>Feature sequence001 3246 1783 gene locus_tag LOCUS_00010 3246 1783 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223979.1 protein_id gnl|my_center|LOCUS_00010 3626 3243 gene locus_tag LOCUS_00020 3626 3243 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223978.1 protein_id gnl|my_center|LOCUS_00020 4863 3715 gene locus_tag LOCUS_00030 4863 3715 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223977.1 protein_id gnl|my_center|LOCUS_00030 4902 5819 gene locus_tag LOCUS_00040 4902 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7835 5919 gene locus_tag LOCUS_00050 7835 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9469 7832 gene locus_tag LOCUS_00060 9469 7832 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392966.1 protein_id gnl|my_center|LOCUS_00060 10428 9499 gene locus_tag LOCUS_00070 10428 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11539 10430 gene locus_tag LOCUS_00080 11539 10430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12209 11550 gene locus_tag LOCUS_00090 12209 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13781 12528 gene locus_tag LOCUS_00100 13781 12528 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226226.1 protein_id gnl|my_center|LOCUS_00100 15158 13947 gene locus_tag LOCUS_00110 15158 13947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_00110 16000 15155 gene locus_tag LOCUS_00120 16000 15155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_00120 16021 16635 gene locus_tag LOCUS_00130 16021 16635 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028825.1 protein_id gnl|my_center|LOCUS_00130 16980 16642 gene locus_tag LOCUS_00140 16980 16642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18310 17069 gene locus_tag LOCUS_00150 18310 17069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19047 18295 gene locus_tag LOCUS_00160 19047 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20351 19080 gene locus_tag LOCUS_00170 20351 19080 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_00170 20379 21107 gene locus_tag LOCUS_00180 20379 21107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21463 21224 gene locus_tag LOCUS_00190 21463 21224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21570 22589 gene locus_tag LOCUS_00200 gene moaA 21570 22589 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 protein_id gnl|my_center|LOCUS_00200 22589 23386 gene locus_tag LOCUS_00210 gene fdhD 22589 23386 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_00210 23581 26004 gene locus_tag LOCUS_00220 23581 26004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27306 26683 gene locus_tag LOCUS_00230 gene lexA 27306 26683 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_00230 27424 27511 gene locus_tag LOCUS_t00010 27424 27511 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27699 29024 gene locus_tag LOCUS_00240 27699 29024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29350 29036 gene locus_tag LOCUS_00250 29350 29036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30284 29439 gene locus_tag LOCUS_00260 30284 29439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 31429 30626 gene locus_tag LOCUS_00270 31429 30626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32781 31504 gene locus_tag LOCUS_00280 32781 31504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32996 33268 gene locus_tag LOCUS_00290 32996 33268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 33358 35616 gene locus_tag LOCUS_00300 gene metE 33358 35616 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918370.1 protein_id gnl|my_center|LOCUS_00300 36470 35628 gene locus_tag LOCUS_00310 36470 35628 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404293.1 protein_id gnl|my_center|LOCUS_00310 37170 36463 gene locus_tag LOCUS_00320 37170 36463 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731458.1 protein_id gnl|my_center|LOCUS_00320 37580 37167 gene locus_tag LOCUS_00330 37580 37167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38419 37913 gene locus_tag LOCUS_00340 38419 37913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 38831 40204 gene locus_tag LOCUS_00350 38831 40204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40206 41627 gene locus_tag LOCUS_00360 40206 41627 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860267.1 protein_id gnl|my_center|LOCUS_00360 41632 41835 gene locus_tag LOCUS_00370 41632 41835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 41853 42701 gene locus_tag LOCUS_00380 41853 42701 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860265.1 protein_id gnl|my_center|LOCUS_00380 44413 42725 gene locus_tag LOCUS_00390 44413 42725 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_00390 45479 44505 gene locus_tag LOCUS_00400 45479 44505 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979108.1 protein_id gnl|my_center|LOCUS_00400 46430 45531 gene locus_tag LOCUS_00410 46430 45531 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_00410 47581 46427 gene locus_tag LOCUS_00420 47581 46427 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142938.1 protein_id gnl|my_center|LOCUS_00420 47983 48492 gene locus_tag LOCUS_00430 47983 48492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 49938 48631 gene locus_tag LOCUS_00440 49938 48631 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941161.1 protein_id gnl|my_center|LOCUS_00440 51955 50105 gene locus_tag LOCUS_00450 51955 50105 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030966.1 protein_id gnl|my_center|LOCUS_00450 52261 52749 gene locus_tag LOCUS_00460 52261 52749 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537140.1 protein_id gnl|my_center|LOCUS_00460 53141 52770 gene locus_tag LOCUS_00470 53141 52770 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_00470 54022 53141 gene locus_tag LOCUS_00480 54022 53141 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115580.1 protein_id gnl|my_center|LOCUS_00480 55003 54263 gene locus_tag LOCUS_00490 55003 54263 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903895.1 protein_id gnl|my_center|LOCUS_00490 55514 55035 gene locus_tag LOCUS_00500 55514 55035 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777100.1 protein_id gnl|my_center|LOCUS_00500 55762 56220 gene locus_tag LOCUS_00510 55762 56220 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_00510 57148 56408 gene locus_tag LOCUS_00520 gene ytfE 57148 56408 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331457.1 protein_id gnl|my_center|LOCUS_00520 58272 57262 gene locus_tag LOCUS_00530 58272 57262 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974176.1 protein_id gnl|my_center|LOCUS_00530 58463 58272 gene locus_tag LOCUS_00540 58463 58272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00540 58954 58451 gene locus_tag LOCUS_00550 58954 58451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00550 58504 58513 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59657 59007 gene locus_tag LOCUS_00560 gene narJ 59657 59007 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026934.1 protein_id gnl|my_center|LOCUS_00560 61225 59657 gene locus_tag LOCUS_00570 gene narH 61225 59657 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692661.1 protein_id gnl|my_center|LOCUS_00570 64956 61246 gene locus_tag LOCUS_00580 64956 61246 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026932.1 protein_id gnl|my_center|LOCUS_00580 65332 66597 gene locus_tag LOCUS_00590 65332 66597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 67317 66691 gene locus_tag LOCUS_00600 67317 66691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 67207 67473 gene locus_tag LOCUS_00610 67207 67473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 67510 67689 gene locus_tag LOCUS_00620 67510 67689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 69295 67748 gene locus_tag LOCUS_00630 69295 67748 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_00630 69784 69323 gene locus_tag LOCUS_00640 69784 69323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 70931 69777 gene locus_tag LOCUS_00650 70931 69777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_00650 71260 70922 gene locus_tag LOCUS_00660 71260 70922 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_00660 71259 71597 gene locus_tag LOCUS_00670 71259 71597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 71540 71770 gene locus_tag LOCUS_00680 71540 71770 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963400.1 protein_id gnl|my_center|LOCUS_00680 72898 71777 gene locus_tag LOCUS_00690 gene tal 72898 71777 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728814.1 protein_id gnl|my_center|LOCUS_00690 74148 72910 gene locus_tag LOCUS_00700 74148 72910 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226226.1 protein_id gnl|my_center|LOCUS_00700 74804 74145 gene locus_tag LOCUS_00710 gene folE 74804 74145 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 protein_id gnl|my_center|LOCUS_00710 76602 74896 gene locus_tag LOCUS_00720 76602 74896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 76957 76742 gene locus_tag LOCUS_00730 76957 76742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 77102 77887 gene locus_tag LOCUS_00740 77102 77887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 77895 78458 gene locus_tag LOCUS_00750 77895 78458 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_00750 78605 78982 gene locus_tag LOCUS_00760 78605 78982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 79280 79011 gene locus_tag LOCUS_00770 79280 79011 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_00770 79640 79383 gene locus_tag LOCUS_00780 79640 79383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 79796 81556 gene locus_tag LOCUS_00790 79796 81556 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_00790 81721 82059 gene locus_tag LOCUS_00800 81721 82059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 82247 82483 gene locus_tag LOCUS_00810 82247 82483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 82614 82949 gene locus_tag LOCUS_00820 82614 82949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 83121 84821 gene locus_tag LOCUS_00830 gene ctaD 83121 84821 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224924.1 protein_id gnl|my_center|LOCUS_00830 84818 85294 gene locus_tag LOCUS_00840 84818 85294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 85763 85287 gene locus_tag LOCUS_00850 85763 85287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 86473 85760 gene locus_tag LOCUS_00860 86473 85760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 86666 86890 gene locus_tag LOCUS_00870 86666 86890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 >Feature sequence002 2415 1759 gene locus_tag LOCUS_00880 2415 1759 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085145692.1 protein_id gnl|my_center|LOCUS_00880 2496 4106 gene locus_tag LOCUS_00890 2496 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 5613 4117 gene locus_tag LOCUS_00900 5613 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 6719 5610 gene locus_tag LOCUS_00910 gene rfbG 6719 5610 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 protein_id gnl|my_center|LOCUS_00910 6744 7565 gene locus_tag LOCUS_00920 6744 7565 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_00920 7594 8880 gene locus_tag LOCUS_00930 7594 8880 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062390429.1 protein_id gnl|my_center|LOCUS_00930 8918 9961 gene locus_tag LOCUS_00940 8918 9961 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730921.1 protein_id gnl|my_center|LOCUS_00940 10524 10042 gene locus_tag LOCUS_00950 10524 10042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 10435 10887 gene locus_tag LOCUS_00960 10435 10887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 12189 10939 gene locus_tag LOCUS_00970 12189 10939 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_00970 13468 12203 gene locus_tag LOCUS_00980 13468 12203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 13500 15371 gene locus_tag LOCUS_00990 13500 15371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 15385 16668 gene locus_tag LOCUS_01000 15385 16668 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461034.1 protein_id gnl|my_center|LOCUS_01000 16670 17713 gene locus_tag LOCUS_01010 16670 17713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 18925 17792 gene locus_tag LOCUS_01020 18925 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 19043 19849 gene locus_tag LOCUS_01030 19043 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 19859 22090 gene locus_tag LOCUS_01040 19859 22090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 22809 22180 gene locus_tag LOCUS_01050 22809 22180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 23045 24037 gene locus_tag LOCUS_01060 23045 24037 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_01060 25841 24093 gene locus_tag LOCUS_01070 25841 24093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 26935 25994 gene locus_tag LOCUS_01080 26935 25994 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_01080 26960 28618 gene locus_tag LOCUS_01090 26960 28618 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_01090 28845 29345 gene locus_tag LOCUS_01100 28845 29345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 29423 30466 gene locus_tag LOCUS_01110 gene asd 29423 30466 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_01110 30681 31589 gene locus_tag LOCUS_01120 30681 31589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 31865 33430 gene locus_tag LOCUS_01130 31865 33430 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_01130 33454 33681 gene locus_tag LOCUS_01140 33454 33681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 33792 35630 gene locus_tag LOCUS_01150 33792 35630 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_01150 35627 36364 gene locus_tag LOCUS_01160 35627 36364 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244757.1 protein_id gnl|my_center|LOCUS_01160 36455 37441 gene locus_tag LOCUS_01170 36455 37441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 37445 38362 gene locus_tag LOCUS_01180 gene cysD 37445 38362 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466878.1 protein_id gnl|my_center|LOCUS_01180 38359 39648 gene locus_tag LOCUS_01190 38359 39648 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_01190 39939 39658 gene locus_tag LOCUS_01200 39939 39658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 39886 41622 gene locus_tag LOCUS_01210 gene accC 39886 41622 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257262.1 protein_id gnl|my_center|LOCUS_01210 42488 41781 gene locus_tag LOCUS_01220 42488 41781 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404012.1 protein_id gnl|my_center|LOCUS_01220 42653 43819 gene locus_tag LOCUS_01230 gene sucC 42653 43819 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109739.1 protein_id gnl|my_center|LOCUS_01230 43819 44727 gene locus_tag LOCUS_01240 gene sucD 43819 44727 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 protein_id gnl|my_center|LOCUS_01240 44732 45253 gene locus_tag LOCUS_01250 44732 45253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 45336 46421 gene locus_tag LOCUS_01260 45336 46421 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211249054.1 protein_id gnl|my_center|LOCUS_01260 47336 46614 gene locus_tag LOCUS_01270 47336 46614 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257014.1 protein_id gnl|my_center|LOCUS_01270 47385 47861 gene locus_tag LOCUS_01280 47385 47861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 48895 48521 gene locus_tag LOCUS_01290 48895 48521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 49041 50135 gene locus_tag LOCUS_01300 49041 50135 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639871.1 protein_id gnl|my_center|LOCUS_01300 50490 50167 gene locus_tag LOCUS_01310 50490 50167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 50818 53148 gene locus_tag LOCUS_01320 50818 53148 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_01320 54525 53182 gene locus_tag LOCUS_01330 54525 53182 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088586.1 protein_id gnl|my_center|LOCUS_01330 55400 54561 gene locus_tag LOCUS_01340 55400 54561 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289338.1 protein_id gnl|my_center|LOCUS_01340 58851 55516 gene locus_tag LOCUS_01350 gene ileS 58851 55516 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_01350 59238 58909 gene locus_tag LOCUS_01360 gene trxA 59238 58909 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226816.1 protein_id gnl|my_center|LOCUS_01360 60209 59451 gene locus_tag LOCUS_01370 60209 59451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 61198 60428 gene locus_tag LOCUS_01380 61198 60428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 61219 61728 gene locus_tag LOCUS_01390 61219 61728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 62413 61892 gene locus_tag LOCUS_01400 62413 61892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 63092 62424 gene locus_tag LOCUS_01410 gene otsB 63092 62424 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877362.1 protein_id gnl|my_center|LOCUS_01410 62982 63212 gene locus_tag LOCUS_01420 62982 63212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 63395 63781 gene locus_tag LOCUS_01430 63395 63781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 63947 64366 gene locus_tag LOCUS_01440 63947 64366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 64501 64752 gene locus_tag LOCUS_01450 64501 64752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 66527 64791 gene locus_tag LOCUS_01460 66527 64791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 67476 66535 gene locus_tag LOCUS_01470 67476 66535 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_01470 67779 68600 gene locus_tag LOCUS_01480 gene parJ 67779 68600 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_01480 70921 68810 gene locus_tag LOCUS_01490 70921 68810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 71006 72148 gene locus_tag LOCUS_01500 71006 72148 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256151.1 protein_id gnl|my_center|LOCUS_01500 72160 73317 gene locus_tag LOCUS_01510 72160 73317 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_01510 73564 75222 gene locus_tag LOCUS_01520 gene lysS 73564 75222 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_01520 75219 76754 gene locus_tag LOCUS_01530 75219 76754 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 protein_id gnl|my_center|LOCUS_01530 77142 76876 gene locus_tag LOCUS_01540 77142 76876 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_01540 77447 77797 gene locus_tag LOCUS_01550 77447 77797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 78135 78350 gene locus_tag LOCUS_01560 78135 78350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 79785 78343 gene locus_tag LOCUS_01570 79785 78343 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_01570 80056 81126 gene locus_tag LOCUS_01580 80056 81126 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_01580 82992 81367 gene locus_tag LOCUS_01590 gene groL 82992 81367 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence003 54 701 gene locus_tag LOCUS_01600 54 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 698 1678 gene locus_tag LOCUS_01610 698 1678 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084006.1 protein_id gnl|my_center|LOCUS_01610 1703 2026 gene locus_tag LOCUS_01620 1703 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 2053 2616 gene locus_tag LOCUS_01630 gene atpF 2053 2616 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002925392.1 protein_id gnl|my_center|LOCUS_01630 2675 3205 gene locus_tag LOCUS_01640 gene atpH 2675 3205 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393858.1 protein_id gnl|my_center|LOCUS_01640 3233 4846 gene locus_tag LOCUS_01650 gene atpA 3233 4846 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_01650 4508 4425 gene locus_tag LOCUS_t00020 4508 4425 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4884 5867 gene locus_tag LOCUS_01660 4884 5867 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056240.1 protein_id gnl|my_center|LOCUS_01660 5976 7469 gene locus_tag LOCUS_01670 gene atpD 5976 7469 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_01670 7602 8009 gene locus_tag LOCUS_01680 7602 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 8066 9373 gene locus_tag LOCUS_01690 8066 9373 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_01690 9361 10467 gene locus_tag LOCUS_01700 9361 10467 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258545.1 protein_id gnl|my_center|LOCUS_01700 10754 11836 gene locus_tag LOCUS_01710 10754 11836 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_01710 11886 13355 gene locus_tag LOCUS_01720 gene ahcY 11886 13355 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_01720 13411 14400 gene locus_tag LOCUS_01730 13411 14400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 14512 14889 gene locus_tag LOCUS_01740 14512 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 15049 17301 gene locus_tag LOCUS_01750 15049 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 17305 18132 gene locus_tag LOCUS_01760 17305 18132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 18191 21106 gene locus_tag LOCUS_01770 gene secA 18191 21106 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_01770 21255 22238 gene locus_tag LOCUS_01780 gene prfB 21255 22238 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_01780 22305 23144 gene locus_tag LOCUS_01790 gene nadC 22305 23144 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_01790 23141 24232 gene locus_tag LOCUS_01800 gene nadA 23141 24232 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224102.1 protein_id gnl|my_center|LOCUS_01800 25438 24260 gene locus_tag LOCUS_01810 25438 24260 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084001.1 protein_id gnl|my_center|LOCUS_01810 25546 26739 gene locus_tag LOCUS_01820 25546 26739 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_01820 26753 28678 gene locus_tag LOCUS_01830 26753 28678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 28782 29267 gene locus_tag LOCUS_01840 28782 29267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 30207 29311 gene locus_tag LOCUS_01850 30207 29311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 30393 30755 gene locus_tag LOCUS_tm00010 30393 30755 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 31093 30911 gene locus_tag LOCUS_01860 31093 30911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 31624 31175 gene locus_tag LOCUS_01870 31624 31175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 31865 32395 gene locus_tag LOCUS_01880 31865 32395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 32452 32868 gene locus_tag LOCUS_01890 32452 32868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 33674 32946 gene locus_tag LOCUS_01900 33674 32946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 33974 34534 gene locus_tag LOCUS_01910 33974 34534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 35559 34423 gene locus_tag LOCUS_01920 35559 34423 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_01920 35759 35974 gene locus_tag LOCUS_01930 35759 35974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 36710 36057 gene locus_tag LOCUS_01940 36710 36057 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024068.1 protein_id gnl|my_center|LOCUS_01940 37659 36631 gene locus_tag LOCUS_01950 37659 36631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 38972 37734 gene locus_tag LOCUS_01960 38972 37734 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_01960 39196 40317 gene locus_tag LOCUS_01970 gene purM 39196 40317 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 protein_id gnl|my_center|LOCUS_01970 40699 41469 gene locus_tag LOCUS_01980 40699 41469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 41641 43323 gene locus_tag LOCUS_01990 41641 43323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 43406 43750 gene locus_tag LOCUS_02000 43406 43750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 43752 46061 gene locus_tag LOCUS_02010 43752 46061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 46066 47469 gene locus_tag LOCUS_02020 46066 47469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 47614 49089 gene locus_tag LOCUS_02030 47614 49089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 49086 50588 gene locus_tag LOCUS_02040 49086 50588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 50626 52071 gene locus_tag LOCUS_02050 50626 52071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 52072 53577 gene locus_tag LOCUS_02060 52072 53577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 53588 54538 gene locus_tag LOCUS_02070 53588 54538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_02070 54740 56008 gene locus_tag LOCUS_02080 54740 56008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 56056 56217 gene locus_tag LOCUS_02090 56056 56217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 56211 56456 gene locus_tag LOCUS_02100 56211 56456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 56491 59973 gene locus_tag LOCUS_02110 gene dnaE2 56491 59973 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417885.1 protein_id gnl|my_center|LOCUS_02110 60729 60061 gene locus_tag LOCUS_02120 60729 60061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 62818 60818 gene locus_tag LOCUS_02130 62818 60818 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229847.1 protein_id gnl|my_center|LOCUS_02130 63782 62943 gene locus_tag LOCUS_02140 63782 62943 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_02140 64130 63816 gene locus_tag LOCUS_02150 64130 63816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 64254 66422 gene locus_tag LOCUS_02160 64254 66422 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405513.1 protein_id gnl|my_center|LOCUS_02160 66515 66886 gene locus_tag LOCUS_02170 66515 66886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 66883 68751 gene locus_tag LOCUS_02180 gene uvrC 66883 68751 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082304.1 protein_id gnl|my_center|LOCUS_02180 68882 69820 gene locus_tag LOCUS_02190 gene rapZ 68882 69820 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462179.1 protein_id gnl|my_center|LOCUS_02190 70019 71023 gene locus_tag LOCUS_02200 gene gap 70019 71023 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_02200 71020 72324 gene locus_tag LOCUS_02210 71020 72324 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_02210 72339 73130 gene locus_tag LOCUS_02220 gene tpiA 72339 73130 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_02220 73207 74808 gene locus_tag LOCUS_02230 gene gpmI 73207 74808 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257028.1 protein_id gnl|my_center|LOCUS_02230 74891 75424 gene locus_tag LOCUS_02240 74891 75424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 75745 76260 gene locus_tag LOCUS_02250 75745 76260 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_02250 >Feature sequence004 801 1409 gene locus_tag LOCUS_02260 801 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 2437 2898 gene locus_tag LOCUS_02270 2437 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 3657 3274 gene locus_tag LOCUS_02280 3657 3274 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403246.1 protein_id gnl|my_center|LOCUS_02280 3905 3654 gene locus_tag LOCUS_02290 3905 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 4931 4152 gene locus_tag LOCUS_02300 4931 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 5461 4928 gene locus_tag LOCUS_02310 5461 4928 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222061.1 protein_id gnl|my_center|LOCUS_02310 5724 5990 gene locus_tag LOCUS_02320 5724 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 5881 6648 gene locus_tag LOCUS_02330 5881 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 6901 7575 gene locus_tag LOCUS_02340 6901 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 7576 7743 gene locus_tag LOCUS_02350 7576 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 7744 8001 gene locus_tag LOCUS_02360 7744 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 8002 8295 gene locus_tag LOCUS_02370 8002 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 8443 9147 gene locus_tag LOCUS_02380 8443 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02380 9669 9887 gene locus_tag LOCUS_02390 9669 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 10005 10337 gene locus_tag LOCUS_02400 10005 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 10331 10960 gene locus_tag LOCUS_02410 10331 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 11398 12714 gene locus_tag LOCUS_02420 11398 12714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 12862 17619 gene locus_tag LOCUS_02430 12862 17619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 17847 19145 gene locus_tag LOCUS_02440 17847 19145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 19284 19493 gene locus_tag LOCUS_02450 19284 19493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 19929 21101 gene locus_tag LOCUS_02460 19929 21101 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_02460 22408 23484 gene locus_tag LOCUS_02470 22408 23484 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526892.1 protein_id gnl|my_center|LOCUS_02470 24045 23527 gene locus_tag LOCUS_02480 24045 23527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 24494 24156 gene locus_tag LOCUS_02490 24494 24156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 24799 25869 gene locus_tag LOCUS_02500 24799 25869 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_02500 25923 26687 gene locus_tag LOCUS_02510 25923 26687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_02510 26951 27277 gene locus_tag LOCUS_02520 26951 27277 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030937.1 protein_id gnl|my_center|LOCUS_02520 27274 27978 gene locus_tag LOCUS_02530 27274 27978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 27975 28976 gene locus_tag LOCUS_02540 27975 28976 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_02540 28987 30030 gene locus_tag LOCUS_02550 28987 30030 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_02550 30209 30637 gene locus_tag LOCUS_02560 30209 30637 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020192.1 protein_id gnl|my_center|LOCUS_02560 32063 30822 gene locus_tag LOCUS_02570 32063 30822 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731107.1 protein_id gnl|my_center|LOCUS_02570 32995 32060 gene locus_tag LOCUS_02580 32995 32060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 33293 34231 gene locus_tag LOCUS_02590 33293 34231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 34797 34177 gene locus_tag LOCUS_02600 34797 34177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 35932 34928 gene locus_tag LOCUS_02610 35932 34928 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528008.1 protein_id gnl|my_center|LOCUS_02610 36209 38437 gene locus_tag LOCUS_02620 36209 38437 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392879.1 protein_id gnl|my_center|LOCUS_02620 39634 38465 gene locus_tag LOCUS_02630 39634 38465 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_02630 39807 41306 gene locus_tag LOCUS_02640 39807 41306 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389222.1 protein_id gnl|my_center|LOCUS_02640 41444 43501 gene locus_tag LOCUS_02650 gene ftsH 41444 43501 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030322.1 protein_id gnl|my_center|LOCUS_02650 43542 43955 gene locus_tag LOCUS_02660 43542 43955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 44850 44029 gene locus_tag LOCUS_02670 gene xynR 44850 44029 CDS product DNA-binding transcriptional repressor XynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121657.1 protein_id gnl|my_center|LOCUS_02670 45235 44873 gene locus_tag LOCUS_02680 45235 44873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 45406 46020 gene locus_tag LOCUS_02690 45406 46020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 46017 47126 gene locus_tag LOCUS_02700 46017 47126 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726983.1 protein_id gnl|my_center|LOCUS_02700 47226 47717 gene locus_tag LOCUS_02710 47226 47717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 49741 47738 gene locus_tag LOCUS_02720 gene uvrB 49741 47738 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_02720 50379 49903 gene locus_tag LOCUS_02730 50379 49903 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816766.1 protein_id gnl|my_center|LOCUS_02730 51280 50690 gene locus_tag LOCUS_02740 gene coaE 51280 50690 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173002.1 protein_id gnl|my_center|LOCUS_02740 52642 51305 gene locus_tag LOCUS_02750 gene rpsA 52642 51305 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812721.1 protein_id gnl|my_center|LOCUS_02750 52844 54025 gene locus_tag LOCUS_02760 52844 54025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 54104 54400 gene locus_tag LOCUS_02770 54104 54400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 55719 54484 gene locus_tag LOCUS_02780 55719 54484 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974708.1 protein_id gnl|my_center|LOCUS_02780 55814 57229 gene locus_tag LOCUS_02790 55814 57229 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029898.1 protein_id gnl|my_center|LOCUS_02790 59858 57219 gene locus_tag LOCUS_02800 gene polA 59858 57219 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_02800 60055 61557 gene locus_tag LOCUS_02810 60055 61557 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839201.1 protein_id gnl|my_center|LOCUS_02810 61692 62603 gene locus_tag LOCUS_02820 61692 62603 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225382.1 protein_id gnl|my_center|LOCUS_02820 63764 62685 gene locus_tag LOCUS_02830 63764 62685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 64110 63949 gene locus_tag LOCUS_02840 64110 63949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 65167 64280 gene locus_tag LOCUS_02850 gene trpA 65167 64280 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142606.1 protein_id gnl|my_center|LOCUS_02850 67112 65160 gene locus_tag LOCUS_02860 67112 65160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 >Feature sequence005 260 727 gene locus_tag LOCUS_02870 260 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 1243 1049 gene locus_tag LOCUS_02880 1243 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 1149 2198 gene locus_tag LOCUS_02890 1149 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 2851 2564 gene locus_tag LOCUS_02900 2851 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 2732 3277 gene locus_tag LOCUS_02910 2732 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 3376 3984 gene locus_tag LOCUS_02920 3376 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 3998 4525 gene locus_tag LOCUS_02930 3998 4525 CDS product DUF6036 family nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958464.1 protein_id gnl|my_center|LOCUS_02930 5796 4600 gene locus_tag LOCUS_02940 5796 4600 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089103.1 protein_id gnl|my_center|LOCUS_02940 6827 5793 gene locus_tag LOCUS_02950 6827 5793 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172490.1 protein_id gnl|my_center|LOCUS_02950 7034 7939 gene locus_tag LOCUS_02960 7034 7939 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705190.1 protein_id gnl|my_center|LOCUS_02960 8105 10240 gene locus_tag LOCUS_02970 8105 10240 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975446.1 protein_id gnl|my_center|LOCUS_02970 10391 10777 gene locus_tag LOCUS_02980 10391 10777 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028770.1 protein_id gnl|my_center|LOCUS_02980 11580 10981 gene locus_tag LOCUS_02990 11580 10981 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099345.1 protein_id gnl|my_center|LOCUS_02990 11682 13007 gene locus_tag LOCUS_03000 11682 13007 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394859.1 protein_id gnl|my_center|LOCUS_03000 13004 13387 gene locus_tag LOCUS_03010 13004 13387 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087447.1 protein_id gnl|my_center|LOCUS_03010 13384 14199 gene locus_tag LOCUS_03020 13384 14199 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113230.1 protein_id gnl|my_center|LOCUS_03020 15804 14284 gene locus_tag LOCUS_03030 gene dhaS 15804 14284 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_03030 16922 16023 gene locus_tag LOCUS_03040 16922 16023 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971315.1 protein_id gnl|my_center|LOCUS_03040 18934 17057 gene locus_tag LOCUS_03050 18934 17057 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930025.1 protein_id gnl|my_center|LOCUS_03050 21041 18936 gene locus_tag LOCUS_03060 21041 18936 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_03060 21857 21168 gene locus_tag LOCUS_03070 21857 21168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 22985 25117 gene locus_tag LOCUS_03080 22985 25117 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_03080 25114 27069 gene locus_tag LOCUS_03090 25114 27069 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_03090 27066 28361 gene locus_tag LOCUS_03100 27066 28361 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974388.1 protein_id gnl|my_center|LOCUS_03100 28363 29157 gene locus_tag LOCUS_03110 gene paaG 28363 29157 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_03110 29291 29740 gene locus_tag LOCUS_03120 29291 29740 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820449.1 protein_id gnl|my_center|LOCUS_03120 30888 29737 gene locus_tag LOCUS_03130 30888 29737 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_03130 31994 30885 gene locus_tag LOCUS_03140 31994 30885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_03140 33022 31997 gene locus_tag LOCUS_03150 33022 31997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067507.1 protein_id gnl|my_center|LOCUS_03150 33956 33036 gene locus_tag LOCUS_03160 33956 33036 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067508.1 protein_id gnl|my_center|LOCUS_03160 34126 34950 gene locus_tag LOCUS_03170 34126 34950 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_03170 35683 35465 gene locus_tag LOCUS_03180 35683 35465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 35673 37193 gene locus_tag LOCUS_03190 35673 37193 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067511.1 protein_id gnl|my_center|LOCUS_03190 37329 38501 gene locus_tag LOCUS_03200 37329 38501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 39073 38462 gene locus_tag LOCUS_03210 39073 38462 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_03210 41058 39079 gene locus_tag LOCUS_03220 41058 39079 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_03220 41119 42420 gene locus_tag LOCUS_03230 41119 42420 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228882.1 protein_id gnl|my_center|LOCUS_03230 42448 44967 gene locus_tag LOCUS_03240 42448 44967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 44964 46607 gene locus_tag LOCUS_03250 44964 46607 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028579.1 protein_id gnl|my_center|LOCUS_03250 46775 47662 gene locus_tag LOCUS_03260 46775 47662 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807962.1 protein_id gnl|my_center|LOCUS_03260 47693 48172 gene locus_tag LOCUS_03270 47693 48172 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807963.1 protein_id gnl|my_center|LOCUS_03270 49123 48182 gene locus_tag LOCUS_03280 49123 48182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 49151 49435 gene locus_tag LOCUS_03290 49151 49435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 52057 49487 gene locus_tag LOCUS_03300 gene ppdK 52057 49487 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_03300 52270 53169 gene locus_tag LOCUS_03310 52270 53169 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093206.1 protein_id gnl|my_center|LOCUS_03310 53423 54151 gene locus_tag LOCUS_03320 53423 54151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 55187 54117 gene locus_tag LOCUS_03330 55187 54117 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_03330 55363 56988 gene locus_tag LOCUS_03340 55363 56988 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_03340 >Feature sequence006 464 1060 gene locus_tag LOCUS_03350 464 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 1405 1235 gene locus_tag LOCUS_03360 1405 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 1886 2290 gene locus_tag LOCUS_03370 1886 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 2304 3050 gene locus_tag LOCUS_03380 2304 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 4086 3217 gene locus_tag LOCUS_03390 4086 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 5720 4851 gene locus_tag LOCUS_03400 5720 4851 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044081650.1 protein_id gnl|my_center|LOCUS_03400 5936 6418 gene locus_tag LOCUS_03410 5936 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 7780 7073 gene locus_tag LOCUS_03420 7780 7073 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224283.1 protein_id gnl|my_center|LOCUS_03420 9108 7777 gene locus_tag LOCUS_03430 9108 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 9464 9123 gene locus_tag LOCUS_03440 9464 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 9463 10035 gene locus_tag LOCUS_03450 9463 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 10035 12635 gene locus_tag LOCUS_03460 10035 12635 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_03460 12972 14360 gene locus_tag LOCUS_03470 12972 14360 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_03470 14456 14803 gene locus_tag LOCUS_03480 14456 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 14956 16137 gene locus_tag LOCUS_03490 14956 16137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 16224 17396 gene locus_tag LOCUS_03500 16224 17396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 17393 18049 gene locus_tag LOCUS_03510 17393 18049 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466646.1 protein_id gnl|my_center|LOCUS_03510 18223 19098 gene locus_tag LOCUS_03520 18223 19098 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529557.1 protein_id gnl|my_center|LOCUS_03520 19176 20930 gene locus_tag LOCUS_03530 19176 20930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_03530 20935 21576 gene locus_tag LOCUS_03540 20935 21576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 21861 22121 gene locus_tag LOCUS_03550 21861 22121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 22227 25055 gene locus_tag LOCUS_03560 22227 25055 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_03560 25431 25781 gene locus_tag LOCUS_03570 25431 25781 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975718.1 protein_id gnl|my_center|LOCUS_03570 26502 25801 gene locus_tag LOCUS_03580 26502 25801 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064011.1 protein_id gnl|my_center|LOCUS_03580 27983 26973 gene locus_tag LOCUS_03590 27983 26973 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_03590 28052 28828 gene locus_tag LOCUS_03600 28052 28828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 29378 28788 gene locus_tag LOCUS_03610 gene rfbC 29378 28788 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_03610 31400 29391 gene locus_tag LOCUS_03620 31400 29391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 31858 31493 gene locus_tag LOCUS_03630 31858 31493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 33014 31983 gene locus_tag LOCUS_03640 gene gmd 33014 31983 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_03640 35042 33036 gene locus_tag LOCUS_03650 35042 33036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 36523 35054 gene locus_tag LOCUS_03660 36523 35054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 36605 38215 gene locus_tag LOCUS_03670 36605 38215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 38212 39126 gene locus_tag LOCUS_03680 38212 39126 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261977.1 protein_id gnl|my_center|LOCUS_03680 39126 40208 gene locus_tag LOCUS_03690 39126 40208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 41074 40238 gene locus_tag LOCUS_03700 41074 40238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 41222 42487 gene locus_tag LOCUS_03710 41222 42487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 42893 44302 gene locus_tag LOCUS_03720 42893 44302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 44295 45026 gene locus_tag LOCUS_03730 44295 45026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 46335 45112 gene locus_tag LOCUS_03740 46335 45112 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_03740 46546 47721 gene locus_tag LOCUS_03750 46546 47721 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250684.1 protein_id gnl|my_center|LOCUS_03750 47798 48778 gene locus_tag LOCUS_03760 47798 48778 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_03760 49832 48729 gene locus_tag LOCUS_03770 49832 48729 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_03770 51104 49842 gene locus_tag LOCUS_03780 51104 49842 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_03780 51819 51127 gene locus_tag LOCUS_03790 51819 51127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 52026 53180 gene locus_tag LOCUS_03800 52026 53180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 53170 54180 gene locus_tag LOCUS_03810 53170 54180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 55113 54310 gene locus_tag LOCUS_03820 55113 54310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence007 2267 348 gene locus_tag LOCUS_03830 2267 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 3189 2269 gene locus_tag LOCUS_03840 3189 2269 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974744.1 protein_id gnl|my_center|LOCUS_03840 4593 3196 gene locus_tag LOCUS_03850 4593 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 4954 5826 gene locus_tag LOCUS_03860 4954 5826 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_03860 6078 8465 gene locus_tag LOCUS_03870 6078 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 8476 10620 gene locus_tag LOCUS_03880 8476 10620 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_03880 10631 11845 gene locus_tag LOCUS_03890 10631 11845 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992331.1 protein_id gnl|my_center|LOCUS_03890 12866 11865 gene locus_tag LOCUS_03900 12866 11865 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228899.1 protein_id gnl|my_center|LOCUS_03900 13246 13914 gene locus_tag LOCUS_03910 13246 13914 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_03910 14090 14362 gene locus_tag LOCUS_03920 14090 14362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 15201 14437 gene locus_tag LOCUS_03930 15201 14437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 16000 15461 gene locus_tag LOCUS_03940 16000 15461 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_03940 16466 16131 gene locus_tag LOCUS_03950 16466 16131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 16356 16949 gene locus_tag LOCUS_03960 gene bacC 16356 16949 CDS product dihydroanticapsin 7-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243359.1 protein_id gnl|my_center|LOCUS_03960 17305 17000 gene locus_tag LOCUS_03970 17305 17000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 17337 18266 gene locus_tag LOCUS_03980 17337 18266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 18244 19776 gene locus_tag LOCUS_03990 18244 19776 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_03990 19773 20891 gene locus_tag LOCUS_04000 19773 20891 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613522.1 protein_id gnl|my_center|LOCUS_04000 20875 21342 gene locus_tag LOCUS_04010 20875 21342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 21323 21733 gene locus_tag LOCUS_04020 21323 21733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 21726 23288 gene locus_tag LOCUS_04030 21726 23288 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086217.1 protein_id gnl|my_center|LOCUS_04030 23285 23719 gene locus_tag LOCUS_04040 23285 23719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 23688 24350 gene locus_tag LOCUS_04050 23688 24350 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103336743.1 protein_id gnl|my_center|LOCUS_04050 24343 25215 gene locus_tag LOCUS_04060 24343 25215 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257434.1 protein_id gnl|my_center|LOCUS_04060 26203 25286 gene locus_tag LOCUS_04070 26203 25286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 27077 26214 gene locus_tag LOCUS_04080 gene phaZ 27077 26214 CDS product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095866.1 protein_id gnl|my_center|LOCUS_04080 29284 27074 gene locus_tag LOCUS_04090 29284 27074 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027760.1 protein_id gnl|my_center|LOCUS_04090 30992 29274 gene locus_tag LOCUS_04100 gene phaC 30992 29274 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115652.1 protein_id gnl|my_center|LOCUS_04100 31248 32234 gene locus_tag LOCUS_04110 gene gyaR 31248 32234 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_04110 33316 32339 gene locus_tag LOCUS_04120 gene folD 33316 32339 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922068.1 protein_id gnl|my_center|LOCUS_04120 34229 33318 gene locus_tag LOCUS_04130 gene folD 34229 33318 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_04130 35138 34236 gene locus_tag LOCUS_04140 gene purU 35138 34236 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893574.1 protein_id gnl|my_center|LOCUS_04140 36349 35138 gene locus_tag LOCUS_04150 36349 35138 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267522.1 protein_id gnl|my_center|LOCUS_04150 36962 36342 gene locus_tag LOCUS_04160 36962 36342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 39850 36959 gene locus_tag LOCUS_04170 39850 36959 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267520.1 protein_id gnl|my_center|LOCUS_04170 40143 39847 gene locus_tag LOCUS_04180 40143 39847 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067491.1 protein_id gnl|my_center|LOCUS_04180 41507 40146 gene locus_tag LOCUS_04190 41507 40146 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762863.1 protein_id gnl|my_center|LOCUS_04190 42231 41500 gene locus_tag LOCUS_04200 42231 41500 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 protein_id gnl|my_center|LOCUS_04200 43136 42228 gene locus_tag LOCUS_04210 43136 42228 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532904.1 protein_id gnl|my_center|LOCUS_04210 43395 44828 gene locus_tag LOCUS_04220 gene glnT 43395 44828 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897682.1 protein_id gnl|my_center|LOCUS_04220 44912 46705 gene locus_tag LOCUS_04230 44912 46705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 47067 46825 gene locus_tag LOCUS_04240 47067 46825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 47030 47950 gene locus_tag LOCUS_04250 47030 47950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 47984 49549 gene locus_tag LOCUS_04260 47984 49549 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174539915.1 protein_id gnl|my_center|LOCUS_04260 49546 50649 gene locus_tag LOCUS_04270 49546 50649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827741.1 protein_id gnl|my_center|LOCUS_04270 50646 51674 gene locus_tag LOCUS_04280 50646 51674 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141439.1 protein_id gnl|my_center|LOCUS_04280 51683 52567 gene locus_tag LOCUS_04290 51683 52567 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184819074.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence008 998 591 gene locus_tag LOCUS_04300 998 591 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_04300 1300 1677 gene locus_tag LOCUS_04310 1300 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 2656 1727 gene locus_tag LOCUS_04320 2656 1727 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412735.1 protein_id gnl|my_center|LOCUS_04320 4456 2858 gene locus_tag LOCUS_04330 4456 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5285 5722 gene locus_tag LOCUS_04340 5285 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 8055 5848 gene locus_tag LOCUS_04350 8055 5848 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_04350 9910 8252 gene locus_tag LOCUS_04360 9910 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 10392 9907 gene locus_tag LOCUS_04370 10392 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 10703 11305 gene locus_tag LOCUS_04380 10703 11305 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_04380 11868 11323 gene locus_tag LOCUS_04390 11868 11323 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406064.1 protein_id gnl|my_center|LOCUS_04390 11927 13228 gene locus_tag LOCUS_04400 11927 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 13413 14162 gene locus_tag LOCUS_04410 13413 14162 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978139.1 protein_id gnl|my_center|LOCUS_04410 14159 16513 gene locus_tag LOCUS_04420 14159 16513 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224843.1 protein_id gnl|my_center|LOCUS_04420 16694 17260 gene locus_tag LOCUS_04430 16694 17260 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_04430 17496 18266 gene locus_tag LOCUS_04440 gene sufC 17496 18266 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_04440 18263 19480 gene locus_tag LOCUS_04450 18263 19480 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_04450 19477 19920 gene locus_tag LOCUS_04460 19477 19920 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_04460 19950 20267 gene locus_tag LOCUS_04470 19950 20267 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259323.1 protein_id gnl|my_center|LOCUS_04470 20267 21745 gene locus_tag LOCUS_04480 gene sufB 20267 21745 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057833.1 protein_id gnl|my_center|LOCUS_04480 21738 23024 gene locus_tag LOCUS_04490 gene sufD 21738 23024 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_04490 23200 24204 gene locus_tag LOCUS_04500 23200 24204 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250183.1 protein_id gnl|my_center|LOCUS_04500 24489 25199 gene locus_tag LOCUS_04510 24489 25199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 25211 27106 gene locus_tag LOCUS_04520 gene asnB 25211 27106 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_04520 27245 30316 gene locus_tag LOCUS_04530 27245 30316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 31799 30297 gene locus_tag LOCUS_04540 31799 30297 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081989.1 protein_id gnl|my_center|LOCUS_04540 32813 31953 gene locus_tag LOCUS_04550 32813 31953 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257881.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04550 33355 33053 gene locus_tag LOCUS_04560 33355 33053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028647.1 protein_id gnl|my_center|LOCUS_04560 33517 34515 gene locus_tag LOCUS_04570 33517 34515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 34740 35207 gene locus_tag LOCUS_04580 34740 35207 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 protein_id gnl|my_center|LOCUS_04580 35277 36101 gene locus_tag LOCUS_04590 35277 36101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 37055 36138 gene locus_tag LOCUS_04600 37055 36138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 37214 38662 gene locus_tag LOCUS_04610 37214 38662 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_04610 39173 40333 gene locus_tag LOCUS_04620 39173 40333 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_04620 40330 41625 gene locus_tag LOCUS_04630 40330 41625 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899014.1 protein_id gnl|my_center|LOCUS_04630 42562 41738 gene locus_tag LOCUS_04640 42562 41738 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950166.1 protein_id gnl|my_center|LOCUS_04640 43442 42594 gene locus_tag LOCUS_04650 43442 42594 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899009.1 protein_id gnl|my_center|LOCUS_04650 43855 43439 gene locus_tag LOCUS_04660 43855 43439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 44273 43875 gene locus_tag LOCUS_04670 44273 43875 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093265.1 protein_id gnl|my_center|LOCUS_04670 44484 45224 gene locus_tag LOCUS_04680 44484 45224 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_04680 45372 46052 gene locus_tag LOCUS_04690 45372 46052 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063392.1 protein_id gnl|my_center|LOCUS_04690 46057 47523 gene locus_tag LOCUS_04700 46057 47523 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230060.1 protein_id gnl|my_center|LOCUS_04700 47619 47930 gene locus_tag LOCUS_04710 47619 47930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 48653 48279 gene locus_tag LOCUS_04720 48653 48279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 48891 49145 gene locus_tag LOCUS_04730 48891 49145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 49462 51099 gene locus_tag LOCUS_04740 49462 51099 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405625.1 protein_id gnl|my_center|LOCUS_04740 51256 51795 gene locus_tag LOCUS_04750 51256 51795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence009 745 1041 gene locus_tag LOCUS_04760 745 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1438 1526 gene locus_tag LOCUS_t00030 1438 1526 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2006 1587 gene locus_tag LOCUS_04770 2006 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 3389 2079 gene locus_tag LOCUS_04780 3389 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3746 4264 gene locus_tag LOCUS_04790 3746 4264 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_04790 6013 4331 gene locus_tag LOCUS_04800 6013 4331 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249802.1 protein_id gnl|my_center|LOCUS_04800 6395 7312 gene locus_tag LOCUS_04810 6395 7312 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_04810 7553 7368 gene locus_tag LOCUS_04820 7553 7368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 7474 8649 gene locus_tag LOCUS_04830 7474 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 8832 9386 gene locus_tag LOCUS_04840 8832 9386 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887536.1 protein_id gnl|my_center|LOCUS_04840 9998 10249 gene locus_tag LOCUS_04850 9998 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 10195 11196 gene locus_tag LOCUS_04860 gene fabD 10195 11196 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172505.1 protein_id gnl|my_center|LOCUS_04860 11183 12217 gene locus_tag LOCUS_04870 11183 12217 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030514.1 protein_id gnl|my_center|LOCUS_04870 12214 12957 gene locus_tag LOCUS_04880 gene fabG 12214 12957 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_04880 13019 13267 gene locus_tag LOCUS_04890 13019 13267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 13289 14716 gene locus_tag LOCUS_04900 gene fabF 13289 14716 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_04900 14713 16176 gene locus_tag LOCUS_04910 14713 16176 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_04910 16526 17341 gene locus_tag LOCUS_04920 gene fabI 16526 17341 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_04920 17338 18447 gene locus_tag LOCUS_04930 17338 18447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 19596 18472 gene locus_tag LOCUS_04940 19596 18472 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146919646.1 protein_id gnl|my_center|LOCUS_04940 19582 19761 gene locus_tag LOCUS_04950 19582 19761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 19763 20512 gene locus_tag LOCUS_04960 19763 20512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 20509 21300 gene locus_tag LOCUS_04970 20509 21300 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085018.1 protein_id gnl|my_center|LOCUS_04970 21436 22317 gene locus_tag LOCUS_04980 21436 22317 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_04980 23119 22382 gene locus_tag LOCUS_04990 23119 22382 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_04990 23618 23106 gene locus_tag LOCUS_05000 23618 23106 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_05000 24267 24890 gene locus_tag LOCUS_05010 24267 24890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 25118 26647 gene locus_tag LOCUS_05020 gene amt 25118 26647 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_05020 26644 27000 gene locus_tag LOCUS_05030 gene glnB 26644 27000 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_05030 27078 27659 gene locus_tag LOCUS_05040 27078 27659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 29174 27705 gene locus_tag LOCUS_05050 29174 27705 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939525.1 protein_id gnl|my_center|LOCUS_05050 30242 29244 gene locus_tag LOCUS_05060 30242 29244 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893402.1 protein_id gnl|my_center|LOCUS_05060 30399 31376 gene locus_tag LOCUS_05070 30399 31376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 31533 32843 gene locus_tag LOCUS_05080 gene aspS 31533 32843 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_05080 32922 35063 gene locus_tag LOCUS_05090 32922 35063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 35123 36262 gene locus_tag LOCUS_05100 35123 36262 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_05100 36269 37138 gene locus_tag LOCUS_05110 gene rfbD 36269 37138 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_05110 37290 38336 gene locus_tag LOCUS_05120 gene rfbB 37290 38336 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_05120 38840 38397 gene locus_tag LOCUS_05130 38840 38397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 39339 39701 gene locus_tag LOCUS_05140 39339 39701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 39802 41193 gene locus_tag LOCUS_05150 39802 41193 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400958.1 protein_id gnl|my_center|LOCUS_05150 42050 41262 gene locus_tag LOCUS_05160 42050 41262 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035627.1 protein_id gnl|my_center|LOCUS_05160 42626 42357 gene locus_tag LOCUS_05170 42626 42357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 42774 43427 gene locus_tag LOCUS_05180 42774 43427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 43438 48549 gene locus_tag LOCUS_05190 43438 48549 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742098.1 protein_id gnl|my_center|LOCUS_05190 48646 49341 gene locus_tag LOCUS_05200 48646 49341 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256704.1 protein_id gnl|my_center|LOCUS_05200 49462 50178 gene locus_tag LOCUS_05210 49462 50178 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727023.1 protein_id gnl|my_center|LOCUS_05210 50269 50802 gene locus_tag LOCUS_05220 50269 50802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 50813 51211 gene locus_tag LOCUS_05230 50813 51211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 51536 51823 gene locus_tag LOCUS_05240 gene groES 51536 51823 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_05240 >Feature sequence010 345 1046 gene locus_tag LOCUS_05250 345 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 1048 1809 gene locus_tag LOCUS_05260 1048 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 1984 2520 gene locus_tag LOCUS_05270 1984 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 3152 4567 gene locus_tag LOCUS_05280 3152 4567 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296542.1 protein_id gnl|my_center|LOCUS_05280 4572 5123 gene locus_tag LOCUS_05290 4572 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 5173 5823 gene locus_tag LOCUS_05300 5173 5823 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174021.1 protein_id gnl|my_center|LOCUS_05300 7178 6153 gene locus_tag LOCUS_05310 7178 6153 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_05310 8487 7423 gene locus_tag LOCUS_05320 8487 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 9002 9349 gene locus_tag LOCUS_05330 9002 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 9460 10338 gene locus_tag LOCUS_05340 9460 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05340 10338 11501 gene locus_tag LOCUS_05350 10338 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 11563 12717 gene locus_tag LOCUS_05360 11563 12717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 12717 12938 gene locus_tag LOCUS_05370 12717 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 12935 15127 gene locus_tag LOCUS_05380 12935 15127 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086230.1 protein_id gnl|my_center|LOCUS_05380 15225 16250 gene locus_tag LOCUS_05390 15225 16250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 16247 18427 gene locus_tag LOCUS_05400 16247 18427 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086230.1 protein_id gnl|my_center|LOCUS_05400 18681 20066 gene locus_tag LOCUS_05410 18681 20066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 20230 21300 gene locus_tag LOCUS_05420 20230 21300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_05420 21480 23606 gene locus_tag LOCUS_05430 21480 23606 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_05430 23652 25955 gene locus_tag LOCUS_05440 23652 25955 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969352.1 protein_id gnl|my_center|LOCUS_05440 26640 25978 gene locus_tag LOCUS_05450 26640 25978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 27989 26883 gene locus_tag LOCUS_05460 27989 26883 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546725.1 protein_id gnl|my_center|LOCUS_05460 28219 27986 gene locus_tag LOCUS_05470 28219 27986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 28422 29927 gene locus_tag LOCUS_05480 28422 29927 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_05480 30551 29988 gene locus_tag LOCUS_05490 30551 29988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 31630 30548 gene locus_tag LOCUS_05500 31630 30548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 31532 31768 gene locus_tag LOCUS_05510 31532 31768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 31972 34215 gene locus_tag LOCUS_05520 31972 34215 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_05520 35825 34296 gene locus_tag LOCUS_05530 35825 34296 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957528.1 protein_id gnl|my_center|LOCUS_05530 36205 35903 gene locus_tag LOCUS_05540 36205 35903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 36548 36288 gene locus_tag LOCUS_05550 36548 36288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 37225 36548 gene locus_tag LOCUS_05560 gene lepB 37225 36548 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_05560 37458 37210 gene locus_tag LOCUS_05570 37458 37210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 38178 37681 gene locus_tag LOCUS_05580 38178 37681 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228678.1 protein_id gnl|my_center|LOCUS_05580 39924 38797 gene locus_tag LOCUS_05590 39924 38797 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002745544.1 protein_id gnl|my_center|LOCUS_05590 41340 40000 gene locus_tag LOCUS_05600 41340 40000 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868644.1 protein_id gnl|my_center|LOCUS_05600 42241 41885 gene locus_tag LOCUS_05610 42241 41885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 42341 43099 gene locus_tag LOCUS_05620 42341 43099 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230452.1 protein_id gnl|my_center|LOCUS_05620 43099 43305 gene locus_tag LOCUS_05630 43099 43305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 43329 43763 gene locus_tag LOCUS_05640 43329 43763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 44579 44172 gene locus_tag LOCUS_05650 44579 44172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 44620 45048 gene locus_tag LOCUS_05660 44620 45048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 45006 46052 gene locus_tag LOCUS_05670 45006 46052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 46428 47477 gene locus_tag LOCUS_05680 46428 47477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 47674 47952 gene locus_tag LOCUS_05690 47674 47952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 48122 48604 gene locus_tag LOCUS_05700 48122 48604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05700 48582 48866 gene locus_tag LOCUS_05710 48582 48866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 48873 50921 gene locus_tag LOCUS_05720 48873 50921 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051509115.1 protein_id gnl|my_center|LOCUS_05720 51647 50931 gene locus_tag LOCUS_05730 51647 50931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05730 >Feature sequence011 1429 569 gene locus_tag LOCUS_05740 1429 569 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_05740 1865 1443 gene locus_tag LOCUS_05750 gene mscL 1865 1443 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_05750 3947 2154 gene locus_tag LOCUS_05760 3947 2154 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_05760 4752 3949 gene locus_tag LOCUS_05770 4752 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 5967 5023 gene locus_tag LOCUS_05780 5967 5023 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226418.1 protein_id gnl|my_center|LOCUS_05780 7920 5968 gene locus_tag LOCUS_05790 7920 5968 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125263880.1 protein_id gnl|my_center|LOCUS_05790 9676 7922 gene locus_tag LOCUS_05800 9676 7922 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226416.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05800 9964 9707 gene locus_tag LOCUS_05810 9964 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05810 11777 10200 gene locus_tag LOCUS_05820 11777 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 12142 11774 gene locus_tag LOCUS_05830 gene crcB 12142 11774 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728181.1 protein_id gnl|my_center|LOCUS_05830 12651 12139 gene locus_tag LOCUS_05840 12651 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 12951 12661 gene locus_tag LOCUS_05850 12951 12661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 14223 12970 gene locus_tag LOCUS_05860 14223 12970 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729771.1 protein_id gnl|my_center|LOCUS_05860 15101 14409 gene locus_tag LOCUS_05870 15101 14409 CDS product AmiS/UreI family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730476.1 protein_id gnl|my_center|LOCUS_05870 17020 15572 gene locus_tag LOCUS_05880 gene selA 17020 15572 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_05880 18615 17017 gene locus_tag LOCUS_05890 18615 17017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 18741 18650 gene locus_tag LOCUS_t00040 18741 18650 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 19830 18778 gene locus_tag LOCUS_05900 gene selD 19830 18778 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_05900 21123 19912 gene locus_tag LOCUS_05910 21123 19912 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229645.1 protein_id gnl|my_center|LOCUS_05910 22519 21143 gene locus_tag LOCUS_05920 22519 21143 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229644.1 protein_id gnl|my_center|LOCUS_05920 23508 22516 gene locus_tag LOCUS_05930 23508 22516 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_05930 24853 23519 gene locus_tag LOCUS_05940 24853 23519 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_05940 26142 24850 gene locus_tag LOCUS_05950 26142 24850 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230941.1 protein_id gnl|my_center|LOCUS_05950 27003 26326 gene locus_tag LOCUS_05960 27003 26326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 27285 27815 gene locus_tag LOCUS_05970 27285 27815 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230299.1 protein_id gnl|my_center|LOCUS_05970 27812 29227 gene locus_tag LOCUS_05980 27812 29227 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_05980 29364 30863 gene locus_tag LOCUS_05990 29364 30863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 31602 30805 gene locus_tag LOCUS_06000 31602 30805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 31508 32725 gene locus_tag LOCUS_06010 31508 32725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 34679 33021 gene locus_tag LOCUS_06020 34679 33021 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093506.1 protein_id gnl|my_center|LOCUS_06020 36647 35388 gene locus_tag LOCUS_06030 36647 35388 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082252.1 protein_id gnl|my_center|LOCUS_06030 37630 36662 gene locus_tag LOCUS_06040 37630 36662 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_06040 39967 37637 gene locus_tag LOCUS_06050 39967 37637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 39918 40568 gene locus_tag LOCUS_06060 39918 40568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 41002 41232 gene locus_tag LOCUS_06070 41002 41232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 41618 41322 gene locus_tag LOCUS_06080 41618 41322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 43799 41619 gene locus_tag LOCUS_06090 43799 41619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 44340 43924 gene locus_tag LOCUS_06100 44340 43924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 44568 44996 gene locus_tag LOCUS_06110 44568 44996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 45617 45186 gene locus_tag LOCUS_06120 45617 45186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 45850 45614 gene locus_tag LOCUS_06130 45850 45614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 46812 45886 gene locus_tag LOCUS_06140 46812 45886 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899172.1 protein_id gnl|my_center|LOCUS_06140 <49347 46812 gene locus_tag LOCUS_06150 <49347 46812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003911743.1:DEAD/DEAH box helicase >Feature sequence012 2895 1099 gene locus_tag LOCUS_06160 2895 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 3407 5548 gene locus_tag LOCUS_06170 3407 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 5563 6462 gene locus_tag LOCUS_06180 5563 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 6995 6393 gene locus_tag LOCUS_06190 6995 6393 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226699.1 protein_id gnl|my_center|LOCUS_06190 7285 7854 gene locus_tag LOCUS_06200 7285 7854 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_06200 7882 8550 gene locus_tag LOCUS_06210 7882 8550 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415983.1 protein_id gnl|my_center|LOCUS_06210 8724 9818 gene locus_tag LOCUS_06220 8724 9818 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730251.1 protein_id gnl|my_center|LOCUS_06220 9933 12719 gene locus_tag LOCUS_06230 9933 12719 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730250.1 protein_id gnl|my_center|LOCUS_06230 12984 12835 gene locus_tag LOCUS_06240 12984 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 13371 13120 gene locus_tag LOCUS_06250 13371 13120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 15663 13489 gene locus_tag LOCUS_06260 15663 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 15969 15712 gene locus_tag LOCUS_06270 15969 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 15874 16344 gene locus_tag LOCUS_06280 15874 16344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 16348 18000 gene locus_tag LOCUS_06290 16348 18000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 18162 18869 gene locus_tag LOCUS_06300 18162 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 18949 20178 gene locus_tag LOCUS_06310 18949 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 21100 20219 gene locus_tag LOCUS_06320 21100 20219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 22233 21097 gene locus_tag LOCUS_06330 gene dnaJ 22233 21097 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_06330 23474 22452 gene locus_tag LOCUS_06340 gene hrcA 23474 22452 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_06340 23993 23577 gene locus_tag LOCUS_06350 23993 23577 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_06350 24438 23998 gene locus_tag LOCUS_06360 24438 23998 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_06360 24865 26328 gene locus_tag LOCUS_06370 24865 26328 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029960.1 protein_id gnl|my_center|LOCUS_06370 26325 27128 gene locus_tag LOCUS_06380 26325 27128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974037.1 protein_id gnl|my_center|LOCUS_06380 27471 27911 gene locus_tag LOCUS_06390 27471 27911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 28351 27908 gene locus_tag LOCUS_06400 28351 27908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 28653 28438 gene locus_tag LOCUS_06410 28653 28438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 29008 28706 gene locus_tag LOCUS_06420 29008 28706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 30160 29363 gene locus_tag LOCUS_06430 30160 29363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 31949 30177 gene locus_tag LOCUS_06440 31949 30177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 33310 32282 gene locus_tag LOCUS_06450 33310 32282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 33991 34620 gene locus_tag LOCUS_06460 33991 34620 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933301.1 protein_id gnl|my_center|LOCUS_06460 35580 34651 gene locus_tag LOCUS_06470 35580 34651 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877923.1 protein_id gnl|my_center|LOCUS_06470 36406 35855 gene locus_tag LOCUS_06480 36406 35855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 40581 36625 gene locus_tag LOCUS_06490 40581 36625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 41251 41718 gene locus_tag LOCUS_06500 41251 41718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 41733 41918 gene locus_tag LOCUS_06510 41733 41918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 43228 41828 gene locus_tag LOCUS_06520 43228 41828 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846386.1 protein_id gnl|my_center|LOCUS_06520 43705 45009 gene locus_tag LOCUS_06530 43705 45009 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258343.1 protein_id gnl|my_center|LOCUS_06530 45435 45076 gene locus_tag LOCUS_06540 gene vapC4 45435 45076 CDS product type II toxin-antitoxin system toxin ribonuclease C4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403122.1 protein_id gnl|my_center|LOCUS_06540 45712 45437 gene locus_tag LOCUS_06550 45712 45437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 46025 45952 gene locus_tag LOCUS_t00050 46025 45952 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 46278 46361 gene locus_tag LOCUS_t00060 46278 46361 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence013 316 2250 gene locus_tag LOCUS_06560 316 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2510 4603 gene locus_tag LOCUS_06570 2510 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 4682 5389 gene locus_tag LOCUS_06580 4682 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 6427 5498 gene locus_tag LOCUS_06590 gene panB 6427 5498 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869215.1 protein_id gnl|my_center|LOCUS_06590 6834 6430 gene locus_tag LOCUS_06600 6834 6430 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804871.1 protein_id gnl|my_center|LOCUS_06600 7916 6831 gene locus_tag LOCUS_06610 7916 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 8120 8881 gene locus_tag LOCUS_06620 8120 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 9037 9678 gene locus_tag LOCUS_06630 9037 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 9663 10580 gene locus_tag LOCUS_06640 9663 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 10577 11104 gene locus_tag LOCUS_06650 gene rimI 10577 11104 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_06650 11164 12207 gene locus_tag LOCUS_06660 gene tsaD 11164 12207 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_06660 12306 12671 gene locus_tag LOCUS_06670 12306 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 12788 13456 gene locus_tag LOCUS_06680 12788 13456 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_06680 13596 14762 gene locus_tag LOCUS_06690 13596 14762 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142291.1 protein_id gnl|my_center|LOCUS_06690 14830 15366 gene locus_tag LOCUS_06700 14830 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 15591 17693 gene locus_tag LOCUS_06710 15591 17693 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_06710 17838 18083 gene locus_tag LOCUS_06720 17838 18083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 18080 20146 gene locus_tag LOCUS_06730 18080 20146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 20157 20585 gene locus_tag LOCUS_06740 20157 20585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 20587 21264 gene locus_tag LOCUS_06750 20587 21264 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774859.1 protein_id gnl|my_center|LOCUS_06750 21504 21576 gene locus_tag LOCUS_t00070 21504 21576 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 23606 21750 gene locus_tag LOCUS_06760 23606 21750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 25522 23603 gene locus_tag LOCUS_06770 25522 23603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_06770 26032 26952 gene locus_tag LOCUS_06780 26032 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 28541 26967 gene locus_tag LOCUS_06790 28541 26967 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142816.1 protein_id gnl|my_center|LOCUS_06790 29155 28625 gene locus_tag LOCUS_06800 29155 28625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 29280 29690 gene locus_tag LOCUS_06810 gene msrB 29280 29690 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089781.1 protein_id gnl|my_center|LOCUS_06810 29743 30054 gene locus_tag LOCUS_06820 29743 30054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 30349 31752 gene locus_tag LOCUS_06830 30349 31752 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978643.1 protein_id gnl|my_center|LOCUS_06830 32147 31938 gene locus_tag LOCUS_06840 32147 31938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 32878 32144 gene locus_tag LOCUS_06850 gene msrA 32878 32144 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083656.1 protein_id gnl|my_center|LOCUS_06850 33244 34575 gene locus_tag LOCUS_06860 33244 34575 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522068.1 protein_id gnl|my_center|LOCUS_06860 35024 34533 gene locus_tag LOCUS_06870 35024 34533 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_06870 36658 35336 gene locus_tag LOCUS_06880 gene glcF 36658 35336 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227984.1 protein_id gnl|my_center|LOCUS_06880 39569 36660 gene locus_tag LOCUS_06890 39569 36660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 39570 40292 gene locus_tag LOCUS_06900 39570 40292 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975126.1 protein_id gnl|my_center|LOCUS_06900 40470 41399 gene locus_tag LOCUS_06910 gene catE 40470 41399 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 protein_id gnl|my_center|LOCUS_06910 41618 41944 gene locus_tag LOCUS_06920 41618 41944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 41941 42495 gene locus_tag LOCUS_06930 41941 42495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 42411 42755 gene locus_tag LOCUS_06940 42411 42755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 42760 43062 gene locus_tag LOCUS_06950 42760 43062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 43059 43337 gene locus_tag LOCUS_06960 43059 43337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence014 561 1331 gene locus_tag LOCUS_06970 561 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1328 2050 gene locus_tag LOCUS_06980 1328 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 2092 2913 gene locus_tag LOCUS_06990 2092 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2979 5783 gene locus_tag LOCUS_07000 2979 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 5800 6972 gene locus_tag LOCUS_07010 5800 6972 CDS product tetraprenyl-beta-curcumene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391704.1 protein_id gnl|my_center|LOCUS_07010 7145 11110 gene locus_tag LOCUS_07020 7145 11110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 11107 14835 gene locus_tag LOCUS_07030 11107 14835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 15688 15080 gene locus_tag LOCUS_07040 15688 15080 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037712.1 protein_id gnl|my_center|LOCUS_07040 16453 15845 gene locus_tag LOCUS_07050 16453 15845 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037712.1 protein_id gnl|my_center|LOCUS_07050 16781 17608 gene locus_tag LOCUS_07060 16781 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 17829 18743 gene locus_tag LOCUS_07070 17829 18743 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405636.1 protein_id gnl|my_center|LOCUS_07070 18740 19672 gene locus_tag LOCUS_07080 18740 19672 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_07080 19979 21541 gene locus_tag LOCUS_07090 19979 21541 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529213.1 protein_id gnl|my_center|LOCUS_07090 21538 22641 gene locus_tag LOCUS_07100 21538 22641 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969403.1 protein_id gnl|my_center|LOCUS_07100 22706 23857 gene locus_tag LOCUS_07110 22706 23857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 24024 25052 gene locus_tag LOCUS_07120 24024 25052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 25152 25227 gene locus_tag LOCUS_t00080 25152 25227 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26545 25643 gene locus_tag LOCUS_07130 26545 25643 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402979.1 protein_id gnl|my_center|LOCUS_07130 27227 26640 gene locus_tag LOCUS_07140 27227 26640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142945.1 protein_id gnl|my_center|LOCUS_07140 27239 27514 gene locus_tag LOCUS_07150 27239 27514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 27541 27771 gene locus_tag LOCUS_07160 27541 27771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 28031 28834 gene locus_tag LOCUS_07170 28031 28834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 28977 29582 gene locus_tag LOCUS_07180 28977 29582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 30262 29750 gene locus_tag LOCUS_07190 30262 29750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 30532 30287 gene locus_tag LOCUS_07200 30532 30287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 30857 30522 gene locus_tag LOCUS_07210 30857 30522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 31759 31154 gene locus_tag LOCUS_07220 31759 31154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 32490 32116 gene locus_tag LOCUS_07230 32490 32116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 33416 32490 gene locus_tag LOCUS_07240 33416 32490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 33943 33413 gene locus_tag LOCUS_07250 33943 33413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 36509 33936 gene locus_tag LOCUS_07260 36509 33936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 37300 36506 gene locus_tag LOCUS_07270 37300 36506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583200.1 protein_id gnl|my_center|LOCUS_07270 38016 37297 gene locus_tag LOCUS_07280 gene glnQ 38016 37297 CDS product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190973.1 protein_id gnl|my_center|LOCUS_07280 38639 38013 gene locus_tag LOCUS_07290 38639 38013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 38947 39219 gene locus_tag LOCUS_07300 38947 39219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 39216 39635 gene locus_tag LOCUS_07310 39216 39635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 39754 39963 gene locus_tag LOCUS_07320 39754 39963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 39960 40370 gene locus_tag LOCUS_07330 gene vapc11 39960 40370 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_07330 40657 41547 gene locus_tag LOCUS_07340 40657 41547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence015 1291 101 gene locus_tag LOCUS_07350 1291 101 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977076.1 protein_id gnl|my_center|LOCUS_07350 1400 2536 gene locus_tag LOCUS_07360 1400 2536 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898087.1 protein_id gnl|my_center|LOCUS_07360 2696 4570 gene locus_tag LOCUS_07370 gene shc 2696 4570 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_07370 6157 4676 gene locus_tag LOCUS_07380 6157 4676 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_07380 7914 6436 gene locus_tag LOCUS_07390 7914 6436 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967349.1 protein_id gnl|my_center|LOCUS_07390 10595 9126 gene locus_tag LOCUS_07400 10595 9126 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878477.1 protein_id gnl|my_center|LOCUS_07400 12180 11122 gene locus_tag LOCUS_07410 12180 11122 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838396.1 protein_id gnl|my_center|LOCUS_07410 12860 12177 gene locus_tag LOCUS_07420 12860 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 14538 13066 gene locus_tag LOCUS_07430 14538 13066 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038543.1 protein_id gnl|my_center|LOCUS_07430 15942 14929 gene locus_tag LOCUS_07440 gene rbsK 15942 14929 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526901.1 protein_id gnl|my_center|LOCUS_07440 16976 15954 gene locus_tag LOCUS_07450 16976 15954 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_07450 17846 17064 gene locus_tag LOCUS_07460 17846 17064 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860724.1 protein_id gnl|my_center|LOCUS_07460 18459 17923 gene locus_tag LOCUS_07470 18459 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 18850 18470 gene locus_tag LOCUS_07480 18850 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 19489 20418 gene locus_tag LOCUS_07490 19489 20418 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223529.1 protein_id gnl|my_center|LOCUS_07490 21199 20825 gene locus_tag LOCUS_07500 21199 20825 CDS product lsr2/espR transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400657.1 protein_id gnl|my_center|LOCUS_07500 21644 21363 gene locus_tag LOCUS_07510 21644 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 23479 21896 gene locus_tag LOCUS_07520 23479 21896 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534776.1 protein_id gnl|my_center|LOCUS_07520 23785 24165 gene locus_tag LOCUS_07530 23785 24165 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_07530 25028 24366 gene locus_tag LOCUS_07540 25028 24366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 25142 25411 gene locus_tag LOCUS_07550 25142 25411 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_07550 25888 25493 gene locus_tag LOCUS_07560 25888 25493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 26208 26387 gene locus_tag LOCUS_07570 26208 26387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 26547 26717 gene locus_tag LOCUS_07580 26547 26717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 26959 26893 gene locus_tag LOCUS_t00090 26959 26893 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 27086 28453 gene locus_tag LOCUS_07590 27086 28453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 28552 28926 gene locus_tag LOCUS_07600 28552 28926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 28927 29622 gene locus_tag LOCUS_07610 28927 29622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 29980 29627 gene locus_tag LOCUS_07620 29980 29627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 30168 32942 gene locus_tag LOCUS_07630 30168 32942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 34660 33281 gene locus_tag LOCUS_07640 34660 33281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 36863 34713 gene locus_tag LOCUS_07650 36863 34713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 37106 37273 gene locus_tag LOCUS_07660 37106 37273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 37938 37414 gene locus_tag LOCUS_07670 37938 37414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 38542 38087 gene locus_tag LOCUS_07680 38542 38087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 38891 39439 gene locus_tag LOCUS_07690 38891 39439 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892804.1 protein_id gnl|my_center|LOCUS_07690 39439 40824 gene locus_tag LOCUS_07700 39439 40824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence016 791 384 gene locus_tag LOCUS_07710 gene rpsH 791 384 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403669.1 protein_id gnl|my_center|LOCUS_07710 1103 918 gene locus_tag LOCUS_07720 1103 918 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_07720 1715 1104 gene locus_tag LOCUS_07730 gene rplE 1715 1104 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567542.1 protein_id gnl|my_center|LOCUS_07730 2080 1715 gene locus_tag LOCUS_07740 gene rplX 2080 1715 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_07740 2448 2080 gene locus_tag LOCUS_07750 gene rplN 2448 2080 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258241.1 protein_id gnl|my_center|LOCUS_07750 3190 2522 gene locus_tag LOCUS_07760 3190 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 3442 3236 gene locus_tag LOCUS_07770 3442 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 3857 3447 gene locus_tag LOCUS_07780 gene rplP 3857 3447 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_07780 4696 3857 gene locus_tag LOCUS_07790 4696 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 5552 4788 gene locus_tag LOCUS_07800 5552 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5824 5552 gene locus_tag LOCUS_07810 gene rpsS 5824 5552 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_07810 6718 5873 gene locus_tag LOCUS_07820 gene rplB 6718 5873 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_07820 7024 6722 gene locus_tag LOCUS_07830 gene rplW 7024 6722 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_07830 7797 7021 gene locus_tag LOCUS_07840 7797 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 8416 7790 gene locus_tag LOCUS_07850 gene rplC 8416 7790 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055936.1 protein_id gnl|my_center|LOCUS_07850 8761 8435 gene locus_tag LOCUS_07860 gene rpsJ 8761 8435 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_07860 10147 8963 gene locus_tag LOCUS_07870 gene tuf 10147 8963 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667564.1 protein_id gnl|my_center|LOCUS_07870 12374 10272 gene locus_tag LOCUS_07880 gene fusA 12374 10272 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_07880 13329 12883 gene locus_tag LOCUS_07890 gene rpsG 13329 12883 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583341.1 protein_id gnl|my_center|LOCUS_07890 13748 13353 gene locus_tag LOCUS_07900 gene rpsL 13748 13353 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854221.1 protein_id gnl|my_center|LOCUS_07900 14800 13910 gene locus_tag LOCUS_07910 14800 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 19223 15105 gene locus_tag LOCUS_07920 19223 15105 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_07920 22968 19255 gene locus_tag LOCUS_07930 gene rpoB 22968 19255 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393945.1 protein_id gnl|my_center|LOCUS_07930 23695 23312 gene locus_tag LOCUS_07940 gene rplL 23695 23312 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_07940 24619 23699 gene locus_tag LOCUS_07950 24619 23699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 25672 24950 gene locus_tag LOCUS_07960 gene rplA 25672 24950 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_07960 26103 25678 gene locus_tag LOCUS_07970 gene rplK 26103 25678 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943497.1 protein_id gnl|my_center|LOCUS_07970 26788 26267 gene locus_tag LOCUS_07980 gene nusG 26788 26267 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_07980 27359 26928 gene locus_tag LOCUS_07990 27359 26928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 27580 27416 gene locus_tag LOCUS_08000 gene rpmG 27580 27416 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_08000 28865 27816 gene locus_tag LOCUS_08010 28865 27816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 29067 29852 gene locus_tag LOCUS_08020 29067 29852 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_08020 30459 29860 gene locus_tag LOCUS_08030 gene clpP 30459 29860 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_08030 31514 30531 gene locus_tag LOCUS_08040 31514 30531 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_08040 31622 32200 gene locus_tag LOCUS_08050 gene pgsA 31622 32200 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_08050 33078 32170 gene locus_tag LOCUS_08060 gene mptA 33078 32170 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878675.1 protein_id gnl|my_center|LOCUS_08060 33460 33542 gene locus_tag LOCUS_t00100 33460 33542 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 34118 33570 gene locus_tag LOCUS_08070 34118 33570 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_08070 34337 34591 gene locus_tag LOCUS_08080 34337 34591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 34717 35094 gene locus_tag LOCUS_08090 34717 35094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 36168 35149 gene locus_tag LOCUS_08100 36168 35149 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_08100 36247 37632 gene locus_tag LOCUS_08110 36247 37632 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_08110 38271 37864 gene locus_tag LOCUS_08120 38271 37864 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065851.1 protein_id gnl|my_center|LOCUS_08120 38585 38241 gene locus_tag LOCUS_08130 38585 38241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 <39220 38601 gene locus_tag LOCUS_08140 <39220 38601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229633.1:MMPL family transporter >Feature sequence017 751 2130 gene locus_tag LOCUS_08150 gene mptB 751 2130 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226496.1 protein_id gnl|my_center|LOCUS_08150 3464 2073 gene locus_tag LOCUS_08160 3464 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 4944 3640 gene locus_tag LOCUS_08170 4944 3640 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223710.1 protein_id gnl|my_center|LOCUS_08170 5612 4956 gene locus_tag LOCUS_08180 5612 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 6455 5634 gene locus_tag LOCUS_08190 gene prmC 6455 5634 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 protein_id gnl|my_center|LOCUS_08190 7692 6625 gene locus_tag LOCUS_08200 gene prfA 7692 6625 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_08200 8986 7862 gene locus_tag LOCUS_08210 8986 7862 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_08210 9239 8991 gene locus_tag LOCUS_08220 gene rpmE 9239 8991 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229538.1 protein_id gnl|my_center|LOCUS_08220 9807 9292 gene locus_tag LOCUS_08230 9807 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 11678 9936 gene locus_tag LOCUS_08240 11678 9936 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 protein_id gnl|my_center|LOCUS_08240 12660 11680 gene locus_tag LOCUS_08250 12660 11680 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899889.1 protein_id gnl|my_center|LOCUS_08250 13478 12687 gene locus_tag LOCUS_08260 13478 12687 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_08260 13973 13545 gene locus_tag LOCUS_08270 13973 13545 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_08270 15086 14058 gene locus_tag LOCUS_08280 15086 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 16286 15096 gene locus_tag LOCUS_08290 16286 15096 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 protein_id gnl|my_center|LOCUS_08290 16364 17980 gene locus_tag LOCUS_08300 16364 17980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 18303 19355 gene locus_tag LOCUS_08310 18303 19355 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529567.1 protein_id gnl|my_center|LOCUS_08310 20429 19530 gene locus_tag LOCUS_08320 20429 19530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 21568 20735 gene locus_tag LOCUS_08330 21568 20735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_08330 22832 21777 gene locus_tag LOCUS_08340 22832 21777 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_08340 23637 22846 gene locus_tag LOCUS_08350 23637 22846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 24825 24052 gene locus_tag LOCUS_08360 24825 24052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 25090 24818 gene locus_tag LOCUS_08370 25090 24818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 26407 25424 gene locus_tag LOCUS_08380 gene meaB 26407 25424 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223478.1 protein_id gnl|my_center|LOCUS_08380 26546 27178 gene locus_tag LOCUS_08390 26546 27178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 27175 28050 gene locus_tag LOCUS_08400 27175 28050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 28828 28073 gene locus_tag LOCUS_08410 28828 28073 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591967.1 protein_id gnl|my_center|LOCUS_08410 28907 29824 gene locus_tag LOCUS_08420 28907 29824 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223513.1 protein_id gnl|my_center|LOCUS_08420 31632 30001 gene locus_tag LOCUS_08430 31632 30001 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_08430 33163 31901 gene locus_tag LOCUS_08440 gene ftsZ 33163 31901 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_08440 34205 33438 gene locus_tag LOCUS_08450 34205 33438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 34344 35543 gene locus_tag LOCUS_08460 34344 35543 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_08460 36990 35551 gene locus_tag LOCUS_08470 36990 35551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 37443 37069 gene locus_tag LOCUS_08480 37443 37069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence018 2475 1486 gene locus_tag LOCUS_08490 gene hemH 2475 1486 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727378.1 protein_id gnl|my_center|LOCUS_08490 3586 2468 gene locus_tag LOCUS_08500 gene hemE 3586 2468 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224512.1 protein_id gnl|my_center|LOCUS_08500 3859 4950 gene locus_tag LOCUS_08510 3859 4950 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_08510 5116 6120 gene locus_tag LOCUS_08520 5116 6120 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_08520 6457 7566 gene locus_tag LOCUS_08530 6457 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 7761 9455 gene locus_tag LOCUS_08540 7761 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 10417 9581 gene locus_tag LOCUS_08550 10417 9581 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036719.1 protein_id gnl|my_center|LOCUS_08550 10753 10496 gene locus_tag LOCUS_08560 10753 10496 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985297.1 protein_id gnl|my_center|LOCUS_08560 10909 12396 gene locus_tag LOCUS_08570 gene glpK 10909 12396 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_08570 12393 13127 gene locus_tag LOCUS_08580 12393 13127 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881346.1 protein_id gnl|my_center|LOCUS_08580 13127 14083 gene locus_tag LOCUS_08590 13127 14083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 14166 14945 gene locus_tag LOCUS_08600 14166 14945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 15699 14863 gene locus_tag LOCUS_08610 15699 14863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 17237 16410 gene locus_tag LOCUS_08620 gene fabG 17237 16410 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546317.1 protein_id gnl|my_center|LOCUS_08620 17950 17492 gene locus_tag LOCUS_08630 17950 17492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 18595 19767 gene locus_tag LOCUS_08640 18595 19767 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 protein_id gnl|my_center|LOCUS_08640 20366 20638 gene locus_tag LOCUS_08650 20366 20638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 20760 21431 gene locus_tag LOCUS_08660 gene cseB 20760 21431 CDS product two-component system response regulator CseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975477.1 protein_id gnl|my_center|LOCUS_08660 21428 22672 gene locus_tag LOCUS_08670 21428 22672 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028932.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08670 22654 23967 gene locus_tag LOCUS_08680 22654 23967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 25304 24114 gene locus_tag LOCUS_08690 gene atuD 25304 24114 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_08690 25538 26260 gene locus_tag LOCUS_08700 25538 26260 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230121.1 protein_id gnl|my_center|LOCUS_08700 26257 27624 gene locus_tag LOCUS_08710 26257 27624 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888344.1 protein_id gnl|my_center|LOCUS_08710 27884 28804 gene locus_tag LOCUS_08720 27884 28804 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808764.1 protein_id gnl|my_center|LOCUS_08720 28801 30441 gene locus_tag LOCUS_08730 28801 30441 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_08730 30470 31432 gene locus_tag LOCUS_08740 30470 31432 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878705.1 protein_id gnl|my_center|LOCUS_08740 31432 32217 gene locus_tag LOCUS_08750 31432 32217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 32378 33220 gene locus_tag LOCUS_08760 32378 33220 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461832.1 protein_id gnl|my_center|LOCUS_08760 33309 33926 gene locus_tag LOCUS_08770 33309 33926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 34054 34188 gene locus_tag LOCUS_08780 34054 34188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 34185 34415 gene locus_tag LOCUS_08790 34185 34415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 34419 34931 gene locus_tag LOCUS_08800 34419 34931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 34931 35164 gene locus_tag LOCUS_08810 34931 35164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence019 250 1443 gene locus_tag LOCUS_08820 250 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2377 1622 gene locus_tag LOCUS_08830 2377 1622 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229887.1 protein_id gnl|my_center|LOCUS_08830 3214 2453 gene locus_tag LOCUS_08840 3214 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3431 4513 gene locus_tag LOCUS_08850 3431 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 5447 4620 gene locus_tag LOCUS_08860 5447 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 5773 6240 gene locus_tag LOCUS_08870 gene greA 5773 6240 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_08870 7216 6302 gene locus_tag LOCUS_08880 7216 6302 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 protein_id gnl|my_center|LOCUS_08880 8026 7625 gene locus_tag LOCUS_08890 8026 7625 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228341.1 protein_id gnl|my_center|LOCUS_08890 8937 8245 gene locus_tag LOCUS_08900 8937 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 10517 8994 gene locus_tag LOCUS_08910 10517 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 11849 10896 gene locus_tag LOCUS_08920 11849 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 12072 12521 gene locus_tag LOCUS_08930 12072 12521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 12726 13217 gene locus_tag LOCUS_08940 12726 13217 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_08940 14701 13283 gene locus_tag LOCUS_08950 14701 13283 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_08950 14883 15491 gene locus_tag LOCUS_08960 14883 15491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 15572 17194 gene locus_tag LOCUS_08970 15572 17194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 17455 19077 gene locus_tag LOCUS_08980 17455 19077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 19879 19046 gene locus_tag LOCUS_08990 19879 19046 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_08990 19903 21309 gene locus_tag LOCUS_09000 19903 21309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 21306 22112 gene locus_tag LOCUS_09010 21306 22112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 22269 23744 gene locus_tag LOCUS_09020 22269 23744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 23850 24851 gene locus_tag LOCUS_09030 gene hemB 23850 24851 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_09030 24830 26029 gene locus_tag LOCUS_09040 24830 26029 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_09040 26026 27330 gene locus_tag LOCUS_09050 gene hemL 26026 27330 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776658.1 protein_id gnl|my_center|LOCUS_09050 27327 27920 gene locus_tag LOCUS_09060 27327 27920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 27980 28642 gene locus_tag LOCUS_09070 27980 28642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 28673 29476 gene locus_tag LOCUS_09080 28673 29476 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546179.1 protein_id gnl|my_center|LOCUS_09080 29483 30217 gene locus_tag LOCUS_09090 29483 30217 CDS product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225562.1 protein_id gnl|my_center|LOCUS_09090 30357 31190 gene locus_tag LOCUS_09100 gene ubiE 30357 31190 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_09100 31335 32276 gene locus_tag LOCUS_09110 31335 32276 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259573.1 protein_id gnl|my_center|LOCUS_09110 32856 32440 gene locus_tag LOCUS_09120 32856 32440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 33127 34224 gene locus_tag LOCUS_09130 33127 34224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 34444 35274 gene locus_tag LOCUS_09140 34444 35274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence020 406 1320 gene locus_tag LOCUS_09150 406 1320 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 protein_id gnl|my_center|LOCUS_09150 1317 3116 gene locus_tag LOCUS_09160 1317 3116 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877899.1 protein_id gnl|my_center|LOCUS_09160 3113 3961 gene locus_tag LOCUS_09170 3113 3961 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728079.1 protein_id gnl|my_center|LOCUS_09170 3969 4757 gene locus_tag LOCUS_09180 3969 4757 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_09180 5336 4695 gene locus_tag LOCUS_09190 5336 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 7047 5386 gene locus_tag LOCUS_09200 7047 5386 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877899.1 protein_id gnl|my_center|LOCUS_09200 7508 7047 gene locus_tag LOCUS_09210 7508 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 8247 7681 gene locus_tag LOCUS_09220 8247 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 9308 8247 gene locus_tag LOCUS_09230 9308 8247 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974116.1 protein_id gnl|my_center|LOCUS_09230 10123 9305 gene locus_tag LOCUS_09240 10123 9305 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084082.1 protein_id gnl|my_center|LOCUS_09240 11168 10146 gene locus_tag LOCUS_09250 11168 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 12973 11165 gene locus_tag LOCUS_09260 12973 11165 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877899.1 protein_id gnl|my_center|LOCUS_09260 14055 12967 gene locus_tag LOCUS_09270 14055 12967 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258336.1 protein_id gnl|my_center|LOCUS_09270 14963 14055 gene locus_tag LOCUS_09280 14963 14055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 15038 16315 gene locus_tag LOCUS_09290 15038 16315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 16306 17493 gene locus_tag LOCUS_09300 16306 17493 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064155.1 protein_id gnl|my_center|LOCUS_09300 17545 18036 gene locus_tag LOCUS_09310 17545 18036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 18048 18872 gene locus_tag LOCUS_09320 18048 18872 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228939.1 protein_id gnl|my_center|LOCUS_09320 19548 18907 gene locus_tag LOCUS_09330 19548 18907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 20043 19639 gene locus_tag LOCUS_09340 20043 19639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 20331 20810 gene locus_tag LOCUS_09350 20331 20810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829440.1 protein_id gnl|my_center|LOCUS_09350 20893 22272 gene locus_tag LOCUS_09360 20893 22272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 22462 22929 gene locus_tag LOCUS_09370 22462 22929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 22926 23666 gene locus_tag LOCUS_09380 22926 23666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 25016 23793 gene locus_tag LOCUS_09390 25016 23793 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_09390 26863 25013 gene locus_tag LOCUS_09400 26863 25013 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_09400 27096 27887 gene locus_tag LOCUS_09410 27096 27887 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921388.1 protein_id gnl|my_center|LOCUS_09410 28055 29158 gene locus_tag LOCUS_09420 28055 29158 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_09420 29155 30333 gene locus_tag LOCUS_09430 29155 30333 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_09430 30356 30862 gene locus_tag LOCUS_09440 30356 30862 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_09440 30892 31326 gene locus_tag LOCUS_09450 30892 31326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 31323 31760 gene locus_tag LOCUS_09460 gene mce 31323 31760 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_09460 31750 32637 gene locus_tag LOCUS_09470 31750 32637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 32625 33104 gene locus_tag LOCUS_09480 32625 33104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 33109 33912 gene locus_tag LOCUS_09490 33109 33912 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969980.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence021 1812 2513 gene locus_tag LOCUS_09500 1812 2513 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_09500 2513 5098 gene locus_tag LOCUS_09510 2513 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 5334 5699 gene locus_tag LOCUS_09520 5334 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 5699 6634 gene locus_tag LOCUS_09530 5699 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 7550 6555 gene locus_tag LOCUS_09540 7550 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 7702 8091 gene locus_tag LOCUS_09550 7702 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 8212 9210 gene locus_tag LOCUS_09560 8212 9210 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467188.1 protein_id gnl|my_center|LOCUS_09560 9548 9180 gene locus_tag LOCUS_09570 9548 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 9658 9807 gene locus_tag LOCUS_09580 9658 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 9997 10281 gene locus_tag LOCUS_09590 9997 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 11679 10591 gene locus_tag LOCUS_09600 11679 10591 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987014.1 protein_id gnl|my_center|LOCUS_09600 12260 11676 gene locus_tag LOCUS_09610 12260 11676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 13450 12257 gene locus_tag LOCUS_09620 13450 12257 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_09620 14872 13541 gene locus_tag LOCUS_09630 14872 13541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 15225 16109 gene locus_tag LOCUS_09640 15225 16109 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229653.1 protein_id gnl|my_center|LOCUS_09640 17088 16213 gene locus_tag LOCUS_09650 17088 16213 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_09650 17771 17118 gene locus_tag LOCUS_09660 17771 17118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 18640 17732 gene locus_tag LOCUS_09670 gene folP 18640 17732 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225731.1 protein_id gnl|my_center|LOCUS_09670 18989 18645 gene locus_tag LOCUS_09680 18989 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 19325 19065 gene locus_tag LOCUS_09690 19325 19065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 19626 19414 gene locus_tag LOCUS_09700 19626 19414 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533400.1 protein_id gnl|my_center|LOCUS_09700 21097 19745 gene locus_tag LOCUS_09710 21097 19745 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230806.1 protein_id gnl|my_center|LOCUS_09710 21862 21110 gene locus_tag LOCUS_09720 21862 21110 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455898.1 protein_id gnl|my_center|LOCUS_09720 23310 21904 gene locus_tag LOCUS_09730 gene dnaB 23310 21904 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_09730 23949 23497 gene locus_tag LOCUS_09740 gene rplI 23949 23497 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391680.1 protein_id gnl|my_center|LOCUS_09740 24280 23957 gene locus_tag LOCUS_09750 24280 23957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 24784 24320 gene locus_tag LOCUS_09760 gene ssb 24784 24320 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391677.1 protein_id gnl|my_center|LOCUS_09760 25566 24895 gene locus_tag LOCUS_09770 25566 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 25990 25622 gene locus_tag LOCUS_09780 25990 25622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 27530 26073 gene locus_tag LOCUS_09790 27530 26073 CDS product glycosyltransferase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877359.1 protein_id gnl|my_center|LOCUS_09790 28834 27533 gene locus_tag LOCUS_09800 28834 27533 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083215.1 protein_id gnl|my_center|LOCUS_09800 28932 30833 gene locus_tag LOCUS_09810 28932 30833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 30864 31772 gene locus_tag LOCUS_09820 30864 31772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 32649 31687 gene locus_tag LOCUS_09830 gene thiL 32649 31687 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_09830 32530 32808 gene locus_tag LOCUS_09840 32530 32808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 33085 32867 gene locus_tag LOCUS_09850 gene infA 33085 32867 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215452.1 protein_id gnl|my_center|LOCUS_09850 <33958 33161 gene locus_tag LOCUS_09860 <33958 33161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038661.1:PBP1A family penicillin-binding protein >Feature sequence022 762 1880 gene locus_tag LOCUS_09870 762 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 2337 1912 gene locus_tag LOCUS_09880 2337 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 3020 2367 gene locus_tag LOCUS_09890 3020 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 4846 3035 gene locus_tag LOCUS_09900 4846 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 5207 6373 gene locus_tag LOCUS_09910 5207 6373 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393538.1 protein_id gnl|my_center|LOCUS_09910 6440 8446 gene locus_tag LOCUS_09920 6440 8446 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763166.1 protein_id gnl|my_center|LOCUS_09920 9731 8508 gene locus_tag LOCUS_09930 9731 8508 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_09930 11059 9920 gene locus_tag LOCUS_09940 11059 9920 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846877.1 protein_id gnl|my_center|LOCUS_09940 11161 13575 gene locus_tag LOCUS_09950 11161 13575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 14527 13565 gene locus_tag LOCUS_09960 14527 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 14632 15093 gene locus_tag LOCUS_09970 14632 15093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 15854 15147 gene locus_tag LOCUS_09980 15854 15147 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173486.1 protein_id gnl|my_center|LOCUS_09980 16100 17287 gene locus_tag LOCUS_09990 16100 17287 CDS product adenylate cyclase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730263.1 protein_id gnl|my_center|LOCUS_09990 17308 18429 gene locus_tag LOCUS_10000 17308 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 18413 19027 gene locus_tag LOCUS_10010 gene hpt 18413 19027 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804893.1 protein_id gnl|my_center|LOCUS_10010 19094 21175 gene locus_tag LOCUS_10020 gene ftsH 19094 21175 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_10020 21271 22128 gene locus_tag LOCUS_10030 gene folP 21271 22128 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227766.1 protein_id gnl|my_center|LOCUS_10030 22116 22688 gene locus_tag LOCUS_10040 22116 22688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 22863 23426 gene locus_tag LOCUS_10050 gene folK 22863 23426 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_10050 23613 26051 gene locus_tag LOCUS_10060 23613 26051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 26059 26823 gene locus_tag LOCUS_10070 26059 26823 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_10070 26820 27893 gene locus_tag LOCUS_10080 gene dusB 26820 27893 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_10080 28021 28548 gene locus_tag LOCUS_10090 gene greA 28021 28548 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_10090 28579 30111 gene locus_tag LOCUS_10100 gene lysS 28579 30111 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_10100 30201 32816 gene locus_tag LOCUS_10110 30201 32816 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_10110 32924 33406 gene locus_tag LOCUS_10120 32924 33406 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence023 1197 70 gene locus_tag LOCUS_10130 1197 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 2364 1213 gene locus_tag LOCUS_10140 2364 1213 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_10140 3233 2487 gene locus_tag LOCUS_10150 3233 2487 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244373.1 protein_id gnl|my_center|LOCUS_10150 4868 3258 gene locus_tag LOCUS_10160 4868 3258 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_10160 5276 6091 gene locus_tag LOCUS_10170 gene paaG 5276 6091 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705609.1 protein_id gnl|my_center|LOCUS_10170 6201 6506 gene locus_tag LOCUS_10180 6201 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 6439 7572 gene locus_tag LOCUS_10190 6439 7572 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031490.1 protein_id gnl|my_center|LOCUS_10190 7606 8526 gene locus_tag LOCUS_10200 7606 8526 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941427.1 protein_id gnl|my_center|LOCUS_10200 8530 9459 gene locus_tag LOCUS_10210 8530 9459 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888751.1 protein_id gnl|my_center|LOCUS_10210 9462 10277 gene locus_tag LOCUS_10220 9462 10277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075839.1 protein_id gnl|my_center|LOCUS_10220 10330 11223 gene locus_tag LOCUS_10230 10330 11223 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040242.1 protein_id gnl|my_center|LOCUS_10230 11426 12268 gene locus_tag LOCUS_10240 11426 12268 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978819.1 protein_id gnl|my_center|LOCUS_10240 12271 13059 gene locus_tag LOCUS_10250 12271 13059 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402699.1 protein_id gnl|my_center|LOCUS_10250 13056 14756 gene locus_tag LOCUS_10260 13056 14756 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_10260 16436 14838 gene locus_tag LOCUS_10270 16436 14838 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877899.1 protein_id gnl|my_center|LOCUS_10270 17202 16405 gene locus_tag LOCUS_10280 17202 16405 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_10280 18083 17199 gene locus_tag LOCUS_10290 18083 17199 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223750.1 protein_id gnl|my_center|LOCUS_10290 19082 18291 gene locus_tag LOCUS_10300 gene fabG 19082 18291 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_10300 20029 19097 gene locus_tag LOCUS_10310 20029 19097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 21378 20026 gene locus_tag LOCUS_10320 21378 20026 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244067.1 protein_id gnl|my_center|LOCUS_10320 21518 21958 gene locus_tag LOCUS_10330 21518 21958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 21958 22371 gene locus_tag LOCUS_10340 21958 22371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 23915 22632 gene locus_tag LOCUS_10350 gene bioI 23915 22632 CDS product biotin biosynthesis cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398783.1 protein_id gnl|my_center|LOCUS_10350 25412 24066 gene locus_tag LOCUS_10360 25412 24066 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730081.1 protein_id gnl|my_center|LOCUS_10360 25587 25991 gene locus_tag LOCUS_10370 25587 25991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 26321 27271 gene locus_tag LOCUS_10380 26321 27271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383769.1 protein_id gnl|my_center|LOCUS_10380 27441 29000 gene locus_tag LOCUS_10390 27441 29000 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085462.1 protein_id gnl|my_center|LOCUS_10390 29059 30969 gene locus_tag LOCUS_10400 29059 30969 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_10400 30992 32263 gene locus_tag LOCUS_10410 30992 32263 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992331.1 protein_id gnl|my_center|LOCUS_10410 32315 33268 gene locus_tag LOCUS_10420 32315 33268 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189188.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence024 136 1077 gene locus_tag LOCUS_10430 136 1077 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_10430 1083 2435 gene locus_tag LOCUS_10440 gene ffh 1083 2435 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414748.1 protein_id gnl|my_center|LOCUS_10440 2487 2747 gene locus_tag LOCUS_10450 gene rpsP 2487 2747 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_10450 2764 3024 gene locus_tag LOCUS_10460 2764 3024 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_10460 3048 3563 gene locus_tag LOCUS_10470 gene rimM 3048 3563 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404374.1 protein_id gnl|my_center|LOCUS_10470 3565 4254 gene locus_tag LOCUS_10480 gene trmD 3565 4254 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_10480 4683 4300 gene locus_tag LOCUS_10490 4683 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 4648 5196 gene locus_tag LOCUS_10500 4648 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 5238 5834 gene locus_tag LOCUS_10510 gene lepB 5238 5834 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_10510 6088 6627 gene locus_tag LOCUS_10520 6088 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7251 6817 gene locus_tag LOCUS_10530 7251 6817 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_10530 7464 7961 gene locus_tag LOCUS_10540 7464 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 8003 8860 gene locus_tag LOCUS_10550 gene thiD 8003 8860 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061871.1 protein_id gnl|my_center|LOCUS_10550 8955 9215 gene locus_tag LOCUS_10560 8955 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 9221 9877 gene locus_tag LOCUS_10570 9221 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 9922 11598 gene locus_tag LOCUS_10580 gene ilvD 9922 11598 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258705.1 protein_id gnl|my_center|LOCUS_10580 12654 11659 gene locus_tag LOCUS_10590 12654 11659 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900558.1 protein_id gnl|my_center|LOCUS_10590 12905 13537 gene locus_tag LOCUS_10600 12905 13537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 13639 14574 gene locus_tag LOCUS_10610 13639 14574 CDS product site-specific tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994886.1 protein_id gnl|my_center|LOCUS_10610 14617 15378 gene locus_tag LOCUS_10620 gene whiG 14617 15378 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_10620 15440 17539 gene locus_tag LOCUS_10630 gene fusA 15440 17539 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546422.1 protein_id gnl|my_center|LOCUS_10630 17668 18867 gene locus_tag LOCUS_10640 17668 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 18926 19159 gene locus_tag LOCUS_10650 18926 19159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 19169 19576 gene locus_tag LOCUS_10660 19169 19576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10660 19849 21252 gene locus_tag LOCUS_10670 19849 21252 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776671.1 protein_id gnl|my_center|LOCUS_10670 21395 22288 gene locus_tag LOCUS_10680 21395 22288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 22431 23924 gene locus_tag LOCUS_10690 gene dhaS 22431 23924 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_10690 24027 24374 gene locus_tag LOCUS_10700 gene rsbV 24027 24374 CDS product anti sigma b factor antagonist RsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721460.1 protein_id gnl|my_center|LOCUS_10700 24632 25834 gene locus_tag LOCUS_10710 24632 25834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 25956 26615 gene locus_tag LOCUS_10720 25956 26615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 26615 26806 gene locus_tag LOCUS_10730 26615 26806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 26803 28386 gene locus_tag LOCUS_10740 26803 28386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 28438 30321 gene locus_tag LOCUS_10750 gene shc 28438 30321 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence025 269 979 gene locus_tag LOCUS_10760 gene mnoR 269 979 CDS product two-component system response regulator MnoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897657.1 protein_id gnl|my_center|LOCUS_10760 1043 2068 gene locus_tag LOCUS_10770 1043 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2412 2687 gene locus_tag LOCUS_10780 2412 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2684 3910 gene locus_tag LOCUS_10790 2684 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 4162 4323 gene locus_tag LOCUS_10800 4162 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 5578 5021 gene locus_tag LOCUS_10810 5578 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 5728 5591 gene locus_tag LOCUS_10820 5728 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 5700 7433 gene locus_tag LOCUS_10830 5700 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 8339 7623 gene locus_tag LOCUS_10840 8339 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 8752 10263 gene locus_tag LOCUS_10850 8752 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 10513 10974 gene locus_tag LOCUS_10860 gene pssD 10513 10974 CDS product PssD/Cps14F family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143701.1 protein_id gnl|my_center|LOCUS_10860 10971 11546 gene locus_tag LOCUS_10870 10971 11546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 11560 13824 gene locus_tag LOCUS_10880 11560 13824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 13923 14540 gene locus_tag LOCUS_10890 13923 14540 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525449.1 protein_id gnl|my_center|LOCUS_10890 16540 14627 gene locus_tag LOCUS_10900 16540 14627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 16421 16693 gene locus_tag LOCUS_10910 16421 16693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 16879 17739 gene locus_tag LOCUS_10920 16879 17739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 17839 19344 gene locus_tag LOCUS_10930 17839 19344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 19351 20439 gene locus_tag LOCUS_10940 19351 20439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 21357 20458 gene locus_tag LOCUS_10950 21357 20458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 23192 21354 gene locus_tag LOCUS_10960 gene asnB 23192 21354 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387983.1 protein_id gnl|my_center|LOCUS_10960 23638 24897 gene locus_tag LOCUS_10970 23638 24897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 24991 25923 gene locus_tag LOCUS_10980 24991 25923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 27007 26036 gene locus_tag LOCUS_10990 27007 26036 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_10990 28410 27106 gene locus_tag LOCUS_11000 28410 27106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 29811 28693 gene locus_tag LOCUS_11010 29811 28693 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence026 409 197 gene locus_tag LOCUS_11020 409 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 989 1237 gene locus_tag LOCUS_11030 989 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1250 1600 gene locus_tag LOCUS_11040 1250 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1819 2250 gene locus_tag LOCUS_11050 1819 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2310 2906 gene locus_tag LOCUS_11060 2310 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2949 4625 gene locus_tag LOCUS_11070 gene ilvB 2949 4625 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880257.1 protein_id gnl|my_center|LOCUS_11070 4629 5186 gene locus_tag LOCUS_11080 gene ilvN 4629 5186 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_11080 5294 6769 gene locus_tag LOCUS_11090 5294 6769 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_11090 8671 6830 gene locus_tag LOCUS_11100 gene menD 8671 6830 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_11100 8749 9513 gene locus_tag LOCUS_11110 gene menH 8749 9513 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_11110 10720 9617 gene locus_tag LOCUS_11120 10720 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 11675 10749 gene locus_tag LOCUS_11130 11675 10749 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_11130 12608 11751 gene locus_tag LOCUS_11140 gene menB 12608 11751 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640013.1 protein_id gnl|my_center|LOCUS_11140 12851 12615 gene locus_tag LOCUS_11150 12851 12615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 12754 14139 gene locus_tag LOCUS_11160 12754 14139 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449576.1 protein_id gnl|my_center|LOCUS_11160 14375 15322 gene locus_tag LOCUS_11170 14375 15322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 15331 16920 gene locus_tag LOCUS_11180 15331 16920 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878348.1 protein_id gnl|my_center|LOCUS_11180 16917 18074 gene locus_tag LOCUS_11190 16917 18074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 18103 19137 gene locus_tag LOCUS_11200 18103 19137 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975986.1 protein_id gnl|my_center|LOCUS_11200 21139 19166 gene locus_tag LOCUS_11210 21139 19166 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523137.1 protein_id gnl|my_center|LOCUS_11210 21906 21136 gene locus_tag LOCUS_11220 21906 21136 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018238032.1 protein_id gnl|my_center|LOCUS_11220 22151 23197 gene locus_tag LOCUS_11230 gene ilvC 22151 23197 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_11230 23474 24718 gene locus_tag LOCUS_11240 gene serC 23474 24718 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404623.1 protein_id gnl|my_center|LOCUS_11240 24715 26418 gene locus_tag LOCUS_11250 gene serA 24715 26418 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_11250 26692 28266 gene locus_tag LOCUS_11260 26692 28266 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_11260 28281 28937 gene locus_tag LOCUS_11270 28281 28937 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808172.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence027 400 2088 gene locus_tag LOCUS_11280 400 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2761 2219 gene locus_tag LOCUS_11290 2761 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2903 3535 gene locus_tag LOCUS_11300 gene purN 2903 3535 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 protein_id gnl|my_center|LOCUS_11300 3667 5364 gene locus_tag LOCUS_11310 gene purH 3667 5364 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901950.1 protein_id gnl|my_center|LOCUS_11310 6211 5261 gene locus_tag LOCUS_11320 6211 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 6837 6223 gene locus_tag LOCUS_11330 6837 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 9533 6933 gene locus_tag LOCUS_11340 9533 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 10583 9537 gene locus_tag LOCUS_11350 10583 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 11287 10583 gene locus_tag LOCUS_11360 11287 10583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11360 11844 11284 gene locus_tag LOCUS_11370 11844 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 12073 13518 gene locus_tag LOCUS_11380 12073 13518 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222347.1 protein_id gnl|my_center|LOCUS_11380 14650 13550 gene locus_tag LOCUS_11390 14650 13550 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484633.1 protein_id gnl|my_center|LOCUS_11390 14970 14647 gene locus_tag LOCUS_11400 14970 14647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 15479 16018 gene locus_tag LOCUS_11410 15479 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 16305 16505 gene locus_tag LOCUS_11420 16305 16505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 16523 16753 gene locus_tag LOCUS_11430 16523 16753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 16763 17185 gene locus_tag LOCUS_11440 16763 17185 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_11440 17598 18554 gene locus_tag LOCUS_11450 17598 18554 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284372.1 protein_id gnl|my_center|LOCUS_11450 18753 19184 gene locus_tag LOCUS_11460 18753 19184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 19772 19473 gene locus_tag LOCUS_11470 19772 19473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 20294 19887 gene locus_tag LOCUS_11480 20294 19887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 20816 20397 gene locus_tag LOCUS_11490 20816 20397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 20739 21275 gene locus_tag LOCUS_11500 20739 21275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 21421 22020 gene locus_tag LOCUS_11510 21421 22020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 22140 24557 gene locus_tag LOCUS_11520 22140 24557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence028 291 364 gene locus_tag LOCUS_t00110 291 364 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 670 398 gene locus_tag LOCUS_11530 670 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 680 1144 gene locus_tag LOCUS_11540 680 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1119 1322 gene locus_tag LOCUS_11550 1119 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1323 1694 gene locus_tag LOCUS_11560 1323 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1953 2327 gene locus_tag LOCUS_11570 1953 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2336 2938 gene locus_tag LOCUS_11580 2336 2938 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775967.1 protein_id gnl|my_center|LOCUS_11580 3437 2955 gene locus_tag LOCUS_11590 3437 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 3691 3452 gene locus_tag LOCUS_11600 3691 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4172 3966 gene locus_tag LOCUS_11610 4172 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 4089 4385 gene locus_tag LOCUS_11620 4089 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 4483 4812 gene locus_tag LOCUS_11630 4483 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 5254 4718 gene locus_tag LOCUS_11640 5254 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 5381 5632 gene locus_tag LOCUS_11650 5381 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5877 6173 gene locus_tag LOCUS_11660 5877 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 6912 6190 gene locus_tag LOCUS_11670 6912 6190 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 protein_id gnl|my_center|LOCUS_11670 7673 7122 gene locus_tag LOCUS_11680 7673 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 7802 8098 gene locus_tag LOCUS_11690 7802 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 8108 8548 gene locus_tag LOCUS_11700 8108 8548 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963099.1 protein_id gnl|my_center|LOCUS_11700 8632 9993 gene locus_tag LOCUS_11710 8632 9993 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_11710 10722 11660 gene locus_tag LOCUS_11720 10722 11660 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532737.1 protein_id gnl|my_center|LOCUS_11720 11746 13992 gene locus_tag LOCUS_11730 11746 13992 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729900.1 protein_id gnl|my_center|LOCUS_11730 14780 14007 gene locus_tag LOCUS_11740 14780 14007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 15274 14810 gene locus_tag LOCUS_11750 15274 14810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11750 16763 15276 gene locus_tag LOCUS_11760 16763 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11760 17464 17255 gene locus_tag LOCUS_11770 17464 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 18914 17469 gene locus_tag LOCUS_11780 18914 17469 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_11780 19087 19434 gene locus_tag LOCUS_11790 19087 19434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 19470 21671 gene locus_tag LOCUS_11800 19470 21671 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775729.1 protein_id gnl|my_center|LOCUS_11800 24231 22045 gene locus_tag LOCUS_11810 24231 22045 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_11810 24304 24627 gene locus_tag LOCUS_11820 24304 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 24673 25932 gene locus_tag LOCUS_11830 24673 25932 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_11830 26783 26040 gene locus_tag LOCUS_11840 26783 26040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 28001 26829 gene locus_tag LOCUS_11850 gene bioF 28001 26829 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_11850 28032 28343 gene locus_tag LOCUS_11860 28032 28343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence029 1341 1066 gene locus_tag LOCUS_11870 1341 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021475.1 protein_id gnl|my_center|LOCUS_11870 2150 1338 gene locus_tag LOCUS_11880 2150 1338 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_11880 3074 2241 gene locus_tag LOCUS_11890 3074 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 3352 4587 gene locus_tag LOCUS_11900 3352 4587 CDS product cell wall-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948956.1 protein_id gnl|my_center|LOCUS_11900 5341 4712 gene locus_tag LOCUS_11910 5341 4712 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883398.1 protein_id gnl|my_center|LOCUS_11910 5680 5952 gene locus_tag LOCUS_11920 5680 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 6661 6101 gene locus_tag LOCUS_11930 6661 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 6814 8229 gene locus_tag LOCUS_11940 gene xseA 6814 8229 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110032.1 protein_id gnl|my_center|LOCUS_11940 8580 8804 gene locus_tag LOCUS_11950 8580 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 8824 9876 gene locus_tag LOCUS_11960 8824 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 10328 11824 gene locus_tag LOCUS_11970 10328 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 13162 11990 gene locus_tag LOCUS_11980 13162 11990 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085491.1 protein_id gnl|my_center|LOCUS_11980 13292 14212 gene locus_tag LOCUS_11990 13292 14212 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_11990 15895 14573 gene locus_tag LOCUS_12000 15895 14573 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_12000 16277 15999 gene locus_tag LOCUS_12010 16277 15999 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074197.1 protein_id gnl|my_center|LOCUS_12010 16345 17235 gene locus_tag LOCUS_12020 16345 17235 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_12020 17976 17239 gene locus_tag LOCUS_12030 17976 17239 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 protein_id gnl|my_center|LOCUS_12030 18557 18114 gene locus_tag LOCUS_12040 18557 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 19144 18554 gene locus_tag LOCUS_12050 19144 18554 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814921.1 protein_id gnl|my_center|LOCUS_12050 19859 19155 gene locus_tag LOCUS_12060 19859 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 20220 20293 gene locus_tag LOCUS_t00120 20220 20293 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 21119 21835 gene locus_tag LOCUS_12070 21119 21835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 22625 21828 gene locus_tag LOCUS_12080 22625 21828 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_12080 22806 23747 gene locus_tag LOCUS_12090 22806 23747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228283.1 protein_id gnl|my_center|LOCUS_12090 23761 24612 gene locus_tag LOCUS_12100 23761 24612 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144635466.1 protein_id gnl|my_center|LOCUS_12100 25359 24715 gene locus_tag LOCUS_12110 25359 24715 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_12110 26247 25543 gene locus_tag LOCUS_12120 gene rlmB 26247 25543 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887393.1 protein_id gnl|my_center|LOCUS_12120 27802 26375 gene locus_tag LOCUS_12130 gene cysS 27802 26375 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869759.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence030 574 1380 gene locus_tag LOCUS_12140 574 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1974 1516 gene locus_tag LOCUS_12150 1974 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 2399 1971 gene locus_tag LOCUS_12160 gene rsbW 2399 1971 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970576.1 protein_id gnl|my_center|LOCUS_12160 2850 7547 gene locus_tag LOCUS_12170 2850 7547 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350708.1 protein_id gnl|my_center|LOCUS_12170 7564 9060 gene locus_tag LOCUS_12180 7564 9060 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899732.1 protein_id gnl|my_center|LOCUS_12180 10981 9086 gene locus_tag LOCUS_12190 10981 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 11371 12396 gene locus_tag LOCUS_12200 11371 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 12591 13052 gene locus_tag LOCUS_12210 12591 13052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 13084 13431 gene locus_tag LOCUS_12220 13084 13431 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081479.1 protein_id gnl|my_center|LOCUS_12220 13661 14482 gene locus_tag LOCUS_12230 13661 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 16085 14607 gene locus_tag LOCUS_12240 16085 14607 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_12240 16293 17309 gene locus_tag LOCUS_12250 16293 17309 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467730.1 protein_id gnl|my_center|LOCUS_12250 17326 18492 gene locus_tag LOCUS_12260 17326 18492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 19390 18593 gene locus_tag LOCUS_12270 19390 18593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 19503 20684 gene locus_tag LOCUS_12280 gene moeB 19503 20684 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_12280 20831 21109 gene locus_tag LOCUS_12290 20831 21109 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559268.1 protein_id gnl|my_center|LOCUS_12290 22733 21075 gene locus_tag LOCUS_12300 22733 21075 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907703.1 protein_id gnl|my_center|LOCUS_12300 22869 23837 gene locus_tag LOCUS_12310 22869 23837 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_12310 23882 24304 gene locus_tag LOCUS_12320 gene mec 23882 24304 CDS product CysO-cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898830.1 protein_id gnl|my_center|LOCUS_12320 24320 24823 gene locus_tag LOCUS_12330 24320 24823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 25584 24952 gene locus_tag LOCUS_12340 25584 24952 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_12340 <27257 25775 gene locus_tag LOCUS_12350 <27257 25775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141226.1:hydantoinase B/oxoprolinase family protein >Feature sequence031 1040 747 gene locus_tag LOCUS_12360 1040 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1039 1239 gene locus_tag LOCUS_12370 1039 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 2263 1292 gene locus_tag LOCUS_12380 2263 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2652 2924 gene locus_tag LOCUS_12390 2652 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2989 3948 gene locus_tag LOCUS_12400 2989 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 4052 4531 gene locus_tag LOCUS_12410 4052 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 4742 4545 gene locus_tag LOCUS_12420 4742 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 5603 8224 gene locus_tag LOCUS_12430 5603 8224 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 protein_id gnl|my_center|LOCUS_12430 8368 8625 gene locus_tag LOCUS_12440 8368 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 8622 9044 gene locus_tag LOCUS_12450 8622 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 9065 9694 gene locus_tag LOCUS_12460 9065 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 10419 9868 gene locus_tag LOCUS_12470 10419 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 10749 11072 gene locus_tag LOCUS_12480 10749 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 12422 11274 gene locus_tag LOCUS_12490 12422 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 13093 12692 gene locus_tag LOCUS_12500 13093 12692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 13671 13090 gene locus_tag LOCUS_12510 13671 13090 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229780.1 protein_id gnl|my_center|LOCUS_12510 13956 13744 gene locus_tag LOCUS_12520 13956 13744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 15312 14269 gene locus_tag LOCUS_12530 15312 14269 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_12530 16544 15489 gene locus_tag LOCUS_12540 16544 15489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 16875 17174 gene locus_tag LOCUS_12550 16875 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 17746 17673 gene locus_tag LOCUS_t00130 17746 17673 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17879 18439 gene locus_tag LOCUS_12560 17879 18439 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228871.1 protein_id gnl|my_center|LOCUS_12560 18553 19023 gene locus_tag LOCUS_12570 18553 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 20803 19067 gene locus_tag LOCUS_12580 gene argS 20803 19067 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723609.1 protein_id gnl|my_center|LOCUS_12580 21424 20906 gene locus_tag LOCUS_12590 gene rlmH 21424 20906 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 protein_id gnl|my_center|LOCUS_12590 21390 21713 gene locus_tag LOCUS_12600 21390 21713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 21780 22511 gene locus_tag LOCUS_12610 21780 22511 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_12610 22520 23137 gene locus_tag LOCUS_12620 22520 23137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 23134 24321 gene locus_tag LOCUS_12630 23134 24321 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877981.1 protein_id gnl|my_center|LOCUS_12630 25520 24258 gene locus_tag LOCUS_12640 gene tgt 25520 24258 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259563.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence032 648 31 gene locus_tag LOCUS_12650 648 31 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_12650 967 1728 gene locus_tag LOCUS_12660 gene phoU 967 1728 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193271.1 protein_id gnl|my_center|LOCUS_12660 1874 2869 gene locus_tag LOCUS_12670 1874 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3283 2783 gene locus_tag LOCUS_12680 gene sixA 3283 2783 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141750.1 protein_id gnl|my_center|LOCUS_12680 3438 5756 gene locus_tag LOCUS_12690 gene ppk1 3438 5756 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141500.1 protein_id gnl|my_center|LOCUS_12690 6127 7539 gene locus_tag LOCUS_12700 6127 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 7586 8131 gene locus_tag LOCUS_12710 7586 8131 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231038.1 protein_id gnl|my_center|LOCUS_12710 8748 8245 gene locus_tag LOCUS_12720 8748 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 9602 8745 gene locus_tag LOCUS_12730 9602 8745 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068242.1 protein_id gnl|my_center|LOCUS_12730 10642 9608 gene locus_tag LOCUS_12740 10642 9608 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200770.1 protein_id gnl|my_center|LOCUS_12740 11904 10639 gene locus_tag LOCUS_12750 11904 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 12860 11904 gene locus_tag LOCUS_12760 12860 11904 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526233.1 protein_id gnl|my_center|LOCUS_12760 12942 14246 gene locus_tag LOCUS_12770 12942 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 14508 15875 gene locus_tag LOCUS_12780 14508 15875 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021944.1 protein_id gnl|my_center|LOCUS_12780 16097 15927 gene locus_tag LOCUS_12790 16097 15927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 16867 16097 gene locus_tag LOCUS_12800 16867 16097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 17691 16864 gene locus_tag LOCUS_12810 17691 16864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_12810 18703 17681 gene locus_tag LOCUS_12820 18703 17681 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225886.1 protein_id gnl|my_center|LOCUS_12820 18765 19202 gene locus_tag LOCUS_12830 18765 19202 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229549.1 protein_id gnl|my_center|LOCUS_12830 21181 19232 gene locus_tag LOCUS_12840 gene typA 21181 19232 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_12840 22823 21354 gene locus_tag LOCUS_12850 gene hpnO 22823 21354 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_12850 23131 22904 gene locus_tag LOCUS_12860 23131 22904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 23488 24732 gene locus_tag LOCUS_12870 23488 24732 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 protein_id gnl|my_center|LOCUS_12870 26054 24873 gene locus_tag LOCUS_12880 26054 24873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence033 1272 496 gene locus_tag LOCUS_12890 1272 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2408 1413 gene locus_tag LOCUS_12900 2408 1413 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_12900 3340 2408 gene locus_tag LOCUS_12910 3340 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 5166 3505 gene locus_tag LOCUS_12920 5166 3505 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776685.1 protein_id gnl|my_center|LOCUS_12920 5414 6211 gene locus_tag LOCUS_12930 5414 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6208 6540 gene locus_tag LOCUS_12940 6208 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 6755 7585 gene locus_tag LOCUS_12950 6755 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 7582 8058 gene locus_tag LOCUS_12960 7582 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 8805 8494 gene locus_tag LOCUS_12970 8805 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 9650 8958 gene locus_tag LOCUS_12980 9650 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 10315 9665 gene locus_tag LOCUS_12990 10315 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 11216 10365 gene locus_tag LOCUS_13000 11216 10365 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223631.1 protein_id gnl|my_center|LOCUS_13000 12631 11213 gene locus_tag LOCUS_13010 12631 11213 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223633.1 protein_id gnl|my_center|LOCUS_13010 12807 13712 gene locus_tag LOCUS_13020 12807 13712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 13726 16056 gene locus_tag LOCUS_13030 gene tkt 13726 16056 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_13030 16087 17202 gene locus_tag LOCUS_13040 gene tal 16087 17202 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111302.1 protein_id gnl|my_center|LOCUS_13040 17205 18449 gene locus_tag LOCUS_13050 17205 18449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 19718 18465 gene locus_tag LOCUS_13060 19718 18465 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462348.1 protein_id gnl|my_center|LOCUS_13060 21009 19792 gene locus_tag LOCUS_13070 21009 19792 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_13070 22068 21127 gene locus_tag LOCUS_13080 gene lipA 22068 21127 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707035.1 protein_id gnl|my_center|LOCUS_13080 22778 22065 gene locus_tag LOCUS_13090 gene lipB 22778 22065 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_13090 23144 22893 gene locus_tag LOCUS_13100 23144 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 23697 23131 gene locus_tag LOCUS_13110 23697 23131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence034 2352 481 gene locus_tag LOCUS_13120 2352 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 6058 2366 gene locus_tag LOCUS_13130 6058 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 8550 6055 gene locus_tag LOCUS_13140 8550 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 8867 8622 gene locus_tag LOCUS_13150 8867 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 8772 9197 gene locus_tag LOCUS_13160 8772 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 11481 9274 gene locus_tag LOCUS_13170 11481 9274 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207707612.1 protein_id gnl|my_center|LOCUS_13170 12654 11533 gene locus_tag LOCUS_13180 12654 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 13812 12859 gene locus_tag LOCUS_13190 13812 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 15347 13809 gene locus_tag LOCUS_13200 gene ltrA 15347 13809 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145832239.1 protein_id gnl|my_center|LOCUS_13200 16117 15347 gene locus_tag LOCUS_13210 16117 15347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 17174 17100 gene locus_tag LOCUS_t00140 17174 17100 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 17944 17417 gene locus_tag LOCUS_13220 17944 17417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 18112 17948 gene locus_tag LOCUS_13230 18112 17948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 18408 18761 gene locus_tag LOCUS_13240 18408 18761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 20080 18869 gene locus_tag LOCUS_13250 20080 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 20292 20690 gene locus_tag LOCUS_13260 20292 20690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13260 20808 20734 gene locus_tag LOCUS_t00150 20808 20734 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21282 22145 gene locus_tag LOCUS_13270 21282 22145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 22309 22803 gene locus_tag LOCUS_13280 22309 22803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence035 4539 3346 gene locus_tag LOCUS_13290 4539 3346 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742100.1 protein_id gnl|my_center|LOCUS_13290 6385 4529 gene locus_tag LOCUS_13300 gene asnB 6385 4529 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387983.1 protein_id gnl|my_center|LOCUS_13300 6581 7378 gene locus_tag LOCUS_13310 6581 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 7487 7762 gene locus_tag LOCUS_13320 7487 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 7769 8179 gene locus_tag LOCUS_13330 7769 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 9831 8320 gene locus_tag LOCUS_13340 9831 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 11170 9980 gene locus_tag LOCUS_13350 11170 9980 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_13350 12291 11167 gene locus_tag LOCUS_13360 12291 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 13625 12276 gene locus_tag LOCUS_13370 13625 12276 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926050.1 protein_id gnl|my_center|LOCUS_13370 14332 13808 gene locus_tag LOCUS_13380 14332 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 14873 14334 gene locus_tag LOCUS_13390 14873 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 16422 14941 gene locus_tag LOCUS_13400 16422 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065354.1 protein_id gnl|my_center|LOCUS_13400 19253 16419 gene locus_tag LOCUS_13410 19253 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 19922 19281 gene locus_tag LOCUS_13420 19922 19281 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902583.1 protein_id gnl|my_center|LOCUS_13420 21082 19967 gene locus_tag LOCUS_13430 gene narH 21082 19967 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487116.1 protein_id gnl|my_center|LOCUS_13430 21891 21082 gene locus_tag LOCUS_13440 21891 21082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 22442 21888 gene locus_tag LOCUS_13450 22442 21888 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230936.1 protein_id gnl|my_center|LOCUS_13450 <23451 22439 gene locus_tag LOCUS_13460 <23451 22439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101443.1:nitrate reductase subunit alpha >Feature sequence036 62 1462 gene locus_tag LOCUS_13470 62 1462 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229362.1 protein_id gnl|my_center|LOCUS_13470 1623 3533 gene locus_tag LOCUS_13480 gene dnaK 1623 3533 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_13480 3549 4322 gene locus_tag LOCUS_13490 gene grpE 3549 4322 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055523.1 protein_id gnl|my_center|LOCUS_13490 4332 5549 gene locus_tag LOCUS_13500 gene dnaJ 4332 5549 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_13500 5546 6205 gene locus_tag LOCUS_13510 5546 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6195 9011 gene locus_tag LOCUS_13520 gene clpB 6195 9011 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_13520 9083 9811 gene locus_tag LOCUS_13530 9083 9811 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728678.1 protein_id gnl|my_center|LOCUS_13530 9845 10927 gene locus_tag LOCUS_13540 gene pdhA 9845 10927 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257841.1 protein_id gnl|my_center|LOCUS_13540 10924 11943 gene locus_tag LOCUS_13550 10924 11943 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_13550 11940 13211 gene locus_tag LOCUS_13560 11940 13211 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_13560 14734 13349 gene locus_tag LOCUS_13570 gene thiC 14734 13349 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141118.1 protein_id gnl|my_center|LOCUS_13570 15502 14987 gene locus_tag LOCUS_13580 gene purE 15502 14987 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_13580 16885 15620 gene locus_tag LOCUS_13590 gene purD 16885 15620 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_13590 17273 16992 gene locus_tag LOCUS_13600 17273 16992 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546546.1 protein_id gnl|my_center|LOCUS_13600 17340 17534 gene locus_tag LOCUS_13610 17340 17534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 17531 18856 gene locus_tag LOCUS_13620 gene purB 17531 18856 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_13620 18935 19846 gene locus_tag LOCUS_13630 18935 19846 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224066.1 protein_id gnl|my_center|LOCUS_13630 19991 20203 gene locus_tag LOCUS_13640 gene purS 19991 20203 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880575.1 protein_id gnl|my_center|LOCUS_13640 20228 20938 gene locus_tag LOCUS_13650 gene purQ 20228 20938 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228731.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence037 676 497 gene locus_tag LOCUS_13660 676 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 943 728 gene locus_tag LOCUS_13670 943 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1431 2363 gene locus_tag LOCUS_13680 1431 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2360 3871 gene locus_tag LOCUS_13690 2360 3871 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_13690 3874 4650 gene locus_tag LOCUS_13700 3874 4650 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809371.1 protein_id gnl|my_center|LOCUS_13700 4727 6208 gene locus_tag LOCUS_13710 4727 6208 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_13710 6236 7285 gene locus_tag LOCUS_13720 6236 7285 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964021.1 protein_id gnl|my_center|LOCUS_13720 7316 8878 gene locus_tag LOCUS_13730 7316 8878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902634.1 protein_id gnl|my_center|LOCUS_13730 8883 9974 gene locus_tag LOCUS_13740 8883 9974 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_13740 9958 10890 gene locus_tag LOCUS_13750 9958 10890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_13750 10928 11779 gene locus_tag LOCUS_13760 10928 11779 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_13760 11776 12744 gene locus_tag LOCUS_13770 11776 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 12741 13334 gene locus_tag LOCUS_13780 12741 13334 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808076.1 protein_id gnl|my_center|LOCUS_13780 13336 14502 gene locus_tag LOCUS_13790 13336 14502 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530301.1 protein_id gnl|my_center|LOCUS_13790 14499 15104 gene locus_tag LOCUS_13800 14499 15104 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495559.1 protein_id gnl|my_center|LOCUS_13800 15101 15832 gene locus_tag LOCUS_13810 15101 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 15952 16176 gene locus_tag LOCUS_13820 15952 16176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 16760 16434 gene locus_tag LOCUS_13830 16760 16434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 17243 17743 gene locus_tag LOCUS_13840 17243 17743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 17963 18922 gene locus_tag LOCUS_13850 17963 18922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 19151 20959 gene locus_tag LOCUS_13860 19151 20959 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 protein_id gnl|my_center|LOCUS_13860 20956 21963 gene locus_tag LOCUS_13870 20956 21963 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_13870 <23037 21974 gene locus_tag LOCUS_13880 <23037 21974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259342.1:deoxyribodipyrimidine photo-lyase >Feature sequence038 3 395 gene locus_tag LOCUS_13890 3 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1837 500 gene locus_tag LOCUS_13900 1837 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2918 2145 gene locus_tag LOCUS_13910 2918 2145 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 protein_id gnl|my_center|LOCUS_13910 3090 4094 gene locus_tag LOCUS_13920 3090 4094 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227738.1 protein_id gnl|my_center|LOCUS_13920 5257 4076 gene locus_tag LOCUS_13930 5257 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 5384 6478 gene locus_tag LOCUS_13940 5384 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 6480 7679 gene locus_tag LOCUS_13950 6480 7679 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973141.1 protein_id gnl|my_center|LOCUS_13950 7811 8578 gene locus_tag LOCUS_13960 7811 8578 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389197.1 protein_id gnl|my_center|LOCUS_13960 8663 9430 gene locus_tag LOCUS_13970 8663 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 10359 9460 gene locus_tag LOCUS_13980 10359 9460 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629595.1 protein_id gnl|my_center|LOCUS_13980 11164 10373 gene locus_tag LOCUS_13990 gene chbG 11164 10373 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212244.1 protein_id gnl|my_center|LOCUS_13990 12261 11161 gene locus_tag LOCUS_14000 12261 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 12506 13987 gene locus_tag LOCUS_14010 12506 13987 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_14010 14488 14276 gene locus_tag LOCUS_14020 14488 14276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 14628 16073 gene locus_tag LOCUS_14030 14628 16073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 17751 16168 gene locus_tag LOCUS_14040 17751 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 17871 19436 gene locus_tag LOCUS_14050 17871 19436 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068360.1 protein_id gnl|my_center|LOCUS_14050 20770 19457 gene locus_tag LOCUS_14060 20770 19457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 21864 20767 gene locus_tag LOCUS_14070 21864 20767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 21757 22023 gene locus_tag LOCUS_14080 21757 22023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence039 <1 1227 gene locus_tag LOCUS_14090 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727088.1:ABC transporter substrate-binding protein 1234 2280 gene locus_tag LOCUS_14100 1234 2280 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727087.1 protein_id gnl|my_center|LOCUS_14100 2277 3308 gene locus_tag LOCUS_14110 2277 3308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892061.1 protein_id gnl|my_center|LOCUS_14110 3305 5029 gene locus_tag LOCUS_14120 3305 5029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970425.1 protein_id gnl|my_center|LOCUS_14120 5203 6531 gene locus_tag LOCUS_14130 5203 6531 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_14130 6725 8329 gene locus_tag LOCUS_14140 gene ftsH 6725 8329 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_14140 8340 8867 gene locus_tag LOCUS_14150 gene mce 8340 8867 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059866.1 protein_id gnl|my_center|LOCUS_14150 8867 9079 gene locus_tag LOCUS_14160 8867 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 9096 9689 gene locus_tag LOCUS_14170 9096 9689 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974128.1 protein_id gnl|my_center|LOCUS_14170 9686 10771 gene locus_tag LOCUS_14180 gene ychF 9686 10771 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_14180 12095 10869 gene locus_tag LOCUS_14190 12095 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 12352 13818 gene locus_tag LOCUS_14200 12352 13818 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229619.1 protein_id gnl|my_center|LOCUS_14200 14372 14911 gene locus_tag LOCUS_14210 14372 14911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 16372 15449 gene locus_tag LOCUS_14220 16372 15449 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_14220 17295 16408 gene locus_tag LOCUS_14230 17295 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 17825 19285 gene locus_tag LOCUS_14240 17825 19285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 19359 20303 gene locus_tag LOCUS_14250 gene galE1 19359 20303 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419610.1 protein_id gnl|my_center|LOCUS_14250 20446 20518 gene locus_tag LOCUS_t00160 20446 20518 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 21039 21413 gene locus_tag LOCUS_14260 21039 21413 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_14260 21410 22294 gene locus_tag LOCUS_14270 21410 22294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence040 617 1417 gene locus_tag LOCUS_14280 617 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2442 2645 gene locus_tag LOCUS_14290 2442 2645 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488188.1 protein_id gnl|my_center|LOCUS_14290 2962 2762 gene locus_tag LOCUS_14300 2962 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 3149 4801 gene locus_tag LOCUS_14310 3149 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 5263 4898 gene locus_tag LOCUS_14320 5263 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 5407 6555 gene locus_tag LOCUS_14330 5407 6555 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_14330 6564 7214 gene locus_tag LOCUS_14340 6564 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 8413 7373 gene locus_tag LOCUS_14350 gene egtD 8413 7373 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 protein_id gnl|my_center|LOCUS_14350 9462 8410 gene locus_tag LOCUS_14360 9462 8410 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057240.1 protein_id gnl|my_center|LOCUS_14360 10460 9831 gene locus_tag LOCUS_14370 10460 9831 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067204.1 protein_id gnl|my_center|LOCUS_14370 11299 10457 gene locus_tag LOCUS_14380 11299 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 12678 11299 gene locus_tag LOCUS_14390 12678 11299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 14285 12678 gene locus_tag LOCUS_14400 gene zwf 14285 12678 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_14400 14679 15692 gene locus_tag LOCUS_14410 gene glpX 14679 15692 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084313.1 protein_id gnl|my_center|LOCUS_14410 16462 15860 gene locus_tag LOCUS_14420 16462 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 16613 17572 gene locus_tag LOCUS_14430 16613 17572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 18199 17624 gene locus_tag LOCUS_14440 18199 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 18714 18502 gene locus_tag LOCUS_14450 18714 18502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 19363 20466 gene locus_tag LOCUS_14460 gene rpoD 19363 20466 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_14460 20730 21905 gene locus_tag LOCUS_14470 20730 21905 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228908.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence041 <1 523 gene locus_tag LOCUS_14480 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228807.1:cobyric acid synthase 517 4425 gene locus_tag LOCUS_14490 gene cobN 517 4425 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228832.1 protein_id gnl|my_center|LOCUS_14490 4422 6572 gene locus_tag LOCUS_14500 4422 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 6569 7219 gene locus_tag LOCUS_14510 gene cobO 6569 7219 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228816.1 protein_id gnl|my_center|LOCUS_14510 7213 8925 gene locus_tag LOCUS_14520 7213 8925 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272612.1 protein_id gnl|my_center|LOCUS_14520 8932 10677 gene locus_tag LOCUS_14530 8932 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 10677 12014 gene locus_tag LOCUS_14540 10677 12014 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192813.1 protein_id gnl|my_center|LOCUS_14540 12098 12994 gene locus_tag LOCUS_14550 gene cobM 12098 12994 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086055.1 protein_id gnl|my_center|LOCUS_14550 13000 13812 gene locus_tag LOCUS_14560 gene cobF 13000 13812 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762606.1 protein_id gnl|my_center|LOCUS_14560 13809 14555 gene locus_tag LOCUS_14570 13809 14555 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228821.1 protein_id gnl|my_center|LOCUS_14570 16218 14527 gene locus_tag LOCUS_14580 16218 14527 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228824.1 protein_id gnl|my_center|LOCUS_14580 16892 16215 gene locus_tag LOCUS_14590 16892 16215 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_14590 17889 16906 gene locus_tag LOCUS_14600 gene cobG 17889 16906 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086496.1 protein_id gnl|my_center|LOCUS_14600 19108 17927 gene locus_tag LOCUS_14610 19108 17927 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414559.1 protein_id gnl|my_center|LOCUS_14610 20223 19342 gene locus_tag LOCUS_14620 20223 19342 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256276.1 protein_id gnl|my_center|LOCUS_14620 20558 20914 gene locus_tag LOCUS_14630 20558 20914 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_14630 21511 21083 gene locus_tag LOCUS_14640 21511 21083 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence042 <1 4865 gene locus_tag LOCUS_14650 <1 4865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206334115.1:type I polyketide synthase 5730 4924 gene locus_tag LOCUS_14660 gene lieB 5730 4924 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_14660 6710 5730 gene locus_tag LOCUS_14670 6710 5730 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_14670 7192 7911 gene locus_tag LOCUS_14680 7192 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 8041 9306 gene locus_tag LOCUS_14690 gene nuoD 8041 9306 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_14690 10580 9588 gene locus_tag LOCUS_14700 10580 9588 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086138.1 protein_id gnl|my_center|LOCUS_14700 11287 10577 gene locus_tag LOCUS_14710 11287 10577 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_14710 12141 11290 gene locus_tag LOCUS_14720 12141 11290 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_14720 12616 13872 gene locus_tag LOCUS_14730 12616 13872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 14297 14935 gene locus_tag LOCUS_14740 14297 14935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 15570 15076 gene locus_tag LOCUS_14750 15570 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 15900 16520 gene locus_tag LOCUS_14760 15900 16520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 16514 16828 gene locus_tag LOCUS_14770 16514 16828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 16825 17049 gene locus_tag LOCUS_14780 16825 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 17374 17084 gene locus_tag LOCUS_14790 17374 17084 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383070.1 protein_id gnl|my_center|LOCUS_14790 18026 17427 gene locus_tag LOCUS_14800 18026 17427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 18569 18117 gene locus_tag LOCUS_14810 18569 18117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14810 18762 18493 gene locus_tag LOCUS_14820 18762 18493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14820 19413 19775 gene locus_tag LOCUS_14830 19413 19775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 19663 21108 gene locus_tag LOCUS_14840 19663 21108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 21704 21135 gene locus_tag LOCUS_14850 21704 21135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence043 <1 1392 gene locus_tag LOCUS_14860 <1 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730149.1:FAD-dependent oxidoreductase 3406 1427 gene locus_tag LOCUS_14870 3406 1427 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064589.1 protein_id gnl|my_center|LOCUS_14870 4113 3403 gene locus_tag LOCUS_14880 4113 3403 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 protein_id gnl|my_center|LOCUS_14880 5223 4393 gene locus_tag LOCUS_14890 5223 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 6695 5310 gene locus_tag LOCUS_14900 6695 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 7688 6807 gene locus_tag LOCUS_14910 7688 6807 CDS product TIGR03854 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225293.1 protein_id gnl|my_center|LOCUS_14910 8101 8331 gene locus_tag LOCUS_14920 8101 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 8534 9607 gene locus_tag LOCUS_14930 8534 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 9632 10528 gene locus_tag LOCUS_14940 9632 10528 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_14940 11463 10663 gene locus_tag LOCUS_14950 11463 10663 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_14950 11949 12680 gene locus_tag LOCUS_14960 11949 12680 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_14960 14478 12715 gene locus_tag LOCUS_14970 14478 12715 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877899.1 protein_id gnl|my_center|LOCUS_14970 15203 14475 gene locus_tag LOCUS_14980 15203 14475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 15316 16803 gene locus_tag LOCUS_14990 15316 16803 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730149.1 protein_id gnl|my_center|LOCUS_14990 18093 16936 gene locus_tag LOCUS_15000 18093 16936 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228953.1 protein_id gnl|my_center|LOCUS_15000 18301 19083 gene locus_tag LOCUS_15010 gene fabG 18301 19083 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_15010 19096 20235 gene locus_tag LOCUS_15020 19096 20235 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225699.1 protein_id gnl|my_center|LOCUS_15020 21068 20256 gene locus_tag LOCUS_15030 21068 20256 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730130.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence044 416 928 gene locus_tag LOCUS_15040 416 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1040 1192 gene locus_tag LOCUS_15050 1040 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1462 2211 gene locus_tag LOCUS_15060 1462 2211 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730633.1 protein_id gnl|my_center|LOCUS_15060 2522 3394 gene locus_tag LOCUS_15070 2522 3394 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_15070 3473 4408 gene locus_tag LOCUS_15080 3473 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4489 6450 gene locus_tag LOCUS_15090 gene thrS 4489 6450 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_15090 6574 7311 gene locus_tag LOCUS_15100 6574 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 7320 7514 gene locus_tag LOCUS_15110 gene rpmI 7320 7514 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_15110 7514 7876 gene locus_tag LOCUS_15120 gene rplT 7514 7876 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559056.1 protein_id gnl|my_center|LOCUS_15120 8184 9143 gene locus_tag LOCUS_15130 8184 9143 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527709.1 protein_id gnl|my_center|LOCUS_15130 9188 10255 gene locus_tag LOCUS_15140 gene pheS 9188 10255 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_15140 10272 12773 gene locus_tag LOCUS_15150 gene pheT 10272 12773 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_15150 12766 13779 gene locus_tag LOCUS_15160 gene argC 12766 13779 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_15160 13776 15218 gene locus_tag LOCUS_15170 gene argJ 13776 15218 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938124.1 protein_id gnl|my_center|LOCUS_15170 15215 16063 gene locus_tag LOCUS_15180 gene argB 15215 16063 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_15180 16141 17298 gene locus_tag LOCUS_15190 16141 17298 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_15190 17504 18769 gene locus_tag LOCUS_15200 17504 18769 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028537.1 protein_id gnl|my_center|LOCUS_15200 18816 20606 gene locus_tag LOCUS_15210 18816 20606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence045 865 554 gene locus_tag LOCUS_15220 865 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1257 871 gene locus_tag LOCUS_15230 gene gloA 1257 871 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064979.1 protein_id gnl|my_center|LOCUS_15230 1417 2205 gene locus_tag LOCUS_15240 1417 2205 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881398.1 protein_id gnl|my_center|LOCUS_15240 2341 3744 gene locus_tag LOCUS_15250 2341 3744 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081989.1 protein_id gnl|my_center|LOCUS_15250 5315 3909 gene locus_tag LOCUS_15260 gene pyk 5315 3909 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_15260 5462 5713 gene locus_tag LOCUS_15270 5462 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 6350 5772 gene locus_tag LOCUS_15280 6350 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 7633 6353 gene locus_tag LOCUS_15290 7633 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 7877 8794 gene locus_tag LOCUS_15300 gene metF 7877 8794 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_15300 8830 9435 gene locus_tag LOCUS_15310 8830 9435 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902031.1 protein_id gnl|my_center|LOCUS_15310 10797 9460 gene locus_tag LOCUS_15320 10797 9460 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_15320 11805 10861 gene locus_tag LOCUS_15330 11805 10861 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_15330 11906 11992 gene locus_tag LOCUS_t00170 11906 11992 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12059 13495 gene locus_tag LOCUS_15340 12059 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 15084 13675 gene locus_tag LOCUS_15350 15084 13675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 15445 15900 gene locus_tag LOCUS_15360 15445 15900 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_15360 16135 17706 gene locus_tag LOCUS_15370 16135 17706 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_15370 18339 17764 gene locus_tag LOCUS_15380 18339 17764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 19605 18496 gene locus_tag LOCUS_15390 19605 18496 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089593.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence046 1452 181 gene locus_tag LOCUS_15400 1452 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1672 3327 gene locus_tag LOCUS_15410 gene ettA 1672 3327 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_15410 3620 3303 gene locus_tag LOCUS_15420 3620 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3770 4534 gene locus_tag LOCUS_15430 3770 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 5893 4673 gene locus_tag LOCUS_15440 5893 4673 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257568.1 protein_id gnl|my_center|LOCUS_15440 8883 5890 gene locus_tag LOCUS_15450 gene acnA 8883 5890 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075957.1 protein_id gnl|my_center|LOCUS_15450 9897 8995 gene locus_tag LOCUS_15460 9897 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 9781 10245 gene locus_tag LOCUS_15470 9781 10245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 13285 10169 gene locus_tag LOCUS_15480 13285 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 13589 14161 gene locus_tag LOCUS_15490 13589 14161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 14656 14234 gene locus_tag LOCUS_15500 14656 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 14792 15751 gene locus_tag LOCUS_15510 14792 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 18516 15907 gene locus_tag LOCUS_15520 18516 15907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence047 76 786 gene locus_tag LOCUS_15530 76 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15530 1099 3012 gene locus_tag LOCUS_15540 1099 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3005 3316 gene locus_tag LOCUS_15550 3005 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3246 3749 gene locus_tag LOCUS_15560 3246 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 4056 3751 gene locus_tag LOCUS_15570 4056 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 4390 8316 gene locus_tag LOCUS_15580 4390 8316 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731067.1 protein_id gnl|my_center|LOCUS_15580 8329 8877 gene locus_tag LOCUS_15590 8329 8877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 8867 10546 gene locus_tag LOCUS_15600 8867 10546 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933376.1 protein_id gnl|my_center|LOCUS_15600 12630 10531 gene locus_tag LOCUS_15610 12630 10531 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963517.1 protein_id gnl|my_center|LOCUS_15610 13900 12647 gene locus_tag LOCUS_15620 13900 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 14068 14949 gene locus_tag LOCUS_15630 14068 14949 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530319.1 protein_id gnl|my_center|LOCUS_15630 15094 15978 gene locus_tag LOCUS_15640 gene pdxS 15094 15978 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_15640 15972 16661 gene locus_tag LOCUS_15650 gene pdxT 15972 16661 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_15650 16658 17104 gene locus_tag LOCUS_15660 16658 17104 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027656.1 protein_id gnl|my_center|LOCUS_15660 18252 17230 gene locus_tag LOCUS_15670 18252 17230 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398688.1 protein_id gnl|my_center|LOCUS_15670 19445 18249 gene locus_tag LOCUS_15680 19445 18249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence048 1 579 gene locus_tag LOCUS_15690 1 579 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977081.1 protein_id gnl|my_center|LOCUS_15690 647 1066 gene locus_tag LOCUS_15700 647 1066 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096834.1 protein_id gnl|my_center|LOCUS_15700 1229 1423 gene locus_tag LOCUS_15710 1229 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1420 2217 gene locus_tag LOCUS_15720 1420 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2214 3227 gene locus_tag LOCUS_15730 2214 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3411 4109 gene locus_tag LOCUS_15740 3411 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 5000 4131 gene locus_tag LOCUS_15750 5000 4131 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_15750 5773 4991 gene locus_tag LOCUS_15760 5773 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 5927 6412 gene locus_tag LOCUS_15770 5927 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 6409 6945 gene locus_tag LOCUS_15780 6409 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 6952 7770 gene locus_tag LOCUS_15790 6952 7770 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112839.1 protein_id gnl|my_center|LOCUS_15790 7887 8858 gene locus_tag LOCUS_15800 7887 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 10723 8855 gene locus_tag LOCUS_15810 10723 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 11274 10837 gene locus_tag LOCUS_15820 11274 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 12693 11281 gene locus_tag LOCUS_15830 12693 11281 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029761399.1 protein_id gnl|my_center|LOCUS_15830 13440 12916 gene locus_tag LOCUS_15840 13440 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 13852 15147 gene locus_tag LOCUS_15850 13852 15147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 15167 15307 gene locus_tag LOCUS_15860 15167 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 15298 16398 gene locus_tag LOCUS_15870 gene adhA 15298 16398 CDS product formaldehyde dehydrogenase AdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229837.1 protein_id gnl|my_center|LOCUS_15870 16391 17116 gene locus_tag LOCUS_15880 16391 17116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 17577 18383 gene locus_tag LOCUS_15890 17577 18383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence049 796 362 gene locus_tag LOCUS_15900 796 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 680 1294 gene locus_tag LOCUS_15910 680 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2794 1772 gene locus_tag LOCUS_15920 2794 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3137 5473 gene locus_tag LOCUS_15930 gene lon 3137 5473 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222513.1 protein_id gnl|my_center|LOCUS_15930 5490 5780 gene locus_tag LOCUS_15940 5490 5780 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898310.1 protein_id gnl|my_center|LOCUS_15940 6868 5756 gene locus_tag LOCUS_15950 6868 5756 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658369.1 protein_id gnl|my_center|LOCUS_15950 7385 6963 gene locus_tag LOCUS_15960 7385 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 8914 7448 gene locus_tag LOCUS_15970 8914 7448 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976304.1 protein_id gnl|my_center|LOCUS_15970 10663 9014 gene locus_tag LOCUS_15980 10663 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 11001 12578 gene locus_tag LOCUS_15990 11001 12578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 12860 14050 gene locus_tag LOCUS_16000 12860 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 14624 14818 gene locus_tag LOCUS_16010 14624 14818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 14834 15991 gene locus_tag LOCUS_16020 14834 15991 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_16020 16037 17215 gene locus_tag LOCUS_16030 16037 17215 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411116.1 protein_id gnl|my_center|LOCUS_16030 17299 19017 gene locus_tag LOCUS_16040 17299 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence050 1262 489 gene locus_tag LOCUS_16050 1262 489 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013866.1 protein_id gnl|my_center|LOCUS_16050 1622 1308 gene locus_tag LOCUS_16060 1622 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2688 1660 gene locus_tag LOCUS_16070 2688 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 3738 3292 gene locus_tag LOCUS_16080 3738 3292 CDS product lactoylglutathione lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119583.1 protein_id gnl|my_center|LOCUS_16080 4684 3878 gene locus_tag LOCUS_16090 4684 3878 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_16090 5580 4708 gene locus_tag LOCUS_16100 5580 4708 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 protein_id gnl|my_center|LOCUS_16100 6335 5577 gene locus_tag LOCUS_16110 6335 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 7661 6396 gene locus_tag LOCUS_16120 7661 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 8587 7772 gene locus_tag LOCUS_16130 8587 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 9877 8630 gene locus_tag LOCUS_16140 9877 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 10293 9922 gene locus_tag LOCUS_16150 10293 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 11170 10346 gene locus_tag LOCUS_16160 11170 10346 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228939.1 protein_id gnl|my_center|LOCUS_16160 11500 11261 gene locus_tag LOCUS_16170 11500 11261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 12483 11497 gene locus_tag LOCUS_16180 12483 11497 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_16180 13508 12501 gene locus_tag LOCUS_16190 gene acoA 13508 12501 CDS product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921304.1 protein_id gnl|my_center|LOCUS_16190 14323 13505 gene locus_tag LOCUS_16200 14323 13505 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227935.1 protein_id gnl|my_center|LOCUS_16200 15087 14320 gene locus_tag LOCUS_16210 15087 14320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075839.1 protein_id gnl|my_center|LOCUS_16210 16994 15084 gene locus_tag LOCUS_16220 16994 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16220 18392 17049 gene locus_tag LOCUS_16230 18392 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence051 1355 810 gene locus_tag LOCUS_16240 1355 810 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_16240 1431 1573 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgccgcgcccacaggcaggcg 1737 2855 gene locus_tag LOCUS_16250 1737 2855 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_16250 2955 4181 gene locus_tag LOCUS_16260 gene sucC 2955 4181 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228010.1 protein_id gnl|my_center|LOCUS_16260 4178 5116 gene locus_tag LOCUS_16270 gene sucD 4178 5116 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228009.1 protein_id gnl|my_center|LOCUS_16270 5470 5567 gene locus_tag LOCUS_t00180 5470 5567 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5532 7484 gene locus_tag LOCUS_16280 5532 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 7748 7557 gene locus_tag LOCUS_16290 7748 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 7841 8065 gene locus_tag LOCUS_16300 7841 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 8065 11253 gene locus_tag LOCUS_16310 8065 11253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 11250 12206 gene locus_tag LOCUS_16320 11250 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 12744 12370 gene locus_tag LOCUS_16330 12744 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 13963 12746 gene locus_tag LOCUS_16340 13963 12746 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222986.1 protein_id gnl|my_center|LOCUS_16340 14504 14094 gene locus_tag LOCUS_16350 14504 14094 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947724.1 protein_id gnl|my_center|LOCUS_16350 14572 16659 gene locus_tag LOCUS_16360 14572 16659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence052 560 336 gene locus_tag LOCUS_16370 560 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 496 1884 gene locus_tag LOCUS_16380 496 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2954 2055 gene locus_tag LOCUS_16390 2954 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3228 3143 gene locus_tag LOCUS_t00190 3228 3143 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3397 3894 gene locus_tag LOCUS_16400 3397 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3957 4039 gene locus_tag LOCUS_t00200 3957 4039 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5168 4176 gene locus_tag LOCUS_16410 5168 4176 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908081.1 protein_id gnl|my_center|LOCUS_16410 6598 5165 gene locus_tag LOCUS_16420 6598 5165 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 protein_id gnl|my_center|LOCUS_16420 6795 7574 gene locus_tag LOCUS_16430 6795 7574 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_16430 7769 8470 gene locus_tag LOCUS_16440 gene npdG 7769 8470 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_16440 8596 9480 gene locus_tag LOCUS_16450 gene cofD 8596 9480 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_16450 9492 10205 gene locus_tag LOCUS_16460 gene cofC 9492 10205 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893758.1 protein_id gnl|my_center|LOCUS_16460 10178 10981 gene locus_tag LOCUS_16470 gene cofE 10178 10981 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_16470 13249 10997 gene locus_tag LOCUS_16480 13249 10997 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121009479.1 protein_id gnl|my_center|LOCUS_16480 13350 14102 gene locus_tag LOCUS_16490 13350 14102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 14520 14155 gene locus_tag LOCUS_16500 14520 14155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 14806 14543 gene locus_tag LOCUS_16510 14806 14543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 14687 14920 gene locus_tag LOCUS_16520 14687 14920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 14982 15998 gene locus_tag LOCUS_16530 14982 15998 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_16530 16101 17426 gene locus_tag LOCUS_16540 gene ccrA 16101 17426 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390811.1 protein_id gnl|my_center|LOCUS_16540 17426 17812 gene locus_tag LOCUS_16550 17426 17812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence053 <1 612 gene locus_tag LOCUS_16560 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030295.1:citramalate synthase 612 1727 gene locus_tag LOCUS_16570 612 1727 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086431.1 protein_id gnl|my_center|LOCUS_16570 1739 3142 gene locus_tag LOCUS_16580 gene argH 1739 3142 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338440.1 protein_id gnl|my_center|LOCUS_16580 3294 3923 gene locus_tag LOCUS_16590 3294 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 6006 4006 gene locus_tag LOCUS_16600 6006 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 6634 6485 gene locus_tag LOCUS_16610 6634 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 7036 6671 gene locus_tag LOCUS_16620 7036 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 7247 7005 gene locus_tag LOCUS_16630 7247 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 7404 8066 gene locus_tag LOCUS_16640 7404 8066 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087248.1 protein_id gnl|my_center|LOCUS_16640 10551 8179 gene locus_tag LOCUS_16650 10551 8179 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530142.1 protein_id gnl|my_center|LOCUS_16650 10940 12169 gene locus_tag LOCUS_16660 gene tyrS 10940 12169 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583842.1 protein_id gnl|my_center|LOCUS_16660 12597 14126 gene locus_tag LOCUS_r00010 12597 14126 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 14585 14199 gene locus_tag LOCUS_16670 14585 14199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 14566 17559 gene locus_tag LOCUS_r00020 14566 17559 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence054 750 2099 gene locus_tag LOCUS_16680 gene murA 750 2099 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083644.1 protein_id gnl|my_center|LOCUS_16680 2160 3140 gene locus_tag LOCUS_16690 gene hisZ 2160 3140 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_16690 3137 3847 gene locus_tag LOCUS_16700 gene hisG 3137 3847 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_16700 3837 5219 gene locus_tag LOCUS_16710 gene hisD 3837 5219 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_16710 5216 5812 gene locus_tag LOCUS_16720 gene hisB 5216 5812 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393530.1 protein_id gnl|my_center|LOCUS_16720 5809 6615 gene locus_tag LOCUS_16730 5809 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 6612 7337 gene locus_tag LOCUS_16740 gene hisA 6612 7337 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140708.1 protein_id gnl|my_center|LOCUS_16740 7528 8286 gene locus_tag LOCUS_16750 gene hisF 7528 8286 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_16750 8610 8350 gene locus_tag LOCUS_16760 8610 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 8503 9687 gene locus_tag LOCUS_16770 8503 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 9684 10421 gene locus_tag LOCUS_16780 gene pgeF 9684 10421 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038202.1 protein_id gnl|my_center|LOCUS_16780 10409 11077 gene locus_tag LOCUS_16790 10409 11077 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082246.1 protein_id gnl|my_center|LOCUS_16790 11325 11834 gene locus_tag LOCUS_16800 11325 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 11945 12703 gene locus_tag LOCUS_16810 gene proC 11945 12703 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101054.1 protein_id gnl|my_center|LOCUS_16810 12700 13008 gene locus_tag LOCUS_16820 12700 13008 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221463.1 protein_id gnl|my_center|LOCUS_16820 13005 13517 gene locus_tag LOCUS_16830 gene lspA 13005 13517 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256792.1 protein_id gnl|my_center|LOCUS_16830 13528 14202 gene locus_tag LOCUS_16840 13528 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 14371 15573 gene locus_tag LOCUS_16850 14371 15573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 15570 16220 gene locus_tag LOCUS_16860 gene tsf 15570 16220 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_16860 16391 16876 gene locus_tag LOCUS_16870 16391 16876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence055 1390 1133 gene locus_tag LOCUS_16880 gene rpsT 1390 1133 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057030.1 protein_id gnl|my_center|LOCUS_16880 1525 3249 gene locus_tag LOCUS_16890 gene murJ 1525 3249 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582940.1 protein_id gnl|my_center|LOCUS_16890 3255 5078 gene locus_tag LOCUS_16900 gene lepA 3255 5078 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_16900 5122 5682 gene locus_tag LOCUS_16910 5122 5682 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_16910 5734 6564 gene locus_tag LOCUS_16920 5734 6564 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_16920 6685 7212 gene locus_tag LOCUS_16930 6685 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 7281 8381 gene locus_tag LOCUS_16940 7281 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 9116 8412 gene locus_tag LOCUS_16950 9116 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 9200 10837 gene locus_tag LOCUS_16960 9200 10837 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029653.1 protein_id gnl|my_center|LOCUS_16960 12218 10932 gene locus_tag LOCUS_16970 12218 10932 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_16970 12719 12789 gene locus_tag LOCUS_t00210 12719 12789 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12811 12884 gene locus_tag LOCUS_t00220 12811 12884 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13224 13529 gene locus_tag LOCUS_16980 13224 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 15100 13721 gene locus_tag LOCUS_16990 15100 13721 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_16990 15167 16051 gene locus_tag LOCUS_17000 15167 16051 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_17000 16327 17253 gene locus_tag LOCUS_17010 16327 17253 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence056 695 1996 gene locus_tag LOCUS_17020 695 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3385 2039 gene locus_tag LOCUS_17030 3385 2039 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727016.1 protein_id gnl|my_center|LOCUS_17030 3737 4144 gene locus_tag LOCUS_17040 3737 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 5038 6366 gene locus_tag LOCUS_17050 5038 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 6363 6821 gene locus_tag LOCUS_17060 6363 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 7042 9414 gene locus_tag LOCUS_17070 7042 9414 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_17070 9596 12001 gene locus_tag LOCUS_17080 9596 12001 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_17080 12044 13468 gene locus_tag LOCUS_17090 12044 13468 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978673.1 protein_id gnl|my_center|LOCUS_17090 13645 14118 gene locus_tag LOCUS_17100 13645 14118 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614581.1 protein_id gnl|my_center|LOCUS_17100 14548 15276 gene locus_tag LOCUS_17110 14548 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 15337 15624 gene locus_tag LOCUS_17120 15337 15624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 16258 15947 gene locus_tag LOCUS_17130 16258 15947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence057 3 818 gene locus_tag LOCUS_17140 3 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1136 1046 gene locus_tag LOCUS_t00230 1136 1046 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1275 1442 gene locus_tag LOCUS_17150 1275 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2631 1528 gene locus_tag LOCUS_17160 2631 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2827 5175 gene locus_tag LOCUS_17170 2827 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 5457 5936 gene locus_tag LOCUS_17180 5457 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 6281 6661 gene locus_tag LOCUS_17190 6281 6661 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031798.1 protein_id gnl|my_center|LOCUS_17190 7208 6972 gene locus_tag LOCUS_17200 7208 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 7189 7446 gene locus_tag LOCUS_17210 7189 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 7906 7529 gene locus_tag LOCUS_17220 7906 7529 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_17220 8217 7903 gene locus_tag LOCUS_17230 8217 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 12380 8562 gene locus_tag LOCUS_17240 12380 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 16069 12377 gene locus_tag LOCUS_17250 16069 12377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence058 3343 2159 gene locus_tag LOCUS_17260 gene murG 3343 2159 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_17260 4715 3270 gene locus_tag LOCUS_17270 4715 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 6461 4893 gene locus_tag LOCUS_17280 gene murD 6461 4893 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_17280 7423 6458 gene locus_tag LOCUS_17290 gene mraY 7423 6458 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_17290 9090 7423 gene locus_tag LOCUS_17300 9090 7423 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_17300 10978 9314 gene locus_tag LOCUS_17310 10978 9314 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_17310 11346 10984 gene locus_tag LOCUS_17320 11346 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 12698 11745 gene locus_tag LOCUS_17330 gene rsmH 12698 11745 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_17330 13290 12850 gene locus_tag LOCUS_17340 gene mraZ 13290 12850 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874670.1 protein_id gnl|my_center|LOCUS_17340 13706 13494 gene locus_tag LOCUS_17350 13706 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 13708 15336 gene locus_tag LOCUS_17360 13708 15336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence059 1120 623 gene locus_tag LOCUS_17370 1120 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2895 1165 gene locus_tag LOCUS_17380 gene cysI 2895 1165 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_17380 4729 2906 gene locus_tag LOCUS_17390 4729 2906 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_17390 4866 5522 gene locus_tag LOCUS_17400 4866 5522 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_17400 5794 6018 gene locus_tag LOCUS_17410 5794 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 6313 8280 gene locus_tag LOCUS_17420 6313 8280 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111158892.1 protein_id gnl|my_center|LOCUS_17420 9727 8414 gene locus_tag LOCUS_17430 9727 8414 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175325.1 protein_id gnl|my_center|LOCUS_17430 9856 10413 gene locus_tag LOCUS_17440 9856 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 10705 11412 gene locus_tag LOCUS_17450 10705 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 11587 11931 gene locus_tag LOCUS_17460 11587 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 11901 13034 gene locus_tag LOCUS_17470 11901 13034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 13508 14170 gene locus_tag LOCUS_17480 13508 14170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 14187 14792 gene locus_tag LOCUS_17490 14187 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 15367 14876 gene locus_tag LOCUS_17500 15367 14876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 15807 15364 gene locus_tag LOCUS_17510 15807 15364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence060 501 1910 gene locus_tag LOCUS_17520 501 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2494 1985 gene locus_tag LOCUS_17530 2494 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2759 3763 gene locus_tag LOCUS_17540 2759 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3791 4300 gene locus_tag LOCUS_17550 3791 4300 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977628.1 protein_id gnl|my_center|LOCUS_17550 4657 6381 gene locus_tag LOCUS_17560 gene dosT 4657 6381 CDS product two-component system sensor histidine kinase DosT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899138.1 protein_id gnl|my_center|LOCUS_17560 6576 7703 gene locus_tag LOCUS_17570 6576 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 8656 7997 gene locus_tag LOCUS_17580 gene pdxH 8656 7997 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_17580 13527 8653 gene locus_tag LOCUS_17590 13527 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 13681 13511 gene locus_tag LOCUS_17600 13681 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 14059 13691 gene locus_tag LOCUS_17610 14059 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 14906 14190 gene locus_tag LOCUS_17620 14906 14190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 15715 14903 gene locus_tag LOCUS_17630 15715 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence061 486 578 gene locus_tag LOCUS_t00240 486 578 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 493 1593 gene locus_tag LOCUS_17640 493 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2156 1602 gene locus_tag LOCUS_17650 2156 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2444 2187 gene locus_tag LOCUS_17660 2444 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2715 2625 gene locus_tag LOCUS_t00250 2715 2625 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3408 4787 gene locus_tag LOCUS_17670 gene ltrA 3408 4787 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_17670 4892 5743 gene locus_tag LOCUS_17680 4892 5743 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890440.1 protein_id gnl|my_center|LOCUS_17680 5743 6654 gene locus_tag LOCUS_17690 5743 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 8019 6970 gene locus_tag LOCUS_17700 8019 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 8682 8098 gene locus_tag LOCUS_17710 8682 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 9635 8679 gene locus_tag LOCUS_17720 9635 8679 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177599.1 protein_id gnl|my_center|LOCUS_17720 12196 9632 gene locus_tag LOCUS_17730 12196 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 12981 12193 gene locus_tag LOCUS_17740 12981 12193 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095617.1 protein_id gnl|my_center|LOCUS_17740 13728 12994 gene locus_tag LOCUS_17750 gene lolD 13728 12994 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367168.1 protein_id gnl|my_center|LOCUS_17750 14384 13728 gene locus_tag LOCUS_17760 14384 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence062 483 88 gene locus_tag LOCUS_17770 483 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1530 595 gene locus_tag LOCUS_17780 1530 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1988 2221 gene locus_tag LOCUS_17790 1988 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 3827 2460 gene locus_tag LOCUS_17800 3827 2460 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227558.1 protein_id gnl|my_center|LOCUS_17800 3926 4507 gene locus_tag LOCUS_17810 3926 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 4533 5156 gene locus_tag LOCUS_17820 4533 5156 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140484.1 protein_id gnl|my_center|LOCUS_17820 5343 5714 gene locus_tag LOCUS_17830 5343 5714 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405142.1 protein_id gnl|my_center|LOCUS_17830 5938 6792 gene locus_tag LOCUS_17840 gene rsmI 5938 6792 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804940.1 protein_id gnl|my_center|LOCUS_17840 6804 8300 gene locus_tag LOCUS_17850 6804 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 8309 9058 gene locus_tag LOCUS_17860 8309 9058 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229979.1 protein_id gnl|my_center|LOCUS_17860 9055 9954 gene locus_tag LOCUS_17870 gene rsmA 9055 9954 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475602.1 protein_id gnl|my_center|LOCUS_17870 9951 10871 gene locus_tag LOCUS_17880 9951 10871 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045756603.1 protein_id gnl|my_center|LOCUS_17880 11051 11263 gene locus_tag LOCUS_17890 11051 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 11264 12490 gene locus_tag LOCUS_17900 11264 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 13254 12700 gene locus_tag LOCUS_17910 13254 12700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 13410 13481 gene locus_tag LOCUS_t00260 13410 13481 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence063 <1 1399 gene locus_tag LOCUS_17920 <1 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162483877.1:presqualene diphosphate synthase HpnD 1402 2808 gene locus_tag LOCUS_17930 gene hpnE 1402 2808 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_17930 2805 3518 gene locus_tag LOCUS_17940 2805 3518 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972232.1 protein_id gnl|my_center|LOCUS_17940 3522 4523 gene locus_tag LOCUS_17950 gene hpnH 3522 4523 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_17950 6008 4656 gene locus_tag LOCUS_17960 6008 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 7361 6237 gene locus_tag LOCUS_17970 7361 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 7857 7558 gene locus_tag LOCUS_17980 7857 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 8694 7882 gene locus_tag LOCUS_17990 8694 7882 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_17990 8759 9484 gene locus_tag LOCUS_18000 8759 9484 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_18000 9822 9547 gene locus_tag LOCUS_18010 9822 9547 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_18010 10469 10122 gene locus_tag LOCUS_18020 10469 10122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 11292 10483 gene locus_tag LOCUS_18030 11292 10483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 11538 12143 gene locus_tag LOCUS_18040 11538 12143 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880118.1 protein_id gnl|my_center|LOCUS_18040 14051 12354 gene locus_tag LOCUS_18050 14051 12354 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085507.1 protein_id gnl|my_center|LOCUS_18050 14376 14068 gene locus_tag LOCUS_18060 14376 14068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence064 474 328 gene locus_tag LOCUS_18070 474 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1684 1007 gene locus_tag LOCUS_18080 1684 1007 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081527.1 protein_id gnl|my_center|LOCUS_18080 3246 1681 gene locus_tag LOCUS_18090 3246 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4710 3442 gene locus_tag LOCUS_18100 gene serS 4710 3442 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_18100 5210 4746 gene locus_tag LOCUS_18110 5210 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 5870 5388 gene locus_tag LOCUS_18120 5870 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 5934 6290 gene locus_tag LOCUS_18130 5934 6290 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_18130 6290 7075 gene locus_tag LOCUS_18140 6290 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 7068 7574 gene locus_tag LOCUS_18150 7068 7574 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258750.1 protein_id gnl|my_center|LOCUS_18150 7623 8882 gene locus_tag LOCUS_18160 gene nuoD 7623 8882 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_18160 8879 9652 gene locus_tag LOCUS_18170 8879 9652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 9804 11210 gene locus_tag LOCUS_18180 gene nuoF 9804 11210 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396808.1 protein_id gnl|my_center|LOCUS_18180 11347 13593 gene locus_tag LOCUS_18190 gene nuoG 11347 13593 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258754.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence065 267 40 gene locus_tag LOCUS_18200 267 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2184 634 gene locus_tag LOCUS_18210 2184 634 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730237.1 protein_id gnl|my_center|LOCUS_18210 2863 2177 gene locus_tag LOCUS_18220 gene mprA 2863 2177 CDS product two-component system response regulator MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014588181.1 protein_id gnl|my_center|LOCUS_18220 3130 5715 gene locus_tag LOCUS_18230 3130 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 5841 6632 gene locus_tag LOCUS_18240 5841 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 6632 7912 gene locus_tag LOCUS_18250 6632 7912 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900426.1 protein_id gnl|my_center|LOCUS_18250 7928 8674 gene locus_tag LOCUS_18260 7928 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 8709 9818 gene locus_tag LOCUS_18270 gene recA 8709 9818 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_18270 9954 10253 gene locus_tag LOCUS_18280 9954 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 10250 10690 gene locus_tag LOCUS_18290 10250 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 10699 12078 gene locus_tag LOCUS_18300 gene miaB 10699 12078 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_18300 12963 12169 gene locus_tag LOCUS_18310 12963 12169 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350071.1 protein_id gnl|my_center|LOCUS_18310 13115 14032 gene locus_tag LOCUS_18320 gene miaA 13115 14032 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804679.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence066 37 903 gene locus_tag LOCUS_18330 37 903 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 protein_id gnl|my_center|LOCUS_18330 2400 898 gene locus_tag LOCUS_18340 gene mftF 2400 898 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112043.1 protein_id gnl|my_center|LOCUS_18340 3254 2460 gene locus_tag LOCUS_18350 3254 2460 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976314.1 protein_id gnl|my_center|LOCUS_18350 3941 3264 gene locus_tag LOCUS_18360 gene mftE 3941 3264 CDS product mycofactocin biosynthesis peptidyl-dipeptidase MftE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403497.1 protein_id gnl|my_center|LOCUS_18360 5146 3938 gene locus_tag LOCUS_18370 gene mftD 5146 3938 CDS product mycofactocin biosynthesis FMN-dependent deaminase MftD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877068.1 protein_id gnl|my_center|LOCUS_18370 6954 5146 gene locus_tag LOCUS_18380 6954 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 7215 6958 gene locus_tag LOCUS_18390 7215 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 7355 7975 gene locus_tag LOCUS_18400 7355 7975 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487124.1 protein_id gnl|my_center|LOCUS_18400 8112 8627 gene locus_tag LOCUS_18410 8112 8627 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_18410 9471 8575 gene locus_tag LOCUS_18420 9471 8575 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_18420 9658 11100 gene locus_tag LOCUS_18430 9658 11100 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_18430 11468 11091 gene locus_tag LOCUS_18440 11468 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402400.1 protein_id gnl|my_center|LOCUS_18440 12943 11456 gene locus_tag LOCUS_18450 12943 11456 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108522916.1 protein_id gnl|my_center|LOCUS_18450 13224 12967 gene locus_tag LOCUS_18460 13224 12967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence067 545 910 gene locus_tag LOCUS_18470 545 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1262 855 gene locus_tag LOCUS_18480 1262 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2311 1625 gene locus_tag LOCUS_18490 2311 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 3120 2308 gene locus_tag LOCUS_18500 3120 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 5948 3117 gene locus_tag LOCUS_18510 5948 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 6791 5979 gene locus_tag LOCUS_18520 6791 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 7591 6794 gene locus_tag LOCUS_18530 7591 6794 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466821.1 protein_id gnl|my_center|LOCUS_18530 8466 7660 gene locus_tag LOCUS_18540 8466 7660 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_18540 8797 9624 gene locus_tag LOCUS_18550 8797 9624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 9942 12095 gene locus_tag LOCUS_18560 9942 12095 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480377.1 protein_id gnl|my_center|LOCUS_18560 12519 12316 gene locus_tag LOCUS_18570 12519 12316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence068 204 926 gene locus_tag LOCUS_18580 204 926 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973892.1 protein_id gnl|my_center|LOCUS_18580 1006 2040 gene locus_tag LOCUS_18590 1006 2040 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_18590 2044 3306 gene locus_tag LOCUS_18600 2044 3306 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901461.1 protein_id gnl|my_center|LOCUS_18600 3546 3473 gene locus_tag LOCUS_t00270 3546 3473 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3786 5006 gene locus_tag LOCUS_18610 3786 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 6922 4979 gene locus_tag LOCUS_18620 6922 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 8069 6933 gene locus_tag LOCUS_18630 8069 6933 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_18630 8773 8066 gene locus_tag LOCUS_18640 8773 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 8876 9130 gene locus_tag LOCUS_18650 gene grxC 8876 9130 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096057.1 protein_id gnl|my_center|LOCUS_18650 10192 9245 gene locus_tag LOCUS_18660 gene mutM 10192 9245 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067767.1 protein_id gnl|my_center|LOCUS_18660 11172 10192 gene locus_tag LOCUS_18670 gene xerD 11172 10192 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_18670 11446 11258 gene locus_tag LOCUS_18680 11446 11258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 13119 11434 gene locus_tag LOCUS_18690 13119 11434 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence069 453 851 gene locus_tag LOCUS_18700 gene aroH 453 851 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258091.1 protein_id gnl|my_center|LOCUS_18700 1138 3201 gene locus_tag LOCUS_18710 1138 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 3215 4348 gene locus_tag LOCUS_18720 gene hisC 3215 4348 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_18720 4661 5701 gene locus_tag LOCUS_18730 gene aroF 4661 5701 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_18730 5739 6698 gene locus_tag LOCUS_18740 5739 6698 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813053.1 protein_id gnl|my_center|LOCUS_18740 6610 8121 gene locus_tag LOCUS_18750 gene aroA 6610 8121 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460209.1 protein_id gnl|my_center|LOCUS_18750 8118 8771 gene locus_tag LOCUS_18760 gene cmk 8118 8771 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_18760 8826 10187 gene locus_tag LOCUS_18770 gene der 8826 10187 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_18770 10245 11570 gene locus_tag LOCUS_18780 gene metK 10245 11570 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392413.1 protein_id gnl|my_center|LOCUS_18780 11577 13562 gene locus_tag LOCUS_18790 11577 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence070 1280 327 gene locus_tag LOCUS_18800 1280 327 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_18800 2392 1277 gene locus_tag LOCUS_18810 2392 1277 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_18810 3288 2515 gene locus_tag LOCUS_18820 3288 2515 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942965.1 protein_id gnl|my_center|LOCUS_18820 4354 3407 gene locus_tag LOCUS_18830 4354 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 5948 4524 gene locus_tag LOCUS_18840 5948 4524 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200855.1 protein_id gnl|my_center|LOCUS_18840 6705 6193 gene locus_tag LOCUS_18850 6705 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 7215 6847 gene locus_tag LOCUS_18860 7215 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 7117 8946 gene locus_tag LOCUS_18870 7117 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 10307 9087 gene locus_tag LOCUS_18880 10307 9087 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938060.1 protein_id gnl|my_center|LOCUS_18880 11713 10325 gene locus_tag LOCUS_18890 11713 10325 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_18890 11738 12241 gene locus_tag LOCUS_18900 11738 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence071 1797 406 gene locus_tag LOCUS_18910 1797 406 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_18910 2819 1794 gene locus_tag LOCUS_18920 2819 1794 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027281.1 protein_id gnl|my_center|LOCUS_18920 2910 3728 gene locus_tag LOCUS_18930 2910 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 4495 3890 gene locus_tag LOCUS_18940 4495 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 7300 5267 gene locus_tag LOCUS_18950 7300 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 7809 7495 gene locus_tag LOCUS_18960 7809 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 9456 7936 gene locus_tag LOCUS_18970 9456 7936 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089485.1 protein_id gnl|my_center|LOCUS_18970 9461 9625 gene locus_tag LOCUS_18980 9461 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 9887 11239 gene locus_tag LOCUS_18990 9887 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 11762 11223 gene locus_tag LOCUS_19000 gene pyrE 11762 11223 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417034.1 protein_id gnl|my_center|LOCUS_19000 11819 12991 gene locus_tag LOCUS_19010 11819 12991 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence072 1432 488 gene locus_tag LOCUS_19020 1432 488 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_19020 1732 2472 gene locus_tag LOCUS_19030 1732 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2653 4107 gene locus_tag LOCUS_19040 gene tig 2653 4107 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723884.1 protein_id gnl|my_center|LOCUS_19040 4134 4334 gene locus_tag LOCUS_19050 4134 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 4331 4915 gene locus_tag LOCUS_19060 gene clpP 4331 4915 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_19060 5084 6397 gene locus_tag LOCUS_19070 gene clpX 5084 6397 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412634.1 protein_id gnl|my_center|LOCUS_19070 6498 7133 gene locus_tag LOCUS_19080 6498 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 7240 9885 gene locus_tag LOCUS_19090 7240 9885 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_19090 9882 11165 gene locus_tag LOCUS_19100 9882 11165 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141076.1 protein_id gnl|my_center|LOCUS_19100 11431 12126 gene locus_tag LOCUS_19110 11431 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 12210 12620 gene locus_tag LOCUS_19120 gene ndk 12210 12620 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence073 2291 1083 gene locus_tag LOCUS_19130 2291 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2579 4507 gene locus_tag LOCUS_19140 2579 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 4530 5846 gene locus_tag LOCUS_19150 4530 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 6846 5965 gene locus_tag LOCUS_19160 6846 5965 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403827.1 protein_id gnl|my_center|LOCUS_19160 7718 6942 gene locus_tag LOCUS_19170 7718 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 8189 9004 gene locus_tag LOCUS_19180 8189 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 10187 8976 gene locus_tag LOCUS_19190 gene lhgO 10187 8976 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727635.1 protein_id gnl|my_center|LOCUS_19190 11061 10231 gene locus_tag LOCUS_19200 11061 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 11135 11332 gene locus_tag LOCUS_19210 11135 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 11962 12492 gene locus_tag LOCUS_19220 11962 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence074 154 819 gene locus_tag LOCUS_19230 154 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 920 1159 gene locus_tag LOCUS_19240 920 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 1293 1219 gene locus_tag LOCUS_t00280 1293 1219 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1577 1347 gene locus_tag LOCUS_19250 1577 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1583 2458 gene locus_tag LOCUS_19260 gene ubiE 1583 2458 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_19260 2436 3173 gene locus_tag LOCUS_19270 2436 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 4246 3332 gene locus_tag LOCUS_19280 4246 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 5041 4283 gene locus_tag LOCUS_19290 5041 4283 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_19290 5936 5052 gene locus_tag LOCUS_19300 gene rsmG 5936 5052 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462328.1 protein_id gnl|my_center|LOCUS_19300 6354 5905 gene locus_tag LOCUS_19310 6354 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 6964 6359 gene locus_tag LOCUS_19320 6964 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 8056 7013 gene locus_tag LOCUS_19330 8056 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 8396 8157 gene locus_tag LOCUS_19340 8396 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 9091 8588 gene locus_tag LOCUS_19350 9091 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 9513 10892 gene locus_tag LOCUS_19360 gene dnaA 9513 10892 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_19360 11116 12219 gene locus_tag LOCUS_19370 gene dnaN 11116 12219 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence075 229 378 gene locus_tag LOCUS_19380 229 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 954 430 gene locus_tag LOCUS_19390 954 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19390 1551 1207 gene locus_tag LOCUS_19400 1551 1207 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235677901.1 protein_id gnl|my_center|LOCUS_19400 2440 1781 gene locus_tag LOCUS_19410 2440 1781 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 protein_id gnl|my_center|LOCUS_19410 3498 3094 gene locus_tag LOCUS_19420 3498 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 3737 3495 gene locus_tag LOCUS_19430 3737 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 3987 5522 gene locus_tag LOCUS_19440 3987 5522 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971719.1 protein_id gnl|my_center|LOCUS_19440 5527 6021 gene locus_tag LOCUS_19450 5527 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 7834 6542 gene locus_tag LOCUS_19460 gene ispG 7834 6542 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_19460 7849 8469 gene locus_tag LOCUS_19470 7849 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 9618 8485 gene locus_tag LOCUS_19480 gene rseP 9618 8485 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 protein_id gnl|my_center|LOCUS_19480 9944 9678 gene locus_tag LOCUS_19490 9944 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 11186 10077 gene locus_tag LOCUS_19500 11186 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 12403 11240 gene locus_tag LOCUS_19510 12403 11240 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence076 72 1028 gene locus_tag LOCUS_19520 72 1028 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053875.1 protein_id gnl|my_center|LOCUS_19520 3127 1148 gene locus_tag LOCUS_19530 3127 1148 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395834.1 protein_id gnl|my_center|LOCUS_19530 3657 4370 gene locus_tag LOCUS_19540 3657 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 4388 5455 gene locus_tag LOCUS_19550 4388 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 7197 5611 gene locus_tag LOCUS_19560 7197 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 8398 7313 gene locus_tag LOCUS_19570 8398 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 8555 10417 gene locus_tag LOCUS_19580 8555 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 <12473 10557 gene locus_tag LOCUS_19590 <12473 10557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898735.1:glucose-6-phosphate dehydrogenase >Feature sequence077 247 630 gene locus_tag LOCUS_19600 gene rpsM 247 630 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_19600 638 1042 gene locus_tag LOCUS_19610 gene rpsK 638 1042 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892910.1 protein_id gnl|my_center|LOCUS_19610 1082 1702 gene locus_tag LOCUS_19620 gene rpsD 1082 1702 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_19620 1796 2773 gene locus_tag LOCUS_19630 1796 2773 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_19630 2812 3165 gene locus_tag LOCUS_19640 gene rplQ 2812 3165 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459109.1 protein_id gnl|my_center|LOCUS_19640 3213 4115 gene locus_tag LOCUS_19650 gene truA 3213 4115 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_19650 4087 4920 gene locus_tag LOCUS_19660 gene surE 4087 4920 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258539.1 protein_id gnl|my_center|LOCUS_19660 4917 7031 gene locus_tag LOCUS_19670 gene ligA 4917 7031 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_19670 8241 7147 gene locus_tag LOCUS_19680 8241 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 8728 8249 gene locus_tag LOCUS_19690 8728 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 10683 8875 gene locus_tag LOCUS_19700 10683 8875 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_19700 10991 10818 gene locus_tag LOCUS_19710 10991 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 11896 11123 gene locus_tag LOCUS_19720 11896 11123 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377592.1 protein_id gnl|my_center|LOCUS_19720 12074 12149 gene locus_tag LOCUS_t00290 12074 12149 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence078 3134 1704 gene locus_tag LOCUS_19730 3134 1704 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392428.1 protein_id gnl|my_center|LOCUS_19730 4364 3144 gene locus_tag LOCUS_19740 4364 3144 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 protein_id gnl|my_center|LOCUS_19740 4936 4364 gene locus_tag LOCUS_19750 4936 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 5805 4933 gene locus_tag LOCUS_19760 5805 4933 CDS product DUF3662 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811808.1 protein_id gnl|my_center|LOCUS_19760 8169 5968 gene locus_tag LOCUS_19770 8169 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 8340 9320 gene locus_tag LOCUS_19780 8340 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 9351 9962 gene locus_tag LOCUS_19790 9351 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 9940 10974 gene locus_tag LOCUS_19800 gene pheA 9940 10974 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066451.1 protein_id gnl|my_center|LOCUS_19800 11024 11617 gene locus_tag LOCUS_19810 11024 11617 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence079 1 825 gene locus_tag LOCUS_19820 1 825 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_19820 1203 769 gene locus_tag LOCUS_19830 1203 769 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531012.1 protein_id gnl|my_center|LOCUS_19830 1383 3494 gene locus_tag LOCUS_19840 1383 3494 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551646.1 protein_id gnl|my_center|LOCUS_19840 3506 4636 gene locus_tag LOCUS_19850 3506 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 4757 5524 gene locus_tag LOCUS_19860 4757 5524 CDS product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141101.1 protein_id gnl|my_center|LOCUS_19860 6677 5652 gene locus_tag LOCUS_19870 6677 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 7478 6708 gene locus_tag LOCUS_19880 7478 6708 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_19880 8269 7478 gene locus_tag LOCUS_19890 8269 7478 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_19890 8468 10294 gene locus_tag LOCUS_19900 8468 10294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_19900 10320 10496 gene locus_tag LOCUS_19910 10320 10496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 10663 10451 gene locus_tag LOCUS_19920 10663 10451 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_19920 11117 10791 gene locus_tag LOCUS_19930 11117 10791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 12125 11268 gene locus_tag LOCUS_19940 12125 11268 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014152.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence080 436 777 gene locus_tag LOCUS_19950 436 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1515 931 gene locus_tag LOCUS_19960 1515 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2718 1783 gene locus_tag LOCUS_19970 2718 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 4714 3173 gene locus_tag LOCUS_19980 4714 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 5673 5149 gene locus_tag LOCUS_19990 5673 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 6111 5977 gene locus_tag LOCUS_20000 6111 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 6579 6506 gene locus_tag LOCUS_t00300 6579 6506 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6651 7550 gene locus_tag LOCUS_20010 6651 7550 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_20010 7547 9205 gene locus_tag LOCUS_20020 7547 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 9236 10558 gene locus_tag LOCUS_20030 9236 10558 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_20030 10555 11523 gene locus_tag LOCUS_20040 10555 11523 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_20040 11685 11775 gene locus_tag LOCUS_t00310 11685 11775 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence081 534 463 gene locus_tag LOCUS_t00320 534 463 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1672 797 gene locus_tag LOCUS_20050 1672 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229131.1 protein_id gnl|my_center|LOCUS_20050 2803 1748 gene locus_tag LOCUS_20060 2803 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3061 4095 gene locus_tag LOCUS_20070 3061 4095 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_20070 5696 4197 gene locus_tag LOCUS_20080 5696 4197 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940879.1 protein_id gnl|my_center|LOCUS_20080 7153 5870 gene locus_tag LOCUS_20090 7153 5870 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776663.1 protein_id gnl|my_center|LOCUS_20090 7381 7157 gene locus_tag LOCUS_20100 7381 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 7544 8557 gene locus_tag LOCUS_20110 7544 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 9349 8687 gene locus_tag LOCUS_20120 9349 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 9945 9595 gene locus_tag LOCUS_20130 9945 9595 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977188.1 protein_id gnl|my_center|LOCUS_20130 9905 10279 gene locus_tag LOCUS_20140 9905 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence082 551 219 gene locus_tag LOCUS_20150 551 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1141 695 gene locus_tag LOCUS_20160 1141 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20160 1321 1494 gene locus_tag LOCUS_20170 1321 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 2498 2148 gene locus_tag LOCUS_20180 2498 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2527 2802 gene locus_tag LOCUS_20190 2527 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2786 3211 gene locus_tag LOCUS_20200 2786 3211 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393507.1 protein_id gnl|my_center|LOCUS_20200 4319 4068 gene locus_tag LOCUS_20210 4319 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 4451 5767 gene locus_tag LOCUS_20220 4451 5767 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817012.1 protein_id gnl|my_center|LOCUS_20220 6400 6137 gene locus_tag LOCUS_20230 6400 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 6287 6562 gene locus_tag LOCUS_20240 6287 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 7407 6538 gene locus_tag LOCUS_20250 gene pstB 7407 6538 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_20250 8339 7425 gene locus_tag LOCUS_20260 gene pstA 8339 7425 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_20260 9334 8339 gene locus_tag LOCUS_20270 gene pstC 9334 8339 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140449.1 protein_id gnl|my_center|LOCUS_20270 9730 9515 gene locus_tag LOCUS_20280 9730 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 9744 10709 gene locus_tag LOCUS_20290 9744 10709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 11101 10907 gene locus_tag LOCUS_20300 11101 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 11000 11674 gene locus_tag LOCUS_20310 gene phoU 11000 11674 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230711.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence083 105 593 gene locus_tag LOCUS_20320 105 593 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092949.1 protein_id gnl|my_center|LOCUS_20320 1561 758 gene locus_tag LOCUS_20330 1561 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2816 1707 gene locus_tag LOCUS_20340 2816 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_20340 3104 2880 gene locus_tag LOCUS_20350 3104 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3434 3141 gene locus_tag LOCUS_20360 3434 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 5085 3556 gene locus_tag LOCUS_20370 gene gndA 5085 3556 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222331.1 protein_id gnl|my_center|LOCUS_20370 5241 6266 gene locus_tag LOCUS_20380 gene gnd 5241 6266 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_20380 7620 6376 gene locus_tag LOCUS_20390 7620 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 7699 9738 gene locus_tag LOCUS_20400 7699 9738 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 protein_id gnl|my_center|LOCUS_20400 9735 11507 gene locus_tag LOCUS_20410 gene treS 9735 11507 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031594.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence084 2594 6598 gene locus_tag LOCUS_20420 2594 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871158.1 protein_id gnl|my_center|LOCUS_20420 7032 6956 gene locus_tag LOCUS_t00330 7032 6956 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7442 8773 gene locus_tag LOCUS_20430 7442 8773 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_20430 9555 8827 gene locus_tag LOCUS_20440 9555 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 9822 9898 gene locus_tag LOCUS_t00340 9822 9898 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9927 11498 gene locus_tag LOCUS_20450 9927 11498 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_20450 11461 11532 gene locus_tag LOCUS_t00350 11461 11532 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 700 2124 gene locus_tag LOCUS_20460 700 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 3589 2054 gene locus_tag LOCUS_20470 3589 2054 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229439.1 protein_id gnl|my_center|LOCUS_20470 4145 3756 gene locus_tag LOCUS_20480 4145 3756 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227982.1 protein_id gnl|my_center|LOCUS_20480 4387 4142 gene locus_tag LOCUS_20490 4387 4142 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227983.1 protein_id gnl|my_center|LOCUS_20490 5474 4509 gene locus_tag LOCUS_20500 5474 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 6045 5494 gene locus_tag LOCUS_20510 6045 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 8871 6130 gene locus_tag LOCUS_20520 8871 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 9569 8868 gene locus_tag LOCUS_20530 9569 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 10162 9566 gene locus_tag LOCUS_20540 10162 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 11199 10771 gene locus_tag LOCUS_20550 11199 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 11486 11196 gene locus_tag LOCUS_20560 11486 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence086 457 1176 gene locus_tag LOCUS_20570 457 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 1177 1899 gene locus_tag LOCUS_20580 1177 1899 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070511.1 protein_id gnl|my_center|LOCUS_20580 2515 2003 gene locus_tag LOCUS_20590 2515 2003 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729404.1 protein_id gnl|my_center|LOCUS_20590 2810 4282 gene locus_tag LOCUS_20600 2810 4282 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055994.1 protein_id gnl|my_center|LOCUS_20600 5434 4502 gene locus_tag LOCUS_20610 5434 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 5669 6343 gene locus_tag LOCUS_20620 5669 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 6396 7682 gene locus_tag LOCUS_20630 6396 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 7700 8581 gene locus_tag LOCUS_20640 7700 8581 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776963.1 protein_id gnl|my_center|LOCUS_20640 8849 9721 gene locus_tag LOCUS_20650 8849 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 9788 10867 gene locus_tag LOCUS_20660 9788 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence087 419 1288 gene locus_tag LOCUS_20670 gene murI 419 1288 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_20670 1356 2210 gene locus_tag LOCUS_20680 gene rph 1356 2210 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_20680 2207 2896 gene locus_tag LOCUS_20690 2207 2896 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_20690 3007 2873 gene locus_tag LOCUS_20700 3007 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 3247 3525 gene locus_tag LOCUS_20710 3247 3525 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_20710 3682 4590 gene locus_tag LOCUS_20720 gene pyrF 3682 4590 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_20720 4773 5831 gene locus_tag LOCUS_20730 gene pfkB 4773 5831 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391561.1 protein_id gnl|my_center|LOCUS_20730 6830 5946 gene locus_tag LOCUS_20740 6830 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 7891 6827 gene locus_tag LOCUS_20750 7891 6827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229772.1 protein_id gnl|my_center|LOCUS_20750 9109 7892 gene locus_tag LOCUS_20760 9109 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 9387 9989 gene locus_tag LOCUS_20770 9387 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 10021 10476 gene locus_tag LOCUS_20780 10021 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence088 92 559 gene locus_tag LOCUS_20790 92 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20790 499 852 gene locus_tag LOCUS_20800 499 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20800 961 1182 gene locus_tag LOCUS_20810 961 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1210 1473 gene locus_tag LOCUS_20820 1210 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1493 4354 gene locus_tag LOCUS_20830 1493 4354 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487609.1 protein_id gnl|my_center|LOCUS_20830 4480 4716 gene locus_tag LOCUS_20840 4480 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4718 5803 gene locus_tag LOCUS_20850 4718 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 5918 8491 gene locus_tag LOCUS_20860 5918 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 8488 9360 gene locus_tag LOCUS_20870 8488 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence089 1390 101 gene locus_tag LOCUS_20880 1390 101 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_20880 1434 2567 gene locus_tag LOCUS_20890 1434 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667978.1 protein_id gnl|my_center|LOCUS_20890 2548 3081 gene locus_tag LOCUS_20900 2548 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3188 4090 gene locus_tag LOCUS_20910 3188 4090 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103194.1 protein_id gnl|my_center|LOCUS_20910 4849 4037 gene locus_tag LOCUS_20920 4849 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 5179 5931 gene locus_tag LOCUS_20930 5179 5931 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976672.1 protein_id gnl|my_center|LOCUS_20930 5975 7663 gene locus_tag LOCUS_20940 5975 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 7638 7925 gene locus_tag LOCUS_20950 7638 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 9636 7963 gene locus_tag LOCUS_20960 gene devS 9636 7963 CDS product two-component system sensor histidine kinase DevS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899933.1 protein_id gnl|my_center|LOCUS_20960 9997 10881 gene locus_tag LOCUS_20970 9997 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence090 437 1177 gene locus_tag LOCUS_20980 gene cysE 437 1177 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_20980 2152 1259 gene locus_tag LOCUS_20990 2152 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2259 4754 gene locus_tag LOCUS_21000 gene pcrA 2259 4754 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_21000 4843 5718 gene locus_tag LOCUS_21010 gene folD 4843 5718 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_21010 5780 6370 gene locus_tag LOCUS_21020 5780 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 6382 6672 gene locus_tag LOCUS_21030 gene gatC 6382 6672 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143272.1 protein_id gnl|my_center|LOCUS_21030 6862 8394 gene locus_tag LOCUS_21040 gene gatA 6862 8394 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_21040 8413 9858 gene locus_tag LOCUS_21050 gene gatB 8413 9858 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_21050 9928 10128 gene locus_tag LOCUS_21060 9928 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence091 1099 20 gene locus_tag LOCUS_21070 gene wecB 1099 20 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_21070 2186 1269 gene locus_tag LOCUS_21080 2186 1269 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_21080 3382 2183 gene locus_tag LOCUS_21090 3382 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 5132 3435 gene locus_tag LOCUS_21100 5132 3435 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_21100 6761 5298 gene locus_tag LOCUS_21110 6761 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 7970 6777 gene locus_tag LOCUS_21120 7970 6777 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141501.1 protein_id gnl|my_center|LOCUS_21120 7969 8181 gene locus_tag LOCUS_21130 7969 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 8515 9729 gene locus_tag LOCUS_21140 8515 9729 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388109.1 protein_id gnl|my_center|LOCUS_21140 9779 10765 gene locus_tag LOCUS_21150 9779 10765 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence092 1493 798 gene locus_tag LOCUS_21160 1493 798 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 protein_id gnl|my_center|LOCUS_21160 2203 1568 gene locus_tag LOCUS_21170 2203 1568 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027667.1 protein_id gnl|my_center|LOCUS_21170 2986 2240 gene locus_tag LOCUS_21180 2986 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 3266 4399 gene locus_tag LOCUS_21190 3266 4399 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_21190 4396 5496 gene locus_tag LOCUS_21200 4396 5496 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966124.1 protein_id gnl|my_center|LOCUS_21200 6772 5555 gene locus_tag LOCUS_21210 6772 5555 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329196.1 protein_id gnl|my_center|LOCUS_21210 6985 6782 gene locus_tag LOCUS_21220 6985 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 8184 7012 gene locus_tag LOCUS_21230 8184 7012 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055608.1 protein_id gnl|my_center|LOCUS_21230 8295 8486 gene locus_tag LOCUS_21240 8295 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 8499 8960 gene locus_tag LOCUS_21250 8499 8960 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090630.1 protein_id gnl|my_center|LOCUS_21250 9043 10257 gene locus_tag LOCUS_21260 9043 10257 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015171.1 protein_id gnl|my_center|LOCUS_21260 <10907 10374 gene locus_tag LOCUS_21270 <10907 10374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005176347.1:high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF >Feature sequence093 1716 307 gene locus_tag LOCUS_21280 1716 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 3093 2098 gene locus_tag LOCUS_21290 3093 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 3258 4616 gene locus_tag LOCUS_21300 3258 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 4900 4598 gene locus_tag LOCUS_21310 4900 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 5097 5678 gene locus_tag LOCUS_21320 5097 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 5994 5919 gene locus_tag LOCUS_t00360 5994 5919 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8027 6069 gene locus_tag LOCUS_21330 8027 6069 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392858.1 protein_id gnl|my_center|LOCUS_21330 8376 8831 gene locus_tag LOCUS_21340 8376 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 10354 8951 gene locus_tag LOCUS_21350 gene rho 10354 8951 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873852.1 protein_id gnl|my_center|LOCUS_21350 10527 10354 gene locus_tag LOCUS_21360 10527 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence094 713 468 gene locus_tag LOCUS_21370 713 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 1063 992 gene locus_tag LOCUS_t00370 1063 992 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1238 1310 gene locus_tag LOCUS_t00380 1238 1310 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2275 1373 gene locus_tag LOCUS_21380 2275 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2249 2731 gene locus_tag LOCUS_21390 2249 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3810 3385 gene locus_tag LOCUS_21400 gene trxA 3810 3385 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228708.1 protein_id gnl|my_center|LOCUS_21400 4014 4757 gene locus_tag LOCUS_21410 4014 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 5071 6678 gene locus_tag LOCUS_21420 5071 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 6675 9074 gene locus_tag LOCUS_21430 6675 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 9388 9173 gene locus_tag LOCUS_21440 9388 9173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 9998 9543 gene locus_tag LOCUS_21450 9998 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence095 429 1457 gene locus_tag LOCUS_21460 429 1457 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_21460 1691 2275 gene locus_tag LOCUS_21470 1691 2275 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_21470 2306 2881 gene locus_tag LOCUS_21480 gene pth 2306 2881 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941324.1 protein_id gnl|my_center|LOCUS_21480 2886 6353 gene locus_tag LOCUS_21490 gene mfd 2886 6353 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_21490 6411 7676 gene locus_tag LOCUS_21500 6411 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 7798 9072 gene locus_tag LOCUS_21510 gene eno 7798 9072 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_21510 9392 9736 gene locus_tag LOCUS_21520 9392 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 9839 10168 gene locus_tag LOCUS_21530 9839 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence096 288 473 gene locus_tag LOCUS_21540 288 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 470 610 gene locus_tag LOCUS_21550 470 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 879 1475 gene locus_tag LOCUS_21560 879 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1429 2193 gene locus_tag LOCUS_21570 1429 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2251 5037 gene locus_tag LOCUS_21580 2251 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 5112 5588 gene locus_tag LOCUS_21590 5112 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 5706 6575 gene locus_tag LOCUS_21600 5706 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 6610 7689 gene locus_tag LOCUS_21610 6610 7689 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_21610 7673 9055 gene locus_tag LOCUS_21620 7673 9055 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence097 219 1379 gene locus_tag LOCUS_21630 219 1379 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546631.1 protein_id gnl|my_center|LOCUS_21630 1508 2443 gene locus_tag LOCUS_21640 1508 2443 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_21640 2660 3928 gene locus_tag LOCUS_21650 2660 3928 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618783.1 protein_id gnl|my_center|LOCUS_21650 3930 5537 gene locus_tag LOCUS_21660 3930 5537 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529505.1 protein_id gnl|my_center|LOCUS_21660 5549 6289 gene locus_tag LOCUS_21670 5549 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 6308 7207 gene locus_tag LOCUS_21680 gene fmt 6308 7207 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227858.1 protein_id gnl|my_center|LOCUS_21680 7173 8507 gene locus_tag LOCUS_21690 gene rsmB 7173 8507 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_21690 8596 8823 gene locus_tag LOCUS_21700 8596 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 9056 9733 gene locus_tag LOCUS_21710 gene rpe 9056 9733 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259044.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence098 993 133 gene locus_tag LOCUS_21720 993 133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_21720 2015 990 gene locus_tag LOCUS_21730 2015 990 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_21730 2272 2018 gene locus_tag LOCUS_21740 2272 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2153 2992 gene locus_tag LOCUS_21750 2153 2992 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110110.1 protein_id gnl|my_center|LOCUS_21750 3275 4780 gene locus_tag LOCUS_21760 3275 4780 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031209.1 protein_id gnl|my_center|LOCUS_21760 5053 5304 gene locus_tag LOCUS_21770 5053 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 5304 7511 gene locus_tag LOCUS_21780 5304 7511 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_21780 7508 7813 gene locus_tag LOCUS_21790 7508 7813 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063731.1 protein_id gnl|my_center|LOCUS_21790 8054 8308 gene locus_tag LOCUS_21800 8054 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence099 1466 54 gene locus_tag LOCUS_21810 gene lpdA 1466 54 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389631.1 protein_id gnl|my_center|LOCUS_21810 1983 1498 gene locus_tag LOCUS_21820 1983 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1918 2178 gene locus_tag LOCUS_21830 1918 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 3709 2171 gene locus_tag LOCUS_21840 3709 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 4731 3736 gene locus_tag LOCUS_21850 gene argF 4731 3736 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729314.1 protein_id gnl|my_center|LOCUS_21850 4910 5515 gene locus_tag LOCUS_21860 4910 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 6360 5596 gene locus_tag LOCUS_21870 6360 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 7613 6360 gene locus_tag LOCUS_21880 7613 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 8463 7642 gene locus_tag LOCUS_21890 8463 7642 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_21890 8674 8471 gene locus_tag LOCUS_21900 8674 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 <9411 8671 gene locus_tag LOCUS_21910 <9411 8671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421597.1:glycine oxidase ThiO >Feature sequence100 189 989 gene locus_tag LOCUS_21920 189 989 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878303.1 protein_id gnl|my_center|LOCUS_21920 979 1890 gene locus_tag LOCUS_21930 979 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2188 1784 gene locus_tag LOCUS_21940 2188 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2559 2185 gene locus_tag LOCUS_21950 2559 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2623 4239 gene locus_tag LOCUS_21960 gene fadD11 2623 4239 CDS product fatty acid--CoA ligase FadD11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083132908.1 protein_id gnl|my_center|LOCUS_21960 4289 7636 gene locus_tag LOCUS_21970 4289 7636 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726759.1 protein_id gnl|my_center|LOCUS_21970 7808 7596 gene locus_tag LOCUS_21980 7808 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence101 410 943 gene locus_tag LOCUS_21990 410 943 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087490.1 protein_id gnl|my_center|LOCUS_21990 1522 1025 gene locus_tag LOCUS_22000 1522 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3423 1660 gene locus_tag LOCUS_22010 3423 1660 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_22010 3857 4510 gene locus_tag LOCUS_22020 3857 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 5745 4627 gene locus_tag LOCUS_22030 5745 4627 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186383115.1 protein_id gnl|my_center|LOCUS_22030 6138 7118 gene locus_tag LOCUS_22040 6138 7118 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420788.1 protein_id gnl|my_center|LOCUS_22040 7246 8562 gene locus_tag LOCUS_22050 7246 8562 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_22050 >Feature sequence102 1053 592 gene locus_tag LOCUS_22060 1053 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 1184 1050 gene locus_tag LOCUS_22070 1184 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 1631 1969 gene locus_tag LOCUS_22080 1631 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 2015 2497 gene locus_tag LOCUS_22090 2015 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2978 2523 gene locus_tag LOCUS_22100 2978 2523 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_22100 3196 3591 gene locus_tag LOCUS_22110 3196 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 4090 3698 gene locus_tag LOCUS_22120 4090 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 4308 4087 gene locus_tag LOCUS_22130 4308 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 5864 4422 gene locus_tag LOCUS_22140 5864 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 5944 6261 gene locus_tag LOCUS_22150 5944 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 6261 8843 gene locus_tag LOCUS_22160 6261 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence103 886 1548 gene locus_tag LOCUS_22170 886 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1648 2475 gene locus_tag LOCUS_22180 1648 2475 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061277.1 protein_id gnl|my_center|LOCUS_22180 3707 2838 gene locus_tag LOCUS_22190 3707 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 4031 3723 gene locus_tag LOCUS_22200 4031 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 4092 5045 gene locus_tag LOCUS_22210 4092 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 5294 5968 gene locus_tag LOCUS_22220 5294 5968 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224709.1 protein_id gnl|my_center|LOCUS_22220 7443 6244 gene locus_tag LOCUS_22230 7443 6244 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_22230 9017 7440 gene locus_tag LOCUS_22240 9017 7440 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259622.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence104 1857 208 gene locus_tag LOCUS_22250 1857 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 3032 1863 gene locus_tag LOCUS_22260 gene aroC 3032 1863 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768335.1 protein_id gnl|my_center|LOCUS_22260 4258 3218 gene locus_tag LOCUS_22270 4258 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 4950 4255 gene locus_tag LOCUS_22280 4950 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 5746 4994 gene locus_tag LOCUS_22290 5746 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 7050 5743 gene locus_tag LOCUS_22300 7050 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 7802 7050 gene locus_tag LOCUS_22310 7802 7050 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_22310 8533 8030 gene locus_tag LOCUS_22320 8533 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence105 <1 1586 gene locus_tag LOCUS_22330 <1 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259744.1:methionine synthase 4077 1693 gene locus_tag LOCUS_22340 4077 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 4125 4823 gene locus_tag LOCUS_22350 4125 4823 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_22350 4835 5566 gene locus_tag LOCUS_22360 4835 5566 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_22360 5791 6405 gene locus_tag LOCUS_22370 5791 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 6885 6532 gene locus_tag LOCUS_22380 gene erpA 6885 6532 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228822.1 protein_id gnl|my_center|LOCUS_22380 6998 7261 gene locus_tag LOCUS_22390 6998 7261 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125238.1 protein_id gnl|my_center|LOCUS_22390 7410 7745 gene locus_tag LOCUS_22400 gene grxD 7410 7745 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874144.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence106 <1 503 gene locus_tag LOCUS_22410 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742140.1:amidohydrolase family protein 1820 651 gene locus_tag LOCUS_22420 1820 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2087 3067 gene locus_tag LOCUS_22430 2087 3067 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030499.1 protein_id gnl|my_center|LOCUS_22430 3520 3167 gene locus_tag LOCUS_22440 3520 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 5009 3657 gene locus_tag LOCUS_22450 5009 3657 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_22450 6688 5213 gene locus_tag LOCUS_22460 6688 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 7088 6957 gene locus_tag LOCUS_22470 7088 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 7420 7085 gene locus_tag LOCUS_22480 7420 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 8145 7867 gene locus_tag LOCUS_22490 8145 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence107 <1 815 gene locus_tag LOCUS_22500 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140935.1:potassium channel protein 1129 1518 gene locus_tag LOCUS_22510 1129 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978746.1 protein_id gnl|my_center|LOCUS_22510 3300 1762 gene locus_tag LOCUS_22520 3300 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 3756 4586 gene locus_tag LOCUS_22530 3756 4586 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228939.1 protein_id gnl|my_center|LOCUS_22530 5784 4678 gene locus_tag LOCUS_22540 5784 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 6420 6052 gene locus_tag LOCUS_22550 6420 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 6424 6711 gene locus_tag LOCUS_22560 6424 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 7577 7840 gene locus_tag LOCUS_22570 7577 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 >Feature sequence108 4999 1181 gene locus_tag LOCUS_22580 4999 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 6828 5239 gene locus_tag LOCUS_22590 6828 5239 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_22590 8126 6834 gene locus_tag LOCUS_22600 8126 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence109 <1 1063 gene locus_tag LOCUS_22610 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393729.1:phosphoglucosamine mutase 1157 3151 gene locus_tag LOCUS_22620 gene glmS 1157 3151 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_22620 3148 4974 gene locus_tag LOCUS_22630 3148 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 4986 6263 gene locus_tag LOCUS_22640 gene alr 4986 6263 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869879.1 protein_id gnl|my_center|LOCUS_22640 6272 7687 gene locus_tag LOCUS_22650 6272 7687 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_22650 >Feature sequence110 2199 1084 gene locus_tag LOCUS_22660 gene ftsZ 2199 1084 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_22660 3562 2438 gene locus_tag LOCUS_22670 3562 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 4477 4058 gene locus_tag LOCUS_22680 4477 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 4731 4468 gene locus_tag LOCUS_22690 4731 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 5203 4802 gene locus_tag LOCUS_22700 5203 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 5392 5231 gene locus_tag LOCUS_22710 5392 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 5720 7003 gene locus_tag LOCUS_22720 5720 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 7129 7563 gene locus_tag LOCUS_22730 7129 7563 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence111 1860 67 gene locus_tag LOCUS_22740 1860 67 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_22740 1955 2995 gene locus_tag LOCUS_22750 1955 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 5308 3083 gene locus_tag LOCUS_22760 gene acs 5308 3083 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404429.1 protein_id gnl|my_center|LOCUS_22760 6401 5355 gene locus_tag LOCUS_22770 6401 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 6485 6769 gene locus_tag LOCUS_22780 6485 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 7140 6991 gene locus_tag LOCUS_22790 7140 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 7561 7376 gene locus_tag LOCUS_22800 7561 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence112 291 1598 gene locus_tag LOCUS_22810 291 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2313 1945 gene locus_tag LOCUS_22820 2313 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2332 2592 gene locus_tag LOCUS_22830 2332 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2706 2930 gene locus_tag LOCUS_22840 2706 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2927 3151 gene locus_tag LOCUS_22850 2927 3151 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391794.1 protein_id gnl|my_center|LOCUS_22850 3240 5411 gene locus_tag LOCUS_22860 3240 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 5750 5442 gene locus_tag LOCUS_22870 5750 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 6424 7680 gene locus_tag LOCUS_22880 gene ltrA 6424 7680 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024495.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence113 <1 3013 gene locus_tag LOCUS_22890 <1 3013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393372.1:DNA polymerase III subunit alpha 3857 2958 gene locus_tag LOCUS_22900 3857 2958 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871993.1 protein_id gnl|my_center|LOCUS_22900 3886 5268 gene locus_tag LOCUS_22910 gene gltX 3886 5268 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087606.1 protein_id gnl|my_center|LOCUS_22910 5589 6761 gene locus_tag LOCUS_22920 5589 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 6860 7252 gene locus_tag LOCUS_22930 6860 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence114 861 1025 gene locus_tag LOCUS_22940 861 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 1756 1980 gene locus_tag LOCUS_22950 1756 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 1964 2500 gene locus_tag LOCUS_22960 1964 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 3524 3177 gene locus_tag LOCUS_22970 3524 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 5014 3956 gene locus_tag LOCUS_22980 5014 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 5983 5015 gene locus_tag LOCUS_22990 5983 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 6773 7000 gene locus_tag LOCUS_23000 6773 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 7062 7394 gene locus_tag LOCUS_23010 gene vapC26 7062 7394 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence115 464 973 gene locus_tag LOCUS_23020 464 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2138 1101 gene locus_tag LOCUS_23030 2138 1101 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_23030 2871 2209 gene locus_tag LOCUS_23040 2871 2209 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255933.1 protein_id gnl|my_center|LOCUS_23040 3871 2909 gene locus_tag LOCUS_23050 3871 2909 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880637.1 protein_id gnl|my_center|LOCUS_23050 3758 4126 gene locus_tag LOCUS_23060 3758 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 4600 4379 gene locus_tag LOCUS_23070 4600 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 4773 4928 gene locus_tag LOCUS_23080 4773 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 5003 5620 gene locus_tag LOCUS_23090 5003 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 6745 5675 gene locus_tag LOCUS_23100 6745 5675 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670421.1 protein_id gnl|my_center|LOCUS_23100 <7662 6983 gene locus_tag LOCUS_23110 <7662 6983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256332.1:ABC transporter permease >Feature sequence116 <1 848 gene locus_tag LOCUS_23120 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142060.1:threonine synthase 1724 900 gene locus_tag LOCUS_23130 1724 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2276 1893 gene locus_tag LOCUS_23140 2276 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2440 2366 gene locus_tag LOCUS_t00390 2440 2366 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2536 3648 gene locus_tag LOCUS_23150 gene rnz 2536 3648 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_23150 3699 4253 gene locus_tag LOCUS_23160 gene pyrR 3699 4253 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_23160 4369 5346 gene locus_tag LOCUS_23170 4369 5346 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_23170 5343 6698 gene locus_tag LOCUS_23180 5343 6698 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031296484.1 protein_id gnl|my_center|LOCUS_23180 6701 7219 gene locus_tag LOCUS_23190 6701 7219 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence117 114 1235 gene locus_tag LOCUS_23200 114 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 1341 4112 gene locus_tag LOCUS_23210 1341 4112 CDS product branched-chain amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228917.1 protein_id gnl|my_center|LOCUS_23210 4162 4878 gene locus_tag LOCUS_23220 4162 4878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030616503.1 protein_id gnl|my_center|LOCUS_23220 6051 5014 gene locus_tag LOCUS_23230 6051 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 7279 6080 gene locus_tag LOCUS_23240 7279 6080 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894393.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence118 <1 872 gene locus_tag LOCUS_23250 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583239.1:type IV pilus twitching motility protein PilT 888 2105 gene locus_tag LOCUS_23260 888 2105 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_23260 2227 3459 gene locus_tag LOCUS_23270 2227 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4784 3591 gene locus_tag LOCUS_23280 gene rnd 4784 3591 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919573.1 protein_id gnl|my_center|LOCUS_23280 6271 4781 gene locus_tag LOCUS_23290 6271 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 7189 6485 gene locus_tag LOCUS_23300 7189 6485 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390248.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence119 313 720 gene locus_tag LOCUS_23310 313 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 759 1835 gene locus_tag LOCUS_23320 759 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 3239 1992 gene locus_tag LOCUS_23330 3239 1992 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_23330 4408 4013 gene locus_tag LOCUS_23340 4408 4013 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417916.1 protein_id gnl|my_center|LOCUS_23340 4701 4405 gene locus_tag LOCUS_23350 4701 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 5116 4787 gene locus_tag LOCUS_23360 5116 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 5311 5120 gene locus_tag LOCUS_23370 5311 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 6548 5652 gene locus_tag LOCUS_23380 6548 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 <7250 6622 gene locus_tag LOCUS_23390 <7250 6622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027206.1:catalase/peroxidase HPI >Feature sequence120 1919 987 gene locus_tag LOCUS_23400 1919 987 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_23400 2452 1916 gene locus_tag LOCUS_23410 gene rfbC 2452 1916 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_23410 3739 2507 gene locus_tag LOCUS_23420 3739 2507 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974172.1 protein_id gnl|my_center|LOCUS_23420 4803 3736 gene locus_tag LOCUS_23430 gene rfbG 4803 3736 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967024.1 protein_id gnl|my_center|LOCUS_23430 5668 4841 gene locus_tag LOCUS_23440 gene rfbF 5668 4841 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence121 838 1104 gene locus_tag LOCUS_23450 838 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 1148 1327 gene locus_tag LOCUS_23460 1148 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 1452 2132 gene locus_tag LOCUS_23470 1452 2132 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410108.1 protein_id gnl|my_center|LOCUS_23470 2233 2568 gene locus_tag LOCUS_23480 2233 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2677 3045 gene locus_tag LOCUS_23490 2677 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 3127 3444 gene locus_tag LOCUS_23500 3127 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 3522 4640 gene locus_tag LOCUS_23510 3522 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 4615 5445 gene locus_tag LOCUS_23520 4615 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 5834 5559 gene locus_tag LOCUS_23530 5834 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 6061 5840 gene locus_tag LOCUS_23540 6061 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 6029 6316 gene locus_tag LOCUS_23550 6029 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 <7047 6373 gene locus_tag LOCUS_23560 <7047 6373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000678909.1:site-specific integrase >Feature sequence122 969 97 gene locus_tag LOCUS_23570 gene thrB 969 97 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_23570 2052 1033 gene locus_tag LOCUS_23580 gene thrC 2052 1033 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406172.1 protein_id gnl|my_center|LOCUS_23580 3452 2049 gene locus_tag LOCUS_23590 3452 2049 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_23590 4761 3442 gene locus_tag LOCUS_23600 gene lysA 4761 3442 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_23600 4755 5762 gene locus_tag LOCUS_23610 gene htpX 4755 5762 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392235.1 protein_id gnl|my_center|LOCUS_23610 5800 6471 gene locus_tag LOCUS_23620 5800 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence123 799 2004 gene locus_tag LOCUS_23630 799 2004 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125976.1 protein_id gnl|my_center|LOCUS_23630 2001 3239 gene locus_tag LOCUS_23640 2001 3239 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_23640 3282 4334 gene locus_tag LOCUS_23650 3282 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4449 5351 gene locus_tag LOCUS_23660 4449 5351 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230821.1 protein_id gnl|my_center|LOCUS_23660 6003 5458 gene locus_tag LOCUS_23670 6003 5458 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227509.1 protein_id gnl|my_center|LOCUS_23670 6086 6700 gene locus_tag LOCUS_23680 6086 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence124 <1 1904 gene locus_tag LOCUS_23690 <1 1904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393678.1:hydrogenase 4 subunit B 1901 2830 gene locus_tag LOCUS_23700 1901 2830 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_23700 2827 3444 gene locus_tag LOCUS_23710 2827 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 3437 4909 gene locus_tag LOCUS_23720 3437 4909 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 protein_id gnl|my_center|LOCUS_23720 4906 6354 gene locus_tag LOCUS_23730 4906 6354 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272520.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence125 69 296 gene locus_tag LOCUS_23740 69 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 651 1415 gene locus_tag LOCUS_23750 651 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 3164 1494 gene locus_tag LOCUS_23760 3164 1494 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_23760 4036 3161 gene locus_tag LOCUS_23770 gene dapA 4036 3161 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_23770 4836 4048 gene locus_tag LOCUS_23780 gene dapB 4836 4048 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728512.1 protein_id gnl|my_center|LOCUS_23780 6179 4833 gene locus_tag LOCUS_23790 6179 4833 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228102.1 protein_id gnl|my_center|LOCUS_23790 <6729 6220 gene locus_tag LOCUS_23800 <6729 6220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390266.1:polyribonucleotide nucleotidyltransferase >Feature sequence126 104 268 gene locus_tag LOCUS_23810 104 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 299 793 gene locus_tag LOCUS_23820 299 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 807 1457 gene locus_tag LOCUS_23830 807 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 3400 1688 gene locus_tag LOCUS_23840 3400 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3577 4734 gene locus_tag LOCUS_23850 3577 4734 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence127 6132 3166 gene locus_tag LOCUS_23860 6132 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 <6697 6157 gene locus_tag LOCUS_23870 <6697 6157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939590.1:type IA DNA topoisomerase >Feature sequence128 2180 1053 gene locus_tag LOCUS_23880 2180 1053 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552051.1 protein_id gnl|my_center|LOCUS_23880 3681 2173 gene locus_tag LOCUS_23890 3681 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 4838 3678 gene locus_tag LOCUS_23900 4838 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 5383 5042 gene locus_tag LOCUS_23910 5383 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 5508 5996 gene locus_tag LOCUS_23920 5508 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 5538 5547 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <6684 6176 gene locus_tag LOCUS_23930 <6684 6176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266467.1:glycosyltransferase >Feature sequence129 <1 1544 gene locus_tag LOCUS_23940 <1 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088683.1:NAD(P)/FAD-dependent oxidoreductase 1541 3043 gene locus_tag LOCUS_23950 1541 3043 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_23950 3079 3453 gene locus_tag LOCUS_23960 3079 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 3633 4847 gene locus_tag LOCUS_23970 3633 4847 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089721.1 protein_id gnl|my_center|LOCUS_23970 5352 5645 gene locus_tag LOCUS_23980 5352 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 5629 6153 gene locus_tag LOCUS_23990 5629 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence130 1365 295 gene locus_tag LOCUS_24000 1365 295 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257434.1 protein_id gnl|my_center|LOCUS_24000 1322 3292 gene locus_tag LOCUS_24010 1322 3292 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338628.1 protein_id gnl|my_center|LOCUS_24010 3327 4358 gene locus_tag LOCUS_24020 3327 4358 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390694.1 protein_id gnl|my_center|LOCUS_24020 4540 5130 gene locus_tag LOCUS_24030 4540 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 6627 5293 gene locus_tag LOCUS_24040 6627 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence131 4850 78 gene locus_tag LOCUS_24050 4850 78 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775966.1 protein_id gnl|my_center|LOCUS_24050 5221 4865 gene locus_tag LOCUS_24060 5221 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 5850 5218 gene locus_tag LOCUS_24070 5850 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence132 1226 237 gene locus_tag LOCUS_24080 gene coxB 1226 237 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038913.1 protein_id gnl|my_center|LOCUS_24080 1523 2374 gene locus_tag LOCUS_24090 1523 2374 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900586.1 protein_id gnl|my_center|LOCUS_24090 2595 3599 gene locus_tag LOCUS_24100 2595 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 3752 4765 gene locus_tag LOCUS_24110 gene trxB 3752 4765 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731638.1 protein_id gnl|my_center|LOCUS_24110 5944 4787 gene locus_tag LOCUS_24120 5944 4787 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence133 <1 690 gene locus_tag LOCUS_24130 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257976.1:nucleotide sugar dehydrogenase 2962 764 gene locus_tag LOCUS_24140 2962 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 4713 2959 gene locus_tag LOCUS_24150 4713 2959 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100021.1 protein_id gnl|my_center|LOCUS_24150 4958 4713 gene locus_tag LOCUS_24160 4958 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 4887 6101 gene locus_tag LOCUS_24170 4887 6101 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 protein_id gnl|my_center|LOCUS_24170 6442 6116 gene locus_tag LOCUS_24180 6442 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence134 1298 2011 gene locus_tag LOCUS_24190 1298 2011 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_24190 1999 2676 gene locus_tag LOCUS_24200 1999 2676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_24200 2705 3466 gene locus_tag LOCUS_24210 2705 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 3508 4479 gene locus_tag LOCUS_24220 3508 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 4479 4748 gene locus_tag LOCUS_24230 4479 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 4745 6118 gene locus_tag LOCUS_24240 gene hemA 4745 6118 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence135 1856 42 gene locus_tag LOCUS_24250 1856 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1855 2325 gene locus_tag LOCUS_24260 gene tadA 1855 2325 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_24260 2495 3709 gene locus_tag LOCUS_24270 2495 3709 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_24270 3851 5413 gene locus_tag LOCUS_24280 3851 5413 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence136 159 794 gene locus_tag LOCUS_24290 159 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1374 913 gene locus_tag LOCUS_24300 1374 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 1962 1393 gene locus_tag LOCUS_24310 1962 1393 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_24310 2822 1962 gene locus_tag LOCUS_24320 2822 1962 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066949941.1 protein_id gnl|my_center|LOCUS_24320 3356 2889 gene locus_tag LOCUS_24330 3356 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 3630 3361 gene locus_tag LOCUS_24340 3630 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 4348 3731 gene locus_tag LOCUS_24350 4348 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 6111 4330 gene locus_tag LOCUS_24360 6111 4330 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880188.1 protein_id gnl|my_center|LOCUS_24360 >Feature sequence137 2493 517 gene locus_tag LOCUS_24370 2493 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 3513 2578 gene locus_tag LOCUS_24380 3513 2578 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391360.1 protein_id gnl|my_center|LOCUS_24380 4890 3547 gene locus_tag LOCUS_24390 4890 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 5339 4872 gene locus_tag LOCUS_24400 5339 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 <6296 5457 gene locus_tag LOCUS_24410 <6296 5457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246158.1:alanine--tRNA ligase >Feature sequence138 877 611 gene locus_tag LOCUS_24420 877 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 1232 1945 gene locus_tag LOCUS_24430 1232 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2424 4157 gene locus_tag LOCUS_24440 2424 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 4366 5472 gene locus_tag LOCUS_24450 4366 5472 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385032.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence139 <1 586 gene locus_tag LOCUS_24460 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258793.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN 1541 783 gene locus_tag LOCUS_24470 1541 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2299 1538 gene locus_tag LOCUS_24480 2299 1538 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392874.1 protein_id gnl|my_center|LOCUS_24480 3341 2304 gene locus_tag LOCUS_24490 gene trpS 3341 2304 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817343.1 protein_id gnl|my_center|LOCUS_24490 3559 5061 gene locus_tag LOCUS_24500 3559 5061 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876999.1 protein_id gnl|my_center|LOCUS_24500 5295 5549 gene locus_tag LOCUS_24510 5295 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence140 1147 779 gene locus_tag LOCUS_24520 1147 779 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929420.1 protein_id gnl|my_center|LOCUS_24520 4880 1254 gene locus_tag LOCUS_24530 gene nifJ 4880 1254 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 protein_id gnl|my_center|LOCUS_24530 5998 4880 gene locus_tag LOCUS_24540 5998 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence141 995 243 gene locus_tag LOCUS_24550 995 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 1167 1388 gene locus_tag LOCUS_24560 1167 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1708 1439 gene locus_tag LOCUS_24570 1708 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 2671 1745 gene locus_tag LOCUS_24580 2671 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2800 3570 gene locus_tag LOCUS_24590 2800 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 3741 4040 gene locus_tag LOCUS_24600 3741 4040 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480331.1 protein_id gnl|my_center|LOCUS_24600 5916 4198 gene locus_tag LOCUS_24610 5916 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence142 <1 726 gene locus_tag LOCUS_24620 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942994.1:malto-oligosyltrehalose trehalohydrolase 723 2870 gene locus_tag LOCUS_24630 gene glgX 723 2870 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971803.1 protein_id gnl|my_center|LOCUS_24630 2867 5011 gene locus_tag LOCUS_24640 2867 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 <6004 5101 gene locus_tag LOCUS_24650 <6004 5101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034285284.1:dipeptidase >Feature sequence143 2511 307 gene locus_tag LOCUS_24660 2511 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 3354 2776 gene locus_tag LOCUS_24670 3354 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 4328 3354 gene locus_tag LOCUS_24680 gene mreC 4328 3354 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_24680 5537 4488 gene locus_tag LOCUS_24690 5537 4488 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence144 145 2793 gene locus_tag LOCUS_24700 145 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 3514 2813 gene locus_tag LOCUS_24710 3514 2813 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227789.1 protein_id gnl|my_center|LOCUS_24710 5105 3519 gene locus_tag LOCUS_24720 gene cobA 5105 3519 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 protein_id gnl|my_center|LOCUS_24720 <5857 5102 gene locus_tag LOCUS_24730 <5857 5102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888978.1:hydroxymethylbilane synthase >Feature sequence145 1254 424 gene locus_tag LOCUS_24740 1254 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1577 2242 gene locus_tag LOCUS_24750 1577 2242 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_24750 3315 2323 gene locus_tag LOCUS_24760 3315 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24760 3894 5309 gene locus_tag LOCUS_24770 3894 5309 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence146 <1 2054 gene locus_tag LOCUS_24780 <1 2054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898855.1:carbamoyl-phosphate synthase large subunit 2424 2714 gene locus_tag LOCUS_24790 2424 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2874 3458 gene locus_tag LOCUS_24800 gene gmk 2874 3458 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055909.1 protein_id gnl|my_center|LOCUS_24800 3559 3786 gene locus_tag LOCUS_24810 gene rpoZ 3559 3786 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_24810 3794 5044 gene locus_tag LOCUS_24820 gene coaBC 3794 5044 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_24820 5131 5499 gene locus_tag LOCUS_24830 5131 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence147 1665 217 gene locus_tag LOCUS_24840 1665 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2023 1769 gene locus_tag LOCUS_24850 gene rpmA 2023 1769 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_24850 2342 2013 gene locus_tag LOCUS_24860 gene rplU 2342 2013 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412578.1 protein_id gnl|my_center|LOCUS_24860 4282 2339 gene locus_tag LOCUS_24870 4282 2339 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_24870 <5742 4561 gene locus_tag LOCUS_24880 <5742 4561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392361.1:putative lipid II flippase FtsW >Feature sequence148 225 965 gene locus_tag LOCUS_24890 225 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 987 2141 gene locus_tag LOCUS_24900 987 2141 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612378.1 protein_id gnl|my_center|LOCUS_24900 2254 3942 gene locus_tag LOCUS_24910 2254 3942 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256282.1 protein_id gnl|my_center|LOCUS_24910 3961 4839 gene locus_tag LOCUS_24920 3961 4839 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112839.1 protein_id gnl|my_center|LOCUS_24920 >Feature sequence149 373 161 gene locus_tag LOCUS_24930 373 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 1629 373 gene locus_tag LOCUS_24940 1629 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence150 <1 1237 gene locus_tag LOCUS_24950 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023666.1:oligosaccharide flippase family protein 1682 1272 gene locus_tag LOCUS_24960 1682 1272 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037032.1 protein_id gnl|my_center|LOCUS_24960 1909 1679 gene locus_tag LOCUS_24970 1909 1679 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 protein_id gnl|my_center|LOCUS_24970 2154 2348 gene locus_tag LOCUS_24980 2154 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2398 2835 gene locus_tag LOCUS_24990 2398 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 3295 2906 gene locus_tag LOCUS_25000 3295 2906 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_25000 3570 3295 gene locus_tag LOCUS_25010 3570 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 4024 3761 gene locus_tag LOCUS_25020 4024 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 5348 4026 gene locus_tag LOCUS_25030 5348 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence151 608 342 gene locus_tag LOCUS_25040 608 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 853 605 gene locus_tag LOCUS_25050 853 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1205 864 gene locus_tag LOCUS_25060 1205 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2626 1406 gene locus_tag LOCUS_25070 2626 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 3550 2717 gene locus_tag LOCUS_25080 gene trpC 3550 2717 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028830.1 protein_id gnl|my_center|LOCUS_25080 4723 3671 gene locus_tag LOCUS_25090 gene trpD 4723 3671 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_25090 5381 4812 gene locus_tag LOCUS_25100 5381 4812 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence152 2013 238 gene locus_tag LOCUS_25110 2013 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2549 2016 gene locus_tag LOCUS_25120 2549 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 3406 2546 gene locus_tag LOCUS_25130 3406 2546 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_25130 5043 3403 gene locus_tag LOCUS_25140 5043 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence153 702 481 gene locus_tag LOCUS_25150 702 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1223 699 gene locus_tag LOCUS_25160 1223 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 1790 1230 gene locus_tag LOCUS_25170 gene efp 1790 1230 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_25170 2424 1864 gene locus_tag LOCUS_25180 2424 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2702 3994 gene locus_tag LOCUS_25190 2702 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 5041 3941 gene locus_tag LOCUS_25200 5041 3941 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence154 489 2306 gene locus_tag LOCUS_25210 489 2306 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039823.1 protein_id gnl|my_center|LOCUS_25210 2351 2938 gene locus_tag LOCUS_25220 2351 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 3424 3008 gene locus_tag LOCUS_25230 3424 3008 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087490.1 protein_id gnl|my_center|LOCUS_25230 3612 4778 gene locus_tag LOCUS_25240 3612 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence155 351 1757 gene locus_tag LOCUS_25250 gene nusA 351 1757 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_25250 1939 4653 gene locus_tag LOCUS_25260 gene infB 1939 4653 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541506.1 protein_id gnl|my_center|LOCUS_25260 4735 5142 gene locus_tag LOCUS_25270 gene rbfA 4735 5142 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence156 63 371 gene locus_tag LOCUS_25280 63 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 368 2002 gene locus_tag LOCUS_25290 gene nadB 368 2002 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140848.1 protein_id gnl|my_center|LOCUS_25290 2264 2719 gene locus_tag LOCUS_25300 2264 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 2779 4827 gene locus_tag LOCUS_25310 2779 4827 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530170.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence157 457 386 gene locus_tag LOCUS_t00400 457 386 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1225 677 gene locus_tag LOCUS_25320 1225 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3192 1393 gene locus_tag LOCUS_25330 3192 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 3338 3985 gene locus_tag LOCUS_25340 3338 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence158 2630 534 gene locus_tag LOCUS_25350 2630 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3916 2630 gene locus_tag LOCUS_25360 3916 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531618.1 protein_id gnl|my_center|LOCUS_25360 4142 3960 gene locus_tag LOCUS_25370 4142 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 4561 4139 gene locus_tag LOCUS_25380 4561 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 4560 4712 gene locus_tag LOCUS_25390 4560 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 5035 4814 gene locus_tag LOCUS_25400 5035 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence159 1 315 gene locus_tag LOCUS_25410 1 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 815 597 gene locus_tag LOCUS_25420 815 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 1173 904 gene locus_tag LOCUS_25430 1173 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 1417 1830 gene locus_tag LOCUS_25440 1417 1830 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486342.1 protein_id gnl|my_center|LOCUS_25440 2304 2077 gene locus_tag LOCUS_25450 2304 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3371 2454 gene locus_tag LOCUS_25460 3371 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 <5095 3509 gene locus_tag LOCUS_25470 <5095 3509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066868161.1:cytochrome c oxidase subunit I >Feature sequence160 633 1883 gene locus_tag LOCUS_25480 633 1883 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228182.1 protein_id gnl|my_center|LOCUS_25480 2069 2569 gene locus_tag LOCUS_25490 2069 2569 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104226.1 protein_id gnl|my_center|LOCUS_25490 3396 2563 gene locus_tag LOCUS_25500 3396 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 <5086 3581 gene locus_tag LOCUS_25510 <5086 3581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484240.1:Na+/H+ antiporter NhaA >Feature sequence161 204 806 gene locus_tag LOCUS_25520 204 806 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387688.1 protein_id gnl|my_center|LOCUS_25520 3806 978 gene locus_tag LOCUS_25530 3806 978 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950392.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence162 671 237 gene locus_tag LOCUS_25540 gene rplM 671 237 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004710905.1 protein_id gnl|my_center|LOCUS_25540 2391 769 gene locus_tag LOCUS_25550 gene guaA 2391 769 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_25550 3577 2384 gene locus_tag LOCUS_25560 3577 2384 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence163 772 311 gene locus_tag LOCUS_25570 772 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 2273 822 gene locus_tag LOCUS_25580 2273 822 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541187.1 protein_id gnl|my_center|LOCUS_25580 3492 2344 gene locus_tag LOCUS_25590 gene yhbH 3492 2344 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392048.1 protein_id gnl|my_center|LOCUS_25590 <5045 3489 gene locus_tag LOCUS_25600 <5045 3489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812023.1:PrkA family serine protein kinase >Feature sequence164 1436 138 gene locus_tag LOCUS_25610 gene hisS 1436 138 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057735.1 protein_id gnl|my_center|LOCUS_25610 2152 1433 gene locus_tag LOCUS_25620 2152 1433 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889182.1 protein_id gnl|my_center|LOCUS_25620 2538 2149 gene locus_tag LOCUS_25630 2538 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3542 2670 gene locus_tag LOCUS_25640 gene ftcD 3542 2670 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_25640 3771 3844 gene locus_tag LOCUS_t00410 3771 3844 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4293 4664 gene locus_tag LOCUS_25650 4293 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence165 1331 48 gene locus_tag LOCUS_25660 1331 48 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211285741.1 protein_id gnl|my_center|LOCUS_25660 1547 1398 gene locus_tag LOCUS_25670 1547 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2158 1772 gene locus_tag LOCUS_25680 2158 1772 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417916.1 protein_id gnl|my_center|LOCUS_25680 2453 2166 gene locus_tag LOCUS_25690 2453 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 2560 2814 gene locus_tag LOCUS_25700 2560 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 4396 3443 gene locus_tag LOCUS_25710 4396 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence166 1597 287 gene locus_tag LOCUS_25720 1597 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2346 1597 gene locus_tag LOCUS_25730 2346 1597 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229293.1 protein_id gnl|my_center|LOCUS_25730 2556 2816 gene locus_tag LOCUS_25740 2556 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 3076 2864 gene locus_tag LOCUS_25750 3076 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 3128 3292 gene locus_tag LOCUS_25760 3128 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 4266 3592 gene locus_tag LOCUS_25770 4266 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 <4897 4263 gene locus_tag LOCUS_25780 <4897 4263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259098.1:sugar transferase >Feature sequence167 671 1252 gene locus_tag LOCUS_25790 671 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2029 1670 gene locus_tag LOCUS_25800 2029 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 3314 2619 gene locus_tag LOCUS_25810 3314 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3777 3520 gene locus_tag LOCUS_25820 3777 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 4031 3774 gene locus_tag LOCUS_25830 4031 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929158.1 protein_id gnl|my_center|LOCUS_25830 4412 4047 gene locus_tag LOCUS_25840 4412 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence168 <1 639 gene locus_tag LOCUS_25850 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817427.1:glutamine amidotransferase 711 1037 gene locus_tag LOCUS_25860 711 1037 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172987.1 protein_id gnl|my_center|LOCUS_25860 2432 1047 gene locus_tag LOCUS_25870 2432 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 3641 2481 gene locus_tag LOCUS_25880 3641 2481 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_25880 4713 3628 gene locus_tag LOCUS_25890 4713 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence169 2 781 gene locus_tag LOCUS_25900 2 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 781 1314 gene locus_tag LOCUS_25910 gene nuoI 781 1314 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258756.1 protein_id gnl|my_center|LOCUS_25910 1471 2238 gene locus_tag LOCUS_25920 1471 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2235 2534 gene locus_tag LOCUS_25930 gene nuoK 2235 2534 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480224.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence170 1946 3301 gene locus_tag LOCUS_25940 1946 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 3521 4342 gene locus_tag LOCUS_25950 3521 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 4446 4517 gene locus_tag LOCUS_t00420 4446 4517 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence171 1775 42 gene locus_tag LOCUS_25960 gene trpE 1775 42 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_25960 2534 1845 gene locus_tag LOCUS_25970 gene hisIE 2534 1845 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_25970 2608 3660 gene locus_tag LOCUS_25980 2608 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 4102 3671 gene locus_tag LOCUS_25990 4102 3671 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319218.1 protein_id gnl|my_center|LOCUS_25990 <4646 4126 gene locus_tag LOCUS_26000 <4646 4126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895864.1:GTPase Era >Feature sequence172 173 1408 gene locus_tag LOCUS_26010 173 1408 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877954.1 protein_id gnl|my_center|LOCUS_26010 1405 3885 gene locus_tag LOCUS_26020 1405 3885 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729600.1 protein_id gnl|my_center|LOCUS_26020 3878 4483 gene locus_tag LOCUS_26030 3878 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence173 146 1417 gene locus_tag LOCUS_26040 146 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2145 1507 gene locus_tag LOCUS_26050 2145 1507 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727052.1 protein_id gnl|my_center|LOCUS_26050 3719 2160 gene locus_tag LOCUS_26060 3719 2160 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_26060 4456 3716 gene locus_tag LOCUS_26070 4456 3716 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888542.1 protein_id gnl|my_center|LOCUS_26070 >Feature sequence174 <1 678 gene locus_tag LOCUS_26080 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878463.1:enoyl-CoA hydratase/isomerase family protein 1470 823 gene locus_tag LOCUS_26090 1470 823 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467027.1 protein_id gnl|my_center|LOCUS_26090 3152 1467 gene locus_tag LOCUS_26100 3152 1467 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877899.1 protein_id gnl|my_center|LOCUS_26100 4119 3160 gene locus_tag LOCUS_26110 4119 3160 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878166.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence175 1261 215 gene locus_tag LOCUS_26120 1261 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 1979 1569 gene locus_tag LOCUS_26130 1979 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2488 2138 gene locus_tag LOCUS_26140 2488 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2725 2495 gene locus_tag LOCUS_26150 2725 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3094 2795 gene locus_tag LOCUS_26160 3094 2795 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546760.1 protein_id gnl|my_center|LOCUS_26160 4500 3091 gene locus_tag LOCUS_26170 gene ltrA 4500 3091 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_26170 >Feature sequence176 2602 2132 gene locus_tag LOCUS_26180 2602 2132 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_26180 2898 2599 gene locus_tag LOCUS_26190 gene rpsO 2898 2599 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890045.1 protein_id gnl|my_center|LOCUS_26190 3899 3009 gene locus_tag LOCUS_26200 3899 3009 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404517.1 protein_id gnl|my_center|LOCUS_26200 <4563 3904 gene locus_tag LOCUS_26210 <4563 3904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804656.1:tRNA pseudouridine(55) synthase TruB >Feature sequence177 278 631 gene locus_tag LOCUS_26220 gene rplR 278 631 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624044.1 protein_id gnl|my_center|LOCUS_26220 680 1483 gene locus_tag LOCUS_26230 680 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1483 1674 gene locus_tag LOCUS_26240 gene rpmD 1483 1674 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727688.1 protein_id gnl|my_center|LOCUS_26240 1664 2200 gene locus_tag LOCUS_26250 gene rplO 1664 2200 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_26250 2296 3567 gene locus_tag LOCUS_26260 gene secY 2296 3567 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854402.1 protein_id gnl|my_center|LOCUS_26260 3746 4423 gene locus_tag LOCUS_26270 3746 4423 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence178 498 322 gene locus_tag LOCUS_26280 498 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 2714 648 gene locus_tag LOCUS_26290 2714 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 3313 2711 gene locus_tag LOCUS_26300 3313 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 3711 3316 gene locus_tag LOCUS_26310 3711 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence179 <1 744 gene locus_tag LOCUS_26320 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921547.1:DUF1015 domain-containing protein 1059 1466 gene locus_tag LOCUS_26330 1059 1466 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_26330 1520 2104 gene locus_tag LOCUS_26340 1520 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 2802 2227 gene locus_tag LOCUS_26350 2802 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 >Feature sequence180 649 500 gene locus_tag LOCUS_26360 649 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 960 646 gene locus_tag LOCUS_26370 960 646 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_26370 2488 1331 gene locus_tag LOCUS_26380 2488 1331 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958509.1 protein_id gnl|my_center|LOCUS_26380 3091 2639 gene locus_tag LOCUS_26390 3091 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 3279 3566 gene locus_tag LOCUS_26400 3279 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 3570 3989 gene locus_tag LOCUS_26410 3570 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 4257 4108 gene locus_tag LOCUS_26420 4257 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence181 525 752 gene locus_tag LOCUS_26430 525 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 1782 919 gene locus_tag LOCUS_26440 1782 919 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325558.1 protein_id gnl|my_center|LOCUS_26440 2618 1779 gene locus_tag LOCUS_26450 2618 1779 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_26450 2900 3397 gene locus_tag LOCUS_26460 2900 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence182 2430 973 gene locus_tag LOCUS_26470 2430 973 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878348.1 protein_id gnl|my_center|LOCUS_26470 2575 2784 gene locus_tag LOCUS_26480 2575 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 3614 2868 gene locus_tag LOCUS_26490 3614 2868 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296677.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence183 1718 2839 gene locus_tag LOCUS_26500 1718 2839 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 protein_id gnl|my_center|LOCUS_26500 2882 3499 gene locus_tag LOCUS_26510 2882 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 3562 4179 gene locus_tag LOCUS_26520 3562 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence184 3673 698 gene locus_tag LOCUS_26530 3673 698 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_26530 <4288 3699 gene locus_tag LOCUS_26540 <4288 3699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259049.1:polysulfide reductase NrfD >Feature sequence185 1529 345 gene locus_tag LOCUS_26550 1529 345 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_26550 2181 1630 gene locus_tag LOCUS_26560 2181 1630 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545889.1 protein_id gnl|my_center|LOCUS_26560 3252 2422 gene locus_tag LOCUS_26570 3252 2422 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972302.1 protein_id gnl|my_center|LOCUS_26570 4263 3355 gene locus_tag LOCUS_26580 4263 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence186 2280 181 gene locus_tag LOCUS_26590 gene kdpB 2280 181 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_26590 3023 2277 gene locus_tag LOCUS_26600 3023 2277 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029186.1 protein_id gnl|my_center|LOCUS_26600 4261 3113 gene locus_tag LOCUS_26610 4261 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence187 4187 912 gene locus_tag LOCUS_26620 4187 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence188 333 731 gene locus_tag LOCUS_26630 gene gcvH 333 731 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_26630 742 2382 gene locus_tag LOCUS_26640 742 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 2379 4040 gene locus_tag LOCUS_26650 gene gcvPB 2379 4040 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393440.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence189 <1 2689 gene locus_tag LOCUS_26660 <1 2689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932519.1:glycosyl hydrolase family 65 protein 2761 3570 gene locus_tag LOCUS_26670 2761 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence190 674 2734 gene locus_tag LOCUS_26680 674 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence191 982 14 gene locus_tag LOCUS_26690 982 14 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_26690 1720 1049 gene locus_tag LOCUS_26700 1720 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2178 1756 gene locus_tag LOCUS_26710 gene dtd 2178 1756 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_26710 3286 2255 gene locus_tag LOCUS_26720 gene galT 3286 2255 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence192 440 988 gene locus_tag LOCUS_26730 440 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 1088 1339 gene locus_tag LOCUS_26740 1088 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 1456 1758 gene locus_tag LOCUS_26750 1456 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 2207 1746 gene locus_tag LOCUS_26760 2207 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2808 2332 gene locus_tag LOCUS_26770 2808 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 2954 2805 gene locus_tag LOCUS_26780 2954 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 >Feature sequence193 29 1006 gene locus_tag LOCUS_26790 29 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1017 945 gene locus_tag LOCUS_t00430 1017 945 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1248 3833 gene locus_tag LOCUS_26800 gene leuS 1248 3833 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence194 862 1482 gene locus_tag LOCUS_26810 862 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 1589 2041 gene locus_tag LOCUS_26820 1589 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 2373 2092 gene locus_tag LOCUS_26830 2373 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 3249 2497 gene locus_tag LOCUS_26840 3249 2497 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939534.1 protein_id gnl|my_center|LOCUS_26840 >Feature sequence195 2060 3706 gene locus_tag LOCUS_26850 2060 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence196 312 1454 gene locus_tag LOCUS_26860 312 1454 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879898.1 protein_id gnl|my_center|LOCUS_26860 1456 2625 gene locus_tag LOCUS_26870 1456 2625 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878160.1 protein_id gnl|my_center|LOCUS_26870 2637 3350 gene locus_tag LOCUS_26880 2637 3350 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816772.1 protein_id gnl|my_center|LOCUS_26880 3483 3492 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence197 679 194 gene locus_tag LOCUS_26890 gene ispF 679 194 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_26890 1533 676 gene locus_tag LOCUS_26900 1533 676 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_26900 2275 1544 gene locus_tag LOCUS_26910 gene ispD 2275 1544 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419436.1 protein_id gnl|my_center|LOCUS_26910 2784 2338 gene locus_tag LOCUS_26920 2784 2338 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_26920 <3852 2968 gene locus_tag LOCUS_26930 <3852 2968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003393302.1:DNA integrity scanning diadenylate cyclase DisA >Feature sequence198 849 1691 gene locus_tag LOCUS_26940 849 1691 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_26940 1761 2843 gene locus_tag LOCUS_26950 gene aksF 1761 2843 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875823.1 protein_id gnl|my_center|LOCUS_26950 3649 3008 gene locus_tag LOCUS_26960 3649 3008 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence199 118 798 gene locus_tag LOCUS_26970 118 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 2240 1848 gene locus_tag LOCUS_26980 2240 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 2502 2245 gene locus_tag LOCUS_26990 2502 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 3258 2941 gene locus_tag LOCUS_27000 3258 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27000 >Feature sequence200 1124 3439 gene locus_tag LOCUS_27010 1124 3439 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028834.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence201 1686 478 gene locus_tag LOCUS_27020 1686 478 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225667.1 protein_id gnl|my_center|LOCUS_27020 2280 1690 gene locus_tag LOCUS_27030 2280 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 <3790 2330 gene locus_tag LOCUS_27040 <3790 2330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039293.1:carboxyl transferase domain-containing protein >Feature sequence202 1048 29 gene locus_tag LOCUS_27050 1048 29 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028006.1 protein_id gnl|my_center|LOCUS_27050 1242 3281 gene locus_tag LOCUS_27060 1242 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence203 141 2840 gene locus_tag LOCUS_27070 141 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence204 708 73 gene locus_tag LOCUS_27080 708 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 867 715 gene locus_tag LOCUS_27090 867 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2673 964 gene locus_tag LOCUS_27100 2673 964 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_27100 3214 2807 gene locus_tag LOCUS_27110 3214 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3516 3443 gene locus_tag LOCUS_t00440 3516 3443 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence205 <1 1973 gene locus_tag LOCUS_27120 <1 1973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531306.1:protein translocase subunit SecDF 1973 2284 gene locus_tag LOCUS_27130 1973 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence206 320 90 gene locus_tag LOCUS_27140 320 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 618 1571 gene locus_tag LOCUS_27150 618 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 1652 3451 gene locus_tag LOCUS_27160 1652 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence207 <1 803 gene locus_tag LOCUS_27170 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259706.1:DNA replication/repair protein RecF 796 1101 gene locus_tag LOCUS_27180 796 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence208 359 286 gene locus_tag LOCUS_t00450 359 286 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 787 1581 gene locus_tag LOCUS_27190 787 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 2981 1650 gene locus_tag LOCUS_27200 2981 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence209 <1 983 gene locus_tag LOCUS_27210 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104178.1:maltose alpha-D-glucosyltransferase 1006 3456 gene locus_tag LOCUS_27220 gene glgB 1006 3456 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_27220 >Feature sequence210 <1 888 gene locus_tag LOCUS_27230 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975718.1:Ppx/GppA phosphatase family protein 2837 1176 gene locus_tag LOCUS_27240 2837 1176 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409218.1 protein_id gnl|my_center|LOCUS_27240 3121 3035 gene locus_tag LOCUS_t00460 3121 3035 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence211 424 1602 gene locus_tag LOCUS_27250 424 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 2791 1781 gene locus_tag LOCUS_27260 2791 1781 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225667.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence212 311 1000 gene locus_tag LOCUS_27270 311 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 1031 1216 gene locus_tag LOCUS_27280 1031 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 1541 1771 gene locus_tag LOCUS_27290 1541 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 1774 2151 gene locus_tag LOCUS_27300 1774 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence213 547 77 gene locus_tag LOCUS_27310 547 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1182 544 gene locus_tag LOCUS_27320 1182 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1886 2899 gene locus_tag LOCUS_27330 1886 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence214 <1 553 gene locus_tag LOCUS_27340 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140155.1:adenosylcobinamide-GDP ribazoletransferase 561 1472 gene locus_tag LOCUS_27350 561 1472 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731186.1 protein_id gnl|my_center|LOCUS_27350 2741 1506 gene locus_tag LOCUS_27360 2741 1506 CDS product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256085.1 protein_id gnl|my_center|LOCUS_27360 <3335 2833 gene locus_tag LOCUS_27370 <3335 2833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726789.1:MaoC family dehydratase >Feature sequence215 <1 1460 gene locus_tag LOCUS_27380 <1 1460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899884.1:long-chain-fatty-acid--CoA ligase FadD2 1457 2020 gene locus_tag LOCUS_27390 1457 2020 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence216 <1 2471 gene locus_tag LOCUS_27400 <1 2471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096872.1:DNA helicase II >Feature sequence217 1608 484 gene locus_tag LOCUS_27410 1608 484 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029024.1 protein_id gnl|my_center|LOCUS_27410 2453 1740 gene locus_tag LOCUS_27420 2453 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence218 276 1010 gene locus_tag LOCUS_27430 276 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1155 2099 gene locus_tag LOCUS_27440 1155 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2112 2339 gene locus_tag LOCUS_27450 2112 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence219 1259 1942 gene locus_tag LOCUS_27460 1259 1942 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_27460 2916 1963 gene locus_tag LOCUS_27470 2916 1963 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257881.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence220 902 639 gene locus_tag LOCUS_27480 902 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 1141 899 gene locus_tag LOCUS_27490 1141 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 1766 1221 gene locus_tag LOCUS_27500 1766 1221 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_27500 2295 1753 gene locus_tag LOCUS_27510 2295 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 2831 2292 gene locus_tag LOCUS_27520 gene pyrE 2831 2292 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417034.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence221 683 492 gene locus_tag LOCUS_27530 gene rpmB 683 492 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_27530 1151 696 gene locus_tag LOCUS_27540 gene ribH 1151 696 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403828.1 protein_id gnl|my_center|LOCUS_27540 2457 1141 gene locus_tag LOCUS_27550 2457 1141 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_27550 2955 2500 gene locus_tag LOCUS_27560 2955 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence222 1045 2037 gene locus_tag LOCUS_27570 1045 2037 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence223 1035 1577 gene locus_tag LOCUS_27580 1035 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 1710 2258 gene locus_tag LOCUS_27590 1710 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 2461 2979 gene locus_tag LOCUS_27600 2461 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence224 <1 809 gene locus_tag LOCUS_27610 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393787.1:FadR/GntR family transcriptional regulator 806 1792 gene locus_tag LOCUS_27620 806 1792 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973121.1 protein_id gnl|my_center|LOCUS_27620 1789 2835 gene locus_tag LOCUS_27630 1789 2835 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973122.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence225 1370 321 gene locus_tag LOCUS_27640 1370 321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613522.1 protein_id gnl|my_center|LOCUS_27640 2979 1447 gene locus_tag LOCUS_27650 2979 1447 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030683778.1 protein_id gnl|my_center|LOCUS_27650 >Feature sequence226 1391 69 gene locus_tag LOCUS_27660 gene thrC 1391 69 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880362.1 protein_id gnl|my_center|LOCUS_27660 <2969 1388 gene locus_tag LOCUS_27670 <2969 1388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942849.1:leucine--tRNA ligase >Feature sequence227 156 1079 gene locus_tag LOCUS_27680 156 1079 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540892.1 protein_id gnl|my_center|LOCUS_27680 1248 2792 gene locus_tag LOCUS_27690 1248 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence228 <1 516 gene locus_tag LOCUS_27700 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003703168.1:UMP kinase 506 1075 gene locus_tag LOCUS_27710 gene frr 506 1075 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_27710 1072 1773 gene locus_tag LOCUS_27720 1072 1773 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081614.1 protein_id gnl|my_center|LOCUS_27720 1971 2732 gene locus_tag LOCUS_27730 1971 2732 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence229 135 800 gene locus_tag LOCUS_27740 135 800 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 protein_id gnl|my_center|LOCUS_27740 817 1167 gene locus_tag LOCUS_27750 817 1167 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 protein_id gnl|my_center|LOCUS_27750 1338 2441 gene locus_tag LOCUS_27760 1338 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27760 2644 2408 gene locus_tag LOCUS_27770 2644 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 >Feature sequence230 636 439 gene locus_tag LOCUS_27780 636 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 1565 744 gene locus_tag LOCUS_27790 1565 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 <2877 1657 gene locus_tag LOCUS_27800 <2877 1657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390949.1:ABC transporter ATP-binding protein >Feature sequence231 1667 48 gene locus_tag LOCUS_27810 1667 48 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258761.1 protein_id gnl|my_center|LOCUS_27810 <2862 1750 gene locus_tag LOCUS_27820 <2862 1750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013061939.1:NADH-quinone oxidoreductase subunit M >Feature sequence232 <1 600 gene locus_tag LOCUS_27830 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106007140.1:DedA family protein 794 492 gene locus_tag LOCUS_27840 794 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1562 879 gene locus_tag LOCUS_27850 1562 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 1666 2160 gene locus_tag LOCUS_27860 gene furA1 1666 2160 CDS product fur family transcriptional regulator FurA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731249.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence233 1171 881 gene locus_tag LOCUS_27870 gene relF 1171 881 CDS product type II toxin-antitoxin system antitoxin RelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414599.1 protein_id gnl|my_center|LOCUS_27870 1509 1769 gene locus_tag LOCUS_27880 1509 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 2047 1880 gene locus_tag LOCUS_27890 2047 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 2502 2056 gene locus_tag LOCUS_27900 2502 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 >Feature sequence234 957 214 gene locus_tag LOCUS_27910 957 214 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_27910 1182 2507 gene locus_tag LOCUS_27920 1182 2507 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402992.1 protein_id gnl|my_center|LOCUS_27920 2827 2663 gene locus_tag LOCUS_27930 2827 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence235 577 912 gene locus_tag LOCUS_27940 577 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 995 1402 gene locus_tag LOCUS_27950 995 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 1399 1794 gene locus_tag LOCUS_27960 1399 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 2014 1940 gene locus_tag LOCUS_t00470 2014 1940 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2188 2532 gene locus_tag LOCUS_27970 2188 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 2540 2612 gene locus_tag LOCUS_t00480 2540 2612 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence236 32 1192 gene locus_tag LOCUS_27980 32 1192 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942893.1 protein_id gnl|my_center|LOCUS_27980 1283 1858 gene locus_tag LOCUS_27990 1283 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence237 50 319 gene locus_tag LOCUS_28000 50 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 786 625 gene locus_tag LOCUS_28010 786 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 1161 1415 gene locus_tag LOCUS_28020 1161 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 2659 1799 gene locus_tag LOCUS_28030 2659 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence238 969 1880 gene locus_tag LOCUS_28040 969 1880 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_28040 <2686 1977 gene locus_tag LOCUS_28050 <2686 1977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977314.1:GTP pyrophosphokinase >Feature sequence239 1134 313 gene locus_tag LOCUS_28060 1134 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 1496 1242 gene locus_tag LOCUS_28070 1496 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 1852 2466 gene locus_tag LOCUS_28080 1852 2466 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088195.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence240 776 192 gene locus_tag LOCUS_28090 776 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 1012 773 gene locus_tag LOCUS_28100 1012 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2062 1412 gene locus_tag LOCUS_28110 2062 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 2400 2059 gene locus_tag LOCUS_28120 2400 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 2118 2127 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence241 1143 205 gene locus_tag LOCUS_28130 1143 205 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191243275.1 protein_id gnl|my_center|LOCUS_28130 2049 1270 gene locus_tag LOCUS_28140 2049 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 >Feature sequence242 <1 860 gene locus_tag LOCUS_28150 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030315.1:chromosome segregation protein SMC 861 1895 gene locus_tag LOCUS_28160 gene ftsY 861 1895 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_28160 2027 2455 gene locus_tag LOCUS_28170 2027 2455 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977025.1 protein_id gnl|my_center|LOCUS_28170