520 gene accC 17780 16440 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_14520 18252 17782 gene locus_tag LOCUS_14530 gene accB 18252 17782 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942663.1 protein_id gnl|my_center|LOCUS_14530 19390 18323 gene locus_tag LOCUS_14540 19390 18323 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942664.1 protein_id gnl|my_center|LOCUS_14540 19908 19471 gene locus_tag LOCUS_14550 gene aroQ 19908 19471 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942665.1 protein_id gnl|my_center|LOCUS_14550 20273 19911 gene locus_tag LOCUS_14560 20273 19911 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942666.1 protein_id gnl|my_center|LOCUS_14560 21421 20264 gene locus_tag LOCUS_14570 21421 20264 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044866.1 protein_id gnl|my_center|LOCUS_14570 22503 21418 gene locus_tag LOCUS_14580 gene aroB 22503 21418 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_14580 23018 22500 gene locus_tag LOCUS_14590 23018 22500 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_14590 24198 23011 gene locus_tag LOCUS_14600 gene aroC 24198 23011 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_14600 24418 25809 gene locus_tag LOCUS_14610 24418 25809 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942412.1 protein_id gnl|my_center|LOCUS_14610 26608 26327 gene locus_tag LOCUS_14620 26608 26327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812455.1 protein_id gnl|my_center|LOCUS_14620 31055 26610 gene locus_tag LOCUS_14630 31055 26610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 32746 31052 gene locus_tag LOCUS_14640 32746 31052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14640 31104 31113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34328 33357 gene locus_tag LOCUS_14650 34328 33357 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942413.1 protein_id gnl|my_center|LOCUS_14650 35701 34334 gene locus_tag LOCUS_14660 35701 34334 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_14660 36937 35753 gene locus_tag LOCUS_14670 36937 35753 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_14670 37906 36938 gene locus_tag LOCUS_14680 gene ftsX 37906 36938 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942418.1 protein_id gnl|my_center|LOCUS_14680 38555 37860 gene locus_tag LOCUS_14690 gene ftsE 38555 37860 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_14690 39033 38560 gene locus_tag LOCUS_14700 39033 38560 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_14700 39547 39038 gene locus_tag LOCUS_14710 39547 39038 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_14710 40335 39571 gene locus_tag LOCUS_14720 40335 39571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 42953 40344 gene locus_tag LOCUS_14730 42953 40344 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942422.1 protein_id gnl|my_center|LOCUS_14730 43650 42988 gene locus_tag LOCUS_14740 43650 42988 CDS product type II secretion system protein PulP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942423.1 protein_id gnl|my_center|LOCUS_14740 44198 43647 gene locus_tag LOCUS_14750 44198 43647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 44734 44195 gene locus_tag LOCUS_14760 44734 44195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 45660 44734 gene locus_tag LOCUS_14770 gene pilM 45660 44734 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942426.1 protein_id gnl|my_center|LOCUS_14770 47395 45677 gene locus_tag LOCUS_14780 47395 45677 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_14780 48612 47404 gene locus_tag LOCUS_14790 48612 47404 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_14790 48972 48787 gene locus_tag LOCUS_14800 48972 48787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 49818 49060 gene locus_tag LOCUS_14810 49818 49060 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_14810 50021 50341 gene locus_tag LOCUS_14820 50021 50341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 51587 50499 gene locus_tag LOCUS_14830 gene gcvT 51587 50499 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941043.1 protein_id gnl|my_center|LOCUS_14830 52084 51608 gene locus_tag LOCUS_14840 52084 51608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943763.1 protein_id gnl|my_center|LOCUS_14840 52241 52531 gene locus_tag LOCUS_14850 52241 52531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 53579 52560 gene locus_tag LOCUS_14860 gene aroF 53579 52560 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_14860 54815 53871 gene locus_tag LOCUS_14870 54815 53871 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941542.1 protein_id gnl|my_center|LOCUS_14870 54975 56450 gene locus_tag LOCUS_14880 gene trpE 54975 56450 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_14880 57244 56540 gene locus_tag LOCUS_14890 57244 56540 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_14890 58724 57237 gene locus_tag LOCUS_14900 58724 57237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 60817 58835 gene locus_tag LOCUS_14910 60817 58835 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958448.1 protein_id gnl|my_center|LOCUS_14910 61038 60814 gene locus_tag LOCUS_14920 61038 60814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 61450 62019 gene locus_tag LOCUS_14930 61450 62019 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_14930 62657 62118 gene locus_tag LOCUS_14940 62657 62118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941253.1 protein_id gnl|my_center|LOCUS_14940 63589 62747 gene locus_tag LOCUS_14950 63589 62747 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941254.1 protein_id gnl|my_center|LOCUS_14950 64627 63638 gene locus_tag LOCUS_14960 64627 63638 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941255.1 protein_id gnl|my_center|LOCUS_14960 65346 64678 gene locus_tag LOCUS_14970 65346 64678 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941256.1 protein_id gnl|my_center|LOCUS_14970 66445 65327 gene locus_tag LOCUS_14980 66445 65327 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941257.1 protein_id gnl|my_center|LOCUS_14980 66691 68100 gene locus_tag LOCUS_14990 66691 68100 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_14990 69676 68117 gene locus_tag LOCUS_15000 69676 68117 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941262.1 protein_id gnl|my_center|LOCUS_15000 70016 70231 gene locus_tag LOCUS_15010 70016 70231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 70305 70532 gene locus_tag LOCUS_15020 70305 70532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 70571 70888 gene locus_tag LOCUS_15030 70571 70888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 71409 70984 gene locus_tag LOCUS_15040 71409 70984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 71601 72380 gene locus_tag LOCUS_15050 71601 72380 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_15050 72507 75167 gene locus_tag LOCUS_15060 72507 75167 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_15060 75175 76038 gene locus_tag LOCUS_15070 75175 76038 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_15070 76046 77707 gene locus_tag LOCUS_15080 gene recN 76046 77707 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_15080 77748 78152 gene locus_tag LOCUS_15090 77748 78152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 78500 78279 gene locus_tag LOCUS_15100 78500 78279 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545978.1 protein_id gnl|my_center|LOCUS_15100 78786 79130 gene locus_tag LOCUS_15110 78786 79130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 79200 79544 gene locus_tag LOCUS_15120 79200 79544 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_15120 79556 80155 gene locus_tag LOCUS_15130 79556 80155 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941355.1 protein_id gnl|my_center|LOCUS_15130 80187 81098 gene locus_tag LOCUS_15140 80187 81098 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941213.1 protein_id gnl|my_center|LOCUS_15140 81141 82058 gene locus_tag LOCUS_15150 81141 82058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 82071 82523 gene locus_tag LOCUS_15160 82071 82523 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941718.1 protein_id gnl|my_center|LOCUS_15160 82576 83274 gene locus_tag LOCUS_15170 82576 83274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 83358 83445 gene locus_tag LOCUS_t00230 83358 83445 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 84682 83525 gene locus_tag LOCUS_15180 84682 83525 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_15180 85552 84710 gene locus_tag LOCUS_15190 gene dinD 85552 84710 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_15190 86590 85616 gene locus_tag LOCUS_15200 86590 85616 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098061990.1 protein_id gnl|my_center|LOCUS_15200 88371 86587 gene locus_tag LOCUS_15210 88371 86587 CDS product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 protein_id gnl|my_center|LOCUS_15210 89460 88483 gene locus_tag LOCUS_15220 89460 88483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15220 91248 89908 gene locus_tag LOCUS_15230 91248 89908 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478813.1 protein_id gnl|my_center|LOCUS_15230 93247 91250 gene locus_tag LOCUS_15240 93247 91250 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933573.1 protein_id gnl|my_center|LOCUS_15240 94068 93250 gene locus_tag LOCUS_15250 94068 93250 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393238.1 protein_id gnl|my_center|LOCUS_15250 94351 94118 gene locus_tag LOCUS_15260 94351 94118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence14 1183 257 gene locus_tag LOCUS_15270 gene fdhE 1183 257 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188802.1 protein_id gnl|my_center|LOCUS_15270 1812 1180 gene locus_tag LOCUS_15280 1812 1180 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551972.1 protein_id gnl|my_center|LOCUS_15280 2686 1802 gene locus_tag LOCUS_15290 gene fdxH 2686 1802 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528944.1 protein_id gnl|my_center|LOCUS_15290 5753 2697 gene locus_tag LOCUS_15300 gene fdnG 5753 2697 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895684.1 transl_except (pos:complement(5166..5168),aa:Sec) note codon on position 196 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_15300 6392 5913 gene locus_tag LOCUS_15310 6392 5913 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941381.1 protein_id gnl|my_center|LOCUS_15310 6923 6429 gene locus_tag LOCUS_15320 6923 6429 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941405.1 protein_id gnl|my_center|LOCUS_15320 8085 6952 gene locus_tag LOCUS_15330 8085 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 8582 8115 gene locus_tag LOCUS_15340 gene bfr 8582 8115 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_15340 8815 8624 gene locus_tag LOCUS_15350 8815 8624 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941512.1 protein_id gnl|my_center|LOCUS_15350 9246 8839 gene locus_tag LOCUS_15360 9246 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 12173 9654 gene locus_tag LOCUS_15370 12173 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 13329 12319 gene locus_tag LOCUS_15380 13329 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 13833 13345 gene locus_tag LOCUS_15390 13833 13345 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943900.1 protein_id gnl|my_center|LOCUS_15390 14257 15684 gene locus_tag LOCUS_15400 14257 15684 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_15400 16298 17737 gene locus_tag LOCUS_15410 16298 17737 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_15410 17820 18152 gene locus_tag LOCUS_15420 17820 18152 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943372.1 protein_id gnl|my_center|LOCUS_15420 18194 18523 gene locus_tag LOCUS_15430 18194 18523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 18668 19108 gene locus_tag LOCUS_15440 18668 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 20802 19213 gene locus_tag LOCUS_15450 20802 19213 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_15450 21989 20802 gene locus_tag LOCUS_15460 21989 20802 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261546.1 protein_id gnl|my_center|LOCUS_15460 22507 22181 gene locus_tag LOCUS_15470 22507 22181 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631113.1 protein_id gnl|my_center|LOCUS_15470 22907 22545 gene locus_tag LOCUS_15480 22907 22545 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021993.1 protein_id gnl|my_center|LOCUS_15480 23132 22938 gene locus_tag LOCUS_15490 23132 22938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 23353 23982 gene locus_tag LOCUS_15500 gene tpx 23353 23982 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_15500 24057 24545 gene locus_tag LOCUS_15510 24057 24545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 24611 25201 gene locus_tag LOCUS_15520 24611 25201 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_15520 25397 26224 gene locus_tag LOCUS_15530 gene ybgF 25397 26224 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940701.1 protein_id gnl|my_center|LOCUS_15530 26652 27896 gene locus_tag LOCUS_15540 26652 27896 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_15540 27966 28160 gene locus_tag LOCUS_15550 27966 28160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 28179 28391 gene locus_tag LOCUS_15560 gene thiS 28179 28391 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_15560 28393 29205 gene locus_tag LOCUS_15570 gene moeB 28393 29205 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942003.1 protein_id gnl|my_center|LOCUS_15570 29207 29608 gene locus_tag LOCUS_15580 29207 29608 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_15580 29694 30671 gene locus_tag LOCUS_15590 29694 30671 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942004.1 protein_id gnl|my_center|LOCUS_15590 30658 30885 gene locus_tag LOCUS_15600 30658 30885 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942005.1 protein_id gnl|my_center|LOCUS_15600 31052 31855 gene locus_tag LOCUS_15610 31052 31855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 31852 33303 gene locus_tag LOCUS_15620 31852 33303 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_15620 33314 34009 gene locus_tag LOCUS_15630 33314 34009 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942361.1 protein_id gnl|my_center|LOCUS_15630 34066 34971 gene locus_tag LOCUS_15640 gene cysD 34066 34971 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_15640 34971 36650 gene locus_tag LOCUS_15650 34971 36650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 36647 37474 gene locus_tag LOCUS_15660 gene larE 36647 37474 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_15660 38536 37583 gene locus_tag LOCUS_15670 gene cysK 38536 37583 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036918.1 protein_id gnl|my_center|LOCUS_15670 39064 38603 gene locus_tag LOCUS_15680 39064 38603 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_15680 40115 39183 gene locus_tag LOCUS_15690 40115 39183 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943444.1 protein_id gnl|my_center|LOCUS_15690 40223 41125 gene locus_tag LOCUS_15700 40223 41125 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 protein_id gnl|my_center|LOCUS_15700 41898 41167 gene locus_tag LOCUS_15710 41898 41167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_15710 43093 41891 gene locus_tag LOCUS_15720 43093 41891 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_15720 44262 43090 gene locus_tag LOCUS_15730 44262 43090 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 protein_id gnl|my_center|LOCUS_15730 45549 44287 gene locus_tag LOCUS_15740 45549 44287 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941618.1 protein_id gnl|my_center|LOCUS_15740 46208 45618 gene locus_tag LOCUS_15750 46208 45618 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941619.1 protein_id gnl|my_center|LOCUS_15750 46693 46618 gene locus_tag LOCUS_t00240 46693 46618 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 47492 47779 gene locus_tag LOCUS_15760 47492 47779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 47927 48133 gene locus_tag LOCUS_15770 47927 48133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 48360 49817 gene locus_tag LOCUS_15780 gene gabD 48360 49817 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_15780 49828 50784 gene locus_tag LOCUS_15790 49828 50784 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_15790 50853 53939 gene locus_tag LOCUS_15800 50853 53939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 54256 55392 gene locus_tag LOCUS_15810 54256 55392 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941612.1 protein_id gnl|my_center|LOCUS_15810 55405 56547 gene locus_tag LOCUS_15820 55405 56547 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941613.1 protein_id gnl|my_center|LOCUS_15820 56544 57596 gene locus_tag LOCUS_15830 gene mnmA 56544 57596 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_15830 59155 57611 gene locus_tag LOCUS_15840 59155 57611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 59311 60294 gene locus_tag LOCUS_15850 59311 60294 CDS product DUF4140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942913.1 protein_id gnl|my_center|LOCUS_15850 61393 60377 gene locus_tag LOCUS_15860 61393 60377 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_15860 61581 61940 gene locus_tag LOCUS_15870 61581 61940 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942264.1 protein_id gnl|my_center|LOCUS_15870 62060 62926 gene locus_tag LOCUS_15880 62060 62926 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942263.1 protein_id gnl|my_center|LOCUS_15880 63679 62978 gene locus_tag LOCUS_15890 63679 62978 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941299.1 protein_id gnl|my_center|LOCUS_15890 66143 63699 gene locus_tag LOCUS_15900 66143 63699 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941298.1 protein_id gnl|my_center|LOCUS_15900 67333 66140 gene locus_tag LOCUS_15910 67333 66140 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941297.1 protein_id gnl|my_center|LOCUS_15910 68313 67330 gene locus_tag LOCUS_15920 68313 67330 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_15920 69265 68390 gene locus_tag LOCUS_15930 69265 68390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 70149 69262 gene locus_tag LOCUS_15940 70149 69262 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530115.1 protein_id gnl|my_center|LOCUS_15940 71426 70152 gene locus_tag LOCUS_15950 71426 70152 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957740.1 protein_id gnl|my_center|LOCUS_15950 72498 71470 gene locus_tag LOCUS_15960 72498 71470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 73602 72514 gene locus_tag LOCUS_15970 73602 72514 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966349.1 protein_id gnl|my_center|LOCUS_15970 74317 73604 gene locus_tag LOCUS_15980 74317 73604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 75856 74351 gene locus_tag LOCUS_15990 75856 74351 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022285.1 protein_id gnl|my_center|LOCUS_15990 76564 75941 gene locus_tag LOCUS_16000 76564 75941 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941288.1 protein_id gnl|my_center|LOCUS_16000 77806 76745 gene locus_tag LOCUS_16010 gene yedE 77806 76745 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943530.1 protein_id gnl|my_center|LOCUS_16010 78349 77807 gene locus_tag LOCUS_16020 78349 77807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943531.1 protein_id gnl|my_center|LOCUS_16020 79261 78356 gene locus_tag LOCUS_16030 79261 78356 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943532.1 protein_id gnl|my_center|LOCUS_16030 79817 79293 gene locus_tag LOCUS_16040 79817 79293 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392977.1 protein_id gnl|my_center|LOCUS_16040 80733 79870 gene locus_tag LOCUS_16050 80733 79870 CDS product GeoRSP system SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943533.1 protein_id gnl|my_center|LOCUS_16050 81782 80769 gene locus_tag LOCUS_16060 81782 80769 CDS product GeoRSP system radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044909.1 protein_id gnl|my_center|LOCUS_16060 82062 81775 gene locus_tag LOCUS_16070 82062 81775 CDS product GeoRSP system PqqD family peptide chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943535.1 protein_id gnl|my_center|LOCUS_16070 82388 82068 gene locus_tag LOCUS_16080 82388 82068 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943536.1 protein_id gnl|my_center|LOCUS_16080 84351 82429 gene locus_tag LOCUS_16090 84351 82429 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943537.1 protein_id gnl|my_center|LOCUS_16090 85258 84338 gene locus_tag LOCUS_16100 85258 84338 CDS product ResB-like family cytochrome C biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943538.1 protein_id gnl|my_center|LOCUS_16100 85826 85272 gene locus_tag LOCUS_16110 85826 85272 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943539.1 protein_id gnl|my_center|LOCUS_16110 86587 85886 gene locus_tag LOCUS_16120 86587 85886 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943540.1 protein_id gnl|my_center|LOCUS_16120 89133 86584 gene locus_tag LOCUS_16130 89133 86584 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044910.1 protein_id gnl|my_center|LOCUS_16130 89386 89865 gene locus_tag LOCUS_16140 89386 89865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 90722 90039 gene locus_tag LOCUS_16150 90722 90039 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_16150 91146 90730 gene locus_tag LOCUS_16160 gene nikR 91146 90730 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_16160 91434 92525 gene locus_tag LOCUS_16170 91434 92525 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_16170 92595 93386 gene locus_tag LOCUS_16180 92595 93386 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933406.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence15 2425 794 gene locus_tag LOCUS_16190 2425 794 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943573.1 protein_id gnl|my_center|LOCUS_16190 3257 2844 gene locus_tag LOCUS_16200 3257 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4551 3274 gene locus_tag LOCUS_16210 4551 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 6415 4757 gene locus_tag LOCUS_16220 6415 4757 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390968.1 protein_id gnl|my_center|LOCUS_16220 6443 6721 gene locus_tag LOCUS_16230 6443 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 7763 6822 gene locus_tag LOCUS_16240 7763 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 9153 8581 gene locus_tag LOCUS_16250 9153 8581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 9961 9155 gene locus_tag LOCUS_16260 9961 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 11336 9942 gene locus_tag LOCUS_16270 11336 9942 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_16270 11731 11387 gene locus_tag LOCUS_16280 11731 11387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 12210 12013 gene locus_tag LOCUS_16290 12210 12013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 12954 12211 gene locus_tag LOCUS_16300 12954 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 14415 13570 gene locus_tag LOCUS_16310 14415 13570 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_16310 14820 14431 gene locus_tag LOCUS_16320 14820 14431 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943337.1 protein_id gnl|my_center|LOCUS_16320 15851 15198 gene locus_tag LOCUS_16330 gene cobC 15851 15198 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812873.1 protein_id gnl|my_center|LOCUS_16330 16975 15848 gene locus_tag LOCUS_16340 16975 15848 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204617516.1 protein_id gnl|my_center|LOCUS_16340 18032 16977 gene locus_tag LOCUS_16350 18032 16977 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_16350 19378 18026 gene locus_tag LOCUS_16360 19378 18026 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812868.1 protein_id gnl|my_center|LOCUS_16360 20724 19372 gene locus_tag LOCUS_16370 20724 19372 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812866.1 protein_id gnl|my_center|LOCUS_16370 21130 20690 gene locus_tag LOCUS_16380 21130 20690 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938847.1 protein_id gnl|my_center|LOCUS_16380 21925 21257 gene locus_tag LOCUS_16390 21925 21257 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459393.1 protein_id gnl|my_center|LOCUS_16390 22174 21971 gene locus_tag LOCUS_16400 22174 21971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 24534 22171 gene locus_tag LOCUS_16410 24534 22171 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459976.1 protein_id gnl|my_center|LOCUS_16410 27446 24651 gene locus_tag LOCUS_16420 27446 24651 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938851.1 protein_id gnl|my_center|LOCUS_16420 28647 27625 gene locus_tag LOCUS_16430 28647 27625 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938852.1 protein_id gnl|my_center|LOCUS_16430 29080 28676 gene locus_tag LOCUS_16440 29080 28676 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942061.1 protein_id gnl|my_center|LOCUS_16440 29332 29162 gene locus_tag LOCUS_16450 29332 29162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 31419 30073 gene locus_tag LOCUS_16460 31419 30073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 31812 33806 gene locus_tag LOCUS_16470 31812 33806 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530092.1 protein_id gnl|my_center|LOCUS_16470 35836 33830 gene locus_tag LOCUS_16480 35836 33830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 36980 35820 gene locus_tag LOCUS_16490 36980 35820 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_16490 38565 37141 gene locus_tag LOCUS_16500 38565 37141 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527142.1 protein_id gnl|my_center|LOCUS_16500 38906 38733 gene locus_tag LOCUS_16510 38906 38733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 39640 39050 gene locus_tag LOCUS_16520 39640 39050 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940850.1 protein_id gnl|my_center|LOCUS_16520 40650 39832 gene locus_tag LOCUS_16530 40650 39832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 41611 41081 gene locus_tag LOCUS_16540 41611 41081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 41935 41663 gene locus_tag LOCUS_16550 41935 41663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 43226 41970 gene locus_tag LOCUS_16560 43226 41970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 43906 45072 gene locus_tag LOCUS_16570 43906 45072 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939668.1 protein_id gnl|my_center|LOCUS_16570 45072 46289 gene locus_tag LOCUS_16580 45072 46289 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011369225.1 protein_id gnl|my_center|LOCUS_16580 46277 47659 gene locus_tag LOCUS_16590 46277 47659 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_16590 47900 48877 gene locus_tag LOCUS_16600 gene moaA 47900 48877 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943768.1 protein_id gnl|my_center|LOCUS_16600 49213 50325 gene locus_tag LOCUS_16610 49213 50325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 50901 52106 gene locus_tag LOCUS_16620 gene mdo 50901 52106 CDS product NDMA-dependent methanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731151.1 protein_id gnl|my_center|LOCUS_16620 52315 53217 gene locus_tag LOCUS_16630 52315 53217 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258665.1 protein_id gnl|my_center|LOCUS_16630 53220 54635 gene locus_tag LOCUS_16640 53220 54635 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_16640 54691 55002 gene locus_tag LOCUS_16650 54691 55002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 55025 56137 gene locus_tag LOCUS_16660 55025 56137 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703952.1 protein_id gnl|my_center|LOCUS_16660 56131 58146 gene locus_tag LOCUS_16670 56131 58146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 58171 58782 gene locus_tag LOCUS_16680 58171 58782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 59288 59082 gene locus_tag LOCUS_16690 59288 59082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 60540 60719 gene locus_tag LOCUS_16700 60540 60719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 61619 61173 gene locus_tag LOCUS_16710 61619 61173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 63962 61953 gene locus_tag LOCUS_16720 63962 61953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 65172 63982 gene locus_tag LOCUS_16730 65172 63982 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392213.1 protein_id gnl|my_center|LOCUS_16730 66520 65291 gene locus_tag LOCUS_16740 66520 65291 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940860.1 protein_id gnl|my_center|LOCUS_16740 67106 68500 gene locus_tag LOCUS_16750 67106 68500 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197970.1 protein_id gnl|my_center|LOCUS_16750 68590 69387 gene locus_tag LOCUS_16760 68590 69387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 69401 69916 gene locus_tag LOCUS_16770 69401 69916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 69935 70516 gene locus_tag LOCUS_16780 69935 70516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 70570 71466 gene locus_tag LOCUS_16790 70570 71466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 71485 72300 gene locus_tag LOCUS_16800 gene soj 71485 72300 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_16800 72272 72871 gene locus_tag LOCUS_16810 72272 72871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 73434 72928 gene locus_tag LOCUS_16820 73434 72928 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977430.1 protein_id gnl|my_center|LOCUS_16820 73977 74225 gene locus_tag LOCUS_16830 73977 74225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 74215 75255 gene locus_tag LOCUS_16840 gene mftC 74215 75255 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727659.1 protein_id gnl|my_center|LOCUS_16840 75375 77339 gene locus_tag LOCUS_16850 75375 77339 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_16850 77339 78343 gene locus_tag LOCUS_16860 77339 78343 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259384.1 protein_id gnl|my_center|LOCUS_16860 78340 79638 gene locus_tag LOCUS_16870 78340 79638 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461372.1 protein_id gnl|my_center|LOCUS_16870 79635 79913 gene locus_tag LOCUS_16880 79635 79913 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391609.1 protein_id gnl|my_center|LOCUS_16880 80029 80922 gene locus_tag LOCUS_16890 80029 80922 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_16890 80919 82352 gene locus_tag LOCUS_16900 gene mftF 80919 82352 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727662.1 protein_id gnl|my_center|LOCUS_16900 82585 84321 gene locus_tag LOCUS_16910 82585 84321 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_16910 84385 84960 gene locus_tag LOCUS_16920 84385 84960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 84965 85189 gene locus_tag LOCUS_16930 84965 85189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 85191 86033 gene locus_tag LOCUS_16940 85191 86033 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986474.1 protein_id gnl|my_center|LOCUS_16940 86030 86902 gene locus_tag LOCUS_16950 86030 86902 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_16950 86963 87661 gene locus_tag LOCUS_16960 86963 87661 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_16960 88568 87870 gene locus_tag LOCUS_16970 88568 87870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 90967 88652 gene locus_tag LOCUS_16980 90967 88652 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948579.1 protein_id gnl|my_center|LOCUS_16980 92666 91743 gene locus_tag LOCUS_16990 92666 91743 CDS product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942203.1 protein_id gnl|my_center|LOCUS_16990 93554 92913 gene locus_tag LOCUS_17000 93554 92913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence16 1425 64 gene locus_tag LOCUS_17010 1425 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 4344 1546 gene locus_tag LOCUS_17020 4344 1546 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942010.1 protein_id gnl|my_center|LOCUS_17020 4393 4686 gene locus_tag LOCUS_17030 4393 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 5238 4960 gene locus_tag LOCUS_17040 5238 4960 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_17040 5541 5275 gene locus_tag LOCUS_17050 5541 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 5785 5504 gene locus_tag LOCUS_17060 5785 5504 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_17060 7154 5925 gene locus_tag LOCUS_17070 7154 5925 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940829.1 protein_id gnl|my_center|LOCUS_17070 8092 7181 gene locus_tag LOCUS_17080 gene argF 8092 7181 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_17080 9298 8102 gene locus_tag LOCUS_17090 9298 8102 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940827.1 protein_id gnl|my_center|LOCUS_17090 10173 9295 gene locus_tag LOCUS_17100 gene argB 10173 9295 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_17100 11396 10275 gene locus_tag LOCUS_17110 11396 10275 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940825.1 protein_id gnl|my_center|LOCUS_17110 14063 11421 gene locus_tag LOCUS_17120 gene alaS 14063 11421 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_17120 14574 14092 gene locus_tag LOCUS_17130 14574 14092 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940823.1 protein_id gnl|my_center|LOCUS_17130 15715 14561 gene locus_tag LOCUS_17140 15715 14561 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_17140 16777 15755 gene locus_tag LOCUS_17150 gene recA 16777 15755 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_17150 17544 16942 gene locus_tag LOCUS_17160 17544 16942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 20996 17544 gene locus_tag LOCUS_17170 20996 17544 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_17170 22353 20983 gene locus_tag LOCUS_17180 22353 20983 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_17180 23702 22350 gene locus_tag LOCUS_17190 23702 22350 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_17190 26056 23699 gene locus_tag LOCUS_17200 26056 23699 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114406.1 protein_id gnl|my_center|LOCUS_17200 27556 26312 gene locus_tag LOCUS_17210 27556 26312 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_17210 28704 27553 gene locus_tag LOCUS_17220 gene larC 28704 27553 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_17220 31261 28709 gene locus_tag LOCUS_17230 31261 28709 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_17230 31644 31306 gene locus_tag LOCUS_17240 31644 31306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 31903 31628 gene locus_tag LOCUS_17250 31903 31628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 32903 32154 gene locus_tag LOCUS_17260 gene larB 32903 32154 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_17260 33103 33984 gene locus_tag LOCUS_17270 33103 33984 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 protein_id gnl|my_center|LOCUS_17270 34108 35391 gene locus_tag LOCUS_17280 34108 35391 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_17280 35525 36052 gene locus_tag LOCUS_17290 35525 36052 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942547.1 protein_id gnl|my_center|LOCUS_17290 37255 36221 gene locus_tag LOCUS_17300 37255 36221 CDS product DUF3187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943756.1 protein_id gnl|my_center|LOCUS_17300 38984 37284 gene locus_tag LOCUS_17310 38984 37284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 39249 39437 gene locus_tag LOCUS_17320 39249 39437 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_17320 40822 39518 gene locus_tag LOCUS_17330 40822 39518 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940793.1 protein_id gnl|my_center|LOCUS_17330 41987 40938 gene locus_tag LOCUS_17340 gene waaC 41987 40938 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_17340 42946 41984 gene locus_tag LOCUS_17350 42946 41984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 44121 43003 gene locus_tag LOCUS_17360 44121 43003 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_17360 44540 44118 gene locus_tag LOCUS_17370 44540 44118 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 protein_id gnl|my_center|LOCUS_17370 45007 44528 gene locus_tag LOCUS_17380 45007 44528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17380 46169 45105 gene locus_tag LOCUS_17390 46169 45105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 48109 46214 gene locus_tag LOCUS_17400 gene cysN 48109 46214 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_17400 49241 48222 gene locus_tag LOCUS_17410 49241 48222 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546260.1 protein_id gnl|my_center|LOCUS_17410 50412 49459 gene locus_tag LOCUS_17420 50412 49459 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980807.1 protein_id gnl|my_center|LOCUS_17420 51488 50559 gene locus_tag LOCUS_17430 51488 50559 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202693.1 protein_id gnl|my_center|LOCUS_17430 52612 51488 gene locus_tag LOCUS_17440 52612 51488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 53783 52680 gene locus_tag LOCUS_17450 53783 52680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 54550 53783 gene locus_tag LOCUS_17460 54550 53783 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_17460 55601 54552 gene locus_tag LOCUS_17470 gene waaF 55601 54552 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_17470 56975 55878 gene locus_tag LOCUS_17480 gene lpxK 56975 55878 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_17480 58345 56972 gene locus_tag LOCUS_17490 58345 56972 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_17490 59039 58326 gene locus_tag LOCUS_17500 59039 58326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 59953 59036 gene locus_tag LOCUS_17510 59953 59036 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944030.1 protein_id gnl|my_center|LOCUS_17510 61698 59950 gene locus_tag LOCUS_17520 gene msbA 61698 59950 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_17520 62891 61695 gene locus_tag LOCUS_17530 gene lpxB 62891 61695 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_17530 63667 62888 gene locus_tag LOCUS_17540 gene lpxA 63667 62888 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_17540 64135 63692 gene locus_tag LOCUS_17550 gene fabZ 64135 63692 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942905.1 protein_id gnl|my_center|LOCUS_17550 65194 64154 gene locus_tag LOCUS_17560 gene lpxD 65194 64154 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_17560 65723 65208 gene locus_tag LOCUS_17570 65723 65208 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942907.1 protein_id gnl|my_center|LOCUS_17570 68078 65772 gene locus_tag LOCUS_17580 gene bamA 68078 65772 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_17580 68773 68102 gene locus_tag LOCUS_17590 68773 68102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_17590 70028 68766 gene locus_tag LOCUS_17600 70028 68766 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_17600 71511 70033 gene locus_tag LOCUS_17610 gene lysS 71511 70033 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_17610 72805 71582 gene locus_tag LOCUS_17620 72805 71582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 75122 72897 gene locus_tag LOCUS_17630 75122 72897 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941589.1 protein_id gnl|my_center|LOCUS_17630 77330 75261 gene locus_tag LOCUS_17640 77330 75261 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943902.1 protein_id gnl|my_center|LOCUS_17640 77631 78458 gene locus_tag LOCUS_17650 gene ybgF 77631 78458 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940701.1 protein_id gnl|my_center|LOCUS_17650 79135 78548 gene locus_tag LOCUS_17660 gene hisB 79135 78548 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_17660 79577 79176 gene locus_tag LOCUS_17670 79577 79176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943184.1 protein_id gnl|my_center|LOCUS_17670 80639 79587 gene locus_tag LOCUS_17680 gene hisC 80639 79587 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_17680 81937 80636 gene locus_tag LOCUS_17690 gene hisD 81937 80636 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_17690 82597 81941 gene locus_tag LOCUS_17700 gene hisG 82597 81941 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_17700 83847 82594 gene locus_tag LOCUS_17710 gene murA 83847 82594 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_17710 84079 87582 gene locus_tag LOCUS_17720 84079 87582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 87572 88645 gene locus_tag LOCUS_17730 87572 88645 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942536.1 protein_id gnl|my_center|LOCUS_17730 91063 88688 gene locus_tag LOCUS_17740 91063 88688 CDS product NADH-quinone oxidoreductase subunit B/C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944054.1 protein_id gnl|my_center|LOCUS_17740 91448 91056 gene locus_tag LOCUS_17750 gene ndhC 91448 91056 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944055.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence17 1705 161 gene locus_tag LOCUS_17760 gene fliF 1705 161 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_17760 2097 1795 gene locus_tag LOCUS_17770 gene fliE 2097 1795 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941077.1 protein_id gnl|my_center|LOCUS_17770 2577 2140 gene locus_tag LOCUS_17780 gene flgC 2577 2140 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_17780 3000 2578 gene locus_tag LOCUS_17790 gene flgB 3000 2578 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941075.1 protein_id gnl|my_center|LOCUS_17790 5307 3193 gene locus_tag LOCUS_17800 5307 3193 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941074.1 protein_id gnl|my_center|LOCUS_17800 6406 5336 gene locus_tag LOCUS_17810 6406 5336 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941073.1 protein_id gnl|my_center|LOCUS_17810 6988 6482 gene locus_tag LOCUS_17820 6988 6482 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_17820 7350 6985 gene locus_tag LOCUS_17830 7350 6985 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_17830 8952 7543 gene locus_tag LOCUS_17840 8952 7543 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_17840 9090 10493 gene locus_tag LOCUS_17850 9090 10493 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941147.1 protein_id gnl|my_center|LOCUS_17850 10563 10784 gene locus_tag LOCUS_17860 10563 10784 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_17860 10951 11415 gene locus_tag LOCUS_17870 10951 11415 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940846.1 protein_id gnl|my_center|LOCUS_17870 11412 11735 gene locus_tag LOCUS_17880 11412 11735 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039645979.1 protein_id gnl|my_center|LOCUS_17880 11737 12180 gene locus_tag LOCUS_17890 11737 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 12186 14048 gene locus_tag LOCUS_17900 12186 14048 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940946.1 protein_id gnl|my_center|LOCUS_17900 14645 14109 gene locus_tag LOCUS_17910 14645 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 14864 14673 gene locus_tag LOCUS_17920 14864 14673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 14960 16597 gene locus_tag LOCUS_17930 14960 16597 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940844.1 protein_id gnl|my_center|LOCUS_17930 17132 16656 gene locus_tag LOCUS_17940 gene greB 17132 16656 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174758.1 protein_id gnl|my_center|LOCUS_17940 17695 17129 gene locus_tag LOCUS_17950 17695 17129 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942734.1 protein_id gnl|my_center|LOCUS_17950 18000 17800 gene locus_tag LOCUS_17960 18000 17800 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940866.1 protein_id gnl|my_center|LOCUS_17960 19759 18116 gene locus_tag LOCUS_17970 19759 18116 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942735.1 protein_id gnl|my_center|LOCUS_17970 19973 20203 gene locus_tag LOCUS_17980 19973 20203 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380890.1 protein_id gnl|my_center|LOCUS_17980 20538 22433 gene locus_tag LOCUS_17990 20538 22433 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_17990 22838 22434 gene locus_tag LOCUS_18000 22838 22434 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942259.1 protein_id gnl|my_center|LOCUS_18000 22977 23756 gene locus_tag LOCUS_18010 22977 23756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 23865 24176 gene locus_tag LOCUS_18020 23865 24176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 24414 27944 gene locus_tag LOCUS_18030 gene smc 24414 27944 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_18030 28036 28392 gene locus_tag LOCUS_18040 28036 28392 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941792.1 protein_id gnl|my_center|LOCUS_18040 28392 29462 gene locus_tag LOCUS_18050 gene ftsY 28392 29462 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_18050 29440 29754 gene locus_tag LOCUS_18060 29440 29754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 29819 30091 gene locus_tag LOCUS_18070 29819 30091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 30314 30156 gene locus_tag LOCUS_18080 30314 30156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 30392 30979 gene locus_tag LOCUS_18090 30392 30979 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941797.1 protein_id gnl|my_center|LOCUS_18090 31027 32598 gene locus_tag LOCUS_18100 gene rny 31027 32598 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_18100 32744 33529 gene locus_tag LOCUS_18110 32744 33529 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_18110 33552 34763 gene locus_tag LOCUS_18120 gene tyrS 33552 34763 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_18120 34994 36301 gene locus_tag LOCUS_18130 34994 36301 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030643.1 protein_id gnl|my_center|LOCUS_18130 36306 37214 gene locus_tag LOCUS_18140 36306 37214 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_18140 37310 38074 gene locus_tag LOCUS_18150 37310 38074 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_18150 38094 39935 gene locus_tag LOCUS_18160 38094 39935 CDS product TIGR04442 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943104.1 protein_id gnl|my_center|LOCUS_18160 42879 40051 gene locus_tag LOCUS_18170 42879 40051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 43108 45921 gene locus_tag LOCUS_18180 43108 45921 CDS product GPMC system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943112.1 protein_id gnl|my_center|LOCUS_18180 45988 47190 gene locus_tag LOCUS_18190 45988 47190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_18190 48574 47198 gene locus_tag LOCUS_18200 48574 47198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 48970 48614 gene locus_tag LOCUS_18210 gene dksA 48970 48614 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_18210 50404 49052 gene locus_tag LOCUS_18220 gene radA 50404 49052 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_18220 50554 52164 gene locus_tag LOCUS_18230 50554 52164 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940958.1 protein_id gnl|my_center|LOCUS_18230 52151 53548 gene locus_tag LOCUS_18240 52151 53548 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940959.1 protein_id gnl|my_center|LOCUS_18240 54123 53545 gene locus_tag LOCUS_18250 54123 53545 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940960.1 protein_id gnl|my_center|LOCUS_18250 54293 55486 gene locus_tag LOCUS_18260 54293 55486 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428474.1 protein_id gnl|my_center|LOCUS_18260 56116 55541 gene locus_tag LOCUS_18270 56116 55541 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941109.1 protein_id gnl|my_center|LOCUS_18270 57027 56146 gene locus_tag LOCUS_18280 gene ubiA 57027 56146 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_18280 58436 57033 gene locus_tag LOCUS_18290 58436 57033 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941106.1 protein_id gnl|my_center|LOCUS_18290 60066 58810 gene locus_tag LOCUS_18300 60066 58810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 61903 60053 gene locus_tag LOCUS_18310 61903 60053 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_18310 62388 61921 gene locus_tag LOCUS_18320 62388 61921 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388577.1 protein_id gnl|my_center|LOCUS_18320 63362 62427 gene locus_tag LOCUS_18330 63362 62427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 64042 63359 gene locus_tag LOCUS_18340 64042 63359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 65047 64232 gene locus_tag LOCUS_18350 65047 64232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 65882 65022 gene locus_tag LOCUS_18360 65882 65022 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390775.1 protein_id gnl|my_center|LOCUS_18360 66781 65879 gene locus_tag LOCUS_18370 66781 65879 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626495.1 protein_id gnl|my_center|LOCUS_18370 67239 66778 gene locus_tag LOCUS_18380 67239 66778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 68280 67660 gene locus_tag LOCUS_18390 68280 67660 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070580.1 protein_id gnl|my_center|LOCUS_18390 68500 68829 gene locus_tag LOCUS_18400 68500 68829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 69876 69070 gene locus_tag LOCUS_18410 69876 69070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 71892 69988 gene locus_tag LOCUS_18420 71892 69988 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_18420 73288 72056 gene locus_tag LOCUS_18430 73288 72056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 73587 73303 gene locus_tag LOCUS_18440 73587 73303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 75280 73766 gene locus_tag LOCUS_18450 75280 73766 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941686.1 protein_id gnl|my_center|LOCUS_18450 75942 75298 gene locus_tag LOCUS_18460 gene fsa 75942 75298 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943606.1 protein_id gnl|my_center|LOCUS_18460 76293 76033 gene locus_tag LOCUS_18470 76293 76033 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943607.1 protein_id gnl|my_center|LOCUS_18470 76795 76304 gene locus_tag LOCUS_18480 gene folK 76795 76304 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_18480 77644 76979 gene locus_tag LOCUS_18490 77644 76979 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_18490 78507 77641 gene locus_tag LOCUS_18500 78507 77641 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_18500 82162 78581 gene locus_tag LOCUS_18510 gene nifJ 82162 78581 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940774.1 protein_id gnl|my_center|LOCUS_18510 82814 82221 gene locus_tag LOCUS_18520 gene recR 82814 82221 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940773.1 protein_id gnl|my_center|LOCUS_18520 83381 83067 gene locus_tag LOCUS_18530 83381 83067 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940772.1 protein_id gnl|my_center|LOCUS_18530 85154 83448 gene locus_tag LOCUS_18540 gene dnaX 85154 83448 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_18540 85509 85419 gene locus_tag LOCUS_t00250 85509 85419 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 85623 86369 gene locus_tag LOCUS_18550 85623 86369 CDS product MTA/SAH nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942542.1 protein_id gnl|my_center|LOCUS_18550 87209 86334 gene locus_tag LOCUS_18560 87209 86334 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942543.1 protein_id gnl|my_center|LOCUS_18560 87670 87263 gene locus_tag LOCUS_18570 87670 87263 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence18 1791 853 gene locus_tag LOCUS_18580 1791 853 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706000.1 protein_id gnl|my_center|LOCUS_18580 3042 1795 gene locus_tag LOCUS_18590 3042 1795 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943927.1 protein_id gnl|my_center|LOCUS_18590 3701 3246 gene locus_tag LOCUS_18600 3701 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 4336 3815 gene locus_tag LOCUS_18610 4336 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 4763 4317 gene locus_tag LOCUS_18620 gene tnpA 4763 4317 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_18620 6111 4867 gene locus_tag LOCUS_18630 6111 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 7478 6108 gene locus_tag LOCUS_18640 7478 6108 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_18640 7756 8868 gene locus_tag LOCUS_18650 7756 8868 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941447.1 protein_id gnl|my_center|LOCUS_18650 8852 9799 gene locus_tag LOCUS_18660 gene hybA 8852 9799 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941448.1 protein_id gnl|my_center|LOCUS_18660 9789 11078 gene locus_tag LOCUS_18670 gene hybB 9789 11078 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941449.1 protein_id gnl|my_center|LOCUS_18670 11211 12890 gene locus_tag LOCUS_18680 11211 12890 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941450.1 protein_id gnl|my_center|LOCUS_18680 13076 13567 gene locus_tag LOCUS_18690 13076 13567 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941451.1 protein_id gnl|my_center|LOCUS_18690 14974 13646 gene locus_tag LOCUS_18700 14974 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 18477 14971 gene locus_tag LOCUS_18710 18477 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 19135 18698 gene locus_tag LOCUS_18720 19135 18698 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943317.1 protein_id gnl|my_center|LOCUS_18720 20372 19203 gene locus_tag LOCUS_18730 20372 19203 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943303.1 protein_id gnl|my_center|LOCUS_18730 20505 20290 gene locus_tag LOCUS_18740 20505 20290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 21091 20474 gene locus_tag LOCUS_18750 21091 20474 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943304.1 protein_id gnl|my_center|LOCUS_18750 21611 22351 gene locus_tag LOCUS_18760 21611 22351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 22749 23501 gene locus_tag LOCUS_18770 22749 23501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 23748 24458 gene locus_tag LOCUS_18780 23748 24458 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257980.1 protein_id gnl|my_center|LOCUS_18780 25301 24699 gene locus_tag LOCUS_18790 25301 24699 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016342.1 protein_id gnl|my_center|LOCUS_18790 25802 26899 gene locus_tag LOCUS_18800 gene per 25802 26899 CDS product GDP-perosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918896.1 protein_id gnl|my_center|LOCUS_18800 27002 28261 gene locus_tag LOCUS_18810 27002 28261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 28343 28966 gene locus_tag LOCUS_18820 28343 28966 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339247.1 protein_id gnl|my_center|LOCUS_18820 29019 30830 gene locus_tag LOCUS_18830 29019 30830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838546.1 protein_id gnl|my_center|LOCUS_18830 30864 31814 gene locus_tag LOCUS_18840 gene gmd 30864 31814 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_18840 32081 33118 gene locus_tag LOCUS_18850 32081 33118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 33222 34715 gene locus_tag LOCUS_18860 gene wzx 33222 34715 CDS product O13/O129/O135 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022479.1 protein_id gnl|my_center|LOCUS_18860 34738 35418 gene locus_tag LOCUS_18870 34738 35418 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078432.1 protein_id gnl|my_center|LOCUS_18870 35429 36487 gene locus_tag LOCUS_18880 35429 36487 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023662.1 protein_id gnl|my_center|LOCUS_18880 38166 39068 gene locus_tag LOCUS_18890 38166 39068 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_18890 39065 40018 gene locus_tag LOCUS_18900 39065 40018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 40022 41260 gene locus_tag LOCUS_18910 40022 41260 CDS product WcaI family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051330685.1 protein_id gnl|my_center|LOCUS_18910 41253 42665 gene locus_tag LOCUS_18920 41253 42665 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060458416.1 protein_id gnl|my_center|LOCUS_18920 42672 44393 gene locus_tag LOCUS_18930 42672 44393 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942489.1 protein_id gnl|my_center|LOCUS_18930 44697 47849 gene locus_tag LOCUS_18940 44697 47849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 47859 49076 gene locus_tag LOCUS_18950 47859 49076 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_18950 49728 49090 gene locus_tag LOCUS_18960 49728 49090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 49878 50114 gene locus_tag LOCUS_18970 49878 50114 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941527.1 protein_id gnl|my_center|LOCUS_18970 50365 51012 gene locus_tag LOCUS_18980 50365 51012 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941525.1 protein_id gnl|my_center|LOCUS_18980 51015 51884 gene locus_tag LOCUS_18990 51015 51884 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_18990 51902 52768 gene locus_tag LOCUS_19000 gene galU 51902 52768 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941523.1 protein_id gnl|my_center|LOCUS_19000 53222 52827 gene locus_tag LOCUS_19010 53222 52827 CDS product exosortase system-associated protein, TIGR04073 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943857.1 protein_id gnl|my_center|LOCUS_19010 55537 53297 gene locus_tag LOCUS_19020 55537 53297 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 protein_id gnl|my_center|LOCUS_19020 56227 55628 gene locus_tag LOCUS_19030 56227 55628 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943859.1 protein_id gnl|my_center|LOCUS_19030 56873 57244 gene locus_tag LOCUS_19040 56873 57244 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005845276.1 protein_id gnl|my_center|LOCUS_19040 57237 58478 gene locus_tag LOCUS_19050 57237 58478 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202285.1 protein_id gnl|my_center|LOCUS_19050 59411 59139 gene locus_tag LOCUS_19060 59411 59139 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941274.1 protein_id gnl|my_center|LOCUS_19060 59835 60164 gene locus_tag LOCUS_19070 59835 60164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 60293 61249 gene locus_tag LOCUS_19080 60293 61249 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_19080 61290 62777 gene locus_tag LOCUS_19090 61290 62777 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227222.1 protein_id gnl|my_center|LOCUS_19090 62786 64429 gene locus_tag LOCUS_19100 62786 64429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 64453 65430 gene locus_tag LOCUS_19110 64453 65430 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222572.1 protein_id gnl|my_center|LOCUS_19110 65427 66545 gene locus_tag LOCUS_19120 65427 66545 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_19120 66559 67317 gene locus_tag LOCUS_19130 66559 67317 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256806.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence19 3120 433 gene locus_tag LOCUS_19140 3120 433 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_19140 3686 3123 gene locus_tag LOCUS_19150 gene kdpC 3686 3123 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943119.1 protein_id gnl|my_center|LOCUS_19150 5837 3771 gene locus_tag LOCUS_19160 gene kdpB 5837 3771 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943118.1 protein_id gnl|my_center|LOCUS_19160 7724 5946 gene locus_tag LOCUS_19170 gene kdpA 7724 5946 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943117.1 protein_id gnl|my_center|LOCUS_19170 7951 7721 gene locus_tag LOCUS_19180 7951 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 8026 8271 gene locus_tag LOCUS_19190 8026 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 8442 11267 gene locus_tag LOCUS_19200 8442 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 11354 13438 gene locus_tag LOCUS_19210 11354 13438 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941245.1 protein_id gnl|my_center|LOCUS_19210 13553 13960 gene locus_tag LOCUS_19220 13553 13960 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_19220 14220 15077 gene locus_tag LOCUS_19230 14220 15077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 15091 15861 gene locus_tag LOCUS_19240 15091 15861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 15967 16128 gene locus_tag LOCUS_19250 15967 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 16115 17662 gene locus_tag LOCUS_19260 16115 17662 CDS product MASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545922.1 protein_id gnl|my_center|LOCUS_19260 17649 19667 gene locus_tag LOCUS_19270 17649 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 19657 21213 gene locus_tag LOCUS_19280 19657 21213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 21249 22499 gene locus_tag LOCUS_19290 21249 22499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 22535 23710 gene locus_tag LOCUS_19300 22535 23710 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 protein_id gnl|my_center|LOCUS_19300 23725 25455 gene locus_tag LOCUS_19310 23725 25455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 25565 26965 gene locus_tag LOCUS_19320 25565 26965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 27005 28855 gene locus_tag LOCUS_19330 27005 28855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 28913 31231 gene locus_tag LOCUS_19340 28913 31231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 31228 31878 gene locus_tag LOCUS_19350 31228 31878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 31923 32588 gene locus_tag LOCUS_19360 31923 32588 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_19360 32585 33622 gene locus_tag LOCUS_19370 32585 33622 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814073.1 protein_id gnl|my_center|LOCUS_19370 33619 34218 gene locus_tag LOCUS_19380 33619 34218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 34390 35238 gene locus_tag LOCUS_19390 34390 35238 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_19390 35243 37000 gene locus_tag LOCUS_19400 35243 37000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 37127 37654 gene locus_tag LOCUS_19410 37127 37654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 37644 39182 gene locus_tag LOCUS_19420 37644 39182 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_19420 39265 39786 gene locus_tag LOCUS_19430 39265 39786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 39828 41579 gene locus_tag LOCUS_19440 39828 41579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 41663 44002 gene locus_tag LOCUS_19450 41663 44002 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256740.1 protein_id gnl|my_center|LOCUS_19450 44014 45087 gene locus_tag LOCUS_19460 44014 45087 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256737.1 protein_id gnl|my_center|LOCUS_19460 45112 47835 gene locus_tag LOCUS_19470 45112 47835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 47842 50247 gene locus_tag LOCUS_19480 47842 50247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 50219 50605 gene locus_tag LOCUS_19490 gene divK 50219 50605 CDS product cell-cycle response regulator DivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640499.1 protein_id gnl|my_center|LOCUS_19490 50602 51939 gene locus_tag LOCUS_19500 50602 51939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 51968 54139 gene locus_tag LOCUS_19510 51968 54139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19510 54306 55208 gene locus_tag LOCUS_19520 54306 55208 CDS product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943193.1 protein_id gnl|my_center|LOCUS_19520 55205 55432 gene locus_tag LOCUS_19530 55205 55432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 57199 55475 gene locus_tag LOCUS_19540 57199 55475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 58205 57183 gene locus_tag LOCUS_19550 58205 57183 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_19550 58289 59563 gene locus_tag LOCUS_19560 gene serS 58289 59563 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_19560 59690 59777 gene locus_tag LOCUS_t00260 59690 59777 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 60106 61227 gene locus_tag LOCUS_19570 60106 61227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 61543 62286 gene locus_tag LOCUS_19580 61543 62286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence20 149 337 gene locus_tag LOCUS_19590 149 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 478 1173 gene locus_tag LOCUS_19600 478 1173 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210775.1 protein_id gnl|my_center|LOCUS_19600 1247 1762 gene locus_tag LOCUS_19610 1247 1762 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943318.1 protein_id gnl|my_center|LOCUS_19610 1791 2654 gene locus_tag LOCUS_19620 1791 2654 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_19620 2885 3589 gene locus_tag LOCUS_19630 2885 3589 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943929.1 protein_id gnl|my_center|LOCUS_19630 3936 6161 gene locus_tag LOCUS_19640 3936 6161 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 protein_id gnl|my_center|LOCUS_19640 6218 7630 gene locus_tag LOCUS_19650 gene icd 6218 7630 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_19650 7712 8662 gene locus_tag LOCUS_19660 gene mdh 7712 8662 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942112.1 protein_id gnl|my_center|LOCUS_19660 8782 8979 gene locus_tag LOCUS_19670 8782 8979 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942113.1 protein_id gnl|my_center|LOCUS_19670 9002 10135 gene locus_tag LOCUS_19680 9002 10135 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 protein_id gnl|my_center|LOCUS_19680 10138 10956 gene locus_tag LOCUS_19690 10138 10956 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_19690 10980 11528 gene locus_tag LOCUS_19700 10980 11528 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_19700 11840 14017 gene locus_tag LOCUS_19710 11840 14017 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_19710 14032 14760 gene locus_tag LOCUS_19720 gene cas5c 14032 14760 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_19720 14757 16520 gene locus_tag LOCUS_19730 gene cas8c 14757 16520 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176708.1 protein_id gnl|my_center|LOCUS_19730 16548 17495 gene locus_tag LOCUS_19740 gene cas7c 16548 17495 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_19740 17716 18816 gene locus_tag LOCUS_19750 17716 18816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 18826 19686 gene locus_tag LOCUS_19760 18826 19686 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_19760 19683 20717 gene locus_tag LOCUS_19770 gene cas1c 19683 20717 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_19770 20944 21237 gene locus_tag LOCUS_19780 gene cas2 20944 21237 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_19780 21409 22527 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gagcgcccgtcctatctgggcgggcgaggattgaaac 24142 22586 gene locus_tag LOCUS_19790 24142 22586 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_19790 25266 24142 gene locus_tag LOCUS_19800 25266 24142 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_19800 26631 25357 gene locus_tag LOCUS_19810 26631 25357 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_19810 27055 26612 gene locus_tag LOCUS_19820 27055 26612 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942129.1 protein_id gnl|my_center|LOCUS_19820 27206 27664 gene locus_tag LOCUS_19830 gene rimI 27206 27664 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_19830 27636 28454 gene locus_tag LOCUS_19840 27636 28454 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_19840 28457 29371 gene locus_tag LOCUS_19850 28457 29371 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_19850 29376 30074 gene locus_tag LOCUS_19860 29376 30074 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 protein_id gnl|my_center|LOCUS_19860 30980 30312 gene locus_tag LOCUS_19870 30980 30312 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_19870 31972 30977 gene locus_tag LOCUS_19880 31972 30977 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275143.1 protein_id gnl|my_center|LOCUS_19880 33675 31969 gene locus_tag LOCUS_19890 gene oleC 33675 31969 CDS product olefin beta-lactone synthetase OleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035474.1 protein_id gnl|my_center|LOCUS_19890 35505 33685 gene locus_tag LOCUS_19900 35505 33685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 36511 35621 gene locus_tag LOCUS_19910 36511 35621 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_19910 37694 36651 gene locus_tag LOCUS_19920 37694 36651 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071874.1 protein_id gnl|my_center|LOCUS_19920 44791 37691 gene locus_tag LOCUS_19930 44791 37691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 50955 44791 gene locus_tag LOCUS_19940 50955 44791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 52415 50952 gene locus_tag LOCUS_19950 gene pfaD 52415 50952 CDS product eicosapentaenoate synthase subunit PfaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071756.1 protein_id gnl|my_center|LOCUS_19950 52778 55324 gene locus_tag LOCUS_19960 gene acnB 52778 55324 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942304.1 protein_id gnl|my_center|LOCUS_19960 55650 55471 gene locus_tag LOCUS_19970 55650 55471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 56017 55853 gene locus_tag LOCUS_19980 56017 55853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 56758 58035 gene locus_tag LOCUS_19990 56758 58035 CDS product DUF6178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943201.1 protein_id gnl|my_center|LOCUS_19990 58823 58071 gene locus_tag LOCUS_20000 58823 58071 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942636.1 protein_id gnl|my_center|LOCUS_20000 59096 60286 gene locus_tag LOCUS_20010 59096 60286 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085426.1 protein_id gnl|my_center|LOCUS_20010 60406 61005 gene locus_tag LOCUS_20020 60406 61005 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_20020 62242 61133 gene locus_tag LOCUS_20030 62242 61133 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence21 153 1310 gene locus_tag LOCUS_20040 gene sucC 153 1310 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941719.1 protein_id gnl|my_center|LOCUS_20040 1340 2269 gene locus_tag LOCUS_20050 gene sucD 1340 2269 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_20050 2403 2825 gene locus_tag LOCUS_20060 2403 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3023 6580 gene locus_tag LOCUS_20070 gene dnaE 3023 6580 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_20070 6766 7722 gene locus_tag LOCUS_20080 6766 7722 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_20080 7832 8713 gene locus_tag LOCUS_20090 7832 8713 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_20090 8803 10182 gene locus_tag LOCUS_20100 gene asnS 8803 10182 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941817.1 protein_id gnl|my_center|LOCUS_20100 10186 13791 gene locus_tag LOCUS_20110 10186 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 13903 14211 gene locus_tag LOCUS_20120 13903 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 14204 14710 gene locus_tag LOCUS_20130 14204 14710 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 protein_id gnl|my_center|LOCUS_20130 14826 16361 gene locus_tag LOCUS_20140 14826 16361 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530049.1 protein_id gnl|my_center|LOCUS_20140 16974 17282 gene locus_tag LOCUS_20150 16974 17282 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941818.1 protein_id gnl|my_center|LOCUS_20150 17413 19857 gene locus_tag LOCUS_20160 17413 19857 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_20160 19826 20227 gene locus_tag LOCUS_20170 gene ybeY 19826 20227 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942921.1 protein_id gnl|my_center|LOCUS_20170 20284 20913 gene locus_tag LOCUS_20180 20284 20913 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648148.1 protein_id gnl|my_center|LOCUS_20180 20972 21829 gene locus_tag LOCUS_20190 20972 21829 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_20190 21826 23385 gene locus_tag LOCUS_20200 gene lnt 21826 23385 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_20200 23463 24536 gene locus_tag LOCUS_20210 gene prfB 23463 24536 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_20210 24517 25425 gene locus_tag LOCUS_20220 24517 25425 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942917.1 protein_id gnl|my_center|LOCUS_20220 25542 26783 gene locus_tag LOCUS_20230 25542 26783 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_20230 27759 26875 gene locus_tag LOCUS_20240 gene ylqF 27759 26875 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263367.1 protein_id gnl|my_center|LOCUS_20240 27917 28462 gene locus_tag LOCUS_20250 27917 28462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 28500 29342 gene locus_tag LOCUS_20260 28500 29342 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943708.1 protein_id gnl|my_center|LOCUS_20260 29707 29372 gene locus_tag LOCUS_20270 29707 29372 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_20270 29958 29704 gene locus_tag LOCUS_20280 29958 29704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 30497 30252 gene locus_tag LOCUS_20290 30497 30252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 31920 31147 gene locus_tag LOCUS_20300 31920 31147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 33426 32140 gene locus_tag LOCUS_20310 gene thiC 33426 32140 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941266.1 protein_id gnl|my_center|LOCUS_20310 35022 33547 gene locus_tag LOCUS_20320 gene thiD 35022 33547 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941267.1 protein_id gnl|my_center|LOCUS_20320 35369 36502 gene locus_tag LOCUS_20330 gene alr 35369 36502 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_20330 36734 37588 gene locus_tag LOCUS_20340 gene selD 36734 37588 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941269.1 protein_id gnl|my_center|LOCUS_20340 37741 38943 gene locus_tag LOCUS_20350 37741 38943 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_20350 39111 40358 gene locus_tag LOCUS_20360 39111 40358 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941270.1 protein_id gnl|my_center|LOCUS_20360 40372 41928 gene locus_tag LOCUS_20370 gene purH 40372 41928 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_20370 41979 43253 gene locus_tag LOCUS_20380 gene purD 41979 43253 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_20380 43279 43779 gene locus_tag LOCUS_20390 gene purE 43279 43779 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_20390 43859 44128 gene locus_tag LOCUS_20400 43859 44128 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941274.1 protein_id gnl|my_center|LOCUS_20400 44297 45661 gene locus_tag LOCUS_20410 44297 45661 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_20410 45679 46536 gene locus_tag LOCUS_20420 gene ccsB 45679 46536 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_20420 46676 47638 gene locus_tag LOCUS_20430 46676 47638 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941284.1 protein_id gnl|my_center|LOCUS_20430 47810 48754 gene locus_tag LOCUS_20440 47810 48754 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_20440 48747 49934 gene locus_tag LOCUS_20450 48747 49934 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941287.1 protein_id gnl|my_center|LOCUS_20450 50077 50151 gene locus_tag LOCUS_t00270 50077 50151 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 51477 50176 gene locus_tag LOCUS_20460 51477 50176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 51816 51547 gene locus_tag LOCUS_20470 51816 51547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 53089 52241 gene locus_tag LOCUS_20480 53089 52241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 55754 54504 gene locus_tag LOCUS_20490 55754 54504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 56343 55999 gene locus_tag LOCUS_20500 56343 55999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 56765 56409 gene locus_tag LOCUS_20510 56765 56409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 57370 56762 gene locus_tag LOCUS_20520 57370 56762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 58111 57449 gene locus_tag LOCUS_20530 58111 57449 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967700.1 protein_id gnl|my_center|LOCUS_20530 58883 58197 gene locus_tag LOCUS_20540 58883 58197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 59086 59262 gene locus_tag LOCUS_20550 59086 59262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 59186 59812 gene locus_tag LOCUS_20560 59186 59812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 59888 60067 gene locus_tag LOCUS_20570 59888 60067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence22 292 708 gene locus_tag LOCUS_20580 292 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 1004 735 gene locus_tag LOCUS_20590 1004 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 1487 1110 gene locus_tag LOCUS_20600 1487 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 1875 1495 gene locus_tag LOCUS_20610 1875 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2078 1872 gene locus_tag LOCUS_20620 2078 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 3418 2204 gene locus_tag LOCUS_20630 3418 2204 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940972.1 protein_id gnl|my_center|LOCUS_20630 3584 4531 gene locus_tag LOCUS_20640 gene meaB 3584 4531 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_20640 4528 5286 gene locus_tag LOCUS_20650 gene cbiQ 4528 5286 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943632.1 protein_id gnl|my_center|LOCUS_20650 5289 6140 gene locus_tag LOCUS_20660 5289 6140 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943631.1 protein_id gnl|my_center|LOCUS_20660 6305 6700 gene locus_tag LOCUS_20670 6305 6700 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943100.1 protein_id gnl|my_center|LOCUS_20670 6703 7014 gene locus_tag LOCUS_20680 6703 7014 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943099.1 protein_id gnl|my_center|LOCUS_20680 7075 7971 gene locus_tag LOCUS_20690 7075 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 8023 9501 gene locus_tag LOCUS_20700 8023 9501 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941675.1 protein_id gnl|my_center|LOCUS_20700 9545 10279 gene locus_tag LOCUS_20710 9545 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941676.1 protein_id gnl|my_center|LOCUS_20710 10839 10351 gene locus_tag LOCUS_20720 10839 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 11008 13206 gene locus_tag LOCUS_20730 11008 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 13301 15130 gene locus_tag LOCUS_20740 gene glmS 13301 15130 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_20740 15234 18767 gene locus_tag LOCUS_20750 15234 18767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 18819 19772 gene locus_tag LOCUS_20760 18819 19772 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942049.1 protein_id gnl|my_center|LOCUS_20760 19827 20633 gene locus_tag LOCUS_20770 19827 20633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 20691 21998 gene locus_tag LOCUS_20780 20691 21998 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_20780 21998 23542 gene locus_tag LOCUS_20790 21998 23542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 23526 26309 gene locus_tag LOCUS_20800 23526 26309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 26353 26808 gene locus_tag LOCUS_20810 26353 26808 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_20810 26884 28818 gene locus_tag LOCUS_20820 26884 28818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 28808 30043 gene locus_tag LOCUS_20830 28808 30043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 30040 30858 gene locus_tag LOCUS_20840 30040 30858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 30961 31614 gene locus_tag LOCUS_20850 30961 31614 CDS product ADP-ribosylation factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228461.1 protein_id gnl|my_center|LOCUS_20850 31611 32912 gene locus_tag LOCUS_20860 31611 32912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 32915 35335 gene locus_tag LOCUS_20870 32915 35335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 35364 35933 gene locus_tag LOCUS_20880 35364 35933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 36880 35948 gene locus_tag LOCUS_20890 36880 35948 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941155.1 protein_id gnl|my_center|LOCUS_20890 38022 36964 gene locus_tag LOCUS_20900 gene arsB 38022 36964 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943585.1 protein_id gnl|my_center|LOCUS_20900 38435 38019 gene locus_tag LOCUS_20910 38435 38019 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943584.1 protein_id gnl|my_center|LOCUS_20910 38564 38887 gene locus_tag LOCUS_20920 38564 38887 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785422.1 protein_id gnl|my_center|LOCUS_20920 38889 39836 gene locus_tag LOCUS_20930 38889 39836 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_20930 39878 40240 gene locus_tag LOCUS_20940 39878 40240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080190.1 protein_id gnl|my_center|LOCUS_20940 40252 40530 gene locus_tag LOCUS_20950 40252 40530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 40534 40761 gene locus_tag LOCUS_20960 40534 40761 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_20960 40758 41138 gene locus_tag LOCUS_20970 40758 41138 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943588.1 protein_id gnl|my_center|LOCUS_20970 41135 41827 gene locus_tag LOCUS_20980 41135 41827 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_20980 42058 42366 gene locus_tag LOCUS_20990 42058 42366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 42757 42410 gene locus_tag LOCUS_21000 42757 42410 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943583.1 protein_id gnl|my_center|LOCUS_21000 43733 42819 gene locus_tag LOCUS_21010 43733 42819 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_21010 44086 44556 gene locus_tag LOCUS_21020 44086 44556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 44757 45722 gene locus_tag LOCUS_21030 gene hgcA 44757 45722 CDS product mercury methylation corrinoid protein HgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_21030 45741 46034 gene locus_tag LOCUS_21040 gene hgcB 45741 46034 CDS product mercury methylation ferredoxin HgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_21040 46216 48171 gene locus_tag LOCUS_21050 46216 48171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 51114 48187 gene locus_tag LOCUS_21060 gene uvrA 51114 48187 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531840.1 protein_id gnl|my_center|LOCUS_21060 52652 51291 gene locus_tag LOCUS_21070 52652 51291 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943105.1 protein_id gnl|my_center|LOCUS_21070 52823 53188 gene locus_tag LOCUS_21080 52823 53188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943106.1 protein_id gnl|my_center|LOCUS_21080 53382 53822 gene locus_tag LOCUS_21090 53382 53822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 54285 54755 gene locus_tag LOCUS_21100 54285 54755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 55473 56225 gene locus_tag LOCUS_21110 55473 56225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 56506 57204 gene locus_tag LOCUS_21120 56506 57204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 58498 57245 gene locus_tag LOCUS_21130 58498 57245 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258689.1 protein_id gnl|my_center|LOCUS_21130 58958 59620 gene locus_tag LOCUS_21140 58958 59620 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942188.1 protein_id gnl|my_center|LOCUS_21140 59845 59645 gene locus_tag LOCUS_21150 59845 59645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence23 152 400 gene locus_tag LOCUS_21160 152 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 456 1118 gene locus_tag LOCUS_21170 456 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 2107 1199 gene locus_tag LOCUS_21180 2107 1199 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_21180 2440 2568 gene locus_tag LOCUS_21190 2440 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2992 3132 gene locus_tag LOCUS_21200 2992 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3318 3614 gene locus_tag LOCUS_21210 3318 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 5216 4167 gene locus_tag LOCUS_21220 5216 4167 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974637.1 protein_id gnl|my_center|LOCUS_21220 5999 5598 gene locus_tag LOCUS_21230 5999 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 7460 6099 gene locus_tag LOCUS_21240 7460 6099 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535038.1 protein_id gnl|my_center|LOCUS_21240 9569 7590 gene locus_tag LOCUS_21250 gene macB 9569 7590 CDS product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523215.1 protein_id gnl|my_center|LOCUS_21250 10759 9572 gene locus_tag LOCUS_21260 10759 9572 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551445.1 protein_id gnl|my_center|LOCUS_21260 11397 10756 gene locus_tag LOCUS_21270 11397 10756 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_21270 12480 11878 gene locus_tag LOCUS_21280 12480 11878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 12829 13143 gene locus_tag LOCUS_21290 12829 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 13274 13867 gene locus_tag LOCUS_21300 13274 13867 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370092.1 protein_id gnl|my_center|LOCUS_21300 13899 14150 gene locus_tag LOCUS_21310 13899 14150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 14427 15221 gene locus_tag LOCUS_21320 14427 15221 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528749.1 protein_id gnl|my_center|LOCUS_21320 15390 15629 gene locus_tag LOCUS_21330 15390 15629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 15785 17170 gene locus_tag LOCUS_21340 15785 17170 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_21340 17171 18208 gene locus_tag LOCUS_21350 17171 18208 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261804.1 protein_id gnl|my_center|LOCUS_21350 18205 21267 gene locus_tag LOCUS_21360 18205 21267 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_21360 21264 22655 gene locus_tag LOCUS_21370 21264 22655 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143607.1 protein_id gnl|my_center|LOCUS_21370 22652 23722 gene locus_tag LOCUS_21380 22652 23722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 23733 26837 gene locus_tag LOCUS_21390 23733 26837 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144156.1 protein_id gnl|my_center|LOCUS_21390 27066 29183 gene locus_tag LOCUS_21400 27066 29183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 29376 30293 gene locus_tag LOCUS_21410 29376 30293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 30290 31042 gene locus_tag LOCUS_21420 30290 31042 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546505.1 protein_id gnl|my_center|LOCUS_21420 31056 31589 gene locus_tag LOCUS_21430 31056 31589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545656.1 protein_id gnl|my_center|LOCUS_21430 31661 32368 gene locus_tag LOCUS_21440 31661 32368 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022565.1 protein_id gnl|my_center|LOCUS_21440 32368 33030 gene locus_tag LOCUS_21450 32368 33030 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 protein_id gnl|my_center|LOCUS_21450 33006 34352 gene locus_tag LOCUS_21460 33006 34352 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931889.1 protein_id gnl|my_center|LOCUS_21460 34395 35027 gene locus_tag LOCUS_21470 34395 35027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 35627 35229 gene locus_tag LOCUS_21480 35627 35229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 37061 35808 gene locus_tag LOCUS_21490 37061 35808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_21490 37929 37069 gene locus_tag LOCUS_21500 37929 37069 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521810.1 protein_id gnl|my_center|LOCUS_21500 38348 40669 gene locus_tag LOCUS_21510 38348 40669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 40666 42129 gene locus_tag LOCUS_21520 40666 42129 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940953.1 protein_id gnl|my_center|LOCUS_21520 42380 42943 gene locus_tag LOCUS_21530 gene pal 42380 42943 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940702.1 protein_id gnl|my_center|LOCUS_21530 43139 43351 gene locus_tag LOCUS_21540 43139 43351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 44621 43491 gene locus_tag LOCUS_21550 44621 43491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_21550 45865 44732 gene locus_tag LOCUS_21560 45865 44732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_21560 47702 45873 gene locus_tag LOCUS_21570 47702 45873 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942144.1 protein_id gnl|my_center|LOCUS_21570 49284 47767 gene locus_tag LOCUS_21580 49284 47767 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107325.1 protein_id gnl|my_center|LOCUS_21580 50412 49426 gene locus_tag LOCUS_21590 50412 49426 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_21590 50777 51049 gene locus_tag LOCUS_21600 50777 51049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 51899 51072 gene locus_tag LOCUS_21610 51899 51072 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198065.1 protein_id gnl|my_center|LOCUS_21610 53560 52007 gene locus_tag LOCUS_21620 53560 52007 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 protein_id gnl|my_center|LOCUS_21620 54097 53831 gene locus_tag LOCUS_21630 54097 53831 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_21630 54333 54091 gene locus_tag LOCUS_21640 54333 54091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 54878 54597 gene locus_tag LOCUS_21650 54878 54597 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379963.1 protein_id gnl|my_center|LOCUS_21650 55231 54875 gene locus_tag LOCUS_21660 55231 54875 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694481.1 protein_id gnl|my_center|LOCUS_21660 55928 55503 gene locus_tag LOCUS_21670 55928 55503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 56905 56147 gene locus_tag LOCUS_21680 56905 56147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence24 156 1145 gene locus_tag LOCUS_21690 156 1145 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902587.1 protein_id gnl|my_center|LOCUS_21690 1438 2400 gene locus_tag LOCUS_21700 1438 2400 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_21700 2662 2462 gene locus_tag LOCUS_21710 2662 2462 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940866.1 protein_id gnl|my_center|LOCUS_21710 3218 2907 gene locus_tag LOCUS_21720 3218 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 3517 4779 gene locus_tag LOCUS_21730 3517 4779 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812238.1 protein_id gnl|my_center|LOCUS_21730 5721 4873 gene locus_tag LOCUS_21740 gene mscS 5721 4873 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_21740 5973 7331 gene locus_tag LOCUS_21750 5973 7331 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_21750 7531 8610 gene locus_tag LOCUS_21760 7531 8610 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940869.1 protein_id gnl|my_center|LOCUS_21760 8985 8803 gene locus_tag LOCUS_21770 8985 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 9233 9072 gene locus_tag LOCUS_21780 9233 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 9434 9255 gene locus_tag LOCUS_21790 9434 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 9822 9373 gene locus_tag LOCUS_21800 9822 9373 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216361.1 protein_id gnl|my_center|LOCUS_21800 10190 10405 gene locus_tag LOCUS_21810 10190 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 10515 11048 gene locus_tag LOCUS_21820 gene def 10515 11048 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206042.1 protein_id gnl|my_center|LOCUS_21820 11041 11238 gene locus_tag LOCUS_21830 11041 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706655.1 protein_id gnl|my_center|LOCUS_21830 11291 11587 gene locus_tag LOCUS_21840 11291 11587 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_21840 11642 13654 gene locus_tag LOCUS_21850 11642 13654 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942207.1 protein_id gnl|my_center|LOCUS_21850 14925 13741 gene locus_tag LOCUS_21860 gene purT 14925 13741 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092658.1 protein_id gnl|my_center|LOCUS_21860 15113 16501 gene locus_tag LOCUS_21870 gene dbpA 15113 16501 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940864.1 protein_id gnl|my_center|LOCUS_21870 16981 16514 gene locus_tag LOCUS_21880 16981 16514 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_21880 17254 17493 gene locus_tag LOCUS_21890 17254 17493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 17761 18666 gene locus_tag LOCUS_21900 17761 18666 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225028.1 protein_id gnl|my_center|LOCUS_21900 19254 18760 gene locus_tag LOCUS_21910 19254 18760 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940871.1 protein_id gnl|my_center|LOCUS_21910 19826 19377 gene locus_tag LOCUS_21920 19826 19377 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141820.1 protein_id gnl|my_center|LOCUS_21920 20045 20551 gene locus_tag LOCUS_21930 20045 20551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 21277 20588 gene locus_tag LOCUS_21940 21277 20588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 21746 21522 gene locus_tag LOCUS_21950 21746 21522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 21628 22362 gene locus_tag LOCUS_21960 21628 22362 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_21960 22489 22956 gene locus_tag LOCUS_21970 22489 22956 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766044.1 protein_id gnl|my_center|LOCUS_21970 23061 23525 gene locus_tag LOCUS_21980 23061 23525 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212871.1 protein_id gnl|my_center|LOCUS_21980 24100 23618 gene locus_tag LOCUS_21990 24100 23618 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_21990 25213 24476 gene locus_tag LOCUS_22000 25213 24476 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_22000 25348 26334 gene locus_tag LOCUS_22010 25348 26334 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_22010 26421 27299 gene locus_tag LOCUS_22020 26421 27299 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940890.1 protein_id gnl|my_center|LOCUS_22020 27338 27730 gene locus_tag LOCUS_22030 27338 27730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 28292 28041 gene locus_tag LOCUS_22040 28292 28041 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 protein_id gnl|my_center|LOCUS_22040 28861 28346 gene locus_tag LOCUS_22050 28861 28346 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940903.1 protein_id gnl|my_center|LOCUS_22050 29004 31133 gene locus_tag LOCUS_22060 gene ovoA 29004 31133 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704222.1 protein_id gnl|my_center|LOCUS_22060 31329 31637 gene locus_tag LOCUS_22070 31329 31637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 31701 31859 gene locus_tag LOCUS_22080 31701 31859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 32027 32572 gene locus_tag LOCUS_22090 32027 32572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 32634 33425 gene locus_tag LOCUS_22100 gene ygiD 32634 33425 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_22100 33474 33677 gene locus_tag LOCUS_22110 33474 33677 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944062.1 protein_id gnl|my_center|LOCUS_22110 33717 34376 gene locus_tag LOCUS_22120 33717 34376 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_22120 35871 34357 gene locus_tag LOCUS_22130 gene hflX 35871 34357 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_22130 36862 36095 gene locus_tag LOCUS_22140 36862 36095 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941673.1 protein_id gnl|my_center|LOCUS_22140 37200 36928 gene locus_tag LOCUS_22150 37200 36928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 37440 38060 gene locus_tag LOCUS_22160 gene trmB 37440 38060 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941189.1 protein_id gnl|my_center|LOCUS_22160 38074 38424 gene locus_tag LOCUS_22170 38074 38424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 38425 39951 gene locus_tag LOCUS_22180 38425 39951 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941186.1 protein_id gnl|my_center|LOCUS_22180 39951 41186 gene locus_tag LOCUS_22190 39951 41186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 41193 42047 gene locus_tag LOCUS_22200 41193 42047 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941184.1 protein_id gnl|my_center|LOCUS_22200 42105 42953 gene locus_tag LOCUS_22210 42105 42953 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941522.1 protein_id gnl|my_center|LOCUS_22210 42950 44350 gene locus_tag LOCUS_22220 42950 44350 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_22220 44347 45096 gene locus_tag LOCUS_22230 44347 45096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22230 45093 45380 gene locus_tag LOCUS_22240 45093 45380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 47369 45381 gene locus_tag LOCUS_22250 47369 45381 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044997.1 protein_id gnl|my_center|LOCUS_22250 48231 47380 gene locus_tag LOCUS_22260 48231 47380 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941545.1 protein_id gnl|my_center|LOCUS_22260 49982 48231 gene locus_tag LOCUS_22270 49982 48231 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044970.1 protein_id gnl|my_center|LOCUS_22270 50062 50238 gene locus_tag LOCUS_22280 50062 50238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 50299 51588 gene locus_tag LOCUS_22290 gene gptM 50299 51588 CDS product geopeptide radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942092.1 protein_id gnl|my_center|LOCUS_22290 52327 51599 gene locus_tag LOCUS_22300 gene recO 52327 51599 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 protein_id gnl|my_center|LOCUS_22300 55118 52332 gene locus_tag LOCUS_22310 gene polA 55118 52332 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_22310 55299 55111 gene locus_tag LOCUS_22320 55299 55111 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941208.1 protein_id gnl|my_center|LOCUS_22320 55695 55955 gene locus_tag LOCUS_22330 55695 55955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 55952 56131 gene locus_tag LOCUS_22340 55952 56131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 56956 56246 gene locus_tag LOCUS_22350 56956 56246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence25 736 1263 gene locus_tag LOCUS_22360 736 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1360 1527 gene locus_tag LOCUS_22370 1360 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1499 1936 gene locus_tag LOCUS_22380 1499 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2177 2539 gene locus_tag LOCUS_22390 2177 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 3874 2597 gene locus_tag LOCUS_22400 3874 2597 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066384.1 protein_id gnl|my_center|LOCUS_22400 4112 5788 gene locus_tag LOCUS_22410 4112 5788 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941246.1 protein_id gnl|my_center|LOCUS_22410 5953 7224 gene locus_tag LOCUS_22420 5953 7224 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391508.1 protein_id gnl|my_center|LOCUS_22420 7860 7294 gene locus_tag LOCUS_22430 7860 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 8471 8914 gene locus_tag LOCUS_22440 8471 8914 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943616.1 protein_id gnl|my_center|LOCUS_22440 8911 9876 gene locus_tag LOCUS_22450 8911 9876 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_22450 9861 10613 gene locus_tag LOCUS_22460 9861 10613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943614.1 protein_id gnl|my_center|LOCUS_22460 10619 11461 gene locus_tag LOCUS_22470 10619 11461 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_22470 12081 11536 gene locus_tag LOCUS_22480 gene rfbC 12081 11536 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_22480 12202 13473 gene locus_tag LOCUS_22490 12202 13473 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_22490 13948 13484 gene locus_tag LOCUS_22500 gene dut 13948 13484 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011566231.1 protein_id gnl|my_center|LOCUS_22500 14067 15170 gene locus_tag LOCUS_22510 14067 15170 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459608.1 protein_id gnl|my_center|LOCUS_22510 15178 15702 gene locus_tag LOCUS_22520 15178 15702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942083.1 protein_id gnl|my_center|LOCUS_22520 15702 16100 gene locus_tag LOCUS_22530 15702 16100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941888.1 protein_id gnl|my_center|LOCUS_22530 16115 16972 gene locus_tag LOCUS_22540 16115 16972 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942085.1 protein_id gnl|my_center|LOCUS_22540 17018 17863 gene locus_tag LOCUS_22550 17018 17863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 17905 18600 gene locus_tag LOCUS_22560 17905 18600 CDS product outer membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941124.1 protein_id gnl|my_center|LOCUS_22560 19462 18608 gene locus_tag LOCUS_22570 19462 18608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941721.1 protein_id gnl|my_center|LOCUS_22570 21711 19774 gene locus_tag LOCUS_22580 gene htpG 21711 19774 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_22580 23003 21900 gene locus_tag LOCUS_22590 23003 21900 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942645.1 protein_id gnl|my_center|LOCUS_22590 23177 23518 gene locus_tag LOCUS_22600 23177 23518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 24397 23567 gene locus_tag LOCUS_22610 24397 23567 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_22610 25098 24418 gene locus_tag LOCUS_22620 gene yrfG 25098 24418 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942337.1 protein_id gnl|my_center|LOCUS_22620 25215 26531 gene locus_tag LOCUS_22630 gene miaB 25215 26531 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_22630 26553 28223 gene locus_tag LOCUS_22640 26553 28223 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_22640 28250 29137 gene locus_tag LOCUS_22650 gene era 28250 29137 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_22650 29134 30480 gene locus_tag LOCUS_22660 gene der 29134 30480 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_22660 30582 32258 gene locus_tag LOCUS_22670 30582 32258 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942864.1 protein_id gnl|my_center|LOCUS_22670 32255 32644 gene locus_tag LOCUS_22680 32255 32644 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942863.1 protein_id gnl|my_center|LOCUS_22680 32735 34849 gene locus_tag LOCUS_22690 32735 34849 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942862.1 protein_id gnl|my_center|LOCUS_22690 34855 35655 gene locus_tag LOCUS_22700 34855 35655 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_22700 35666 36436 gene locus_tag LOCUS_22710 35666 36436 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942860.1 protein_id gnl|my_center|LOCUS_22710 36452 36841 gene locus_tag LOCUS_22720 36452 36841 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942859.1 protein_id gnl|my_center|LOCUS_22720 36845 37291 gene locus_tag LOCUS_22730 36845 37291 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942858.1 protein_id gnl|my_center|LOCUS_22730 37403 39409 gene locus_tag LOCUS_22740 37403 39409 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942856.1 protein_id gnl|my_center|LOCUS_22740 39406 40281 gene locus_tag LOCUS_22750 39406 40281 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942855.1 protein_id gnl|my_center|LOCUS_22750 40278 41336 gene locus_tag LOCUS_22760 40278 41336 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942854.1 protein_id gnl|my_center|LOCUS_22760 41414 43885 gene locus_tag LOCUS_22770 gene leuS 41414 43885 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_22770 43899 44453 gene locus_tag LOCUS_22780 43899 44453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 44454 45446 gene locus_tag LOCUS_22790 gene holA 44454 45446 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_22790 45678 45845 gene locus_tag LOCUS_22800 45678 45845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 46280 46017 gene locus_tag LOCUS_22810 gene rpsT 46280 46017 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_22810 46992 46369 gene locus_tag LOCUS_22820 gene purN 46992 46369 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_22820 48041 46992 gene locus_tag LOCUS_22830 gene purM 48041 46992 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_22830 48517 48254 gene locus_tag LOCUS_22840 48517 48254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 49801 48581 gene locus_tag LOCUS_22850 49801 48581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 50967 49798 gene locus_tag LOCUS_22860 50967 49798 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941437.1 protein_id gnl|my_center|LOCUS_22860 51978 50977 gene locus_tag LOCUS_22870 51978 50977 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_22870 54472 52037 gene locus_tag LOCUS_22880 54472 52037 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942370.1 protein_id gnl|my_center|LOCUS_22880 55722 54475 gene locus_tag LOCUS_22890 55722 54475 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942369.1 protein_id gnl|my_center|LOCUS_22890 56628 56389 gene locus_tag LOCUS_22900 56628 56389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence26 450 944 gene locus_tag LOCUS_22910 450 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1406 1146 gene locus_tag LOCUS_22920 1406 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1660 1403 gene locus_tag LOCUS_22930 1660 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 3568 1661 gene locus_tag LOCUS_22940 gene speA 3568 1661 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943173.1 protein_id gnl|my_center|LOCUS_22940 3954 4394 gene locus_tag LOCUS_22950 3954 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 4391 6856 gene locus_tag LOCUS_22960 gene lon 4391 6856 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_22960 7027 8133 gene locus_tag LOCUS_22970 gene thiL 7027 8133 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_22970 8154 10157 gene locus_tag LOCUS_22980 gene tkt 8154 10157 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944033.1 protein_id gnl|my_center|LOCUS_22980 10160 10849 gene locus_tag LOCUS_22990 10160 10849 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_22990 10865 11878 gene locus_tag LOCUS_23000 gene aroF 10865 11878 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943946.1 protein_id gnl|my_center|LOCUS_23000 13265 12189 gene locus_tag LOCUS_23010 gene cobD 13265 12189 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_23010 14220 13249 gene locus_tag LOCUS_23020 gene cbiB 14220 13249 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_23020 16556 14217 gene locus_tag LOCUS_23030 16556 14217 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943622.1 protein_id gnl|my_center|LOCUS_23030 17503 16697 gene locus_tag LOCUS_23040 17503 16697 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940970.1 protein_id gnl|my_center|LOCUS_23040 18836 17511 gene locus_tag LOCUS_23050 18836 17511 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_23050 19221 19715 gene locus_tag LOCUS_23060 19221 19715 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940969.1 protein_id gnl|my_center|LOCUS_23060 19841 21673 gene locus_tag LOCUS_23070 19841 21673 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_23070 21791 22618 gene locus_tag LOCUS_23080 21791 22618 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940967.1 protein_id gnl|my_center|LOCUS_23080 22636 23544 gene locus_tag LOCUS_23090 22636 23544 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940966.1 protein_id gnl|my_center|LOCUS_23090 23544 24644 gene locus_tag LOCUS_23100 23544 24644 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940965.1 protein_id gnl|my_center|LOCUS_23100 24942 24712 gene locus_tag LOCUS_23110 24942 24712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 26525 24942 gene locus_tag LOCUS_23120 26525 24942 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940814.1 protein_id gnl|my_center|LOCUS_23120 27050 26604 gene locus_tag LOCUS_23130 27050 26604 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940812.1 protein_id gnl|my_center|LOCUS_23130 27918 27043 gene locus_tag LOCUS_23140 27918 27043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 28048 27972 gene locus_tag LOCUS_t00280 28048 27972 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 28500 28177 gene locus_tag LOCUS_23150 28500 28177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 28381 28842 gene locus_tag LOCUS_23160 28381 28842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 28835 30016 gene locus_tag LOCUS_23170 28835 30016 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_23170 30301 30032 gene locus_tag LOCUS_23180 30301 30032 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943558.1 protein_id gnl|my_center|LOCUS_23180 30657 30322 gene locus_tag LOCUS_23190 30657 30322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 31929 30769 gene locus_tag LOCUS_23200 gene dnaJ 31929 30769 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_23200 33896 31980 gene locus_tag LOCUS_23210 gene dnaK 33896 31980 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_23210 34541 33975 gene locus_tag LOCUS_23220 gene grpE 34541 33975 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940710.1 protein_id gnl|my_center|LOCUS_23220 35616 34585 gene locus_tag LOCUS_23230 gene hrcA 35616 34585 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_23230 35911 36729 gene locus_tag LOCUS_23240 gene murI 35911 36729 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_23240 36735 37367 gene locus_tag LOCUS_23250 36735 37367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 37364 39784 gene locus_tag LOCUS_23260 37364 39784 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_23260 39935 40483 gene locus_tag LOCUS_23270 39935 40483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943551.1 protein_id gnl|my_center|LOCUS_23270 40547 42064 gene locus_tag LOCUS_23280 40547 42064 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943547.1 protein_id gnl|my_center|LOCUS_23280 42036 43409 gene locus_tag LOCUS_23290 42036 43409 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_23290 43478 43648 gene locus_tag LOCUS_23300 43478 43648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 43806 46475 gene locus_tag LOCUS_23310 43806 46475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 47756 47178 gene locus_tag LOCUS_23320 47756 47178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 48420 50387 gene locus_tag LOCUS_23330 48420 50387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 51052 50924 gene locus_tag LOCUS_23340 51052 50924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 51340 51134 gene locus_tag LOCUS_23350 51340 51134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 51506 52525 gene locus_tag LOCUS_23360 51506 52525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 52619 53650 gene locus_tag LOCUS_23370 52619 53650 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943526.1 protein_id gnl|my_center|LOCUS_23370 55491 53653 gene locus_tag LOCUS_23380 55491 53653 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence27 3 245 gene locus_tag LOCUS_23390 3 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 782 306 gene locus_tag LOCUS_23400 782 306 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941202.1 protein_id gnl|my_center|LOCUS_23400 1629 901 gene locus_tag LOCUS_23410 1629 901 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_23410 2374 1721 gene locus_tag LOCUS_23420 2374 1721 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940801.1 protein_id gnl|my_center|LOCUS_23420 2973 2389 gene locus_tag LOCUS_23430 2973 2389 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943932.1 protein_id gnl|my_center|LOCUS_23430 4248 3082 gene locus_tag LOCUS_23440 4248 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941963.1 protein_id gnl|my_center|LOCUS_23440 5325 4375 gene locus_tag LOCUS_23450 gene hemH 5325 4375 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943924.1 protein_id gnl|my_center|LOCUS_23450 5646 5329 gene locus_tag LOCUS_23460 5646 5329 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940899.1 protein_id gnl|my_center|LOCUS_23460 7639 5984 gene locus_tag LOCUS_23470 gene groL 7639 5984 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_23470 8099 7812 gene locus_tag LOCUS_23480 gene groES 8099 7812 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_23480 8653 9186 gene locus_tag LOCUS_23490 gene cobU 8653 9186 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943640.1 protein_id gnl|my_center|LOCUS_23490 9238 10311 gene locus_tag LOCUS_23500 gene cobT 9238 10311 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_23500 10377 10619 gene locus_tag LOCUS_23510 10377 10619 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392534.1 protein_id gnl|my_center|LOCUS_23510 10613 10963 gene locus_tag LOCUS_23520 gene mazF 10613 10963 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_23520 11633 12373 gene locus_tag LOCUS_23530 gene cobS 11633 12373 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943638.1 protein_id gnl|my_center|LOCUS_23530 12394 14151 gene locus_tag LOCUS_23540 gene pabB 12394 14151 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_23540 14242 15552 gene locus_tag LOCUS_23550 gene thiC 14242 15552 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943635.1 protein_id gnl|my_center|LOCUS_23550 16173 17030 gene locus_tag LOCUS_23560 16173 17030 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_23560 17040 17204 gene locus_tag LOCUS_23570 17040 17204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 17353 22281 gene locus_tag LOCUS_23580 17353 22281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 22294 23838 gene locus_tag LOCUS_23590 22294 23838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 24028 25239 gene locus_tag LOCUS_23600 24028 25239 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_23600 25251 26774 gene locus_tag LOCUS_23610 25251 26774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 27917 26880 gene locus_tag LOCUS_23620 27917 26880 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941134.1 protein_id gnl|my_center|LOCUS_23620 28172 28330 gene locus_tag LOCUS_23630 28172 28330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 30189 28633 gene locus_tag LOCUS_23640 30189 28633 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_23640 31676 30186 gene locus_tag LOCUS_23650 gene glpK 31676 30186 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_23650 32547 32119 gene locus_tag LOCUS_23660 32547 32119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 33428 32544 gene locus_tag LOCUS_23670 33428 32544 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727947.1 protein_id gnl|my_center|LOCUS_23670 35508 33637 gene locus_tag LOCUS_23680 35508 33637 CDS product DUF3857 and transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037137.1 protein_id gnl|my_center|LOCUS_23680 36343 35675 gene locus_tag LOCUS_23690 36343 35675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 36959 36462 gene locus_tag LOCUS_23700 36959 36462 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941229.1 protein_id gnl|my_center|LOCUS_23700 37495 37121 gene locus_tag LOCUS_23710 37495 37121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 37965 37675 gene locus_tag LOCUS_23720 37965 37675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 38462 39958 gene locus_tag LOCUS_23730 38462 39958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 40186 39893 gene locus_tag LOCUS_23740 40186 39893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 40067 40669 gene locus_tag LOCUS_23750 gene cobC 40067 40669 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914029.1 protein_id gnl|my_center|LOCUS_23750 40892 42148 gene locus_tag LOCUS_23760 40892 42148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 42346 43134 gene locus_tag LOCUS_23770 42346 43134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 43230 43547 gene locus_tag LOCUS_23780 43230 43547 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941868.1 protein_id gnl|my_center|LOCUS_23780 44350 43583 gene locus_tag LOCUS_23790 44350 43583 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941333.1 protein_id gnl|my_center|LOCUS_23790 44753 44379 gene locus_tag LOCUS_23800 44753 44379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943064.1 protein_id gnl|my_center|LOCUS_23800 44912 45313 gene locus_tag LOCUS_23810 44912 45313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 45461 46891 gene locus_tag LOCUS_23820 gene hpnJ 45461 46891 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_23820 46895 47773 gene locus_tag LOCUS_23830 gene hpnK 46895 47773 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_23830 47766 48146 gene locus_tag LOCUS_23840 47766 48146 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941813.1 protein_id gnl|my_center|LOCUS_23840 48169 48981 gene locus_tag LOCUS_23850 gene proC 48169 48981 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_23850 50111 49317 gene locus_tag LOCUS_23860 50111 49317 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943179.1 protein_id gnl|my_center|LOCUS_23860 50623 50168 gene locus_tag LOCUS_23870 50623 50168 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941183.1 protein_id gnl|my_center|LOCUS_23870 50857 51639 gene locus_tag LOCUS_23880 50857 51639 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence28 687 406 gene locus_tag LOCUS_23890 687 406 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277238.1 protein_id gnl|my_center|LOCUS_23890 940 674 gene locus_tag LOCUS_23900 gene dinJ 940 674 CDS product type II toxin-antitoxin system antitoxin DinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729705.1 protein_id gnl|my_center|LOCUS_23900 2323 1091 gene locus_tag LOCUS_23910 2323 1091 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_23910 2588 2502 gene locus_tag LOCUS_t00290 2588 2502 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2898 2617 gene locus_tag LOCUS_23920 2898 2617 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_23920 4656 2911 gene locus_tag LOCUS_23930 4656 2911 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_23930 5588 4746 gene locus_tag LOCUS_23940 gene ispH 5588 4746 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_23940 6296 5592 gene locus_tag LOCUS_23950 gene cmk 6296 5592 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_23950 7578 6289 gene locus_tag LOCUS_23960 gene aroA 7578 6289 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_23960 8467 7601 gene locus_tag LOCUS_23970 8467 7601 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_23970 9559 8480 gene locus_tag LOCUS_23980 gene pheA 9559 8480 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_23980 10226 9657 gene locus_tag LOCUS_23990 10226 9657 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942328.1 protein_id gnl|my_center|LOCUS_23990 10406 10573 gene locus_tag LOCUS_24000 10406 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 11755 10688 gene locus_tag LOCUS_24010 11755 10688 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_24010 12300 11812 gene locus_tag LOCUS_24020 12300 11812 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941805.1 protein_id gnl|my_center|LOCUS_24020 13166 12297 gene locus_tag LOCUS_24030 13166 12297 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_24030 13654 13178 gene locus_tag LOCUS_24040 13654 13178 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_24040 15409 13733 gene locus_tag LOCUS_24050 15409 13733 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941952.1 protein_id gnl|my_center|LOCUS_24050 17627 15519 gene locus_tag LOCUS_24060 17627 15519 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_24060 17997 17632 gene locus_tag LOCUS_24070 17997 17632 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941944.1 protein_id gnl|my_center|LOCUS_24070 18356 17997 gene locus_tag LOCUS_24080 18356 17997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 20225 18381 gene locus_tag LOCUS_24090 20225 18381 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044990.1 protein_id gnl|my_center|LOCUS_24090 20671 20273 gene locus_tag LOCUS_24100 20671 20273 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_24100 21897 20761 gene locus_tag LOCUS_24110 21897 20761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 22612 22070 gene locus_tag LOCUS_24120 22612 22070 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941939.1 protein_id gnl|my_center|LOCUS_24120 24184 22715 gene locus_tag LOCUS_24130 24184 22715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 24839 24357 gene locus_tag LOCUS_24140 24839 24357 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_24140 26528 24849 gene locus_tag LOCUS_24150 26528 24849 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941952.1 protein_id gnl|my_center|LOCUS_24150 26753 26574 gene locus_tag LOCUS_24160 26753 26574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 30358 26909 gene locus_tag LOCUS_24170 30358 26909 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941263.1 protein_id gnl|my_center|LOCUS_24170 30978 30394 gene locus_tag LOCUS_24180 30978 30394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 32424 31150 gene locus_tag LOCUS_24190 32424 31150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 32752 32435 gene locus_tag LOCUS_24200 32752 32435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 33999 33103 gene locus_tag LOCUS_24210 33999 33103 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462297.1 protein_id gnl|my_center|LOCUS_24210 34297 34764 gene locus_tag LOCUS_24220 34297 34764 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_24220 34761 35213 gene locus_tag LOCUS_24230 gene nrdR 34761 35213 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_24230 35223 36329 gene locus_tag LOCUS_24240 gene ribD 35223 36329 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942331.1 protein_id gnl|my_center|LOCUS_24240 36314 36955 gene locus_tag LOCUS_24250 36314 36955 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_24250 36971 38176 gene locus_tag LOCUS_24260 36971 38176 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_24260 38176 38718 gene locus_tag LOCUS_24270 38176 38718 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941742.1 protein_id gnl|my_center|LOCUS_24270 38715 38930 gene locus_tag LOCUS_24280 38715 38930 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941743.1 protein_id gnl|my_center|LOCUS_24280 39169 42552 gene locus_tag LOCUS_24290 39169 42552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 42565 43617 gene locus_tag LOCUS_24300 42565 43617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 45085 43823 gene locus_tag LOCUS_24310 45085 43823 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_24310 45401 46657 gene locus_tag LOCUS_24320 45401 46657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 46676 47419 gene locus_tag LOCUS_24330 46676 47419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 47468 48580 gene locus_tag LOCUS_24340 47468 48580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 48839 48672 gene locus_tag LOCUS_24350 48839 48672 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943346.1 protein_id gnl|my_center|LOCUS_24350 49085 50350 gene locus_tag LOCUS_24360 49085 50350 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_24360 >Feature sequence29 403 1953 gene locus_tag LOCUS_24370 403 1953 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_24370 1950 3584 gene locus_tag LOCUS_24380 1950 3584 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_24380 3581 6280 gene locus_tag LOCUS_24390 3581 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 6372 6578 gene locus_tag LOCUS_24400 6372 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 6568 6975 gene locus_tag LOCUS_24410 6568 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 7063 7530 gene locus_tag LOCUS_24420 7063 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 7669 8754 gene locus_tag LOCUS_24430 7669 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 8771 9748 gene locus_tag LOCUS_24440 8771 9748 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_24440 9750 10610 gene locus_tag LOCUS_24450 9750 10610 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_24450 10790 11146 gene locus_tag LOCUS_24460 10790 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 11197 11979 gene locus_tag LOCUS_24470 11197 11979 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_24470 12723 12046 gene locus_tag LOCUS_24480 12723 12046 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942283.1 protein_id gnl|my_center|LOCUS_24480 13341 12844 gene locus_tag LOCUS_24490 13341 12844 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942700.1 protein_id gnl|my_center|LOCUS_24490 13871 13380 gene locus_tag LOCUS_24500 13871 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 14035 13895 gene locus_tag LOCUS_24510 14035 13895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 14915 14028 gene locus_tag LOCUS_24520 14915 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 16352 14946 gene locus_tag LOCUS_24530 gene ccoN 16352 14946 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_24530 18026 16467 gene locus_tag LOCUS_24540 gene guaA 18026 16467 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942834.1 protein_id gnl|my_center|LOCUS_24540 19631 18162 gene locus_tag LOCUS_24550 gene guaB 19631 18162 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_24550 19970 20200 gene locus_tag LOCUS_24560 19970 20200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 21606 20320 gene locus_tag LOCUS_24570 21606 20320 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_24570 23985 21931 gene locus_tag LOCUS_24580 23985 21931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 24440 23982 gene locus_tag LOCUS_24590 24440 23982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 24644 27289 gene locus_tag LOCUS_24600 gene prsT 24644 27289 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_24600 27301 28692 gene locus_tag LOCUS_24610 27301 28692 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_24610 28756 29562 gene locus_tag LOCUS_24620 28756 29562 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942629.1 protein_id gnl|my_center|LOCUS_24620 29595 31061 gene locus_tag LOCUS_24630 29595 31061 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_24630 31108 31947 gene locus_tag LOCUS_24640 31108 31947 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_24640 31979 33157 gene locus_tag LOCUS_24650 31979 33157 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044863.1 protein_id gnl|my_center|LOCUS_24650 33193 34416 gene locus_tag LOCUS_24660 33193 34416 CDS product TIGR03016 family PEP-CTERM system-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942625.1 protein_id gnl|my_center|LOCUS_24660 34439 35269 gene locus_tag LOCUS_24670 34439 35269 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_24670 35646 36707 gene locus_tag LOCUS_24680 35646 36707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 37441 37157 gene locus_tag LOCUS_24690 37441 37157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 37870 39330 gene locus_tag LOCUS_24700 37870 39330 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108540.1 protein_id gnl|my_center|LOCUS_24700 39346 40635 gene locus_tag LOCUS_24710 39346 40635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 40729 42099 gene locus_tag LOCUS_24720 40729 42099 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_24720 42092 43171 gene locus_tag LOCUS_24730 42092 43171 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_24730 43174 44322 gene locus_tag LOCUS_24740 43174 44322 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485734.1 protein_id gnl|my_center|LOCUS_24740 44319 45617 gene locus_tag LOCUS_24750 44319 45617 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_24750 45697 46227 gene locus_tag LOCUS_24760 45697 46227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 46259 47296 gene locus_tag LOCUS_24770 46259 47296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence30 143 1960 gene locus_tag LOCUS_24780 143 1960 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943122.1 protein_id gnl|my_center|LOCUS_24780 1960 2976 gene locus_tag LOCUS_24790 1960 2976 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_24790 3880 2960 gene locus_tag LOCUS_24800 3880 2960 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_24800 4979 3978 gene locus_tag LOCUS_24810 4979 3978 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_24810 5498 5082 gene locus_tag LOCUS_24820 5498 5082 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940790.1 protein_id gnl|my_center|LOCUS_24820 6954 5539 gene locus_tag LOCUS_24830 gene atpD 6954 5539 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_24830 7876 7010 gene locus_tag LOCUS_24840 gene atpG 7876 7010 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_24840 9403 7895 gene locus_tag LOCUS_24850 gene atpA 9403 7895 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_24850 9954 9412 gene locus_tag LOCUS_24860 gene atpH 9954 9412 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_24860 10562 9951 gene locus_tag LOCUS_24870 10562 9951 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940785.1 protein_id gnl|my_center|LOCUS_24870 10990 10565 gene locus_tag LOCUS_24880 10990 10565 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_24880 11999 11142 gene locus_tag LOCUS_24890 11999 11142 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_24890 12765 11992 gene locus_tag LOCUS_24900 12765 11992 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_24900 13850 12957 gene locus_tag LOCUS_24910 13850 12957 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943965.1 protein_id gnl|my_center|LOCUS_24910 14329 13970 gene locus_tag LOCUS_24920 14329 13970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 14213 14527 gene locus_tag LOCUS_24930 14213 14527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 14527 15675 gene locus_tag LOCUS_24940 gene hpnI 14527 15675 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941358.1 protein_id gnl|my_center|LOCUS_24940 15760 16335 gene locus_tag LOCUS_24950 15760 16335 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_24950 16417 17613 gene locus_tag LOCUS_24960 16417 17613 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_24960 17626 20796 gene locus_tag LOCUS_24970 17626 20796 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943334.1 protein_id gnl|my_center|LOCUS_24970 20798 22240 gene locus_tag LOCUS_24980 gene adeC 20798 22240 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153304094.1 protein_id gnl|my_center|LOCUS_24980 22375 23145 gene locus_tag LOCUS_24990 22375 23145 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_24990 23153 23899 gene locus_tag LOCUS_25000 23153 23899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_25000 23934 24383 gene locus_tag LOCUS_25010 gene mlaD 23934 24383 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_25010 24399 25793 gene locus_tag LOCUS_25020 24399 25793 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941480.1 protein_id gnl|my_center|LOCUS_25020 25793 26395 gene locus_tag LOCUS_25030 25793 26395 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_25030 26586 26789 gene locus_tag LOCUS_25040 26586 26789 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941244.1 protein_id gnl|my_center|LOCUS_25040 28756 26855 gene locus_tag LOCUS_25050 28756 26855 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943502.1 protein_id gnl|my_center|LOCUS_25050 28896 30221 gene locus_tag LOCUS_25060 28896 30221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 32663 30300 gene locus_tag LOCUS_25070 32663 30300 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_25070 33067 33747 gene locus_tag LOCUS_25080 33067 33747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 34230 33826 gene locus_tag LOCUS_25090 34230 33826 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_25090 34798 34271 gene locus_tag LOCUS_25100 gene cobO 34798 34271 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_25100 35034 38012 gene locus_tag LOCUS_25110 35034 38012 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942209.1 protein_id gnl|my_center|LOCUS_25110 38100 38345 gene locus_tag LOCUS_25120 38100 38345 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943601.1 protein_id gnl|my_center|LOCUS_25120 38400 39692 gene locus_tag LOCUS_25130 gene larA 38400 39692 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943907.1 protein_id gnl|my_center|LOCUS_25130 41023 39785 gene locus_tag LOCUS_25140 41023 39785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 41286 42263 gene locus_tag LOCUS_25150 gene hemB 41286 42263 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_25150 42706 42272 gene locus_tag LOCUS_25160 42706 42272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 43616 42723 gene locus_tag LOCUS_25170 43616 42723 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942225.1 protein_id gnl|my_center|LOCUS_25170 43773 44837 gene locus_tag LOCUS_25180 43773 44837 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944019.1 protein_id gnl|my_center|LOCUS_25180 44858 45016 gene locus_tag LOCUS_25190 44858 45016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941841.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence31 844 485 gene locus_tag LOCUS_25200 844 485 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083612.1 protein_id gnl|my_center|LOCUS_25200 973 2856 gene locus_tag LOCUS_25210 973 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 2849 3793 gene locus_tag LOCUS_25220 2849 3793 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687768.1 protein_id gnl|my_center|LOCUS_25220 3867 4856 gene locus_tag LOCUS_25230 3867 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 6301 4877 gene locus_tag LOCUS_25240 6301 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 8801 6402 gene locus_tag LOCUS_25250 8801 6402 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106891683.1 protein_id gnl|my_center|LOCUS_25250 10020 9133 gene locus_tag LOCUS_25260 10020 9133 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942094.1 protein_id gnl|my_center|LOCUS_25260 10099 10755 gene locus_tag LOCUS_25270 10099 10755 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_25270 10874 11740 gene locus_tag LOCUS_25280 10874 11740 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942097.1 protein_id gnl|my_center|LOCUS_25280 11820 13424 gene locus_tag LOCUS_25290 11820 13424 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943925.1 protein_id gnl|my_center|LOCUS_25290 13986 13507 gene locus_tag LOCUS_25300 13986 13507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941987.1 protein_id gnl|my_center|LOCUS_25300 17277 14140 gene locus_tag LOCUS_25310 17277 14140 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941986.1 protein_id gnl|my_center|LOCUS_25310 18779 17388 gene locus_tag LOCUS_25320 18779 17388 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_25320 20168 18804 gene locus_tag LOCUS_25330 20168 18804 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_25330 21432 20554 gene locus_tag LOCUS_25340 21432 20554 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942785.1 protein_id gnl|my_center|LOCUS_25340 22386 21460 gene locus_tag LOCUS_25350 22386 21460 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044954.1 protein_id gnl|my_center|LOCUS_25350 22971 22423 gene locus_tag LOCUS_25360 22971 22423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 23405 23220 gene locus_tag LOCUS_25370 23405 23220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 24995 23646 gene locus_tag LOCUS_25380 24995 23646 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941138.1 protein_id gnl|my_center|LOCUS_25380 26236 24998 gene locus_tag LOCUS_25390 26236 24998 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941139.1 protein_id gnl|my_center|LOCUS_25390 27503 26721 gene locus_tag LOCUS_25400 27503 26721 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044954.1 protein_id gnl|my_center|LOCUS_25400 27439 27681 gene locus_tag LOCUS_25410 27439 27681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 27729 28166 gene locus_tag LOCUS_25420 27729 28166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 30822 28363 gene locus_tag LOCUS_25430 30822 28363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 32834 31464 gene locus_tag LOCUS_25440 32834 31464 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941138.1 protein_id gnl|my_center|LOCUS_25440 34066 32831 gene locus_tag LOCUS_25450 34066 32831 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941139.1 protein_id gnl|my_center|LOCUS_25450 35030 34191 gene locus_tag LOCUS_25460 35030 34191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 36484 35684 gene locus_tag LOCUS_25470 36484 35684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 38185 36686 gene locus_tag LOCUS_25480 38185 36686 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147298.1 protein_id gnl|my_center|LOCUS_25480 39307 38255 gene locus_tag LOCUS_25490 39307 38255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 41220 39493 gene locus_tag LOCUS_25500 41220 39493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 42841 41459 gene locus_tag LOCUS_25510 42841 41459 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_25510 43938 42838 gene locus_tag LOCUS_25520 43938 42838 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence32 634 110 gene locus_tag LOCUS_25530 634 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1487 1011 gene locus_tag LOCUS_25540 gene nuoE 1487 1011 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944053.1 protein_id gnl|my_center|LOCUS_25540 4272 1672 gene locus_tag LOCUS_25550 gene clpB 4272 1672 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869824.1 protein_id gnl|my_center|LOCUS_25550 5559 4414 gene locus_tag LOCUS_25560 5559 4414 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941360.1 protein_id gnl|my_center|LOCUS_25560 7738 5549 gene locus_tag LOCUS_25570 7738 5549 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941359.1 protein_id gnl|my_center|LOCUS_25570 7983 9479 gene locus_tag LOCUS_25580 gene malQ 7983 9479 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941842.1 protein_id gnl|my_center|LOCUS_25580 9564 10106 gene locus_tag LOCUS_25590 9564 10106 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942243.1 protein_id gnl|my_center|LOCUS_25590 10153 10341 gene locus_tag LOCUS_25600 gene rpmF 10153 10341 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_25600 10373 11410 gene locus_tag LOCUS_25610 gene plsX 10373 11410 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_25610 11612 12538 gene locus_tag LOCUS_25620 gene fabD 11612 12538 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_25620 12563 13000 gene locus_tag LOCUS_25630 gene fabZ 12563 13000 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942905.1 protein_id gnl|my_center|LOCUS_25630 13043 13780 gene locus_tag LOCUS_25640 gene fabG 13043 13780 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_25640 13892 14125 gene locus_tag LOCUS_25650 gene acpP 13892 14125 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942249.1 protein_id gnl|my_center|LOCUS_25650 14213 15448 gene locus_tag LOCUS_25660 gene fabF 14213 15448 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_25660 15457 15900 gene locus_tag LOCUS_25670 gene rpiB 15457 15900 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942251.1 protein_id gnl|my_center|LOCUS_25670 15991 17238 gene locus_tag LOCUS_25680 15991 17238 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_25680 17594 18277 gene locus_tag LOCUS_25690 17594 18277 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942478.1 protein_id gnl|my_center|LOCUS_25690 18334 19314 gene locus_tag LOCUS_25700 gene trpS 18334 19314 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_25700 19316 20149 gene locus_tag LOCUS_25710 19316 20149 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_25710 20162 20602 gene locus_tag LOCUS_25720 gene mscL 20162 20602 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_25720 20621 21226 gene locus_tag LOCUS_25730 gene scpB 20621 21226 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_25730 21245 22051 gene locus_tag LOCUS_25740 gene amrB 21245 22051 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942474.1 protein_id gnl|my_center|LOCUS_25740 22638 22856 gene locus_tag LOCUS_25750 gene infA 22638 22856 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_25750 22943 23506 gene locus_tag LOCUS_25760 gene efp 22943 23506 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_25760 23611 24516 gene locus_tag LOCUS_25770 gene epmA 23611 24516 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_25770 25222 24497 gene locus_tag LOCUS_25780 25222 24497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 25627 27390 gene locus_tag LOCUS_25790 25627 27390 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942184.1 protein_id gnl|my_center|LOCUS_25790 27834 27610 gene locus_tag LOCUS_25800 27834 27610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 27888 28082 gene locus_tag LOCUS_25810 27888 28082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 28683 28087 gene locus_tag LOCUS_25820 gene pgsA 28683 28087 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_25820 29301 28687 gene locus_tag LOCUS_25830 29301 28687 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_25830 29642 29545 gene locus_tag LOCUS_t00300 29642 29545 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 29803 31572 gene locus_tag LOCUS_25840 29803 31572 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_25840 33592 31751 gene locus_tag LOCUS_25850 33592 31751 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_25850 34860 33592 gene locus_tag LOCUS_25860 34860 33592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 34955 37462 gene locus_tag LOCUS_25870 34955 37462 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943129.1 protein_id gnl|my_center|LOCUS_25870 37472 38854 gene locus_tag LOCUS_25880 37472 38854 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943160.1 protein_id gnl|my_center|LOCUS_25880 38970 39752 gene locus_tag LOCUS_25890 38970 39752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 39845 41968 gene locus_tag LOCUS_25900 39845 41968 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941831.1 protein_id gnl|my_center|LOCUS_25900 42097 43068 gene locus_tag LOCUS_25910 42097 43068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 43148 43224 gene locus_tag LOCUS_t00310 43148 43224 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 43401 43679 gene locus_tag LOCUS_25920 43401 43679 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942767.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence33 528 199 gene locus_tag LOCUS_25930 528 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 700 512 gene locus_tag LOCUS_25940 700 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1018 797 gene locus_tag LOCUS_25950 1018 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 1051 1206 gene locus_tag LOCUS_25960 1051 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 1279 1971 gene locus_tag LOCUS_25970 1279 1971 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044955.1 protein_id gnl|my_center|LOCUS_25970 2170 3003 gene locus_tag LOCUS_25980 2170 3003 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943197.1 protein_id gnl|my_center|LOCUS_25980 3017 4543 gene locus_tag LOCUS_25990 3017 4543 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943196.1 protein_id gnl|my_center|LOCUS_25990 5482 4616 gene locus_tag LOCUS_26000 5482 4616 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941539.1 protein_id gnl|my_center|LOCUS_26000 5768 6538 gene locus_tag LOCUS_26010 5768 6538 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_26010 6548 7018 gene locus_tag LOCUS_26020 6548 7018 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942915.1 protein_id gnl|my_center|LOCUS_26020 7015 7767 gene locus_tag LOCUS_26030 7015 7767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941593.1 protein_id gnl|my_center|LOCUS_26030 7795 8877 gene locus_tag LOCUS_26040 7795 8877 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941594.1 protein_id gnl|my_center|LOCUS_26040 12537 8992 gene locus_tag LOCUS_26050 12537 8992 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941263.1 protein_id gnl|my_center|LOCUS_26050 14541 12616 gene locus_tag LOCUS_26060 14541 12616 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943809.1 protein_id gnl|my_center|LOCUS_26060 14839 15687 gene locus_tag LOCUS_26070 14839 15687 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_26070 15961 15755 gene locus_tag LOCUS_26080 15961 15755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 16046 16561 gene locus_tag LOCUS_26090 gene def 16046 16561 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940805.1 protein_id gnl|my_center|LOCUS_26090 16558 17517 gene locus_tag LOCUS_26100 gene fmt 16558 17517 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_26100 17514 18311 gene locus_tag LOCUS_26110 17514 18311 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 protein_id gnl|my_center|LOCUS_26110 18540 19805 gene locus_tag LOCUS_26120 18540 19805 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992237.1 protein_id gnl|my_center|LOCUS_26120 23546 20382 gene locus_tag LOCUS_26130 gene glnE 23546 20382 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_26130 24588 23548 gene locus_tag LOCUS_26140 gene mtnA 24588 23548 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_26140 24784 25341 gene locus_tag LOCUS_26150 24784 25341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26150 25341 25859 gene locus_tag LOCUS_26160 25341 25859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 25887 26513 gene locus_tag LOCUS_26170 25887 26513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 26640 29153 gene locus_tag LOCUS_26180 26640 29153 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941031.1 protein_id gnl|my_center|LOCUS_26180 29725 29243 gene locus_tag LOCUS_26190 29725 29243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941030.1 protein_id gnl|my_center|LOCUS_26190 29928 30863 gene locus_tag LOCUS_26200 29928 30863 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_26200 30863 31573 gene locus_tag LOCUS_26210 30863 31573 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_26210 31675 31998 gene locus_tag LOCUS_26220 31675 31998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943731.1 protein_id gnl|my_center|LOCUS_26220 32055 33965 gene locus_tag LOCUS_26230 gene selB 32055 33965 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_26230 35968 33962 gene locus_tag LOCUS_26240 35968 33962 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941543.1 protein_id gnl|my_center|LOCUS_26240 36566 36042 gene locus_tag LOCUS_26250 36566 36042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 37155 36841 gene locus_tag LOCUS_26260 37155 36841 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529164.1 protein_id gnl|my_center|LOCUS_26260 37436 37155 gene locus_tag LOCUS_26270 37436 37155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 37610 37930 gene locus_tag LOCUS_26280 37610 37930 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677634.1 protein_id gnl|my_center|LOCUS_26280 37917 38228 gene locus_tag LOCUS_26290 37917 38228 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_26290 39315 38644 gene locus_tag LOCUS_26300 39315 38644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 39573 39394 gene locus_tag LOCUS_26310 39573 39394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 39895 40455 gene locus_tag LOCUS_26320 39895 40455 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_26320 40460 40966 gene locus_tag LOCUS_26330 gene def 40460 40966 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_26330 40979 41527 gene locus_tag LOCUS_26340 gene amrA 40979 41527 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence34 1326 133 gene locus_tag LOCUS_26350 gene trpB 1326 133 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_26350 2112 1369 gene locus_tag LOCUS_26360 2112 1369 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_26360 2847 2230 gene locus_tag LOCUS_26370 2847 2230 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_26370 4221 2866 gene locus_tag LOCUS_26380 4221 2866 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_26380 5633 4317 gene locus_tag LOCUS_26390 5633 4317 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_26390 6064 5630 gene locus_tag LOCUS_26400 gene nusB 6064 5630 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_26400 6531 6064 gene locus_tag LOCUS_26410 gene ribE 6531 6064 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_26410 7710 6622 gene locus_tag LOCUS_26420 7710 6622 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943627.1 protein_id gnl|my_center|LOCUS_26420 8624 7716 gene locus_tag LOCUS_26430 8624 7716 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926866.1 protein_id gnl|my_center|LOCUS_26430 9287 8631 gene locus_tag LOCUS_26440 9287 8631 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_26440 10675 9284 gene locus_tag LOCUS_26450 10675 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 11058 10675 gene locus_tag LOCUS_26460 11058 10675 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_26460 12968 11055 gene locus_tag LOCUS_26470 gene nuoG 12968 11055 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944049.1 protein_id gnl|my_center|LOCUS_26470 13983 13186 gene locus_tag LOCUS_26480 13983 13186 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941827.1 protein_id gnl|my_center|LOCUS_26480 14141 16537 gene locus_tag LOCUS_26490 gene ptsP 14141 16537 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941826.1 protein_id gnl|my_center|LOCUS_26490 16900 16595 gene locus_tag LOCUS_26500 16900 16595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 19475 17073 gene locus_tag LOCUS_26510 19475 17073 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455369.1 protein_id gnl|my_center|LOCUS_26510 20832 19513 gene locus_tag LOCUS_26520 20832 19513 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938840.1 protein_id gnl|my_center|LOCUS_26520 21349 23160 gene locus_tag LOCUS_26530 21349 23160 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_26530 23198 25585 gene locus_tag LOCUS_26540 23198 25585 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272544.1 protein_id gnl|my_center|LOCUS_26540 25706 26878 gene locus_tag LOCUS_26550 25706 26878 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_26550 27019 28797 gene locus_tag LOCUS_26560 27019 28797 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_26560 28861 29826 gene locus_tag LOCUS_26570 28861 29826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 29917 31920 gene locus_tag LOCUS_26580 29917 31920 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461059.1 protein_id gnl|my_center|LOCUS_26580 31946 32503 gene locus_tag LOCUS_26590 31946 32503 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_26590 32506 33423 gene locus_tag LOCUS_26600 32506 33423 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707407.1 protein_id gnl|my_center|LOCUS_26600 33429 34205 gene locus_tag LOCUS_26610 33429 34205 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_26610 34226 35434 gene locus_tag LOCUS_26620 34226 35434 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792854.1 protein_id gnl|my_center|LOCUS_26620 35922 35524 gene locus_tag LOCUS_26630 35922 35524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 36116 36901 gene locus_tag LOCUS_26640 36116 36901 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_26640 36898 39060 gene locus_tag LOCUS_26650 36898 39060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence35 161 1420 gene locus_tag LOCUS_26660 161 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 1713 2396 gene locus_tag LOCUS_26670 1713 2396 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_26670 3364 2762 gene locus_tag LOCUS_26680 3364 2762 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941844.1 protein_id gnl|my_center|LOCUS_26680 4934 3456 gene locus_tag LOCUS_26690 4934 3456 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_26690 5101 6156 gene locus_tag LOCUS_26700 gene desE 5101 6156 CDS product fatty acid desaturase DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399588.1 protein_id gnl|my_center|LOCUS_26700 6574 6194 gene locus_tag LOCUS_26710 6574 6194 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_26710 7484 6657 gene locus_tag LOCUS_26720 7484 6657 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740539.1 protein_id gnl|my_center|LOCUS_26720 10397 7605 gene locus_tag LOCUS_26730 gene ppc 10397 7605 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 protein_id gnl|my_center|LOCUS_26730 10736 10434 gene locus_tag LOCUS_26740 10736 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 11075 10758 gene locus_tag LOCUS_26750 11075 10758 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941979.1 protein_id gnl|my_center|LOCUS_26750 11520 11116 gene locus_tag LOCUS_26760 11520 11116 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933794.1 protein_id gnl|my_center|LOCUS_26760 12102 11632 gene locus_tag LOCUS_26770 12102 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 12481 12143 gene locus_tag LOCUS_26780 12481 12143 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944048.1 protein_id gnl|my_center|LOCUS_26780 13141 12611 gene locus_tag LOCUS_26790 gene fabA 13141 12611 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316569.1 protein_id gnl|my_center|LOCUS_26790 13676 13272 gene locus_tag LOCUS_26800 13676 13272 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061570.1 protein_id gnl|my_center|LOCUS_26800 14526 13861 gene locus_tag LOCUS_26810 14526 13861 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_26810 18148 14612 gene locus_tag LOCUS_26820 18148 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943753.1 protein_id gnl|my_center|LOCUS_26820 19866 18226 gene locus_tag LOCUS_26830 gene lnt 19866 18226 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_26830 20824 19970 gene locus_tag LOCUS_26840 20824 19970 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_26840 21013 21264 gene locus_tag LOCUS_26850 21013 21264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 21806 21489 gene locus_tag LOCUS_26860 21806 21489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943407.1 protein_id gnl|my_center|LOCUS_26860 22087 23928 gene locus_tag LOCUS_26870 gene ftsH 22087 23928 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941840.1 protein_id gnl|my_center|LOCUS_26870 24998 25759 gene locus_tag LOCUS_26880 24998 25759 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941733.1 protein_id gnl|my_center|LOCUS_26880 25962 26273 gene locus_tag LOCUS_26890 25962 26273 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039127.1 protein_id gnl|my_center|LOCUS_26890 26270 27985 gene locus_tag LOCUS_26900 26270 27985 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 protein_id gnl|my_center|LOCUS_26900 28323 29426 gene locus_tag LOCUS_26910 28323 29426 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940905.1 protein_id gnl|my_center|LOCUS_26910 31050 32258 gene locus_tag LOCUS_26920 31050 32258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 33825 32464 gene locus_tag LOCUS_26930 gene pcnB 33825 32464 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943862.1 protein_id gnl|my_center|LOCUS_26930 34843 33953 gene locus_tag LOCUS_26940 34843 33953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 35873 35235 gene locus_tag LOCUS_26950 35873 35235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 37248 35962 gene locus_tag LOCUS_26960 37248 35962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 37652 37395 gene locus_tag LOCUS_26970 37652 37395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 38692 38174 gene locus_tag LOCUS_26980 38692 38174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence36 567 199 gene locus_tag LOCUS_26990 567 199 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941122.1 protein_id gnl|my_center|LOCUS_26990 1607 723 gene locus_tag LOCUS_27000 1607 723 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_27000 3343 1604 gene locus_tag LOCUS_27010 gene recD 3343 1604 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932748.1 protein_id gnl|my_center|LOCUS_27010 4512 3430 gene locus_tag LOCUS_27020 4512 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 5067 4579 gene locus_tag LOCUS_27030 5067 4579 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941021.1 protein_id gnl|my_center|LOCUS_27030 5146 6180 gene locus_tag LOCUS_27040 5146 6180 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_27040 6241 7386 gene locus_tag LOCUS_27050 6241 7386 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_27050 7387 8025 gene locus_tag LOCUS_27060 7387 8025 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941145.1 protein_id gnl|my_center|LOCUS_27060 9058 8129 gene locus_tag LOCUS_27070 9058 8129 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_27070 8960 9160 gene locus_tag LOCUS_27080 8960 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 9491 9228 gene locus_tag LOCUS_27090 9491 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940758.1 protein_id gnl|my_center|LOCUS_27090 10948 9515 gene locus_tag LOCUS_27100 10948 9515 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_27100 11232 11834 gene locus_tag LOCUS_27110 11232 11834 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940756.1 protein_id gnl|my_center|LOCUS_27110 13182 11923 gene locus_tag LOCUS_27120 13182 11923 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940986.1 protein_id gnl|my_center|LOCUS_27120 13913 13260 gene locus_tag LOCUS_27130 gene elbB 13913 13260 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940751.1 protein_id gnl|my_center|LOCUS_27130 14851 13937 gene locus_tag LOCUS_27140 14851 13937 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940752.1 protein_id gnl|my_center|LOCUS_27140 15035 16654 gene locus_tag LOCUS_27150 15035 16654 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937393.1 protein_id gnl|my_center|LOCUS_27150 16737 19052 gene locus_tag LOCUS_27160 gene lon 16737 19052 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941591.1 protein_id gnl|my_center|LOCUS_27160 19687 19181 gene locus_tag LOCUS_27170 gene mog 19687 19181 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_27170 20166 19684 gene locus_tag LOCUS_27180 gene moaC 20166 19684 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943342.1 protein_id gnl|my_center|LOCUS_27180 20635 20306 gene locus_tag LOCUS_27190 20635 20306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 20915 20625 gene locus_tag LOCUS_27200 20915 20625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 22545 21481 gene locus_tag LOCUS_27210 22545 21481 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_27210 24264 22612 gene locus_tag LOCUS_27220 24264 22612 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941104.1 protein_id gnl|my_center|LOCUS_27220 25668 24295 gene locus_tag LOCUS_27230 gene dnaB 25668 24295 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_27230 25874 27856 gene locus_tag LOCUS_27240 25874 27856 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942091.1 protein_id gnl|my_center|LOCUS_27240 29535 28234 gene locus_tag LOCUS_27250 gene gptM 29535 28234 CDS product geopeptide radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942092.1 protein_id gnl|my_center|LOCUS_27250 30217 29936 gene locus_tag LOCUS_27260 30217 29936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 30210 31076 gene locus_tag LOCUS_27270 30210 31076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 31073 33394 gene locus_tag LOCUS_27280 31073 33394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 33391 35508 gene locus_tag LOCUS_27290 33391 35508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 36759 35596 gene locus_tag LOCUS_27300 gene pseC 36759 35596 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_27300 36758 37090 gene locus_tag LOCUS_27310 36758 37090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 37087 38040 gene locus_tag LOCUS_27320 37087 38040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 38737 37973 gene locus_tag LOCUS_27330 38737 37973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence37 377 246 gene locus_tag LOCUS_27340 377 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 1449 400 gene locus_tag LOCUS_27350 1449 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941634.1 protein_id gnl|my_center|LOCUS_27350 1713 1462 gene locus_tag LOCUS_27360 1713 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941633.1 protein_id gnl|my_center|LOCUS_27360 1816 1694 gene locus_tag LOCUS_27370 1816 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 2044 1853 gene locus_tag LOCUS_27380 2044 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941632.1 protein_id gnl|my_center|LOCUS_27380 2380 2952 gene locus_tag LOCUS_27390 2380 2952 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_27390 3435 3794 gene locus_tag LOCUS_27400 3435 3794 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_27400 3787 4062 gene locus_tag LOCUS_27410 3787 4062 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272449.1 protein_id gnl|my_center|LOCUS_27410 6127 4208 gene locus_tag LOCUS_27420 6127 4208 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942341.1 protein_id gnl|my_center|LOCUS_27420 6839 6114 gene locus_tag LOCUS_27430 6839 6114 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644821.1 protein_id gnl|my_center|LOCUS_27430 6735 7034 gene locus_tag LOCUS_27440 6735 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 7882 6977 gene locus_tag LOCUS_27450 7882 6977 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942339.1 protein_id gnl|my_center|LOCUS_27450 8022 8306 gene locus_tag LOCUS_27460 8022 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942318.1 protein_id gnl|my_center|LOCUS_27460 8485 10011 gene locus_tag LOCUS_27470 8485 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 10012 11406 gene locus_tag LOCUS_27480 10012 11406 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941631.1 protein_id gnl|my_center|LOCUS_27480 11576 13615 gene locus_tag LOCUS_27490 gene hyfB 11576 13615 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_27490 13612 14556 gene locus_tag LOCUS_27500 13612 14556 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_27500 14561 15226 gene locus_tag LOCUS_27510 14561 15226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_27510 15458 16282 gene locus_tag LOCUS_27520 15458 16282 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_27520 16289 16429 gene locus_tag LOCUS_27530 16289 16429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 16627 17274 gene locus_tag LOCUS_27540 16627 17274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 17427 18875 gene locus_tag LOCUS_27550 17427 18875 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_27550 18872 20455 gene locus_tag LOCUS_27560 18872 20455 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089083.1 protein_id gnl|my_center|LOCUS_27560 20560 21129 gene locus_tag LOCUS_27570 20560 21129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 21126 21431 gene locus_tag LOCUS_27580 21126 21431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 21643 22587 gene locus_tag LOCUS_27590 21643 22587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 22786 23124 gene locus_tag LOCUS_27600 22786 23124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 23195 23716 gene locus_tag LOCUS_27610 23195 23716 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_27610 25747 23741 gene locus_tag LOCUS_27620 25747 23741 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_27620 26430 25744 gene locus_tag LOCUS_27630 26430 25744 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_27630 26800 26435 gene locus_tag LOCUS_27640 26800 26435 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941397.1 protein_id gnl|my_center|LOCUS_27640 27029 26793 gene locus_tag LOCUS_27650 27029 26793 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941398.1 protein_id gnl|my_center|LOCUS_27650 27211 29202 gene locus_tag LOCUS_27660 27211 29202 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941399.1 protein_id gnl|my_center|LOCUS_27660 29247 30155 gene locus_tag LOCUS_27670 29247 30155 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_27670 30163 30804 gene locus_tag LOCUS_27680 30163 30804 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_27680 30809 32245 gene locus_tag LOCUS_27690 30809 32245 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_27690 32242 33762 gene locus_tag LOCUS_27700 32242 33762 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_27700 33872 34618 gene locus_tag LOCUS_27710 33872 34618 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_27710 34615 35532 gene locus_tag LOCUS_27720 34615 35532 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940889.1 protein_id gnl|my_center|LOCUS_27720 36857 35622 gene locus_tag LOCUS_27730 gene dinB 36857 35622 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_27730 37105 36854 gene locus_tag LOCUS_27740 37105 36854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940719.1 protein_id gnl|my_center|LOCUS_27740 37717 37109 gene locus_tag LOCUS_27750 gene lexA 37717 37109 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940718.1 protein_id gnl|my_center|LOCUS_27750 38149 37952 gene locus_tag LOCUS_27760 38149 37952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940932.1 protein_id gnl|my_center|LOCUS_27760 >Feature sequence38 316 1653 gene locus_tag LOCUS_27770 316 1653 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943105.1 protein_id gnl|my_center|LOCUS_27770 1836 1991 gene locus_tag LOCUS_27780 1836 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 1988 2455 gene locus_tag LOCUS_27790 1988 2455 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_27790 2653 3123 gene locus_tag LOCUS_27800 2653 3123 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940875.1 protein_id gnl|my_center|LOCUS_27800 3120 5291 gene locus_tag LOCUS_27810 3120 5291 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_27810 5436 5759 gene locus_tag LOCUS_27820 5436 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 5927 6082 gene locus_tag LOCUS_27830 5927 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 6541 7563 gene locus_tag LOCUS_27840 6541 7563 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_27840 7651 8301 gene locus_tag LOCUS_27850 7651 8301 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729782.1 protein_id gnl|my_center|LOCUS_27850 8408 9310 gene locus_tag LOCUS_27860 8408 9310 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941492.1 protein_id gnl|my_center|LOCUS_27860 9342 10250 gene locus_tag LOCUS_27870 9342 10250 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941599.1 protein_id gnl|my_center|LOCUS_27870 10283 10786 gene locus_tag LOCUS_27880 10283 10786 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_27880 11102 10827 gene locus_tag LOCUS_27890 11102 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 11524 11105 gene locus_tag LOCUS_27900 11524 11105 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940910.1 protein_id gnl|my_center|LOCUS_27900 12224 11550 gene locus_tag LOCUS_27910 12224 11550 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941846.1 protein_id gnl|my_center|LOCUS_27910 14200 12470 gene locus_tag LOCUS_27920 14200 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 14526 14452 gene locus_tag LOCUS_t00320 14526 14452 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14782 15648 gene locus_tag LOCUS_27930 14782 15648 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941330.1 protein_id gnl|my_center|LOCUS_27930 16986 15769 gene locus_tag LOCUS_27940 16986 15769 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941728.1 protein_id gnl|my_center|LOCUS_27940 19078 17078 gene locus_tag LOCUS_27950 19078 17078 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942987.1 protein_id gnl|my_center|LOCUS_27950 19406 19095 gene locus_tag LOCUS_27960 19406 19095 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941730.1 protein_id gnl|my_center|LOCUS_27960 20277 19501 gene locus_tag LOCUS_27970 20277 19501 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941733.1 protein_id gnl|my_center|LOCUS_27970 20839 23022 gene locus_tag LOCUS_27980 20839 23022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 23085 24209 gene locus_tag LOCUS_27990 23085 24209 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486313.1 protein_id gnl|my_center|LOCUS_27990 24295 25491 gene locus_tag LOCUS_28000 24295 25491 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_28000 25649 26977 gene locus_tag LOCUS_28010 25649 26977 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_28010 27131 27511 gene locus_tag LOCUS_28020 27131 27511 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_28020 27738 27905 gene locus_tag LOCUS_28030 27738 27905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 27905 30571 gene locus_tag LOCUS_28040 27905 30571 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229117.1 protein_id gnl|my_center|LOCUS_28040 30568 32106 gene locus_tag LOCUS_28050 gene casA 30568 32106 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 protein_id gnl|my_center|LOCUS_28050 32103 32573 gene locus_tag LOCUS_28060 gene casB 32103 32573 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229115.1 protein_id gnl|my_center|LOCUS_28060 32621 33808 gene locus_tag LOCUS_28070 gene cas7e 32621 33808 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_28070 33812 34513 gene locus_tag LOCUS_28080 gene cas5e 33812 34513 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_28080 34896 35174 gene locus_tag LOCUS_28090 34896 35174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 35460 35861 gene locus_tag LOCUS_28100 35460 35861 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_28100 35890 36810 gene locus_tag LOCUS_28110 gene cas1e 35890 36810 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942041.1 protein_id gnl|my_center|LOCUS_28110 36937 37248 gene locus_tag LOCUS_28120 gene cas2e 36937 37248 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942042.1 protein_id gnl|my_center|LOCUS_28120 37317 >37771 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgttccccgcaagcgcggggatgaaccg >Feature sequence39 282 1274 gene locus_tag LOCUS_28130 gene fliG 282 1274 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941079.1 protein_id gnl|my_center|LOCUS_28130 1261 1992 gene locus_tag LOCUS_28140 1261 1992 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941080.1 protein_id gnl|my_center|LOCUS_28140 2014 3333 gene locus_tag LOCUS_28150 2014 3333 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_28150 3365 3808 gene locus_tag LOCUS_28160 gene fliJ 3365 3808 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941082.1 protein_id gnl|my_center|LOCUS_28160 3808 4371 gene locus_tag LOCUS_28170 3808 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 4442 6376 gene locus_tag LOCUS_28180 4442 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 6393 7055 gene locus_tag LOCUS_28190 6393 7055 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_28190 7059 7445 gene locus_tag LOCUS_28200 7059 7445 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_28200 7545 8432 gene locus_tag LOCUS_28210 7545 8432 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392300.1 protein_id gnl|my_center|LOCUS_28210 8589 9122 gene locus_tag LOCUS_28220 8589 9122 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941088.1 protein_id gnl|my_center|LOCUS_28220 9143 10129 gene locus_tag LOCUS_28230 gene fliM 9143 10129 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941089.1 protein_id gnl|my_center|LOCUS_28230 10122 10421 gene locus_tag LOCUS_28240 gene fliN 10122 10421 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941090.1 protein_id gnl|my_center|LOCUS_28240 10418 10822 gene locus_tag LOCUS_28250 10418 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 10846 11613 gene locus_tag LOCUS_28260 gene fliP 10846 11613 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_28260 11630 11899 gene locus_tag LOCUS_28270 gene fliQ 11630 11899 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941093.1 protein_id gnl|my_center|LOCUS_28270 11904 12698 gene locus_tag LOCUS_28280 gene fliR 11904 12698 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941094.1 protein_id gnl|my_center|LOCUS_28280 12801 13772 gene locus_tag LOCUS_28290 gene flhB 12801 13772 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941095.1 protein_id gnl|my_center|LOCUS_28290 13983 16067 gene locus_tag LOCUS_28300 gene flhA 13983 16067 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_28300 16057 17394 gene locus_tag LOCUS_28310 gene flhF 16057 17394 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943680.1 protein_id gnl|my_center|LOCUS_28310 17391 18314 gene locus_tag LOCUS_28320 17391 18314 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_28320 18318 19064 gene locus_tag LOCUS_28330 18318 19064 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_28330 19077 19814 gene locus_tag LOCUS_28340 gene flgF 19077 19814 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_28340 19842 20630 gene locus_tag LOCUS_28350 gene flgG 19842 20630 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_28350 20730 21443 gene locus_tag LOCUS_28360 gene flgA 20730 21443 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943675.1 protein_id gnl|my_center|LOCUS_28360 21581 22261 gene locus_tag LOCUS_28370 21581 22261 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_28370 22276 23370 gene locus_tag LOCUS_28380 22276 23370 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_28380 23421 23792 gene locus_tag LOCUS_28390 23421 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 23821 24312 gene locus_tag LOCUS_28400 23821 24312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 24314 25711 gene locus_tag LOCUS_28410 gene flgK 24314 25711 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_28410 25798 26712 gene locus_tag LOCUS_28420 gene flgL 25798 26712 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_28420 29106 26896 gene locus_tag LOCUS_28430 29106 26896 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944022.1 protein_id gnl|my_center|LOCUS_28430 29793 29257 gene locus_tag LOCUS_28440 29793 29257 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_28440 29930 30880 gene locus_tag LOCUS_28450 29930 30880 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_28450 31127 32473 gene locus_tag LOCUS_28460 31127 32473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943361.1 protein_id gnl|my_center|LOCUS_28460 32470 32946 gene locus_tag LOCUS_28470 32470 32946 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943360.1 protein_id gnl|my_center|LOCUS_28470 33483 33283 gene locus_tag LOCUS_28480 33483 33283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 35109 36947 gene locus_tag LOCUS_28490 35109 36947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence40 371 156 gene locus_tag LOCUS_28500 371 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 408 995 gene locus_tag LOCUS_28510 408 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 1041 2186 gene locus_tag LOCUS_28520 1041 2186 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705890.1 protein_id gnl|my_center|LOCUS_28520 2173 2655 gene locus_tag LOCUS_28530 2173 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 2668 5097 gene locus_tag LOCUS_28540 2668 5097 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819022.1 protein_id gnl|my_center|LOCUS_28540 5158 7587 gene locus_tag LOCUS_28550 5158 7587 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943959.1 protein_id gnl|my_center|LOCUS_28550 7588 8115 gene locus_tag LOCUS_28560 7588 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 8291 9169 gene locus_tag LOCUS_28570 gene gspC 8291 9169 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940998.1 protein_id gnl|my_center|LOCUS_28570 9183 11159 gene locus_tag LOCUS_28580 gene gspD 9183 11159 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_28580 11156 12727 gene locus_tag LOCUS_28590 gene gspE 11156 12727 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_28590 12708 13919 gene locus_tag LOCUS_28600 gene gspF 12708 13919 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_28600 15410 14016 gene locus_tag LOCUS_28610 gene ahcY 15410 14016 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942520.1 protein_id gnl|my_center|LOCUS_28610 16427 15501 gene locus_tag LOCUS_28620 16427 15501 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_28620 16678 19209 gene locus_tag LOCUS_28630 16678 19209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 19260 19817 gene locus_tag LOCUS_28640 19260 19817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 21396 19921 gene locus_tag LOCUS_28650 21396 19921 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_28650 23348 21393 gene locus_tag LOCUS_28660 23348 21393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 24873 23341 gene locus_tag LOCUS_28670 24873 23341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 27659 24873 gene locus_tag LOCUS_28680 27659 24873 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_28680 28063 28929 gene locus_tag LOCUS_28690 gene mtnP 28063 28929 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_28690 29037 30122 gene locus_tag LOCUS_28700 29037 30122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943125.1 protein_id gnl|my_center|LOCUS_28700 30136 31026 gene locus_tag LOCUS_28710 gene rocF 30136 31026 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038039155.1 protein_id gnl|my_center|LOCUS_28710 31248 32165 gene locus_tag LOCUS_28720 31248 32165 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_28720 32359 32162 gene locus_tag LOCUS_28730 32359 32162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 32261 33010 gene locus_tag LOCUS_28740 32261 33010 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941775.1 protein_id gnl|my_center|LOCUS_28740 33022 33891 gene locus_tag LOCUS_28750 33022 33891 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941776.1 protein_id gnl|my_center|LOCUS_28750 34061 34474 gene locus_tag LOCUS_28760 34061 34474 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941778.1 protein_id gnl|my_center|LOCUS_28760 34461 34916 gene locus_tag LOCUS_28770 34461 34916 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_28770 34948 36135 gene locus_tag LOCUS_28780 34948 36135 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941780.1 protein_id gnl|my_center|LOCUS_28780 36208 36606 gene locus_tag LOCUS_28790 36208 36606 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941781.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence41 151 76 gene locus_tag LOCUS_t00330 151 76 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1519 188 gene locus_tag LOCUS_28800 1519 188 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389343.1 protein_id gnl|my_center|LOCUS_28800 1613 2752 gene locus_tag LOCUS_28810 1613 2752 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941162.1 protein_id gnl|my_center|LOCUS_28810 3189 2749 gene locus_tag LOCUS_28820 3189 2749 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943824.1 protein_id gnl|my_center|LOCUS_28820 4597 3281 gene locus_tag LOCUS_28830 gene rimO 4597 3281 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_28830 5128 4643 gene locus_tag LOCUS_28840 5128 4643 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_28840 5900 5163 gene locus_tag LOCUS_28850 5900 5163 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943821.1 protein_id gnl|my_center|LOCUS_28850 7557 5929 gene locus_tag LOCUS_28860 7557 5929 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943817.1 protein_id gnl|my_center|LOCUS_28860 7923 7561 gene locus_tag LOCUS_28870 7923 7561 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943816.1 protein_id gnl|my_center|LOCUS_28870 9380 7938 gene locus_tag LOCUS_28880 gene gatB 9380 7938 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_28880 10771 9380 gene locus_tag LOCUS_28890 gene gatA 10771 9380 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_28890 11154 10867 gene locus_tag LOCUS_28900 gene gatC 11154 10867 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_28900 11356 11784 gene locus_tag LOCUS_28910 gene rplM 11356 11784 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_28910 11806 12198 gene locus_tag LOCUS_28920 gene rpsI 11806 12198 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_28920 12345 13385 gene locus_tag LOCUS_28930 gene argC 12345 13385 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_28930 14763 13471 gene locus_tag LOCUS_28940 14763 13471 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_28940 16079 14766 gene locus_tag LOCUS_28950 16079 14766 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943919.1 protein_id gnl|my_center|LOCUS_28950 17587 16076 gene locus_tag LOCUS_28960 17587 16076 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943918.1 protein_id gnl|my_center|LOCUS_28960 17927 18904 gene locus_tag LOCUS_28970 17927 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 19023 20270 gene locus_tag LOCUS_28980 19023 20270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 22225 20771 gene locus_tag LOCUS_28990 22225 20771 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943916.1 protein_id gnl|my_center|LOCUS_28990 23077 22673 gene locus_tag LOCUS_29000 gene mce 23077 22673 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_29000 24796 23144 gene locus_tag LOCUS_29010 24796 23144 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_29010 27860 24963 gene locus_tag LOCUS_29020 27860 24963 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943912.1 protein_id gnl|my_center|LOCUS_29020 29618 27894 gene locus_tag LOCUS_29030 29618 27894 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943911.1 protein_id gnl|my_center|LOCUS_29030 30251 29688 gene locus_tag LOCUS_29040 30251 29688 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943910.1 protein_id gnl|my_center|LOCUS_29040 31736 30453 gene locus_tag LOCUS_29050 31736 30453 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943909.1 protein_id gnl|my_center|LOCUS_29050 33975 31843 gene locus_tag LOCUS_29060 gene uvrB 33975 31843 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_29060 34795 33962 gene locus_tag LOCUS_29070 34795 33962 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_29070 35230 34844 gene locus_tag LOCUS_29080 35230 34844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence42 <1 613 gene locus_tag LOCUS_29090 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943065.1:pyruvate carboxylase 1114 1668 gene locus_tag LOCUS_29100 1114 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 3728 1785 gene locus_tag LOCUS_29110 3728 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 3998 4723 gene locus_tag LOCUS_29120 3998 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 5971 4733 gene locus_tag LOCUS_29130 5971 4733 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941367.1 protein_id gnl|my_center|LOCUS_29130 6282 8993 gene locus_tag LOCUS_29140 gene glnD 6282 8993 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_29140 9019 9270 gene locus_tag LOCUS_29150 9019 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 9426 9587 gene locus_tag LOCUS_29160 9426 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 9580 9774 gene locus_tag LOCUS_29170 9580 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29170 10033 10701 gene locus_tag LOCUS_29180 10033 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29180 10950 11321 gene locus_tag LOCUS_29190 10950 11321 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969959.1 protein_id gnl|my_center|LOCUS_29190 11311 11622 gene locus_tag LOCUS_29200 11311 11622 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141642.1 protein_id gnl|my_center|LOCUS_29200 11840 12496 gene locus_tag LOCUS_29210 11840 12496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 12622 13509 gene locus_tag LOCUS_29220 gene xerD 12622 13509 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_29220 13681 14451 gene locus_tag LOCUS_29230 13681 14451 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_29230 14491 15786 gene locus_tag LOCUS_29240 gene purB 14491 15786 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532121.1 protein_id gnl|my_center|LOCUS_29240 15842 16876 gene locus_tag LOCUS_29250 15842 16876 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942278.1 protein_id gnl|my_center|LOCUS_29250 16878 19868 gene locus_tag LOCUS_29260 16878 19868 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_29260 20052 20378 gene locus_tag LOCUS_29270 20052 20378 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142290.1 protein_id gnl|my_center|LOCUS_29270 20365 20772 gene locus_tag LOCUS_29280 20365 20772 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142289.1 protein_id gnl|my_center|LOCUS_29280 20818 22959 gene locus_tag LOCUS_29290 gene recQ 20818 22959 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_29290 23033 23860 gene locus_tag LOCUS_29300 23033 23860 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942280.1 protein_id gnl|my_center|LOCUS_29300 23894 25321 gene locus_tag LOCUS_29310 gene purF 23894 25321 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_29310 25314 25862 gene locus_tag LOCUS_29320 gene pyrE 25314 25862 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_29320 25862 26617 gene locus_tag LOCUS_29330 25862 26617 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_29330 26617 26961 gene locus_tag LOCUS_29340 26617 26961 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942071.1 protein_id gnl|my_center|LOCUS_29340 28385 27087 gene locus_tag LOCUS_29350 28385 27087 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_29350 29661 28399 gene locus_tag LOCUS_29360 29661 28399 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_29360 30065 30523 gene locus_tag LOCUS_29370 gene smpB 30065 30523 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_29370 30546 30898 gene locus_tag LOCUS_tm00010 30546 30898 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence43 564 1088 gene locus_tag LOCUS_29380 564 1088 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_29380 1212 2135 gene locus_tag LOCUS_29390 1212 2135 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_29390 2144 3148 gene locus_tag LOCUS_29400 2144 3148 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940764.1 protein_id gnl|my_center|LOCUS_29400 3355 4200 gene locus_tag LOCUS_29410 3355 4200 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_29410 4392 7778 gene locus_tag LOCUS_29420 4392 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 8347 7865 gene locus_tag LOCUS_29430 8347 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 9545 8361 gene locus_tag LOCUS_29440 9545 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 10264 9545 gene locus_tag LOCUS_29450 gene ispD 10264 9545 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_29450 11673 10261 gene locus_tag LOCUS_29460 gene selA 11673 10261 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_29460 12511 11822 gene locus_tag LOCUS_29470 12511 11822 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_29470 12809 12615 gene locus_tag LOCUS_29480 12809 12615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 12744 13766 gene locus_tag LOCUS_29490 12744 13766 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_29490 13756 14526 gene locus_tag LOCUS_29500 13756 14526 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943982.1 protein_id gnl|my_center|LOCUS_29500 14583 15569 gene locus_tag LOCUS_29510 gene galE 14583 15569 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_29510 16741 15587 gene locus_tag LOCUS_29520 16741 15587 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940982.1 protein_id gnl|my_center|LOCUS_29520 18085 16751 gene locus_tag LOCUS_29530 18085 16751 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_29530 19881 18868 gene locus_tag LOCUS_29540 19881 18868 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071609.1 protein_id gnl|my_center|LOCUS_29540 20817 20236 gene locus_tag LOCUS_29550 gene satP 20817 20236 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209246.1 protein_id gnl|my_center|LOCUS_29550 21942 21163 gene locus_tag LOCUS_29560 21942 21163 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941733.1 protein_id gnl|my_center|LOCUS_29560 22529 22191 gene locus_tag LOCUS_29570 22529 22191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 22839 22630 gene locus_tag LOCUS_29580 22839 22630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 23583 23353 gene locus_tag LOCUS_29590 23583 23353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 25538 23814 gene locus_tag LOCUS_29600 25538 23814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 25902 26309 gene locus_tag LOCUS_29610 25902 26309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence44 <1 992 gene locus_tag LOCUS_29620 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943976.1:cysteine--tRNA ligase 1169 2752 gene locus_tag LOCUS_29630 1169 2752 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943864.1 protein_id gnl|my_center|LOCUS_29630 2749 3129 gene locus_tag LOCUS_29640 2749 3129 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943865.1 protein_id gnl|my_center|LOCUS_29640 3197 5704 gene locus_tag LOCUS_29650 3197 5704 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943866.1 protein_id gnl|my_center|LOCUS_29650 5715 7904 gene locus_tag LOCUS_29660 5715 7904 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943867.1 protein_id gnl|my_center|LOCUS_29660 7964 8989 gene locus_tag LOCUS_29670 gene galT 7964 8989 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943868.1 protein_id gnl|my_center|LOCUS_29670 8992 9858 gene locus_tag LOCUS_29680 8992 9858 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_29680 9972 11447 gene locus_tag LOCUS_29690 9972 11447 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943347.1 protein_id gnl|my_center|LOCUS_29690 12055 11534 gene locus_tag LOCUS_29700 12055 11534 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940903.1 protein_id gnl|my_center|LOCUS_29700 12470 12159 gene locus_tag LOCUS_29710 12470 12159 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_29710 12909 12457 gene locus_tag LOCUS_29720 12909 12457 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941529.1 protein_id gnl|my_center|LOCUS_29720 13252 12929 gene locus_tag LOCUS_29730 13252 12929 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_29730 13479 14288 gene locus_tag LOCUS_29740 13479 14288 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_29740 14285 14620 gene locus_tag LOCUS_29750 14285 14620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940961.1 protein_id gnl|my_center|LOCUS_29750 14680 14970 gene locus_tag LOCUS_29760 14680 14970 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943600.1 protein_id gnl|my_center|LOCUS_29760 15220 16815 gene locus_tag LOCUS_29770 15220 16815 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941158.1 protein_id gnl|my_center|LOCUS_29770 16979 17683 gene locus_tag LOCUS_29780 16979 17683 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943279.1 protein_id gnl|my_center|LOCUS_29780 17696 18370 gene locus_tag LOCUS_29790 17696 18370 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943278.1 protein_id gnl|my_center|LOCUS_29790 19307 18462 gene locus_tag LOCUS_29800 gene xerC 19307 18462 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_29800 19805 19374 gene locus_tag LOCUS_29810 19805 19374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 21639 19810 gene locus_tag LOCUS_29820 21639 19810 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_29820 21718 22320 gene locus_tag LOCUS_29830 21718 22320 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_29830 22374 23243 gene locus_tag LOCUS_29840 gene pgeF 22374 23243 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_29840 >Feature sequence45 849 2699 gene locus_tag LOCUS_29850 849 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 2859 3890 gene locus_tag LOCUS_29860 2859 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 3922 4431 gene locus_tag LOCUS_29870 3922 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 4612 4815 gene locus_tag LOCUS_29880 4612 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 4861 6237 gene locus_tag LOCUS_29890 gene argH 4861 6237 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_29890 6244 7107 gene locus_tag LOCUS_29900 6244 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 7115 7837 gene locus_tag LOCUS_29910 7115 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942183.1 protein_id gnl|my_center|LOCUS_29910 7865 8626 gene locus_tag LOCUS_29920 7865 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 8985 8707 gene locus_tag LOCUS_29930 gene atpE 8985 8707 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941001.1 protein_id gnl|my_center|LOCUS_29930 9748 9059 gene locus_tag LOCUS_29940 9748 9059 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_29940 10136 9753 gene locus_tag LOCUS_29950 10136 9753 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941003.1 protein_id gnl|my_center|LOCUS_29950 10353 10111 gene locus_tag LOCUS_29960 10353 10111 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941004.1 protein_id gnl|my_center|LOCUS_29960 11725 10439 gene locus_tag LOCUS_29970 gene hemL 11725 10439 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_29970 11974 12330 gene locus_tag LOCUS_29980 11974 12330 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_29980 12321 12836 gene locus_tag LOCUS_29990 12321 12836 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_29990 12891 13379 gene locus_tag LOCUS_30000 12891 13379 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941008.1 protein_id gnl|my_center|LOCUS_30000 13427 14599 gene locus_tag LOCUS_30010 gene nuoD 13427 14599 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_30010 14627 15139 gene locus_tag LOCUS_30020 14627 15139 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941010.1 protein_id gnl|my_center|LOCUS_30020 15168 16955 gene locus_tag LOCUS_30030 gene nuoF 15168 16955 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941011.1 protein_id gnl|my_center|LOCUS_30030 17010 19484 gene locus_tag LOCUS_30040 17010 19484 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941012.1 protein_id gnl|my_center|LOCUS_30040 19538 20605 gene locus_tag LOCUS_30050 gene nuoH 19538 20605 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_30050 20647 21051 gene locus_tag LOCUS_30060 gene nuoI 20647 21051 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941014.1 protein_id gnl|my_center|LOCUS_30060 21063 21569 gene locus_tag LOCUS_30070 21063 21569 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_30070 21586 21888 gene locus_tag LOCUS_30080 gene nuoK 21586 21888 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_30080 21938 23932 gene locus_tag LOCUS_30090 gene nuoL 21938 23932 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence46 996 712 gene locus_tag LOCUS_30100 996 712 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020811.1 protein_id gnl|my_center|LOCUS_30100 3415 1175 gene locus_tag LOCUS_30110 3415 1175 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_30110 3715 4782 gene locus_tag LOCUS_30120 3715 4782 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942515.1 protein_id gnl|my_center|LOCUS_30120 4797 5909 gene locus_tag LOCUS_30130 4797 5909 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942514.1 protein_id gnl|my_center|LOCUS_30130 5975 7153 gene locus_tag LOCUS_30140 5975 7153 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_30140 7200 8519 gene locus_tag LOCUS_30150 7200 8519 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_30150 8679 9701 gene locus_tag LOCUS_30160 gene tsaD 8679 9701 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_30160 9698 10510 gene locus_tag LOCUS_30170 gene rsmA 9698 10510 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942509.1 protein_id gnl|my_center|LOCUS_30170 11124 10543 gene locus_tag LOCUS_30180 11124 10543 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942508.1 protein_id gnl|my_center|LOCUS_30180 11314 12654 gene locus_tag LOCUS_30190 gene rmuC 11314 12654 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_30190 12654 14228 gene locus_tag LOCUS_30200 gene murJ 12654 14228 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_30200 14225 14752 gene locus_tag LOCUS_30210 14225 14752 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039645658.1 protein_id gnl|my_center|LOCUS_30210 15817 15014 gene locus_tag LOCUS_30220 gene mazG 15817 15014 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_30220 15924 16652 gene locus_tag LOCUS_30230 15924 16652 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942088.1 protein_id gnl|my_center|LOCUS_30230 16984 18303 gene locus_tag LOCUS_30240 16984 18303 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942582.1 protein_id gnl|my_center|LOCUS_30240 18293 18841 gene locus_tag LOCUS_30250 18293 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 20078 18954 gene locus_tag LOCUS_30260 gene tgt 20078 18954 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941835.1 protein_id gnl|my_center|LOCUS_30260 20414 21088 gene locus_tag LOCUS_30270 20414 21088 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_30270 21099 23012 gene locus_tag LOCUS_30280 21099 23012 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941837.1 protein_id gnl|my_center|LOCUS_30280 23012 23770 gene locus_tag LOCUS_30290 23012 23770 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941838.1 protein_id gnl|my_center|LOCUS_30290 >Feature sequence47 888 466 gene locus_tag LOCUS_30300 888 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 1780 872 gene locus_tag LOCUS_30310 1780 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 2008 1784 gene locus_tag LOCUS_30320 2008 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 2694 2149 gene locus_tag LOCUS_30330 2694 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 3027 2719 gene locus_tag LOCUS_30340 3027 2719 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994045.1 protein_id gnl|my_center|LOCUS_30340 3367 3032 gene locus_tag LOCUS_30350 3367 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 4703 3405 gene locus_tag LOCUS_30360 4703 3405 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_30360 5717 4890 gene locus_tag LOCUS_30370 5717 4890 CDS product cytidylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942570.1 protein_id gnl|my_center|LOCUS_30370 5771 6421 gene locus_tag LOCUS_30380 5771 6421 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942571.1 protein_id gnl|my_center|LOCUS_30380 7319 6411 gene locus_tag LOCUS_30390 7319 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 8370 7390 gene locus_tag LOCUS_30400 8370 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942576.1 protein_id gnl|my_center|LOCUS_30400 9568 8471 gene locus_tag LOCUS_30410 9568 8471 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942577.1 protein_id gnl|my_center|LOCUS_30410 11685 9601 gene locus_tag LOCUS_30420 gene fusA 11685 9601 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_30420 12593 11829 gene locus_tag LOCUS_30430 12593 11829 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_30430 13575 12595 gene locus_tag LOCUS_30440 13575 12595 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_30440 14406 13579 gene locus_tag LOCUS_30450 gene nadC 14406 13579 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_30450 14596 16098 gene locus_tag LOCUS_30460 14596 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 16999 16178 gene locus_tag LOCUS_30470 16999 16178 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942703.1 protein_id gnl|my_center|LOCUS_30470 16904 17095 gene locus_tag LOCUS_30480 16904 17095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 17942 17100 gene locus_tag LOCUS_30490 17942 17100 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_30490 18261 17926 gene locus_tag LOCUS_30500 18261 17926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942705.1 protein_id gnl|my_center|LOCUS_30500 21272 18471 gene locus_tag LOCUS_30510 21272 18471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 22344 21397 gene locus_tag LOCUS_30520 22344 21397 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_30520 22826 22344 gene locus_tag LOCUS_30530 22826 22344 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942345.1 protein_id gnl|my_center|LOCUS_30530 >Feature sequence48 794 1225 gene locus_tag LOCUS_30540 794 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 2164 1937 gene locus_tag LOCUS_30550 2164 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 2512 2640 gene locus_tag LOCUS_30560 2512 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 3045 3689 gene locus_tag LOCUS_30570 3045 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 3885 4313 gene locus_tag LOCUS_30580 3885 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 4751 5128 gene locus_tag LOCUS_30590 4751 5128 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963397.1 protein_id gnl|my_center|LOCUS_30590 5536 6324 gene locus_tag LOCUS_30600 5536 6324 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082773.1 protein_id gnl|my_center|LOCUS_30600 6885 6391 gene locus_tag LOCUS_30610 6885 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 7850 7293 gene locus_tag LOCUS_30620 7850 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 8782 8015 gene locus_tag LOCUS_30630 8782 8015 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_30630 10107 8827 gene locus_tag LOCUS_30640 10107 8827 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_30640 10382 10573 gene locus_tag LOCUS_30650 10382 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 10656 10868 gene locus_tag LOCUS_30660 10656 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940874.1 protein_id gnl|my_center|LOCUS_30660 11043 11198 gene locus_tag LOCUS_30670 11043 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 12328 11396 gene locus_tag LOCUS_30680 12328 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 13706 12477 gene locus_tag LOCUS_30690 13706 12477 CDS product DUF3443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192528.1 protein_id gnl|my_center|LOCUS_30690 14157 13690 gene locus_tag LOCUS_30700 14157 13690 CDS product DUF2844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531315.1 protein_id gnl|my_center|LOCUS_30700 14872 14408 gene locus_tag LOCUS_30710 14872 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 16875 14998 gene locus_tag LOCUS_30720 16875 14998 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457972.1 protein_id gnl|my_center|LOCUS_30720 17203 19671 gene locus_tag LOCUS_30730 17203 19671 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942486.1 protein_id gnl|my_center|LOCUS_30730 19829 20266 gene locus_tag LOCUS_30740 19829 20266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 20256 20678 gene locus_tag LOCUS_30750 20256 20678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30750 20916 22127 gene locus_tag LOCUS_30760 20916 22127 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_30760 >Feature sequence49 822 418 gene locus_tag LOCUS_30770 822 418 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943046.1 protein_id gnl|my_center|LOCUS_30770 1301 852 gene locus_tag LOCUS_30780 1301 852 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943047.1 protein_id gnl|my_center|LOCUS_30780 1689 2954 gene locus_tag LOCUS_30790 gene nuoF 1689 2954 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944051.1 protein_id gnl|my_center|LOCUS_30790 3042 4424 gene locus_tag LOCUS_30800 3042 4424 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943126.1 protein_id gnl|my_center|LOCUS_30800 4431 6437 gene locus_tag LOCUS_30810 4431 6437 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_30810 6440 7432 gene locus_tag LOCUS_30820 6440 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 7516 8229 gene locus_tag LOCUS_30830 7516 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 9963 8320 gene locus_tag LOCUS_30840 9963 8320 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941068.1 protein_id gnl|my_center|LOCUS_30840 10563 9997 gene locus_tag LOCUS_30850 10563 9997 CDS product CheB methylesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943384.1 protein_id gnl|my_center|LOCUS_30850 10983 10564 gene locus_tag LOCUS_30860 10983 10564 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943385.1 protein_id gnl|my_center|LOCUS_30860 12245 10980 gene locus_tag LOCUS_30870 12245 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30870 14325 12379 gene locus_tag LOCUS_30880 14325 12379 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_30880 14671 14744 gene locus_tag LOCUS_t00340 14671 14744 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15729 14959 gene locus_tag LOCUS_30890 15729 14959 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071010.1 protein_id gnl|my_center|LOCUS_30890 17719 15998 gene locus_tag LOCUS_30900 17719 15998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 18160 17759 gene locus_tag LOCUS_30910 18160 17759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 18712 18170 gene locus_tag LOCUS_30920 18712 18170 CDS product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222498.1 protein_id gnl|my_center|LOCUS_30920 19493 18702 gene locus_tag LOCUS_30930 19493 18702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 19849 19490 gene locus_tag LOCUS_30940 19849 19490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 21399 19861 gene locus_tag LOCUS_30950 21399 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence50 1376 237 gene locus_tag LOCUS_30960 1376 237 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_30960 2182 1400 gene locus_tag LOCUS_30970 2182 1400 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_30970 3042 2197 gene locus_tag LOCUS_30980 3042 2197 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970098.1 protein_id gnl|my_center|LOCUS_30980 4316 3138 gene locus_tag LOCUS_30990 4316 3138 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_30990 5721 4555 gene locus_tag LOCUS_31000 5721 4555 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927165.1 protein_id gnl|my_center|LOCUS_31000 9015 5770 gene locus_tag LOCUS_31010 9015 5770 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_31010 9467 9862 gene locus_tag LOCUS_31020 9467 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 10157 10339 gene locus_tag LOCUS_31030 10157 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 10574 10843 gene locus_tag LOCUS_31040 10574 10843 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941274.1 protein_id gnl|my_center|LOCUS_31040 11153 12076 gene locus_tag LOCUS_31050 11153 12076 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943159.1 protein_id gnl|my_center|LOCUS_31050 12428 12625 gene locus_tag LOCUS_31060 12428 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 12845 13687 gene locus_tag LOCUS_31070 gene mutM 12845 13687 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594829.1 protein_id gnl|my_center|LOCUS_31070 13790 13875 gene locus_tag LOCUS_t00350 13790 13875 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14302 14048 gene locus_tag LOCUS_31080 14302 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 14469 14642 gene locus_tag LOCUS_31090 14469 14642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 15430 14888 gene locus_tag LOCUS_31100 15430 14888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 15702 15430 gene locus_tag LOCUS_31110 15702 15430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 15598 15864 gene locus_tag LOCUS_31120 15598 15864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 15961 16320 gene locus_tag LOCUS_31130 15961 16320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 16324 16758 gene locus_tag LOCUS_31140 16324 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 16965 18761 gene locus_tag LOCUS_31150 16965 18761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 18761 20074 gene locus_tag LOCUS_31160 18761 20074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 20071 21189 gene locus_tag LOCUS_31170 20071 21189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 >Feature sequence51 <1 938 gene locus_tag LOCUS_31180 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940804.1:primosomal protein N' 3162 1054 gene locus_tag LOCUS_31190 3162 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3695 5524 gene locus_tag LOCUS_31200 3695 5524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_31200 5596 6330 gene locus_tag LOCUS_31210 gene hypB 5596 6330 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_31210 6868 7428 gene locus_tag LOCUS_31220 6868 7428 CDS product contact-dependent growth inhibition system immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142760.1 protein_id gnl|my_center|LOCUS_31220 7740 8348 gene locus_tag LOCUS_31230 7740 8348 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_31230 8507 8917 gene locus_tag LOCUS_31240 8507 8917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 9375 8974 gene locus_tag LOCUS_31250 9375 8974 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928351.1 protein_id gnl|my_center|LOCUS_31250 9565 9377 gene locus_tag LOCUS_31260 9565 9377 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689143.1 protein_id gnl|my_center|LOCUS_31260 9842 12160 gene locus_tag LOCUS_31270 gene hypF 9842 12160 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_31270 12162 12392 gene locus_tag LOCUS_31280 12162 12392 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940976.1 protein_id gnl|my_center|LOCUS_31280 12389 13480 gene locus_tag LOCUS_31290 gene hypD 12389 13480 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_31290 13484 14383 gene locus_tag LOCUS_31300 13484 14383 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943923.1 protein_id gnl|my_center|LOCUS_31300 14387 14974 gene locus_tag LOCUS_31310 14387 14974 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014157.1 protein_id gnl|my_center|LOCUS_31310 15026 16300 gene locus_tag LOCUS_31320 15026 16300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941247.1 protein_id gnl|my_center|LOCUS_31320 16375 16767 gene locus_tag LOCUS_31330 16375 16767 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941471.1 protein_id gnl|my_center|LOCUS_31330 18390 16906 gene locus_tag LOCUS_31340 gene pap 18390 16906 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_31340 18686 19090 gene locus_tag LOCUS_31350 18686 19090 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941536.1 protein_id gnl|my_center|LOCUS_31350 20044 19142 gene locus_tag LOCUS_31360 20044 19142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 20123 20509 gene locus_tag LOCUS_31370 20123 20509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence52 <1 786 gene locus_tag LOCUS_31380 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942073.1:prolipoprotein diacylglyceryl transferase 783 1745 gene locus_tag LOCUS_31390 gene pfkA 783 1745 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942710.1 protein_id gnl|my_center|LOCUS_31390 1745 2818 gene locus_tag LOCUS_31400 gene corA 1745 2818 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_31400 2835 3185 gene locus_tag LOCUS_31410 2835 3185 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_31410 3157 4605 gene locus_tag LOCUS_31420 gene tilS 3157 4605 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_31420 4702 6573 gene locus_tag LOCUS_31430 gene ftsH 4702 6573 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_31430 6577 7785 gene locus_tag LOCUS_31440 6577 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 7809 8561 gene locus_tag LOCUS_31450 gene cdaA 7809 8561 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942452.1 protein_id gnl|my_center|LOCUS_31450 8600 9958 gene locus_tag LOCUS_31460 gene glmM 8600 9958 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_31460 9958 10677 gene locus_tag LOCUS_31470 9958 10677 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_31470 10674 11054 gene locus_tag LOCUS_31480 10674 11054 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_31480 11051 12631 gene locus_tag LOCUS_31490 11051 12631 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_31490 12732 13184 gene locus_tag LOCUS_31500 12732 13184 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_31500 13192 13674 gene locus_tag LOCUS_31510 gene tsaE 13192 13674 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_31510 13751 14965 gene locus_tag LOCUS_31520 13751 14965 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_31520 15037 16398 gene locus_tag LOCUS_31530 gene fdhD 15037 16398 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941444.1 protein_id gnl|my_center|LOCUS_31530 16855 16391 gene locus_tag LOCUS_31540 gene tadA 16855 16391 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_31540 17730 16882 gene locus_tag LOCUS_31550 17730 16882 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_31550 18183 17740 gene locus_tag LOCUS_31560 18183 17740 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_31560 18305 18499 gene locus_tag LOCUS_31570 18305 18499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 19394 18552 gene locus_tag LOCUS_31580 gene lipA 19394 18552 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941048.1 protein_id gnl|my_center|LOCUS_31580 20146 19391 gene locus_tag LOCUS_31590 20146 19391 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941047.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence53 921 592 gene locus_tag LOCUS_31600 921 592 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943430.1 protein_id gnl|my_center|LOCUS_31600 1238 975 gene locus_tag LOCUS_31610 gene fdxB 1238 975 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943431.1 protein_id gnl|my_center|LOCUS_31610 1580 1317 gene locus_tag LOCUS_31620 gene fdxB 1580 1317 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943431.1 protein_id gnl|my_center|LOCUS_31620 2028 1642 gene locus_tag LOCUS_31630 gene nifX 2028 1642 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943432.1 protein_id gnl|my_center|LOCUS_31630 2456 3562 gene locus_tag LOCUS_31640 2456 3562 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943210.1 protein_id gnl|my_center|LOCUS_31640 6401 3642 gene locus_tag LOCUS_31650 6401 3642 CDS product bifunctional nitrogenase iron-molybdenum cofactor biosynthesis protein NifEN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943433.1 protein_id gnl|my_center|LOCUS_31650 8196 6727 gene locus_tag LOCUS_31660 gene nifK 8196 6727 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943445.1 protein_id gnl|my_center|LOCUS_31660 9778 8333 gene locus_tag LOCUS_31670 gene nifD 9778 8333 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943446.1 protein_id gnl|my_center|LOCUS_31670 10776 9907 gene locus_tag LOCUS_31680 gene nifH 10776 9907 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_31680 12185 11127 gene locus_tag LOCUS_31690 gene modC 12185 11127 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943591.1 protein_id gnl|my_center|LOCUS_31690 12870 12187 gene locus_tag LOCUS_31700 gene modB 12870 12187 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943592.1 protein_id gnl|my_center|LOCUS_31700 13624 12881 gene locus_tag LOCUS_31710 gene modA 13624 12881 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943593.1 protein_id gnl|my_center|LOCUS_31710 14523 13669 gene locus_tag LOCUS_31720 gene modD 14523 13669 CDS product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932141.1 protein_id gnl|my_center|LOCUS_31720 15413 14607 gene locus_tag LOCUS_31730 15413 14607 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943595.1 protein_id gnl|my_center|LOCUS_31730 16789 15512 gene locus_tag LOCUS_31740 16789 15512 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_31740 17107 17661 gene locus_tag LOCUS_31750 17107 17661 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943765.1 protein_id gnl|my_center|LOCUS_31750 17658 17966 gene locus_tag LOCUS_31760 17658 17966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 18197 18042 gene locus_tag LOCUS_31770 18197 18042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 18891 18232 gene locus_tag LOCUS_31780 18891 18232 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_31780 19521 19105 gene locus_tag LOCUS_31790 19521 19105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 19677 19814 gene locus_tag LOCUS_31800 19677 19814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 20034 19819 gene locus_tag LOCUS_31810 20034 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence54 995 762 gene locus_tag LOCUS_31820 995 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 2784 1144 gene locus_tag LOCUS_31830 2784 1144 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 protein_id gnl|my_center|LOCUS_31830 3560 2928 gene locus_tag LOCUS_31840 3560 2928 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256419.1 protein_id gnl|my_center|LOCUS_31840 3748 4002 gene locus_tag LOCUS_31850 gene yefM 3748 4002 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259255.1 protein_id gnl|my_center|LOCUS_31850 3999 4253 gene locus_tag LOCUS_31860 gene yoeB 3999 4253 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_31860 5604 4534 gene locus_tag LOCUS_31870 5604 4534 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942522.1 protein_id gnl|my_center|LOCUS_31870 6066 5890 gene locus_tag LOCUS_31880 6066 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 6335 6928 gene locus_tag LOCUS_31890 6335 6928 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_31890 7183 7635 gene locus_tag LOCUS_31900 7183 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 7749 8144 gene locus_tag LOCUS_31910 7749 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 8198 8665 gene locus_tag LOCUS_31920 8198 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 8768 9223 gene locus_tag LOCUS_31930 8768 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 9491 10159 gene locus_tag LOCUS_31940 9491 10159 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104937.1 protein_id gnl|my_center|LOCUS_31940 10194 11339 gene locus_tag LOCUS_31950 10194 11339 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103299.1 protein_id gnl|my_center|LOCUS_31950 11336 14428 gene locus_tag LOCUS_31960 11336 14428 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967993.1 protein_id gnl|my_center|LOCUS_31960 14413 15819 gene locus_tag LOCUS_31970 gene adeC 14413 15819 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153304094.1 protein_id gnl|my_center|LOCUS_31970 15896 16165 gene locus_tag LOCUS_31980 15896 16165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 16187 16576 gene locus_tag LOCUS_31990 16187 16576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 17056 17340 gene locus_tag LOCUS_32000 17056 17340 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219993657.1 protein_id gnl|my_center|LOCUS_32000 17330 18592 gene locus_tag LOCUS_32010 17330 18592 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533388.1 protein_id gnl|my_center|LOCUS_32010 18780 19145 gene locus_tag LOCUS_32020 18780 19145 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_32020 >Feature sequence55 1365 136 gene locus_tag LOCUS_32030 1365 136 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_32030 2142 1462 gene locus_tag LOCUS_32040 2142 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 3243 2293 gene locus_tag LOCUS_32050 3243 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_32050 3809 3240 gene locus_tag LOCUS_32060 gene gmhA 3809 3240 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942729.1 protein_id gnl|my_center|LOCUS_32060 4858 3806 gene locus_tag LOCUS_32070 4858 3806 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942730.1 protein_id gnl|my_center|LOCUS_32070 6106 5063 gene locus_tag LOCUS_32080 6106 5063 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_32080 9772 6230 gene locus_tag LOCUS_32090 gene mfd 9772 6230 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_32090 10349 9780 gene locus_tag LOCUS_32100 10349 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940945.1 protein_id gnl|my_center|LOCUS_32100 10538 11911 gene locus_tag LOCUS_32110 10538 11911 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940944.1 protein_id gnl|my_center|LOCUS_32110 11972 14089 gene locus_tag LOCUS_32120 11972 14089 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942572.1 protein_id gnl|my_center|LOCUS_32120 14317 15084 gene locus_tag LOCUS_32130 14317 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 16255 15188 gene locus_tag LOCUS_32140 16255 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 16587 16889 gene locus_tag LOCUS_32150 16587 16889 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_32150 17465 16911 gene locus_tag LOCUS_32160 17465 16911 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933129.1 protein_id gnl|my_center|LOCUS_32160 17821 17615 gene locus_tag LOCUS_32170 17821 17615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 18300 18614 gene locus_tag LOCUS_32180 18300 18614 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770554.1 protein_id gnl|my_center|LOCUS_32180 18860 18648 gene locus_tag LOCUS_32190 18860 18648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 19079 19345 gene locus_tag LOCUS_32200 19079 19345 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530040.1 protein_id gnl|my_center|LOCUS_32200 >Feature sequence56 462 229 gene locus_tag LOCUS_32210 462 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 461 2515 gene locus_tag LOCUS_32220 461 2515 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943953.1 protein_id gnl|my_center|LOCUS_32220 2631 4016 gene locus_tag LOCUS_32230 2631 4016 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943954.1 protein_id gnl|my_center|LOCUS_32230 4184 5812 gene locus_tag LOCUS_32240 4184 5812 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943955.1 protein_id gnl|my_center|LOCUS_32240 5823 8132 gene locus_tag LOCUS_32250 5823 8132 CDS product serine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943956.1 protein_id gnl|my_center|LOCUS_32250 9512 8235 gene locus_tag LOCUS_32260 9512 8235 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_32260 11988 9544 gene locus_tag LOCUS_32270 11988 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32270 13599 12010 gene locus_tag LOCUS_32280 13599 12010 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546185.1 protein_id gnl|my_center|LOCUS_32280 15167 13596 gene locus_tag LOCUS_32290 15167 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 15614 15174 gene locus_tag LOCUS_32300 15614 15174 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_32300 17146 15611 gene locus_tag LOCUS_32310 17146 15611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 17643 17359 gene locus_tag LOCUS_32320 17643 17359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 17590 17823 gene locus_tag LOCUS_32330 17590 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 >Feature sequence57 420 184 gene locus_tag LOCUS_32340 420 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 392 1297 gene locus_tag LOCUS_32350 392 1297 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943997.1 protein_id gnl|my_center|LOCUS_32350 1445 2758 gene locus_tag LOCUS_32360 1445 2758 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_32360 3124 4887 gene locus_tag LOCUS_32370 3124 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943223.1 protein_id gnl|my_center|LOCUS_32370 5131 5670 gene locus_tag LOCUS_32380 5131 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 5874 8069 gene locus_tag LOCUS_32390 gene katG 5874 8069 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942744.1 protein_id gnl|my_center|LOCUS_32390 9938 8301 gene locus_tag LOCUS_32400 9938 8301 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943573.1 protein_id gnl|my_center|LOCUS_32400 10351 10680 gene locus_tag LOCUS_32410 10351 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 10677 11294 gene locus_tag LOCUS_32420 10677 11294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 12038 12979 gene locus_tag LOCUS_32430 12038 12979 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_32430 13100 13243 gene locus_tag LOCUS_32440 13100 13243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 13392 14027 gene locus_tag LOCUS_32450 13392 14027 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940854.1 protein_id gnl|my_center|LOCUS_32450 14247 14119 gene locus_tag LOCUS_32460 14247 14119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 16198 14417 gene locus_tag LOCUS_32470 16198 14417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence58 60 590 gene locus_tag LOCUS_32480 60 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 587 1594 gene locus_tag LOCUS_32490 587 1594 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_32490 1671 2789 gene locus_tag LOCUS_32500 gene gmd 1671 2789 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331385.1 protein_id gnl|my_center|LOCUS_32500 2929 3861 gene locus_tag LOCUS_32510 2929 3861 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_32510 3941 4831 gene locus_tag LOCUS_32520 gene hslO 3941 4831 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943960.1 protein_id gnl|my_center|LOCUS_32520 4835 5614 gene locus_tag LOCUS_32530 gene truA 4835 5614 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_32530 6185 5589 gene locus_tag LOCUS_32540 6185 5589 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943891.1 protein_id gnl|my_center|LOCUS_32540 6520 6191 gene locus_tag LOCUS_32550 gene trxA 6520 6191 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_32550 6676 7272 gene locus_tag LOCUS_32560 6676 7272 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943893.1 protein_id gnl|my_center|LOCUS_32560 7269 8069 gene locus_tag LOCUS_32570 gene ccsB 7269 8069 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_32570 8116 9420 gene locus_tag LOCUS_32580 gene hemA 8116 9420 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_32580 9417 10109 gene locus_tag LOCUS_32590 gene sfsA 9417 10109 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_32590 10169 11107 gene locus_tag LOCUS_32600 gene hemC 10169 11107 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_32600 11100 12626 gene locus_tag LOCUS_32610 gene cobA 11100 12626 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 protein_id gnl|my_center|LOCUS_32610 15540 12772 gene locus_tag LOCUS_32620 15540 12772 CDS product CxxxxCH/CxxCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943543.1 protein_id gnl|my_center|LOCUS_32620 15847 16026 gene locus_tag LOCUS_32630 15847 16026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence59 3195 4268 gene locus_tag LOCUS_32640 3195 4268 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_32640 4323 4520 gene locus_tag LOCUS_32650 4323 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 4741 6480 gene locus_tag LOCUS_32660 4741 6480 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086257.1 protein_id gnl|my_center|LOCUS_32660 6747 7508 gene locus_tag LOCUS_32670 gene rpsB 6747 7508 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_32670 7573 8508 gene locus_tag LOCUS_32680 gene tsf 7573 8508 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_32680 8771 9490 gene locus_tag LOCUS_32690 gene pyrH 8771 9490 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_32690 9493 10050 gene locus_tag LOCUS_32700 gene frr 9493 10050 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_32700 10050 10790 gene locus_tag LOCUS_32710 10050 10790 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942562.1 protein_id gnl|my_center|LOCUS_32710 10802 11581 gene locus_tag LOCUS_32720 10802 11581 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_32720 11668 12828 gene locus_tag LOCUS_32730 11668 12828 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_32730 12833 13975 gene locus_tag LOCUS_32740 gene rseP 12833 13975 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_32740 14419 15648 gene locus_tag LOCUS_32750 14419 15648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 15649 15870 gene locus_tag LOCUS_32760 15649 15870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence60 1910 180 gene locus_tag LOCUS_32770 1910 180 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869035.1 protein_id gnl|my_center|LOCUS_32770 3172 1907 gene locus_tag LOCUS_32780 3172 1907 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943192.1 protein_id gnl|my_center|LOCUS_32780 3323 4048 gene locus_tag LOCUS_32790 gene ybgF 3323 4048 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943188.1 protein_id gnl|my_center|LOCUS_32790 4101 5135 gene locus_tag LOCUS_32800 4101 5135 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914065.1 protein_id gnl|my_center|LOCUS_32800 5286 6377 gene locus_tag LOCUS_32810 gene dprA 5286 6377 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_32810 6411 8735 gene locus_tag LOCUS_32820 gene topA 6411 8735 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943185.1 protein_id gnl|my_center|LOCUS_32820 8732 10042 gene locus_tag LOCUS_32830 gene trmFO 8732 10042 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_32830 10032 10913 gene locus_tag LOCUS_32840 10032 10913 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_32840 11225 10953 gene locus_tag LOCUS_32850 11225 10953 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941274.1 protein_id gnl|my_center|LOCUS_32850 11518 11958 gene locus_tag LOCUS_32860 gene gspG 11518 11958 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_32860 12099 14756 gene locus_tag LOCUS_32870 gene ppdK 12099 14756 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_32870 >Feature sequence61 317 1951 gene locus_tag LOCUS_32880 317 1951 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_32880 1938 3569 gene locus_tag LOCUS_32890 1938 3569 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_32890 3675 4889 gene locus_tag LOCUS_32900 gene waaF 3675 4889 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_32900 4893 5954 gene locus_tag LOCUS_32910 4893 5954 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267479.1 protein_id gnl|my_center|LOCUS_32910 5951 7093 gene locus_tag LOCUS_32920 5951 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 7261 8178 gene locus_tag LOCUS_32930 7261 8178 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_32930 8181 10040 gene locus_tag LOCUS_32940 8181 10040 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_32940 10072 11490 gene locus_tag LOCUS_32950 10072 11490 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_32950 11551 12489 gene locus_tag LOCUS_32960 11551 12489 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103695.1 protein_id gnl|my_center|LOCUS_32960 13341 12583 gene locus_tag LOCUS_32970 13341 12583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_32970 >Feature sequence62 1063 359 gene locus_tag LOCUS_32980 gene hoxU 1063 359 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943355.1 protein_id gnl|my_center|LOCUS_32980 2925 1060 gene locus_tag LOCUS_32990 2925 1060 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943356.1 protein_id gnl|my_center|LOCUS_32990 3069 3986 gene locus_tag LOCUS_33000 3069 3986 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943599.1 protein_id gnl|my_center|LOCUS_33000 4543 4094 gene locus_tag LOCUS_33010 4543 4094 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942702.1 protein_id gnl|my_center|LOCUS_33010 5042 4557 gene locus_tag LOCUS_33020 gene ybaK 5042 4557 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943709.1 protein_id gnl|my_center|LOCUS_33020 6149 5043 gene locus_tag LOCUS_33030 gene hypE 6149 5043 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_33030 6259 7593 gene locus_tag LOCUS_33040 6259 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941665.1 protein_id gnl|my_center|LOCUS_33040 7620 8360 gene locus_tag LOCUS_33050 7620 8360 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941169.1 protein_id gnl|my_center|LOCUS_33050 8386 8982 gene locus_tag LOCUS_33060 gene plsY 8386 8982 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_33060 9695 8979 gene locus_tag LOCUS_33070 gene ubiE 9695 8979 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_33070 9974 11389 gene locus_tag LOCUS_33080 gene cdaA 9974 11389 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941532.1 protein_id gnl|my_center|LOCUS_33080 11516 12562 gene locus_tag LOCUS_33090 11516 12562 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941533.1 protein_id gnl|my_center|LOCUS_33090 >Feature sequence63 245 3526 gene locus_tag LOCUS_33100 245 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 3526 4062 gene locus_tag LOCUS_33110 3526 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 4144 4734 gene locus_tag LOCUS_33120 4144 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 4757 5605 gene locus_tag LOCUS_33130 gene xrt 4757 5605 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_33130 5598 6230 gene locus_tag LOCUS_33140 5598 6230 CDS product EpsI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176634.1 protein_id gnl|my_center|LOCUS_33140 6301 7587 gene locus_tag LOCUS_33150 6301 7587 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_33150 7651 8676 gene locus_tag LOCUS_33160 7651 8676 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064483.1 protein_id gnl|my_center|LOCUS_33160 8689 10761 gene locus_tag LOCUS_33170 gene prsK 8689 10761 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_33170 10844 12232 gene locus_tag LOCUS_33180 gene prsR 10844 12232 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_33180 >Feature sequence64 208 429 gene locus_tag LOCUS_33190 208 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 480 812 gene locus_tag LOCUS_33200 480 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 930 1496 gene locus_tag LOCUS_33210 930 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 2477 1704 gene locus_tag LOCUS_33220 2477 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 3103 2501 gene locus_tag LOCUS_33230 3103 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942305.1 protein_id gnl|my_center|LOCUS_33230 3704 3549 gene locus_tag LOCUS_33240 3704 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 5969 4461 gene locus_tag LOCUS_33250 5969 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 7105 5966 gene locus_tag LOCUS_33260 gene nicK 7105 5966 CDS product DNA relaxase NicK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966621.1 protein_id gnl|my_center|LOCUS_33260 7420 7262 gene locus_tag LOCUS_33270 7420 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 7935 7417 gene locus_tag LOCUS_33280 7935 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 8296 8769 gene locus_tag LOCUS_33290 8296 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 8871 9380 gene locus_tag LOCUS_33300 8871 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 10208 9921 gene locus_tag LOCUS_33310 10208 9921 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143494.1 protein_id gnl|my_center|LOCUS_33310 10474 10208 gene locus_tag LOCUS_33320 10474 10208 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530040.1 protein_id gnl|my_center|LOCUS_33320 >Feature sequence65 151 480 gene locus_tag LOCUS_33330 151 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 580 1512 gene locus_tag LOCUS_33340 580 1512 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045033.1 protein_id gnl|my_center|LOCUS_33340 1701 1991 gene locus_tag LOCUS_33350 1701 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 1988 2287 gene locus_tag LOCUS_33360 1988 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 2673 3245 gene locus_tag LOCUS_33370 2673 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 4818 3469 gene locus_tag LOCUS_33380 4818 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 4956 5174 gene locus_tag LOCUS_33390 4956 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33390 5480 5148 gene locus_tag LOCUS_33400 5480 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 5921 5673 gene locus_tag LOCUS_33410 5921 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 6055 6219 gene locus_tag LOCUS_33420 6055 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 6373 7047 gene locus_tag LOCUS_33430 6373 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 7272 7072 gene locus_tag LOCUS_33440 7272 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 7620 7420 gene locus_tag LOCUS_33450 7620 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 8052 8753 gene locus_tag LOCUS_33460 gene tsaB 8052 8753 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_33460 >Feature sequence66 743 48 gene locus_tag LOCUS_33470 743 48 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942483.1 protein_id gnl|my_center|LOCUS_33470 1549 737 gene locus_tag LOCUS_33480 1549 737 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942484.1 protein_id gnl|my_center|LOCUS_33480 1865 2869 gene locus_tag LOCUS_33490 gene gap 1865 2869 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_33490 2956 4155 gene locus_tag LOCUS_33500 gene pgk 2956 4155 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_33500 4164 4922 gene locus_tag LOCUS_33510 gene tpiA 4164 4922 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_33510 5339 5199 gene locus_tag LOCUS_33520 5339 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 5547 5633 gene locus_tag LOCUS_t00360 5547 5633 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence67 647 204 gene locus_tag LOCUS_33530 647 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 1288 2847 gene locus_tag LOCUS_33540 1288 2847 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942551.1 protein_id gnl|my_center|LOCUS_33540 3082 4536 gene locus_tag LOCUS_33550 3082 4536 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_33550 4533 5195 gene locus_tag LOCUS_33560 4533 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 5192 5491 gene locus_tag LOCUS_33570 5192 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 >Feature sequence68 1775 150 gene locus_tag LOCUS_33580 gene serA 1775 150 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941855.1 protein_id gnl|my_center|LOCUS_33580 1891 2373 gene locus_tag LOCUS_33590 1891 2373 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_33590 2398 3594 gene locus_tag LOCUS_33600 gene truD 2398 3594 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941188.1 protein_id gnl|my_center|LOCUS_33600