>Feature sequence001 <1 626 gene locus_tag LOCUS_00010 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256532.1:FTR1 family protein 1687 746 gene locus_tag LOCUS_00020 1687 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3161 2046 gene locus_tag LOCUS_00030 3161 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3753 6719 gene locus_tag LOCUS_00040 gene ileS 3753 6719 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_00040 6716 7225 gene locus_tag LOCUS_00050 gene lspA 6716 7225 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014705.1 protein_id gnl|my_center|LOCUS_00050 7253 8029 gene locus_tag LOCUS_00060 7253 8029 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_00060 8440 8084 gene locus_tag LOCUS_00070 8440 8084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8635 9243 gene locus_tag LOCUS_00080 8635 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9402 12497 gene locus_tag LOCUS_00090 gene uvrA 9402 12497 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_00090 12497 13834 gene locus_tag LOCUS_00100 12497 13834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13961 14707 gene locus_tag LOCUS_00110 13961 14707 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491603.1 protein_id gnl|my_center|LOCUS_00110 15661 14867 gene locus_tag LOCUS_00120 15661 14867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15742 16356 gene locus_tag LOCUS_00130 gene hpt 15742 16356 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_00130 16525 17328 gene locus_tag LOCUS_00140 gene deoC 16525 17328 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_00140 17408 19366 gene locus_tag LOCUS_00150 17408 19366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 21475 19382 gene locus_tag LOCUS_00160 21475 19382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22323 21565 gene locus_tag LOCUS_00170 22323 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22557 23882 gene locus_tag LOCUS_00180 gene aroA 22557 23882 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403445.1 protein_id gnl|my_center|LOCUS_00180 26215 23984 gene locus_tag LOCUS_00190 26215 23984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 26750 27700 gene locus_tag LOCUS_00200 gene truA 26750 27700 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_00200 27810 29084 gene locus_tag LOCUS_00210 27810 29084 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_00210 29129 30130 gene locus_tag LOCUS_00220 29129 30130 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392639.1 protein_id gnl|my_center|LOCUS_00220 30330 32024 gene locus_tag LOCUS_00230 30330 32024 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_00230 32181 32771 gene locus_tag LOCUS_00240 32181 32771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 34193 32838 gene locus_tag LOCUS_00250 gene lysA 34193 32838 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401767.1 protein_id gnl|my_center|LOCUS_00250 35041 34190 gene locus_tag LOCUS_00260 35041 34190 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267659.1 protein_id gnl|my_center|LOCUS_00260 36363 35155 gene locus_tag LOCUS_00270 36363 35155 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706487.1 protein_id gnl|my_center|LOCUS_00270 36755 36504 gene locus_tag LOCUS_00280 36755 36504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 38024 37014 gene locus_tag LOCUS_00290 38024 37014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37917 38303 gene locus_tag LOCUS_00300 37917 38303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 38450 38923 gene locus_tag LOCUS_00310 38450 38923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39121 40515 gene locus_tag LOCUS_00320 39121 40515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 41141 40521 gene locus_tag LOCUS_00330 41141 40521 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_00330 42713 41148 gene locus_tag LOCUS_00340 gene guaA 42713 41148 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_00340 43727 42747 gene locus_tag LOCUS_00350 43727 42747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 46435 43808 gene locus_tag LOCUS_00360 gene leuS 46435 43808 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_00360 48060 46513 gene locus_tag LOCUS_00370 48060 46513 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_00370 49203 48268 gene locus_tag LOCUS_00380 49203 48268 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_00380 50211 49219 gene locus_tag LOCUS_00390 50211 49219 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466227.1 protein_id gnl|my_center|LOCUS_00390 51625 50348 gene locus_tag LOCUS_00400 gene clpX 51625 50348 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056361.1 protein_id gnl|my_center|LOCUS_00400 52271 51681 gene locus_tag LOCUS_00410 gene clpP 52271 51681 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_00410 53837 52344 gene locus_tag LOCUS_00420 gene tig 53837 52344 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_00420 54775 54524 gene locus_tag LOCUS_00430 54775 54524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 56017 54920 gene locus_tag LOCUS_00440 56017 54920 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158561.1 protein_id gnl|my_center|LOCUS_00440 56429 57151 gene locus_tag LOCUS_00450 56429 57151 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_00450 58042 57158 gene locus_tag LOCUS_00460 58042 57158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 58344 58676 gene locus_tag LOCUS_00470 58344 58676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 60497 58785 gene locus_tag LOCUS_00480 60497 58785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 63464 60681 gene locus_tag LOCUS_00490 63464 60681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 63806 64231 gene locus_tag LOCUS_00500 63806 64231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 64787 64509 gene locus_tag LOCUS_00510 64787 64509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 65373 64963 gene locus_tag LOCUS_00520 65373 64963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 65434 66105 gene locus_tag LOCUS_00530 65434 66105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 67632 66826 gene locus_tag LOCUS_00540 67632 66826 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_00540 67816 68778 gene locus_tag LOCUS_00550 gene sppA 67816 68778 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_00550 68845 69186 gene locus_tag LOCUS_00560 68845 69186 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_00560 69986 69381 gene locus_tag LOCUS_00570 69986 69381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 70224 70694 gene locus_tag LOCUS_00580 70224 70694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 70908 71351 gene locus_tag LOCUS_00590 70908 71351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 71348 72400 gene locus_tag LOCUS_00600 71348 72400 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_00600 72817 72521 gene locus_tag LOCUS_00610 72817 72521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 74123 72921 gene locus_tag LOCUS_00620 74123 72921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 74250 74603 gene locus_tag LOCUS_00630 74250 74603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 75867 75025 gene locus_tag LOCUS_00640 75867 75025 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_00640 76029 77798 gene locus_tag LOCUS_00650 76029 77798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 77928 77779 gene locus_tag LOCUS_00660 77928 77779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 77997 78998 gene locus_tag LOCUS_00670 77997 78998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 79244 79065 gene locus_tag LOCUS_00680 79244 79065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 79633 79244 gene locus_tag LOCUS_00690 79633 79244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 80900 79734 gene locus_tag LOCUS_00700 80900 79734 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_00700 81370 80957 gene locus_tag LOCUS_00710 gene msrB 81370 80957 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070109.1 protein_id gnl|my_center|LOCUS_00710 81527 81601 gene locus_tag LOCUS_t00010 81527 81601 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 82956 81673 gene locus_tag LOCUS_00720 82956 81673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 83457 83972 gene locus_tag LOCUS_00730 83457 83972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 84344 85003 gene locus_tag LOCUS_00740 84344 85003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 85000 85953 gene locus_tag LOCUS_00750 85000 85953 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976054.1 protein_id gnl|my_center|LOCUS_00750 86193 85972 gene locus_tag LOCUS_00760 86193 85972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 86223 86405 gene locus_tag LOCUS_00770 86223 86405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 87376 88110 gene locus_tag LOCUS_00780 87376 88110 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_00780 88581 88195 gene locus_tag LOCUS_00790 88581 88195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 89065 90117 gene locus_tag LOCUS_00800 89065 90117 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_00800 90694 90332 gene locus_tag LOCUS_00810 90694 90332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 91064 90744 gene locus_tag LOCUS_00820 91064 90744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 93714 91549 gene locus_tag LOCUS_00830 93714 91549 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969651.1 protein_id gnl|my_center|LOCUS_00830 94811 93711 gene locus_tag LOCUS_00840 94811 93711 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975037.1 protein_id gnl|my_center|LOCUS_00840 95494 95772 gene locus_tag LOCUS_00850 95494 95772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 96486 96034 gene locus_tag LOCUS_00860 96486 96034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 96665 97300 gene locus_tag LOCUS_00870 96665 97300 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_00870 97935 97681 gene locus_tag LOCUS_00880 97935 97681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 98258 97938 gene locus_tag LOCUS_00890 98258 97938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 99144 98608 gene locus_tag LOCUS_00900 99144 98608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 99468 99163 gene locus_tag LOCUS_00910 99468 99163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 99636 100712 gene locus_tag LOCUS_00920 99636 100712 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_00920 100994 100818 gene locus_tag LOCUS_00930 100994 100818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 101334 101011 gene locus_tag LOCUS_00940 101334 101011 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390589.1 protein_id gnl|my_center|LOCUS_00940 101645 101355 gene locus_tag LOCUS_00950 101645 101355 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390588.1 protein_id gnl|my_center|LOCUS_00950 101982 102206 gene locus_tag LOCUS_00960 101982 102206 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140251.1 protein_id gnl|my_center|LOCUS_00960 102308 102622 gene locus_tag LOCUS_00970 102308 102622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 103054 102662 gene locus_tag LOCUS_00980 103054 102662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 103821 103186 gene locus_tag LOCUS_00990 103821 103186 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_00990 103955 104707 gene locus_tag LOCUS_01000 103955 104707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 105314 105090 gene locus_tag LOCUS_01010 105314 105090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 105950 105507 gene locus_tag LOCUS_01020 105950 105507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 106524 105910 gene locus_tag LOCUS_01030 106524 105910 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_01030 107140 106682 gene locus_tag LOCUS_01040 107140 106682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 107180 108634 gene locus_tag LOCUS_01050 107180 108634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 108631 109908 gene locus_tag LOCUS_01060 108631 109908 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027071.1 protein_id gnl|my_center|LOCUS_01060 109905 111179 gene locus_tag LOCUS_01070 109905 111179 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089037.1 protein_id gnl|my_center|LOCUS_01070 111182 113164 gene locus_tag LOCUS_01080 gene asnB 111182 113164 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027075.1 protein_id gnl|my_center|LOCUS_01080 113648 113824 gene locus_tag LOCUS_01090 113648 113824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 113776 113973 gene locus_tag LOCUS_01100 113776 113973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 114206 114748 gene locus_tag LOCUS_01110 114206 114748 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705140.1 protein_id gnl|my_center|LOCUS_01110 116358 114754 gene locus_tag LOCUS_01120 116358 114754 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389689.1 protein_id gnl|my_center|LOCUS_01120 116805 116560 gene locus_tag LOCUS_01130 116805 116560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 117131 116772 gene locus_tag LOCUS_01140 117131 116772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 119451 117196 gene locus_tag LOCUS_01150 119451 117196 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022286.1 protein_id gnl|my_center|LOCUS_01150 122127 119701 gene locus_tag LOCUS_01160 122127 119701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 123017 122175 gene locus_tag LOCUS_01170 123017 122175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 123730 123041 gene locus_tag LOCUS_01180 123730 123041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 124362 123784 gene locus_tag LOCUS_01190 124362 123784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 125186 126010 gene locus_tag LOCUS_01200 125186 126010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 126007 126918 gene locus_tag LOCUS_01210 126007 126918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 126921 127688 gene locus_tag LOCUS_01220 126921 127688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 127698 128810 gene locus_tag LOCUS_01230 127698 128810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 128803 129750 gene locus_tag LOCUS_01240 128803 129750 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065630.1 protein_id gnl|my_center|LOCUS_01240 133592 129906 gene locus_tag LOCUS_01250 133592 129906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 134102 133926 gene locus_tag LOCUS_01260 134102 133926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 136140 134872 gene locus_tag LOCUS_01270 136140 134872 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113702.1 protein_id gnl|my_center|LOCUS_01270 137667 136354 gene locus_tag LOCUS_01280 gene gltP 137667 136354 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096956.1 protein_id gnl|my_center|LOCUS_01280 138096 139028 gene locus_tag LOCUS_01290 gene cysD 138096 139028 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417374.1 protein_id gnl|my_center|LOCUS_01290 139028 140668 gene locus_tag LOCUS_01300 gene cysN 139028 140668 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786535.1 protein_id gnl|my_center|LOCUS_01300 140668 141360 gene locus_tag LOCUS_01310 140668 141360 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172761.1 protein_id gnl|my_center|LOCUS_01310 143174 141582 gene locus_tag LOCUS_01320 143174 141582 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_01320 144132 143224 gene locus_tag LOCUS_01330 144132 143224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 145146 144250 gene locus_tag LOCUS_01340 145146 144250 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228547.1 protein_id gnl|my_center|LOCUS_01340 145440 147722 gene locus_tag LOCUS_01350 145440 147722 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108997.1 protein_id gnl|my_center|LOCUS_01350 149225 147750 gene locus_tag LOCUS_01360 149225 147750 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_01360 150894 149236 gene locus_tag LOCUS_01370 150894 149236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 151470 150979 gene locus_tag LOCUS_01380 151470 150979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 152488 151415 gene locus_tag LOCUS_01390 152488 151415 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742152.1 protein_id gnl|my_center|LOCUS_01390 153816 152587 gene locus_tag LOCUS_01400 153816 152587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 155558 153813 gene locus_tag LOCUS_01410 155558 153813 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534221.1 protein_id gnl|my_center|LOCUS_01410 156274 155555 gene locus_tag LOCUS_01420 156274 155555 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936452.1 protein_id gnl|my_center|LOCUS_01420 157302 156271 gene locus_tag LOCUS_01430 157302 156271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534104.1 protein_id gnl|my_center|LOCUS_01430 159148 157394 gene locus_tag LOCUS_01440 159148 157394 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533218.1 protein_id gnl|my_center|LOCUS_01440 159672 160523 gene locus_tag LOCUS_01450 159672 160523 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548064.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01450 160627 161394 gene locus_tag LOCUS_01460 160627 161394 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_01460 161473 163446 gene locus_tag LOCUS_01470 161473 163446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 165595 163541 gene locus_tag LOCUS_01480 165595 163541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 166679 165690 gene locus_tag LOCUS_01490 gene ispB 166679 165690 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693233.1 protein_id gnl|my_center|LOCUS_01490 167218 166718 gene locus_tag LOCUS_01500 167218 166718 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_01500 168112 167225 gene locus_tag LOCUS_01510 168112 167225 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_01510 170370 168127 gene locus_tag LOCUS_01520 170370 168127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 170555 172537 gene locus_tag LOCUS_01530 170555 172537 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 protein_id gnl|my_center|LOCUS_01530 174180 172663 gene locus_tag LOCUS_01540 174180 172663 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_01540 174770 174237 gene locus_tag LOCUS_01550 174770 174237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 175259 177571 gene locus_tag LOCUS_01560 175259 177571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 177598 178188 gene locus_tag LOCUS_01570 177598 178188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 178182 178664 gene locus_tag LOCUS_01580 178182 178664 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_01580 178669 179520 gene locus_tag LOCUS_01590 178669 179520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 180174 179554 gene locus_tag LOCUS_01600 gene yihA 180174 179554 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565283.1 protein_id gnl|my_center|LOCUS_01600 182246 180315 gene locus_tag LOCUS_01610 182246 180315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 183557 182562 gene locus_tag LOCUS_01620 183557 182562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 183838 184809 gene locus_tag LOCUS_01630 183838 184809 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009941024.1 protein_id gnl|my_center|LOCUS_01630 185538 184825 gene locus_tag LOCUS_01640 185538 184825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 185619 185924 gene locus_tag LOCUS_01650 185619 185924 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061280.1 protein_id gnl|my_center|LOCUS_01650 186519 185977 gene locus_tag LOCUS_01660 186519 185977 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083218.1 protein_id gnl|my_center|LOCUS_01660 186764 187471 gene locus_tag LOCUS_01670 186764 187471 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531388.1 protein_id gnl|my_center|LOCUS_01670 187823 190195 gene locus_tag LOCUS_01680 187823 190195 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_01680 190321 190554 gene locus_tag LOCUS_01690 190321 190554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 191559 191026 gene locus_tag LOCUS_01700 191559 191026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 191784 192680 gene locus_tag LOCUS_01710 191784 192680 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_01710 192694 193059 gene locus_tag LOCUS_01720 192694 193059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 194434 193079 gene locus_tag LOCUS_01730 194434 193079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 195799 194552 gene locus_tag LOCUS_01740 195799 194552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 197502 196078 gene locus_tag LOCUS_01750 gene ftsZ 197502 196078 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804705.1 protein_id gnl|my_center|LOCUS_01750 199319 198096 gene locus_tag LOCUS_01760 gene ftsA 199319 198096 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957399.1 protein_id gnl|my_center|LOCUS_01760 200365 199367 gene locus_tag LOCUS_01770 200365 199367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 200276 200533 gene locus_tag LOCUS_01780 200276 200533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 202049 200718 gene locus_tag LOCUS_01790 gene murC 202049 200718 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_01790 201930 202304 gene locus_tag LOCUS_01800 201930 202304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 202422 203834 gene locus_tag LOCUS_01810 202422 203834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 205226 204129 gene locus_tag LOCUS_01820 gene murG 205226 204129 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073900.1 protein_id gnl|my_center|LOCUS_01820 206323 205232 gene locus_tag LOCUS_01830 gene ftsW 206323 205232 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_01830 207690 206302 gene locus_tag LOCUS_01840 gene murD 207690 206302 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_01840 209114 207981 gene locus_tag LOCUS_01850 gene mraY 209114 207981 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458164.1 protein_id gnl|my_center|LOCUS_01850 209392 210918 gene locus_tag LOCUS_01860 209392 210918 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_01860 211287 211838 gene locus_tag LOCUS_01870 211287 211838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 212202 212801 gene locus_tag LOCUS_01880 212202 212801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 212858 213793 gene locus_tag LOCUS_01890 212858 213793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 >Feature sequence002 2426 216 gene locus_tag LOCUS_01900 2426 216 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226869.1 protein_id gnl|my_center|LOCUS_01900 4461 2485 gene locus_tag LOCUS_01910 4461 2485 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020638992.1 protein_id gnl|my_center|LOCUS_01910 5894 4458 gene locus_tag LOCUS_01920 5894 4458 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_01920 9210 5887 gene locus_tag LOCUS_01930 9210 5887 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_01930 9495 10580 gene locus_tag LOCUS_01940 9495 10580 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_01940 10924 12420 gene locus_tag LOCUS_01950 10924 12420 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_01950 12531 12905 gene locus_tag LOCUS_01960 12531 12905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 15972 12997 gene locus_tag LOCUS_01970 15972 12997 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_01970 16266 18419 gene locus_tag LOCUS_01980 16266 18419 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 protein_id gnl|my_center|LOCUS_01980 19639 18431 gene locus_tag LOCUS_01990 19639 18431 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976258.1 protein_id gnl|my_center|LOCUS_01990 21209 19788 gene locus_tag LOCUS_02000 21209 19788 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_02000 22694 21231 gene locus_tag LOCUS_02010 22694 21231 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_02010 25495 22781 gene locus_tag LOCUS_02020 25495 22781 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928482.1 protein_id gnl|my_center|LOCUS_02020 29082 25588 gene locus_tag LOCUS_02030 29082 25588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 29276 29422 gene locus_tag LOCUS_02040 29276 29422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 29419 31227 gene locus_tag LOCUS_02050 29419 31227 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705772.1 protein_id gnl|my_center|LOCUS_02050 32308 31331 gene locus_tag LOCUS_02060 gene iolX 32308 31331 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_02060 32733 33737 gene locus_tag LOCUS_02070 32733 33737 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195868.1 protein_id gnl|my_center|LOCUS_02070 33943 35400 gene locus_tag LOCUS_02080 gene eat 33943 35400 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195858.1 protein_id gnl|my_center|LOCUS_02080 35735 36232 gene locus_tag LOCUS_02090 35735 36232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 36870 37118 gene locus_tag LOCUS_02100 36870 37118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 37542 38117 gene locus_tag LOCUS_02110 37542 38117 CDS product DUF4337 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083279.1 protein_id gnl|my_center|LOCUS_02110 38140 38970 gene locus_tag LOCUS_02120 gene kdsA 38140 38970 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_02120 40196 39024 gene locus_tag LOCUS_02130 40196 39024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 41986 40904 gene locus_tag LOCUS_02140 41986 40904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 43029 42001 gene locus_tag LOCUS_02150 43029 42001 CDS product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196835716.1 protein_id gnl|my_center|LOCUS_02150 43475 43399 gene locus_tag LOCUS_t00020 43475 43399 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 43828 43556 gene locus_tag LOCUS_02160 43828 43556 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_02160 44463 43933 gene locus_tag LOCUS_02170 44463 43933 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940698.1 protein_id gnl|my_center|LOCUS_02170 45021 44611 gene locus_tag LOCUS_02180 45021 44611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 45020 45295 gene locus_tag LOCUS_02190 45020 45295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 48285 45487 gene locus_tag LOCUS_02200 gene ppc 48285 45487 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_02200 50416 48335 gene locus_tag LOCUS_02210 50416 48335 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_02210 50507 52030 gene locus_tag LOCUS_02220 50507 52030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 53945 52080 gene locus_tag LOCUS_02230 53945 52080 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122444.1 protein_id gnl|my_center|LOCUS_02230 55352 54102 gene locus_tag LOCUS_02240 gene rho 55352 54102 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_02240 55705 55487 gene locus_tag LOCUS_02250 55705 55487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 57810 56251 gene locus_tag LOCUS_02260 57810 56251 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_02260 57900 59309 gene locus_tag LOCUS_02270 57900 59309 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_02270 60168 59341 gene locus_tag LOCUS_02280 60168 59341 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_02280 61349 60165 gene locus_tag LOCUS_02290 61349 60165 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_02290 62044 62763 gene locus_tag LOCUS_02300 62044 62763 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920927.1 protein_id gnl|my_center|LOCUS_02300 63903 62770 gene locus_tag LOCUS_02310 gene dnaJ 63903 62770 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_02310 64505 63900 gene locus_tag LOCUS_02320 gene grpE 64505 63900 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_02320 65833 64760 gene locus_tag LOCUS_02330 gene hrcA 65833 64760 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_02330 66022 67065 gene locus_tag LOCUS_02340 66022 67065 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258385.1 protein_id gnl|my_center|LOCUS_02340 68086 67049 gene locus_tag LOCUS_02350 68086 67049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 69305 68319 gene locus_tag LOCUS_02360 69305 68319 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256958.1 protein_id gnl|my_center|LOCUS_02360 70188 69436 gene locus_tag LOCUS_02370 gene rph 70188 69436 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256154.1 protein_id gnl|my_center|LOCUS_02370 71396 72319 gene locus_tag LOCUS_02380 71396 72319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 72376 73764 gene locus_tag LOCUS_02390 gene atoC 72376 73764 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 protein_id gnl|my_center|LOCUS_02390 73840 74343 gene locus_tag LOCUS_02400 73840 74343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 75556 74441 gene locus_tag LOCUS_02410 75556 74441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 77349 76099 gene locus_tag LOCUS_02420 77349 76099 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889017.1 protein_id gnl|my_center|LOCUS_02420 78918 77383 gene locus_tag LOCUS_02430 78918 77383 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889218.1 protein_id gnl|my_center|LOCUS_02430 79675 79067 gene locus_tag LOCUS_02440 79675 79067 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_02440 80030 79704 gene locus_tag LOCUS_02450 80030 79704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 80237 80776 gene locus_tag LOCUS_02460 80237 80776 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_02460 80886 81722 gene locus_tag LOCUS_02470 80886 81722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 81897 85430 gene locus_tag LOCUS_02480 gene mfd 81897 85430 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_02480 85976 85431 gene locus_tag LOCUS_02490 85976 85431 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_02490 86114 87892 gene locus_tag LOCUS_02500 86114 87892 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_02500 88037 88945 gene locus_tag LOCUS_02510 gene galU 88037 88945 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_02510 88976 89452 gene locus_tag LOCUS_02520 gene bcp 88976 89452 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220392.1 protein_id gnl|my_center|LOCUS_02520 89469 90089 gene locus_tag LOCUS_02530 89469 90089 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528654.1 protein_id gnl|my_center|LOCUS_02530 91119 90124 gene locus_tag LOCUS_02540 91119 90124 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_02540 92054 91182 gene locus_tag LOCUS_02550 gene panC 92054 91182 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_02550 93017 92067 gene locus_tag LOCUS_02560 gene panB 93017 92067 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_02560 93342 94232 gene locus_tag LOCUS_02570 93342 94232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 94784 96106 gene locus_tag LOCUS_02580 94784 96106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440269.1 protein_id gnl|my_center|LOCUS_02580 97038 96148 gene locus_tag LOCUS_02590 97038 96148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 97145 97330 gene locus_tag LOCUS_02600 97145 97330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 97472 99244 gene locus_tag LOCUS_02610 gene dnaG 97472 99244 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_02610 99722 101236 gene locus_tag LOCUS_02620 99722 101236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 101323 102228 gene locus_tag LOCUS_02630 gene rnc 101323 102228 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_02630 102225 103088 gene locus_tag LOCUS_02640 102225 103088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 103111 103899 gene locus_tag LOCUS_02650 gene lepB 103111 103899 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933117.1 protein_id gnl|my_center|LOCUS_02650 103910 106771 gene locus_tag LOCUS_02660 103910 106771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 107414 106785 gene locus_tag LOCUS_02670 107414 106785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 108032 107532 gene locus_tag LOCUS_02680 gene mog 108032 107532 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_02680 108175 109296 gene locus_tag LOCUS_02690 108175 109296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 109506 110558 gene locus_tag LOCUS_02700 gene miaA 109506 110558 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_02700 110659 111693 gene locus_tag LOCUS_02710 gene tdh 110659 111693 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 protein_id gnl|my_center|LOCUS_02710 113478 111784 gene locus_tag LOCUS_02720 gene rpoD 113478 111784 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_02720 114519 113845 gene locus_tag LOCUS_02730 114519 113845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 115238 114516 gene locus_tag LOCUS_02740 gene rpoE 115238 114516 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_02740 116408 115461 gene locus_tag LOCUS_02750 116408 115461 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 protein_id gnl|my_center|LOCUS_02750 117581 116550 gene locus_tag LOCUS_02760 gene iolG 117581 116550 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_02760 118515 117625 gene locus_tag LOCUS_02770 118515 117625 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_02770 118411 118755 gene locus_tag LOCUS_02780 118411 118755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 118842 119783 gene locus_tag LOCUS_02790 118842 119783 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_02790 120676 119780 gene locus_tag LOCUS_02800 120676 119780 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223781.1 protein_id gnl|my_center|LOCUS_02800 122179 120713 gene locus_tag LOCUS_02810 122179 120713 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218124.1 protein_id gnl|my_center|LOCUS_02810 124068 122182 gene locus_tag LOCUS_02820 gene iolD 124068 122182 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_02820 124916 124092 gene locus_tag LOCUS_02830 gene iolB 124916 124092 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640197.1 protein_id gnl|my_center|LOCUS_02830 125151 126242 gene locus_tag LOCUS_02840 125151 126242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 127336 126500 gene locus_tag LOCUS_02850 127336 126500 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919502.1 protein_id gnl|my_center|LOCUS_02850 127638 129158 gene locus_tag LOCUS_02860 gene glpK 127638 129158 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_02860 129207 130778 gene locus_tag LOCUS_02870 129207 130778 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_02870 131165 132088 gene locus_tag LOCUS_02880 131165 132088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 132085 133266 gene locus_tag LOCUS_02890 132085 133266 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_02890 133342 136617 gene locus_tag LOCUS_02900 133342 136617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 137731 136769 gene locus_tag LOCUS_02910 137731 136769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 138793 137735 gene locus_tag LOCUS_02920 138793 137735 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461131.1 protein_id gnl|my_center|LOCUS_02920 140006 138843 gene locus_tag LOCUS_02930 140006 138843 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814041.1 protein_id gnl|my_center|LOCUS_02930 140290 140009 gene locus_tag LOCUS_02940 140290 140009 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_02940 141776 140334 gene locus_tag LOCUS_02950 gene gabD 141776 140334 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358103.1 protein_id gnl|my_center|LOCUS_02950 142413 141859 gene locus_tag LOCUS_02960 142413 141859 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464619.1 protein_id gnl|my_center|LOCUS_02960 142324 142569 gene locus_tag LOCUS_02970 142324 142569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 144028 142658 gene locus_tag LOCUS_02980 144028 142658 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 protein_id gnl|my_center|LOCUS_02980 144902 144030 gene locus_tag LOCUS_02990 144902 144030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 145705 146697 gene locus_tag LOCUS_03000 145705 146697 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256958.1 protein_id gnl|my_center|LOCUS_03000 146999 148276 gene locus_tag LOCUS_03010 146999 148276 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_03010 148337 150448 gene locus_tag LOCUS_03020 148337 150448 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083040.1 protein_id gnl|my_center|LOCUS_03020 150487 151629 gene locus_tag LOCUS_03030 150487 151629 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582708.1 protein_id gnl|my_center|LOCUS_03030 151721 152833 gene locus_tag LOCUS_03040 151721 152833 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994140.1 protein_id gnl|my_center|LOCUS_03040 153886 152936 gene locus_tag LOCUS_03050 153886 152936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 156593 154323 gene locus_tag LOCUS_03060 156593 154323 CDS product DUF5916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925729.1 protein_id gnl|my_center|LOCUS_03060 157944 156913 gene locus_tag LOCUS_03070 gene ruvB 157944 156913 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_03070 158091 159245 gene locus_tag LOCUS_03080 158091 159245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 159431 162076 gene locus_tag LOCUS_03090 gene gyrA 159431 162076 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_03090 162220 162441 gene locus_tag LOCUS_03100 162220 162441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 162485 163057 gene locus_tag LOCUS_03110 162485 163057 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206205.1 protein_id gnl|my_center|LOCUS_03110 163271 164293 gene locus_tag LOCUS_03120 163271 164293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 164567 165265 gene locus_tag LOCUS_03130 164567 165265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 165879 165538 gene locus_tag LOCUS_03140 165879 165538 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141555.1 protein_id gnl|my_center|LOCUS_03140 166633 165965 gene locus_tag LOCUS_03150 gene phoU 166633 165965 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853444.1 protein_id gnl|my_center|LOCUS_03150 167388 166630 gene locus_tag LOCUS_03160 gene pstB 167388 166630 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064266.1 protein_id gnl|my_center|LOCUS_03160 168729 167734 gene locus_tag LOCUS_03170 168729 167734 CDS product DedA family protein/thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036907.1 protein_id gnl|my_center|LOCUS_03170 169810 168797 gene locus_tag LOCUS_03180 169810 168797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 170530 169934 gene locus_tag LOCUS_03190 170530 169934 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977779.1 protein_id gnl|my_center|LOCUS_03190 171829 170648 gene locus_tag LOCUS_03200 gene hpnI 171829 170648 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197829.1 protein_id gnl|my_center|LOCUS_03200 172372 171965 gene locus_tag LOCUS_03210 172372 171965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 172418 172903 gene locus_tag LOCUS_03220 172418 172903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 173701 172943 gene locus_tag LOCUS_03230 173701 172943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 174979 173756 gene locus_tag LOCUS_03240 gene dnaJ 174979 173756 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_03240 175351 175001 gene locus_tag LOCUS_03250 175351 175001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 175640 175362 gene locus_tag LOCUS_03260 175640 175362 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_03260 175897 175679 gene locus_tag LOCUS_03270 175897 175679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 176124 175954 gene locus_tag LOCUS_03280 176124 175954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 178214 176286 gene locus_tag LOCUS_03290 gene dnaK 178214 176286 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_03290 179340 178399 gene locus_tag LOCUS_03300 179340 178399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 179623 179354 gene locus_tag LOCUS_03310 179623 179354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 >Feature sequence003 735 379 gene locus_tag LOCUS_03320 735 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 2053 746 gene locus_tag LOCUS_03330 2053 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 2298 3698 gene locus_tag LOCUS_03340 2298 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 3695 4678 gene locus_tag LOCUS_03350 gene thrB 3695 4678 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816738.1 protein_id gnl|my_center|LOCUS_03350 5034 5366 gene locus_tag LOCUS_03360 gene trxA 5034 5366 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_03360 7848 5437 gene locus_tag LOCUS_03370 gene lon 7848 5437 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705882.1 protein_id gnl|my_center|LOCUS_03370 8377 7976 gene locus_tag LOCUS_03380 gene mscL 8377 7976 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_03380 8629 9324 gene locus_tag LOCUS_03390 8629 9324 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 protein_id gnl|my_center|LOCUS_03390 9617 9330 gene locus_tag LOCUS_03400 9617 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 9756 10424 gene locus_tag LOCUS_03410 9756 10424 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_03410 11655 10579 gene locus_tag LOCUS_03420 gene mtnA 11655 10579 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_03420 13132 11906 gene locus_tag LOCUS_03430 13132 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 13481 13293 gene locus_tag LOCUS_03440 13481 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 13434 13667 gene locus_tag LOCUS_03450 13434 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 14222 13620 gene locus_tag LOCUS_03460 gene pyrE 14222 13620 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929494.1 protein_id gnl|my_center|LOCUS_03460 15695 14367 gene locus_tag LOCUS_03470 15695 14367 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797467.1 protein_id gnl|my_center|LOCUS_03470 17844 15811 gene locus_tag LOCUS_03480 gene uvrB 17844 15811 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_03480 19462 17894 gene locus_tag LOCUS_03490 19462 17894 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036870.1 protein_id gnl|my_center|LOCUS_03490 23141 19623 gene locus_tag LOCUS_03500 23141 19623 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766599.1 protein_id gnl|my_center|LOCUS_03500 24799 23276 gene locus_tag LOCUS_03510 24799 23276 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257845.1 protein_id gnl|my_center|LOCUS_03510 26313 24796 gene locus_tag LOCUS_03520 26313 24796 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_03520 27891 26335 gene locus_tag LOCUS_03530 27891 26335 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257847.1 protein_id gnl|my_center|LOCUS_03530 29975 27888 gene locus_tag LOCUS_03540 gene nuoL 29975 27888 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257848.1 protein_id gnl|my_center|LOCUS_03540 30399 30088 gene locus_tag LOCUS_03550 gene nuoK 30399 30088 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_03550 30893 30396 gene locus_tag LOCUS_03560 30893 30396 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140655.1 protein_id gnl|my_center|LOCUS_03560 32182 30995 gene locus_tag LOCUS_03570 gene nuoH 32182 30995 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257851.1 protein_id gnl|my_center|LOCUS_03570 32823 32179 gene locus_tag LOCUS_03580 32823 32179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 34071 32902 gene locus_tag LOCUS_03590 34071 32902 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257853.1 protein_id gnl|my_center|LOCUS_03590 34700 34068 gene locus_tag LOCUS_03600 34700 34068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 35322 34681 gene locus_tag LOCUS_03610 35322 34681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 35751 35380 gene locus_tag LOCUS_03620 gene ndhC 35751 35380 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_03620 35902 39603 gene locus_tag LOCUS_03630 gene nifJ 35902 39603 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_03630 39603 40610 gene locus_tag LOCUS_03640 39603 40610 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_03640 40962 42815 gene locus_tag LOCUS_03650 40962 42815 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_03650 42818 43861 gene locus_tag LOCUS_03660 42818 43861 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_03660 44154 46397 gene locus_tag LOCUS_03670 44154 46397 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918421.1 protein_id gnl|my_center|LOCUS_03670 48722 46506 gene locus_tag LOCUS_03680 48722 46506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108861.1 protein_id gnl|my_center|LOCUS_03680 49042 49542 gene locus_tag LOCUS_03690 49042 49542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 49535 51193 gene locus_tag LOCUS_03700 gene nuoF 49535 51193 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_03700 51190 51903 gene locus_tag LOCUS_03710 gene hoxU 51190 51903 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_03710 51900 52433 gene locus_tag LOCUS_03720 51900 52433 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_03720 52443 53870 gene locus_tag LOCUS_03730 52443 53870 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_03730 53867 54385 gene locus_tag LOCUS_03740 53867 54385 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_03740 54402 54476 gene locus_tag LOCUS_t00030 54402 54476 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 54558 55691 gene locus_tag LOCUS_03750 54558 55691 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109096.1 protein_id gnl|my_center|LOCUS_03750 58132 55757 gene locus_tag LOCUS_03760 58132 55757 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_03760 58710 60488 gene locus_tag LOCUS_03770 58710 60488 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065602.1 protein_id gnl|my_center|LOCUS_03770 60566 61465 gene locus_tag LOCUS_03780 60566 61465 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190155.1 protein_id gnl|my_center|LOCUS_03780 62999 61503 gene locus_tag LOCUS_03790 gene gltX 62999 61503 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_03790 63663 63103 gene locus_tag LOCUS_03800 63663 63103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 65354 63750 gene locus_tag LOCUS_03810 65354 63750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 66701 65649 gene locus_tag LOCUS_03820 66701 65649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 67451 68443 gene locus_tag LOCUS_03830 gene galE 67451 68443 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 protein_id gnl|my_center|LOCUS_03830 68655 69596 gene locus_tag LOCUS_03840 68655 69596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 69655 70596 gene locus_tag LOCUS_03850 69655 70596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 70744 71658 gene locus_tag LOCUS_03860 70744 71658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 73124 71898 gene locus_tag LOCUS_03870 73124 71898 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315676.1 protein_id gnl|my_center|LOCUS_03870 73326 74381 gene locus_tag LOCUS_03880 73326 74381 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_03880 74378 75208 gene locus_tag LOCUS_03890 74378 75208 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_03890 75262 76392 gene locus_tag LOCUS_03900 75262 76392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 77808 76486 gene locus_tag LOCUS_03910 77808 76486 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968439.1 protein_id gnl|my_center|LOCUS_03910 77958 78218 gene locus_tag LOCUS_03920 gene rpsP 77958 78218 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545141.1 protein_id gnl|my_center|LOCUS_03920 78508 78792 gene locus_tag LOCUS_03930 78508 78792 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_03930 78859 79491 gene locus_tag LOCUS_03940 gene rimM 78859 79491 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056908.1 protein_id gnl|my_center|LOCUS_03940 80772 79588 gene locus_tag LOCUS_03950 80772 79588 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085634.1 protein_id gnl|my_center|LOCUS_03950 82614 80920 gene locus_tag LOCUS_03960 gene ggt 82614 80920 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_03960 83030 84679 gene locus_tag LOCUS_03970 gene cimA 83030 84679 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146979.1 protein_id gnl|my_center|LOCUS_03970 84681 85247 gene locus_tag LOCUS_03980 84681 85247 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_03980 85269 86123 gene locus_tag LOCUS_03990 gene trmD 85269 86123 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_03990 86113 88656 gene locus_tag LOCUS_04000 86113 88656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 88751 89113 gene locus_tag LOCUS_04010 gene rplS 88751 89113 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_04010 89512 91551 gene locus_tag LOCUS_04020 89512 91551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 91694 92332 gene locus_tag LOCUS_04030 91694 92332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 92403 93281 gene locus_tag LOCUS_04040 92403 93281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 93871 93278 gene locus_tag LOCUS_04050 93871 93278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 94065 93868 gene locus_tag LOCUS_04060 94065 93868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 94846 94223 gene locus_tag LOCUS_04070 94846 94223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 95827 94856 gene locus_tag LOCUS_04080 gene msrP 95827 94856 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 protein_id gnl|my_center|LOCUS_04080 96523 96065 gene locus_tag LOCUS_04090 96523 96065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 96809 98794 gene locus_tag LOCUS_04100 96809 98794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 100118 98856 gene locus_tag LOCUS_04110 100118 98856 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_04110 100452 103964 gene locus_tag LOCUS_04120 gene dnaE 100452 103964 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_04120 104659 104015 gene locus_tag LOCUS_04130 104659 104015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 105111 104656 gene locus_tag LOCUS_04140 105111 104656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 108401 105261 gene locus_tag LOCUS_04150 108401 105261 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_04150 109599 108490 gene locus_tag LOCUS_04160 109599 108490 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057458.1 protein_id gnl|my_center|LOCUS_04160 110595 109903 gene locus_tag LOCUS_04170 110595 109903 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_04170 111486 110611 gene locus_tag LOCUS_04180 111486 110611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 111774 114020 gene locus_tag LOCUS_04190 111774 114020 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_04190 114281 115486 gene locus_tag LOCUS_04200 114281 115486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 115941 115570 gene locus_tag LOCUS_04210 115941 115570 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_04210 116234 116503 gene locus_tag LOCUS_04220 116234 116503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 116737 117012 gene locus_tag LOCUS_04230 116737 117012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 117285 118871 gene locus_tag LOCUS_04240 117285 118871 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 protein_id gnl|my_center|LOCUS_04240 118911 119195 gene locus_tag LOCUS_04250 118911 119195 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071642.1 protein_id gnl|my_center|LOCUS_04250 119183 119473 gene locus_tag LOCUS_04260 119183 119473 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 protein_id gnl|my_center|LOCUS_04260 119963 121264 gene locus_tag LOCUS_04270 119963 121264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 121474 121809 gene locus_tag LOCUS_04280 121474 121809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 121967 121767 gene locus_tag LOCUS_04290 121967 121767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 122199 121942 gene locus_tag LOCUS_04300 122199 121942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 122427 123128 gene locus_tag LOCUS_04310 122427 123128 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921887.1 protein_id gnl|my_center|LOCUS_04310 123269 123652 gene locus_tag LOCUS_04320 123269 123652 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 protein_id gnl|my_center|LOCUS_04320 123775 124335 gene locus_tag LOCUS_04330 gene kdsC 123775 124335 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 protein_id gnl|my_center|LOCUS_04330 125601 124507 gene locus_tag LOCUS_04340 gene waaF 125601 124507 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_04340 125844 126329 gene locus_tag LOCUS_04350 125844 126329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 126415 129918 gene locus_tag LOCUS_04360 gene metH 126415 129918 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140480.1 protein_id gnl|my_center|LOCUS_04360 130103 130579 gene locus_tag LOCUS_04370 130103 130579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 130879 132276 gene locus_tag LOCUS_04380 130879 132276 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_04380 132284 132739 gene locus_tag LOCUS_04390 132284 132739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 134438 132900 gene locus_tag LOCUS_04400 134438 132900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 136552 134660 gene locus_tag LOCUS_04410 136552 134660 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_04410 137326 136628 gene locus_tag LOCUS_04420 137326 136628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 138620 137349 gene locus_tag LOCUS_04430 138620 137349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 142023 138667 gene locus_tag LOCUS_04440 gene treS 142023 138667 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_04440 143827 142079 gene locus_tag LOCUS_04450 143827 142079 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 protein_id gnl|my_center|LOCUS_04450 143891 144103 gene locus_tag LOCUS_04460 143891 144103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 144305 144634 gene locus_tag LOCUS_04470 144305 144634 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356630.1 protein_id gnl|my_center|LOCUS_04470 144644 145351 gene locus_tag LOCUS_04480 144644 145351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04480 145356 145856 gene locus_tag LOCUS_04490 145356 145856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04490 145916 147040 gene locus_tag LOCUS_04500 145916 147040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 147652 147050 gene locus_tag LOCUS_04510 gene lexA 147652 147050 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_04510 148417 147773 gene locus_tag LOCUS_04520 148417 147773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 148958 148431 gene locus_tag LOCUS_04530 148958 148431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 >Feature sequence004 346 648 gene locus_tag LOCUS_04540 346 648 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263506.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04540 632 955 gene locus_tag LOCUS_04550 632 955 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526806.1 protein_id gnl|my_center|LOCUS_04550 1840 1085 gene locus_tag LOCUS_04560 gene gpmA 1840 1085 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198007.1 protein_id gnl|my_center|LOCUS_04560 3106 2114 gene locus_tag LOCUS_04570 3106 2114 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_04570 3349 4050 gene locus_tag LOCUS_04580 3349 4050 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088801.1 protein_id gnl|my_center|LOCUS_04580 4531 5457 gene locus_tag LOCUS_04590 4531 5457 CDS product GSU2203 family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942843.1 protein_id gnl|my_center|LOCUS_04590 5512 8076 gene locus_tag LOCUS_04600 5512 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 8128 8451 gene locus_tag LOCUS_04610 8128 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 10807 8624 gene locus_tag LOCUS_04620 gene glgX 10807 8624 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766232.1 protein_id gnl|my_center|LOCUS_04620 11354 11094 gene locus_tag LOCUS_04630 11354 11094 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197795.1 protein_id gnl|my_center|LOCUS_04630 12080 11502 gene locus_tag LOCUS_04640 12080 11502 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095503.1 protein_id gnl|my_center|LOCUS_04640 12600 12917 gene locus_tag LOCUS_04650 12600 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 12914 13756 gene locus_tag LOCUS_04660 12914 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 14448 13810 gene locus_tag LOCUS_04670 14448 13810 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812028.1 protein_id gnl|my_center|LOCUS_04670 14560 15348 gene locus_tag LOCUS_04680 14560 15348 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_04680 15341 16135 gene locus_tag LOCUS_04690 gene nth 15341 16135 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_04690 16190 16717 gene locus_tag LOCUS_04700 16190 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 16742 16897 gene locus_tag LOCUS_04710 16742 16897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 17887 17090 gene locus_tag LOCUS_04720 17887 17090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 18834 17884 gene locus_tag LOCUS_04730 gene hemC 18834 17884 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099264.1 protein_id gnl|my_center|LOCUS_04730 20318 18831 gene locus_tag LOCUS_04740 gene hemA 20318 18831 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_04740 21130 20315 gene locus_tag LOCUS_04750 gene ccsB 21130 20315 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_04750 21440 24094 gene locus_tag LOCUS_04760 gene mutS 21440 24094 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_04760 24091 25200 gene locus_tag LOCUS_04770 gene nagZ 24091 25200 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104591.1 protein_id gnl|my_center|LOCUS_04770 25197 26414 gene locus_tag LOCUS_04780 gene anmK 25197 26414 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_04780 26407 27972 gene locus_tag LOCUS_04790 26407 27972 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_04790 28847 27981 gene locus_tag LOCUS_04800 28847 27981 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525137.1 protein_id gnl|my_center|LOCUS_04800 30529 29024 gene locus_tag LOCUS_04810 30529 29024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 31113 30517 gene locus_tag LOCUS_04820 31113 30517 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931994.1 protein_id gnl|my_center|LOCUS_04820 31906 31145 gene locus_tag LOCUS_04830 31906 31145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 32778 31918 gene locus_tag LOCUS_04840 32778 31918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 33384 32788 gene locus_tag LOCUS_04850 33384 32788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 35024 33381 gene locus_tag LOCUS_04860 gene ctaD 35024 33381 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533221.1 protein_id gnl|my_center|LOCUS_04860 36219 35128 gene locus_tag LOCUS_04870 gene coxB 36219 35128 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971124.1 protein_id gnl|my_center|LOCUS_04870 37364 36438 gene locus_tag LOCUS_04880 gene gsiC 37364 36438 CDS product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813715.1 protein_id gnl|my_center|LOCUS_04880 38848 37361 gene locus_tag LOCUS_04890 38848 37361 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_04890 39022 39936 gene locus_tag LOCUS_04900 39022 39936 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074942.1 protein_id gnl|my_center|LOCUS_04900 40170 40856 gene locus_tag LOCUS_04910 40170 40856 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942832.1 protein_id gnl|my_center|LOCUS_04910 41624 40866 gene locus_tag LOCUS_04920 41624 40866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 41757 42086 gene locus_tag LOCUS_04930 41757 42086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 43931 42159 gene locus_tag LOCUS_04940 gene ilvB 43931 42159 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057136.1 protein_id gnl|my_center|LOCUS_04940 44536 44045 gene locus_tag LOCUS_04950 44536 44045 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 protein_id gnl|my_center|LOCUS_04950 45423 44536 gene locus_tag LOCUS_04960 45423 44536 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 protein_id gnl|my_center|LOCUS_04960 45503 46612 gene locus_tag LOCUS_04970 45503 46612 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_04970 46660 46736 gene locus_tag LOCUS_t00040 46660 46736 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 46676 47665 gene locus_tag LOCUS_04980 46676 47665 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730867.1 protein_id gnl|my_center|LOCUS_04980 47673 48479 gene locus_tag LOCUS_04990 47673 48479 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_04990 48849 48568 gene locus_tag LOCUS_05000 48849 48568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 48766 48963 gene locus_tag LOCUS_05010 48766 48963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 49370 49017 gene locus_tag LOCUS_05020 49370 49017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 49369 50388 gene locus_tag LOCUS_05030 49369 50388 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_05030 50537 50860 gene locus_tag LOCUS_05040 50537 50860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 51281 51123 gene locus_tag LOCUS_05050 51281 51123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 52856 51300 gene locus_tag LOCUS_05060 52856 51300 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_05060 54643 53102 gene locus_tag LOCUS_05070 54643 53102 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_05070 57234 54820 gene locus_tag LOCUS_05080 57234 54820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 57236 57424 gene locus_tag LOCUS_05090 57236 57424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 58413 58075 gene locus_tag LOCUS_05100 58413 58075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 58944 60602 gene locus_tag LOCUS_05110 58944 60602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 60966 61358 gene locus_tag LOCUS_05120 60966 61358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 61355 62230 gene locus_tag LOCUS_05130 gene hisG 61355 62230 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_05130 62244 63542 gene locus_tag LOCUS_05140 gene hisD 62244 63542 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880475.1 protein_id gnl|my_center|LOCUS_05140 63539 64642 gene locus_tag LOCUS_05150 63539 64642 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124366.1 protein_id gnl|my_center|LOCUS_05150 64624 65232 gene locus_tag LOCUS_05160 gene hisB 64624 65232 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257804.1 protein_id gnl|my_center|LOCUS_05160 65245 65856 gene locus_tag LOCUS_05170 gene hisH 65245 65856 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_05170 65850 66620 gene locus_tag LOCUS_05180 gene hisF 65850 66620 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144298.1 protein_id gnl|my_center|LOCUS_05180 66666 67388 gene locus_tag LOCUS_05190 gene hisA 66666 67388 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871056.1 protein_id gnl|my_center|LOCUS_05190 68508 67453 gene locus_tag LOCUS_05200 68508 67453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 69735 68623 gene locus_tag LOCUS_05210 69735 68623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 70021 70374 gene locus_tag LOCUS_05220 70021 70374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 70402 72111 gene locus_tag LOCUS_05230 70402 72111 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05230 72199 73128 gene locus_tag LOCUS_05240 72199 73128 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086191.1 protein_id gnl|my_center|LOCUS_05240 74290 73139 gene locus_tag LOCUS_05250 gene holA 74290 73139 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403276.1 protein_id gnl|my_center|LOCUS_05250 74817 74293 gene locus_tag LOCUS_05260 74817 74293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 76883 74973 gene locus_tag LOCUS_05270 gene ftsH 76883 74973 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_05270 78725 77160 gene locus_tag LOCUS_05280 gene tilS 78725 77160 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_05280 79263 79928 gene locus_tag LOCUS_05290 gene ispD 79263 79928 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_05290 80140 80745 gene locus_tag LOCUS_05300 80140 80745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 81435 80803 gene locus_tag LOCUS_05310 81435 80803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 82180 81584 gene locus_tag LOCUS_05320 82180 81584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 82943 82419 gene locus_tag LOCUS_05330 82943 82419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 83237 85534 gene locus_tag LOCUS_05340 83237 85534 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942973.1 protein_id gnl|my_center|LOCUS_05340 85537 86325 gene locus_tag LOCUS_05350 gene otsB 85537 86325 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869049.1 protein_id gnl|my_center|LOCUS_05350 86884 87285 gene locus_tag LOCUS_05360 86884 87285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 88682 87759 gene locus_tag LOCUS_05370 88682 87759 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_05370 88819 90030 gene locus_tag LOCUS_05380 88819 90030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 90122 91237 gene locus_tag LOCUS_05390 gene leuB 90122 91237 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393735.1 protein_id gnl|my_center|LOCUS_05390 91319 92740 gene locus_tag LOCUS_05400 gene leuC 91319 92740 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_05400 92743 93372 gene locus_tag LOCUS_05410 gene leuD 92743 93372 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330456.1 protein_id gnl|my_center|LOCUS_05410 93369 95069 gene locus_tag LOCUS_05420 gene ilvD 93369 95069 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_05420 95081 96862 gene locus_tag LOCUS_05430 gene ilvB 95081 96862 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880257.1 protein_id gnl|my_center|LOCUS_05430 96876 97475 gene locus_tag LOCUS_05440 gene ilvN 96876 97475 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_05440 97499 98554 gene locus_tag LOCUS_05450 gene ilvC 97499 98554 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256075.1 protein_id gnl|my_center|LOCUS_05450 98677 100146 gene locus_tag LOCUS_05460 98677 100146 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_05460 100447 100163 gene locus_tag LOCUS_05470 100447 100163 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_05470 100935 100609 gene locus_tag LOCUS_05480 100935 100609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 101551 101108 gene locus_tag LOCUS_05490 101551 101108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 102193 101558 gene locus_tag LOCUS_05500 102193 101558 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_05500 105042 102217 gene locus_tag LOCUS_05510 105042 102217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 106485 105268 gene locus_tag LOCUS_05520 gene dprA 106485 105268 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_05520 106594 106938 gene locus_tag LOCUS_05530 106594 106938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 106976 107782 gene locus_tag LOCUS_05540 106976 107782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 107966 108307 gene locus_tag LOCUS_05550 107966 108307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 108727 108527 gene locus_tag LOCUS_05560 108727 108527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 108775 109359 gene locus_tag LOCUS_05570 108775 109359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 109422 110096 gene locus_tag LOCUS_05580 109422 110096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 110418 110062 gene locus_tag LOCUS_05590 110418 110062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 111154 110345 gene locus_tag LOCUS_05600 111154 110345 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971771.1 protein_id gnl|my_center|LOCUS_05600 111333 112340 gene locus_tag LOCUS_05610 111333 112340 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966367.1 protein_id gnl|my_center|LOCUS_05610 113399 112383 gene locus_tag LOCUS_05620 113399 112383 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933768.1 protein_id gnl|my_center|LOCUS_05620 113653 115170 gene locus_tag LOCUS_05630 gene rimO 113653 115170 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257724.1 protein_id gnl|my_center|LOCUS_05630 115246 115479 gene locus_tag LOCUS_05640 115246 115479 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696096.1 protein_id gnl|my_center|LOCUS_05640 115480 115974 gene locus_tag LOCUS_05650 115480 115974 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694464.1 protein_id gnl|my_center|LOCUS_05650 115989 117032 gene locus_tag LOCUS_05660 115989 117032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 117089 118333 gene locus_tag LOCUS_05670 117089 118333 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_05670 118394 119032 gene locus_tag LOCUS_05680 gene plsY 118394 119032 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_05680 119029 120045 gene locus_tag LOCUS_05690 119029 120045 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_05690 120204 121304 gene locus_tag LOCUS_05700 120204 121304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 121337 122284 gene locus_tag LOCUS_05710 gene ftsY 121337 122284 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_05710 122404 123513 gene locus_tag LOCUS_05720 gene ribD 122404 123513 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_05720 123562 124239 gene locus_tag LOCUS_05730 123562 124239 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_05730 126824 124278 gene locus_tag LOCUS_05740 126824 124278 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_05740 128676 127030 gene locus_tag LOCUS_05750 128676 127030 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089646.1 protein_id gnl|my_center|LOCUS_05750 129071 128706 gene locus_tag LOCUS_05760 129071 128706 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965665.1 protein_id gnl|my_center|LOCUS_05760 130195 129146 gene locus_tag LOCUS_05770 gene glk 130195 129146 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_05770 130989 130192 gene locus_tag LOCUS_05780 gene pgl 130989 130192 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_05780 132561 131020 gene locus_tag LOCUS_05790 gene zwf 132561 131020 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_05790 133555 132647 gene locus_tag LOCUS_05800 gene gnd 133555 132647 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038537.1 protein_id gnl|my_center|LOCUS_05800 134237 133587 gene locus_tag LOCUS_05810 134237 133587 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 protein_id gnl|my_center|LOCUS_05810 134734 134234 gene locus_tag LOCUS_05820 gene rpiB 134734 134234 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525805.1 protein_id gnl|my_center|LOCUS_05820 136760 134742 gene locus_tag LOCUS_05830 gene tkt 136760 134742 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_05830 139282 136871 gene locus_tag LOCUS_05840 139282 136871 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_05840 139614 140225 gene locus_tag LOCUS_05850 139614 140225 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444156.1 protein_id gnl|my_center|LOCUS_05850 141688 140258 gene locus_tag LOCUS_05860 141688 140258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 141809 142852 gene locus_tag LOCUS_05870 gene tsaD 141809 142852 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_05870 142898 144376 gene locus_tag LOCUS_05880 gene cysS 142898 144376 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570132.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence005 25 1191 gene locus_tag LOCUS_05890 25 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1736 1512 gene locus_tag LOCUS_05900 1736 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 1811 3217 gene locus_tag LOCUS_05910 1811 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3406 4929 gene locus_tag LOCUS_05920 3406 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 4961 5743 gene locus_tag LOCUS_05930 gene rpe 4961 5743 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_05930 5740 7461 gene locus_tag LOCUS_05940 5740 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 7564 8748 gene locus_tag LOCUS_05950 7564 8748 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_05950 8760 11597 gene locus_tag LOCUS_05960 8760 11597 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_05960 11598 12485 gene locus_tag LOCUS_05970 gene nadC 11598 12485 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 protein_id gnl|my_center|LOCUS_05970 12497 13333 gene locus_tag LOCUS_05980 12497 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 13317 14147 gene locus_tag LOCUS_05990 13317 14147 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_05990 14158 14883 gene locus_tag LOCUS_06000 14158 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 14880 16202 gene locus_tag LOCUS_06010 14880 16202 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880115.1 protein_id gnl|my_center|LOCUS_06010 16465 19071 gene locus_tag LOCUS_06020 16465 19071 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204034.1 protein_id gnl|my_center|LOCUS_06020 19128 19529 gene locus_tag LOCUS_06030 19128 19529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 20429 19656 gene locus_tag LOCUS_06040 20429 19656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 21059 20496 gene locus_tag LOCUS_06050 21059 20496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 22147 21056 gene locus_tag LOCUS_06060 gene waaC 22147 21056 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_06060 23231 22155 gene locus_tag LOCUS_06070 23231 22155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 24574 23228 gene locus_tag LOCUS_06080 24574 23228 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_06080 24750 26165 gene locus_tag LOCUS_06090 gene trmFO 24750 26165 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_06090 27264 26119 gene locus_tag LOCUS_06100 27264 26119 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_06100 29479 27284 gene locus_tag LOCUS_06110 29479 27284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 31196 29622 gene locus_tag LOCUS_06120 gene purH 31196 29622 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_06120 31420 32280 gene locus_tag LOCUS_06130 31420 32280 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564613.1 protein_id gnl|my_center|LOCUS_06130 32702 32346 gene locus_tag LOCUS_06140 32702 32346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 33010 34524 gene locus_tag LOCUS_06150 33010 34524 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926923.1 protein_id gnl|my_center|LOCUS_06150 34707 36107 gene locus_tag LOCUS_06160 gene zwf 34707 36107 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_06160 36291 37328 gene locus_tag LOCUS_06170 gene queA 36291 37328 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095273.1 protein_id gnl|my_center|LOCUS_06170 37361 40138 gene locus_tag LOCUS_06180 gene polA 37361 40138 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478619.1 protein_id gnl|my_center|LOCUS_06180 41535 40186 gene locus_tag LOCUS_06190 gene glmM 41535 40186 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_06190 42953 41532 gene locus_tag LOCUS_06200 gene xseA 42953 41532 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_06200 43388 43164 gene locus_tag LOCUS_06210 43388 43164 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869668.1 protein_id gnl|my_center|LOCUS_06210 43582 43364 gene locus_tag LOCUS_06220 43582 43364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 43581 44756 gene locus_tag LOCUS_06230 43581 44756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 45376 44795 gene locus_tag LOCUS_06240 45376 44795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 46538 45477 gene locus_tag LOCUS_06250 46538 45477 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 protein_id gnl|my_center|LOCUS_06250 48165 46657 gene locus_tag LOCUS_06260 gene der 48165 46657 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_06260 48255 50243 gene locus_tag LOCUS_06270 48255 50243 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_06270 50358 50651 gene locus_tag LOCUS_06280 50358 50651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 50793 51170 gene locus_tag LOCUS_06290 gene queD 50793 51170 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_06290 51175 51855 gene locus_tag LOCUS_06300 gene queE 51175 51855 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769397.1 protein_id gnl|my_center|LOCUS_06300 51997 52284 gene locus_tag LOCUS_06310 51997 52284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 52313 53020 gene locus_tag LOCUS_06320 gene queC 52313 53020 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_06320 53506 53231 gene locus_tag LOCUS_06330 53506 53231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 53388 54530 gene locus_tag LOCUS_06340 53388 54530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 54768 56102 gene locus_tag LOCUS_06350 54768 56102 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_06350 56167 56589 gene locus_tag LOCUS_06360 gene moaC 56167 56589 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228918.1 protein_id gnl|my_center|LOCUS_06360 56661 57845 gene locus_tag LOCUS_06370 56661 57845 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521284.1 protein_id gnl|my_center|LOCUS_06370 58168 57842 gene locus_tag LOCUS_06380 58168 57842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 59742 58711 gene locus_tag LOCUS_06390 59742 58711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 61902 59959 gene locus_tag LOCUS_06400 61902 59959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 65344 62186 gene locus_tag LOCUS_06410 65344 62186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 66092 65517 gene locus_tag LOCUS_06420 66092 65517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 66322 67398 gene locus_tag LOCUS_06430 66322 67398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 68025 67447 gene locus_tag LOCUS_06440 68025 67447 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259161.1 protein_id gnl|my_center|LOCUS_06440 68091 68336 gene locus_tag LOCUS_06450 gene purS 68091 68336 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393546.1 protein_id gnl|my_center|LOCUS_06450 68511 70391 gene locus_tag LOCUS_06460 gene glmS 68511 70391 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_06460 70480 72099 gene locus_tag LOCUS_06470 70480 72099 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537669.1 protein_id gnl|my_center|LOCUS_06470 72202 73740 gene locus_tag LOCUS_06480 gene cotA 72202 73740 CDS product outer spore coat copper-dependent laccase CotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243170.1 protein_id gnl|my_center|LOCUS_06480 73831 75744 gene locus_tag LOCUS_06490 gene typA 73831 75744 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_06490 75794 76129 gene locus_tag LOCUS_06500 75794 76129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 76182 77138 gene locus_tag LOCUS_06510 76182 77138 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256676.1 protein_id gnl|my_center|LOCUS_06510 77282 77785 gene locus_tag LOCUS_06520 77282 77785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 80359 77816 gene locus_tag LOCUS_06530 80359 77816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 81039 81614 gene locus_tag LOCUS_06540 81039 81614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 82452 81748 gene locus_tag LOCUS_06550 82452 81748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 82585 85038 gene locus_tag LOCUS_06560 82585 85038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 85122 85712 gene locus_tag LOCUS_06570 85122 85712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 86153 85869 gene locus_tag LOCUS_06580 86153 85869 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259014.1 protein_id gnl|my_center|LOCUS_06580 87464 86265 gene locus_tag LOCUS_06590 87464 86265 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_06590 87862 88419 gene locus_tag LOCUS_06600 87862 88419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 90431 88515 gene locus_tag LOCUS_06610 90431 88515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 92575 90704 gene locus_tag LOCUS_06620 92575 90704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 92806 94935 gene locus_tag LOCUS_06630 92806 94935 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_06630 96886 94937 gene locus_tag LOCUS_06640 96886 94937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_06640 97275 96898 gene locus_tag LOCUS_06650 97275 96898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 97927 97400 gene locus_tag LOCUS_06660 97927 97400 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977146.1 protein_id gnl|my_center|LOCUS_06660 98874 97930 gene locus_tag LOCUS_06670 98874 97930 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_06670 101230 98885 gene locus_tag LOCUS_06680 101230 98885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 101636 101391 gene locus_tag LOCUS_06690 101636 101391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 101704 104691 gene locus_tag LOCUS_06700 101704 104691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 104688 108401 gene locus_tag LOCUS_06710 104688 108401 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_06710 108565 108425 gene locus_tag LOCUS_06720 108565 108425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 110846 108786 gene locus_tag LOCUS_06730 110846 108786 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223614.1 protein_id gnl|my_center|LOCUS_06730 111158 111346 gene locus_tag LOCUS_06740 111158 111346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 112234 111419 gene locus_tag LOCUS_06750 112234 111419 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_06750 112486 113298 gene locus_tag LOCUS_06760 112486 113298 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389099.1 protein_id gnl|my_center|LOCUS_06760 113295 114482 gene locus_tag LOCUS_06770 113295 114482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 114531 116054 gene locus_tag LOCUS_06780 gene xylB 114531 116054 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_06780 116065 117447 gene locus_tag LOCUS_06790 116065 117447 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083033.1 protein_id gnl|my_center|LOCUS_06790 117483 118976 gene locus_tag LOCUS_06800 gene dhaS 117483 118976 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080281.1 protein_id gnl|my_center|LOCUS_06800 119029 119280 gene locus_tag LOCUS_06810 119029 119280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 119466 120266 gene locus_tag LOCUS_06820 119466 120266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 120674 124036 gene locus_tag LOCUS_06830 120674 124036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 124051 125604 gene locus_tag LOCUS_06840 124051 125604 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_06840 125601 127052 gene locus_tag LOCUS_06850 125601 127052 CDS product ribonuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141613167.1 protein_id gnl|my_center|LOCUS_06850 127049 128128 gene locus_tag LOCUS_06860 127049 128128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 128498 128683 gene locus_tag LOCUS_06870 128498 128683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 129030 129530 gene locus_tag LOCUS_06880 129030 129530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 129579 130103 gene locus_tag LOCUS_06890 129579 130103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 130736 130152 gene locus_tag LOCUS_06900 130736 130152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 131548 132393 gene locus_tag LOCUS_06910 131548 132393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06910 132303 132527 gene locus_tag LOCUS_06920 132303 132527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06920 136659 132637 gene locus_tag LOCUS_06930 136659 132637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 139688 136671 gene locus_tag LOCUS_06940 139688 136671 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_06940 139818 140009 gene locus_tag LOCUS_06950 139818 140009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 140705 140968 gene locus_tag LOCUS_06960 140705 140968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 140965 141393 gene locus_tag LOCUS_06970 140965 141393 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142976.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence006 170 520 gene locus_tag LOCUS_06980 170 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 517 2484 gene locus_tag LOCUS_06990 517 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2636 2878 gene locus_tag LOCUS_07000 2636 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 3006 3947 gene locus_tag LOCUS_07010 3006 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 4123 6882 gene locus_tag LOCUS_07020 gene mobF 4123 6882 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_07020 7984 7019 gene locus_tag LOCUS_07030 7984 7019 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257878.1 protein_id gnl|my_center|LOCUS_07030 7874 8095 gene locus_tag LOCUS_07040 7874 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 9057 8098 gene locus_tag LOCUS_07050 9057 8098 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257879.1 protein_id gnl|my_center|LOCUS_07050 10603 9095 gene locus_tag LOCUS_07060 10603 9095 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_07060 11408 10587 gene locus_tag LOCUS_07070 11408 10587 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 protein_id gnl|my_center|LOCUS_07070 11620 12387 gene locus_tag LOCUS_07080 11620 12387 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 protein_id gnl|my_center|LOCUS_07080 12972 13856 gene locus_tag LOCUS_07090 12972 13856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 14124 14780 gene locus_tag LOCUS_07100 14124 14780 CDS product DUF6338 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429495.1 protein_id gnl|my_center|LOCUS_07100 14821 16296 gene locus_tag LOCUS_07110 gene gatB 14821 16296 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_07110 16289 16747 gene locus_tag LOCUS_07120 16289 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 17087 16875 gene locus_tag LOCUS_07130 17087 16875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 17691 17194 gene locus_tag LOCUS_07140 17691 17194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 18977 17688 gene locus_tag LOCUS_07150 gene purD 18977 17688 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_07150 19061 19492 gene locus_tag LOCUS_07160 19061 19492 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950624.1 protein_id gnl|my_center|LOCUS_07160 20254 19568 gene locus_tag LOCUS_07170 20254 19568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 20622 22037 gene locus_tag LOCUS_07180 20622 22037 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_07180 22543 22061 gene locus_tag LOCUS_07190 22543 22061 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_07190 23033 22716 gene locus_tag LOCUS_07200 23033 22716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 23298 23011 gene locus_tag LOCUS_07210 23298 23011 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_07210 23497 23763 gene locus_tag LOCUS_07220 23497 23763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 23760 24302 gene locus_tag LOCUS_07230 23760 24302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 24439 25020 gene locus_tag LOCUS_07240 24439 25020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 25365 28172 gene locus_tag LOCUS_07250 gene acnA 25365 28172 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_07250 28258 29034 gene locus_tag LOCUS_07260 28258 29034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 29260 29054 gene locus_tag LOCUS_07270 29260 29054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 30487 29438 gene locus_tag LOCUS_07280 30487 29438 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 protein_id gnl|my_center|LOCUS_07280 32085 30487 gene locus_tag LOCUS_07290 32085 30487 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523062.1 protein_id gnl|my_center|LOCUS_07290 32198 32434 gene locus_tag LOCUS_07300 32198 32434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 35152 32504 gene locus_tag LOCUS_07310 35152 32504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 35358 35810 gene locus_tag LOCUS_07320 35358 35810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07320 36255 35791 gene locus_tag LOCUS_07330 36255 35791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 36984 36265 gene locus_tag LOCUS_07340 36984 36265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 37754 36981 gene locus_tag LOCUS_07350 37754 36981 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258719.1 protein_id gnl|my_center|LOCUS_07350 38749 37844 gene locus_tag LOCUS_07360 38749 37844 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_07360 39583 39185 gene locus_tag LOCUS_07370 39583 39185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 39712 40593 gene locus_tag LOCUS_07380 39712 40593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 41839 40613 gene locus_tag LOCUS_07390 41839 40613 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_07390 43019 42084 gene locus_tag LOCUS_07400 43019 42084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 43189 44610 gene locus_tag LOCUS_07410 43189 44610 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125901.1 protein_id gnl|my_center|LOCUS_07410 44651 45577 gene locus_tag LOCUS_07420 gene mdh 44651 45577 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_07420 46394 45657 gene locus_tag LOCUS_07430 46394 45657 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_07430 47037 46507 gene locus_tag LOCUS_07440 gene lirB 47037 46507 CDS product type IV secretion system effector LirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947678.1 protein_id gnl|my_center|LOCUS_07440 47663 47139 gene locus_tag LOCUS_07450 47663 47139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 48370 49854 gene locus_tag LOCUS_07460 48370 49854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 50259 50107 gene locus_tag LOCUS_07470 50259 50107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 50263 51714 gene locus_tag LOCUS_07480 50263 51714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 51805 51987 gene locus_tag LOCUS_07490 51805 51987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 52533 53144 gene locus_tag LOCUS_07500 52533 53144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_07500 53146 55059 gene locus_tag LOCUS_07510 53146 55059 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_07510 55059 55856 gene locus_tag LOCUS_07520 55059 55856 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_07520 56522 55869 gene locus_tag LOCUS_07530 56522 55869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 56865 56530 gene locus_tag LOCUS_07540 56865 56530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 57588 56953 gene locus_tag LOCUS_07550 57588 56953 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_07550 57715 58149 gene locus_tag LOCUS_07560 57715 58149 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870191.1 protein_id gnl|my_center|LOCUS_07560 59924 58161 gene locus_tag LOCUS_07570 59924 58161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552510.1 protein_id gnl|my_center|LOCUS_07570 62461 60026 gene locus_tag LOCUS_07580 62461 60026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 62542 64629 gene locus_tag LOCUS_07590 62542 64629 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070840.1 protein_id gnl|my_center|LOCUS_07590 66224 64659 gene locus_tag LOCUS_07600 66224 64659 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_07600 68031 66490 gene locus_tag LOCUS_07610 68031 66490 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_07610 70128 68188 gene locus_tag LOCUS_07620 gene uvrC 70128 68188 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933467.1 protein_id gnl|my_center|LOCUS_07620 70352 71176 gene locus_tag LOCUS_07630 70352 71176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 71904 71293 gene locus_tag LOCUS_07640 71904 71293 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939172.1 protein_id gnl|my_center|LOCUS_07640 72011 73060 gene locus_tag LOCUS_07650 72011 73060 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909272.1 protein_id gnl|my_center|LOCUS_07650 73100 73618 gene locus_tag LOCUS_07660 73100 73618 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_07660 75355 73718 gene locus_tag LOCUS_07670 75355 73718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 78016 75359 gene locus_tag LOCUS_07680 78016 75359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 79969 78038 gene locus_tag LOCUS_07690 79969 78038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 80076 80960 gene locus_tag LOCUS_07700 80076 80960 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_07700 81047 81658 gene locus_tag LOCUS_07710 81047 81658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 81670 81942 gene locus_tag LOCUS_07720 81670 81942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 81975 83012 gene locus_tag LOCUS_07730 81975 83012 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202790.1 protein_id gnl|my_center|LOCUS_07730 83036 83479 gene locus_tag LOCUS_07740 83036 83479 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 protein_id gnl|my_center|LOCUS_07740 83476 84594 gene locus_tag LOCUS_07750 83476 84594 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_07750 84591 86099 gene locus_tag LOCUS_07760 84591 86099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 86149 87144 gene locus_tag LOCUS_07770 86149 87144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 87277 88197 gene locus_tag LOCUS_07780 87277 88197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 88551 89174 gene locus_tag LOCUS_07790 88551 89174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 89200 90093 gene locus_tag LOCUS_07800 89200 90093 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087598.1 protein_id gnl|my_center|LOCUS_07800 90274 90074 gene locus_tag LOCUS_07810 90274 90074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 90394 91494 gene locus_tag LOCUS_07820 90394 91494 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942154.1 protein_id gnl|my_center|LOCUS_07820 91644 92657 gene locus_tag LOCUS_07830 91644 92657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 92862 92620 gene locus_tag LOCUS_07840 92862 92620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 92961 94097 gene locus_tag LOCUS_07850 92961 94097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 94108 94449 gene locus_tag LOCUS_07860 94108 94449 CDS product DUF3147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171510.1 protein_id gnl|my_center|LOCUS_07860 94462 94881 gene locus_tag LOCUS_07870 94462 94881 CDS product DUF3147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090367.1 protein_id gnl|my_center|LOCUS_07870 95008 96273 gene locus_tag LOCUS_07880 95008 96273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 96417 98381 gene locus_tag LOCUS_07890 96417 98381 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_07890 98514 100085 gene locus_tag LOCUS_07900 gene malQ 98514 100085 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_07900 100237 100422 gene locus_tag LOCUS_07910 100237 100422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 102484 100511 gene locus_tag LOCUS_07920 102484 100511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 103782 102553 gene locus_tag LOCUS_07930 gene lpxB 103782 102553 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_07930 105740 103800 gene locus_tag LOCUS_07940 105740 103800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_07940 105836 107086 gene locus_tag LOCUS_07950 gene hemW 105836 107086 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_07950 107083 108165 gene locus_tag LOCUS_07960 gene ltaE 107083 108165 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_07960 108283 109029 gene locus_tag LOCUS_07970 108283 109029 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_07970 109074 110834 gene locus_tag LOCUS_07980 109074 110834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 110938 111873 gene locus_tag LOCUS_07990 110938 111873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 112429 111884 gene locus_tag LOCUS_08000 112429 111884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 113714 112506 gene locus_tag LOCUS_08010 113714 112506 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 protein_id gnl|my_center|LOCUS_08010 113832 114704 gene locus_tag LOCUS_08020 gene htpX 113832 114704 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_08020 114793 115302 gene locus_tag LOCUS_08030 114793 115302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 115389 116474 gene locus_tag LOCUS_08040 gene ychF 115389 116474 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965433.1 protein_id gnl|my_center|LOCUS_08040 116483 117214 gene locus_tag LOCUS_08050 116483 117214 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775202.1 protein_id gnl|my_center|LOCUS_08050 117245 118042 gene locus_tag LOCUS_08060 117245 118042 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_08060 118257 118625 gene locus_tag LOCUS_08070 118257 118625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 118765 121242 gene locus_tag LOCUS_08080 118765 121242 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338417.1 protein_id gnl|my_center|LOCUS_08080 121909 121271 gene locus_tag LOCUS_08090 121909 121271 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266412.1 protein_id gnl|my_center|LOCUS_08090 122078 122422 gene locus_tag LOCUS_08100 122078 122422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 122419 123102 gene locus_tag LOCUS_08110 gene hypB 122419 123102 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_08110 123661 123227 gene locus_tag LOCUS_08120 123661 123227 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_08120 123790 125679 gene locus_tag LOCUS_08130 123790 125679 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_08130 126046 125813 gene locus_tag LOCUS_08140 126046 125813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 126155 126454 gene locus_tag LOCUS_08150 126155 126454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 126558 126848 gene locus_tag LOCUS_08160 126558 126848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 126876 127493 gene locus_tag LOCUS_08170 126876 127493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 127819 128889 gene locus_tag LOCUS_08180 127819 128889 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_08180 129764 128961 gene locus_tag LOCUS_08190 129764 128961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 130434 129757 gene locus_tag LOCUS_08200 gene modB 130434 129757 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064503.1 protein_id gnl|my_center|LOCUS_08200 131253 130480 gene locus_tag LOCUS_08210 gene modA 131253 130480 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258350.1 protein_id gnl|my_center|LOCUS_08210 131647 131246 gene locus_tag LOCUS_08220 131647 131246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence007 195 617 gene locus_tag LOCUS_08230 195 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 710 2083 gene locus_tag LOCUS_08240 gene miaB 710 2083 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880136.1 protein_id gnl|my_center|LOCUS_08240 2080 2607 gene locus_tag LOCUS_08250 2080 2607 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_08250 2808 3815 gene locus_tag LOCUS_08260 2808 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 3951 5465 gene locus_tag LOCUS_08270 3951 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 6219 5452 gene locus_tag LOCUS_08280 6219 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 7146 6346 gene locus_tag LOCUS_08290 7146 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 7676 8251 gene locus_tag LOCUS_08300 gene lepB 7676 8251 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_08300 8351 9493 gene locus_tag LOCUS_08310 gene carA 8351 9493 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_08310 9611 12898 gene locus_tag LOCUS_08320 gene carB 9611 12898 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_08320 13315 13124 gene locus_tag LOCUS_08330 13315 13124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 13427 14551 gene locus_tag LOCUS_08340 13427 14551 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_08340 15889 14600 gene locus_tag LOCUS_08350 gene amt 15889 14600 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_08350 16095 15916 gene locus_tag LOCUS_08360 16095 15916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 16517 17935 gene locus_tag LOCUS_08370 16517 17935 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256733.1 protein_id gnl|my_center|LOCUS_08370 19213 18146 gene locus_tag LOCUS_08380 19213 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 19858 20955 gene locus_tag LOCUS_08390 19858 20955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 20948 21709 gene locus_tag LOCUS_08400 20948 21709 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_08400 21828 22721 gene locus_tag LOCUS_08410 21828 22721 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035613.1 protein_id gnl|my_center|LOCUS_08410 23643 23936 gene locus_tag LOCUS_08420 23643 23936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 24009 30617 gene locus_tag LOCUS_08430 24009 30617 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031213.1 protein_id gnl|my_center|LOCUS_08430 30617 35821 gene locus_tag LOCUS_08440 30617 35821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 35814 40259 gene locus_tag LOCUS_08450 35814 40259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 40278 46907 gene locus_tag LOCUS_08460 40278 46907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 46904 52537 gene locus_tag LOCUS_08470 46904 52537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 52534 55938 gene locus_tag LOCUS_08480 52534 55938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 55965 60578 gene locus_tag LOCUS_08490 55965 60578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 60638 62275 gene locus_tag LOCUS_08500 60638 62275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08500 62494 62570 gene locus_tag LOCUS_t00050 62494 62570 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 63417 62572 gene locus_tag LOCUS_08510 63417 62572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 64855 64334 gene locus_tag LOCUS_08520 64855 64334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 64793 65188 gene locus_tag LOCUS_08530 64793 65188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 65548 66678 gene locus_tag LOCUS_08540 65548 66678 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_08540 66686 67726 gene locus_tag LOCUS_08550 gene murQ 66686 67726 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369100.1 protein_id gnl|my_center|LOCUS_08550 67805 69112 gene locus_tag LOCUS_08560 gene murA 67805 69112 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527889.1 protein_id gnl|my_center|LOCUS_08560 69414 70412 gene locus_tag LOCUS_08570 69414 70412 CDS product 1,5-anhydro-D-fructose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535887.1 protein_id gnl|my_center|LOCUS_08570 71406 70435 gene locus_tag LOCUS_08580 71406 70435 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233444.1 protein_id gnl|my_center|LOCUS_08580 73819 71429 gene locus_tag LOCUS_08590 gene pnp 73819 71429 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_08590 74284 74018 gene locus_tag LOCUS_08600 gene rpsO 74284 74018 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185828.1 protein_id gnl|my_center|LOCUS_08600 74419 75288 gene locus_tag LOCUS_08610 74419 75288 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933215.1 protein_id gnl|my_center|LOCUS_08610 75601 76074 gene locus_tag LOCUS_08620 75601 76074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 76305 76102 gene locus_tag LOCUS_08630 76305 76102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 77784 76306 gene locus_tag LOCUS_08640 gene thiC 77784 76306 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_08640 78006 78719 gene locus_tag LOCUS_08650 78006 78719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107522.1 protein_id gnl|my_center|LOCUS_08650 78716 79216 gene locus_tag LOCUS_08660 gene ybaK 78716 79216 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868926.1 protein_id gnl|my_center|LOCUS_08660 79213 79887 gene locus_tag LOCUS_08670 79213 79887 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_08670 79939 80655 gene locus_tag LOCUS_08680 gene ccsA 79939 80655 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_08680 80988 82079 gene locus_tag LOCUS_08690 gene aroF 80988 82079 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256593.1 protein_id gnl|my_center|LOCUS_08690 82091 83332 gene locus_tag LOCUS_08700 82091 83332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 83860 83339 gene locus_tag LOCUS_08710 83860 83339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 86135 83943 gene locus_tag LOCUS_08720 86135 83943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 87262 86324 gene locus_tag LOCUS_08730 87262 86324 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 protein_id gnl|my_center|LOCUS_08730 87693 87905 gene locus_tag LOCUS_08740 87693 87905 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_08740 90741 89374 gene locus_tag LOCUS_08750 90741 89374 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_08750 92138 90783 gene locus_tag LOCUS_08760 92138 90783 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_08760 92720 97444 gene locus_tag LOCUS_08770 92720 97444 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_08770 97447 98295 gene locus_tag LOCUS_08780 97447 98295 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_08780 100039 99263 gene locus_tag LOCUS_08790 gene znuB 100039 99263 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705956.1 protein_id gnl|my_center|LOCUS_08790 100775 100032 gene locus_tag LOCUS_08800 100775 100032 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339418.1 protein_id gnl|my_center|LOCUS_08800 101767 100772 gene locus_tag LOCUS_08810 101767 100772 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_08810 102645 101764 gene locus_tag LOCUS_08820 102645 101764 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_08820 103053 102727 gene locus_tag LOCUS_08830 103053 102727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 103687 103067 gene locus_tag LOCUS_08840 103687 103067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 104033 103773 gene locus_tag LOCUS_08850 104033 103773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 104374 104237 gene locus_tag LOCUS_08860 104374 104237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 105430 105191 gene locus_tag LOCUS_08870 105430 105191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 105323 106252 gene locus_tag LOCUS_08880 105323 106252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 106396 106755 gene locus_tag LOCUS_08890 106396 106755 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_08890 106858 107196 gene locus_tag LOCUS_08900 106858 107196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 107735 107427 gene locus_tag LOCUS_08910 107735 107427 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545454.1 protein_id gnl|my_center|LOCUS_08910 109260 107875 gene locus_tag LOCUS_08920 gene pncB 109260 107875 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327257.1 protein_id gnl|my_center|LOCUS_08920 109813 111480 gene locus_tag LOCUS_08930 109813 111480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 113120 111549 gene locus_tag LOCUS_08940 113120 111549 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_08940 114147 113395 gene locus_tag LOCUS_08950 gene cobB 114147 113395 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391392.1 protein_id gnl|my_center|LOCUS_08950 114550 114302 gene locus_tag LOCUS_08960 114550 114302 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222412.1 protein_id gnl|my_center|LOCUS_08960 114568 114762 gene locus_tag LOCUS_08970 114568 114762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 116269 114938 gene locus_tag LOCUS_08980 116269 114938 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_08980 117429 116320 gene locus_tag LOCUS_08990 117429 116320 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_08990 117850 119094 gene locus_tag LOCUS_09000 117850 119094 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence008 573 1445 gene locus_tag LOCUS_09010 573 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1442 1948 gene locus_tag LOCUS_09020 1442 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2201 3217 gene locus_tag LOCUS_09030 2201 3217 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_09030 4426 3452 gene locus_tag LOCUS_09040 4426 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4649 6619 gene locus_tag LOCUS_09050 4649 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 6738 7136 gene locus_tag LOCUS_09060 6738 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 7721 8431 gene locus_tag LOCUS_09070 7721 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 9825 8647 gene locus_tag LOCUS_09080 9825 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 10917 10330 gene locus_tag LOCUS_09090 10917 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 11309 11031 gene locus_tag LOCUS_09100 11309 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 12207 13532 gene locus_tag LOCUS_09110 12207 13532 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038435.1 protein_id gnl|my_center|LOCUS_09110 13532 14875 gene locus_tag LOCUS_09120 13532 14875 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_09120 14882 18106 gene locus_tag LOCUS_09130 14882 18106 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_09130 19402 18383 gene locus_tag LOCUS_09140 19402 18383 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765639.1 protein_id gnl|my_center|LOCUS_09140 19591 21048 gene locus_tag LOCUS_09150 19591 21048 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444920.1 protein_id gnl|my_center|LOCUS_09150 21477 24860 gene locus_tag LOCUS_09160 21477 24860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 24937 27810 gene locus_tag LOCUS_09170 24937 27810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 27859 29220 gene locus_tag LOCUS_09180 27859 29220 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225277.1 protein_id gnl|my_center|LOCUS_09180 29217 30140 gene locus_tag LOCUS_09190 29217 30140 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974044.1 protein_id gnl|my_center|LOCUS_09190 30150 31529 gene locus_tag LOCUS_09200 30150 31529 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061331.1 protein_id gnl|my_center|LOCUS_09200 32018 31818 gene locus_tag LOCUS_09210 32018 31818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 32307 32023 gene locus_tag LOCUS_09220 32307 32023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 32942 32436 gene locus_tag LOCUS_09230 32942 32436 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771208.1 protein_id gnl|my_center|LOCUS_09230 33355 33020 gene locus_tag LOCUS_09240 33355 33020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 33413 34762 gene locus_tag LOCUS_09250 33413 34762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 34870 35283 gene locus_tag LOCUS_09260 34870 35283 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921774.1 protein_id gnl|my_center|LOCUS_09260 35578 36450 gene locus_tag LOCUS_09270 35578 36450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 36997 36539 gene locus_tag LOCUS_09280 36997 36539 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_09280 40578 37216 gene locus_tag LOCUS_09290 40578 37216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 41132 40782 gene locus_tag LOCUS_09300 41132 40782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 41696 41148 gene locus_tag LOCUS_09310 41696 41148 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231280.1 protein_id gnl|my_center|LOCUS_09310 42562 41720 gene locus_tag LOCUS_09320 42562 41720 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390252.1 protein_id gnl|my_center|LOCUS_09320 43581 42562 gene locus_tag LOCUS_09330 43581 42562 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405088.1 protein_id gnl|my_center|LOCUS_09330 44620 43586 gene locus_tag LOCUS_09340 gene cyoE 44620 43586 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_09340 45234 44959 gene locus_tag LOCUS_09350 45234 44959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 45155 46468 gene locus_tag LOCUS_09360 45155 46468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 47796 46702 gene locus_tag LOCUS_09370 47796 46702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 48391 47870 gene locus_tag LOCUS_09380 48391 47870 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403434.1 protein_id gnl|my_center|LOCUS_09380 48802 48539 gene locus_tag LOCUS_09390 48802 48539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 49530 48799 gene locus_tag LOCUS_09400 49530 48799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 50654 49599 gene locus_tag LOCUS_09410 50654 49599 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212090561.1 protein_id gnl|my_center|LOCUS_09410 50977 54111 gene locus_tag LOCUS_09420 50977 54111 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_09420 54180 54914 gene locus_tag LOCUS_09430 54180 54914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 54911 59128 gene locus_tag LOCUS_09440 54911 59128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 59342 60145 gene locus_tag LOCUS_09450 59342 60145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 61831 60275 gene locus_tag LOCUS_09460 61831 60275 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_09460 62212 63072 gene locus_tag LOCUS_09470 gene ubiA 62212 63072 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_09470 63498 63193 gene locus_tag LOCUS_09480 63498 63193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 63783 63631 gene locus_tag LOCUS_09490 63783 63631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 63899 64726 gene locus_tag LOCUS_09500 gene pheA 63899 64726 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933330.1 protein_id gnl|my_center|LOCUS_09500 64872 67328 gene locus_tag LOCUS_09510 gene lon 64872 67328 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_09510 68362 67508 gene locus_tag LOCUS_09520 gene proC 68362 67508 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_09520 70265 68367 gene locus_tag LOCUS_09530 70265 68367 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207976.1 protein_id gnl|my_center|LOCUS_09530 70684 71040 gene locus_tag LOCUS_09540 70684 71040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 71733 71134 gene locus_tag LOCUS_09550 gene recR 71733 71134 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_09550 72144 71806 gene locus_tag LOCUS_09560 72144 71806 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256425.1 protein_id gnl|my_center|LOCUS_09560 74233 72125 gene locus_tag LOCUS_09570 74233 72125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 75040 74405 gene locus_tag LOCUS_09580 75040 74405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 75159 76040 gene locus_tag LOCUS_09590 75159 76040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 76608 76042 gene locus_tag LOCUS_09600 76608 76042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 76684 76878 gene locus_tag LOCUS_09610 76684 76878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 76922 77797 gene locus_tag LOCUS_09620 gene mazG 76922 77797 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869818.1 protein_id gnl|my_center|LOCUS_09620 77829 78572 gene locus_tag LOCUS_09630 77829 78572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 78639 79796 gene locus_tag LOCUS_09640 gene menC 78639 79796 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_09640 80850 79828 gene locus_tag LOCUS_09650 80850 79828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 81010 81663 gene locus_tag LOCUS_09660 81010 81663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 81727 82782 gene locus_tag LOCUS_09670 gene thiO 81727 82782 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921239.1 protein_id gnl|my_center|LOCUS_09670 84138 82822 gene locus_tag LOCUS_09680 84138 82822 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_09680 84304 85014 gene locus_tag LOCUS_09690 84304 85014 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258401.1 protein_id gnl|my_center|LOCUS_09690 87946 85550 gene locus_tag LOCUS_09700 87946 85550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 88269 88102 gene locus_tag LOCUS_09710 88269 88102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 88351 89964 gene locus_tag LOCUS_09720 gene lnt 88351 89964 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 protein_id gnl|my_center|LOCUS_09720 90156 91121 gene locus_tag LOCUS_09730 gene prfB 90156 91121 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_09730 91161 91580 gene locus_tag LOCUS_09740 91161 91580 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_09740 91625 93703 gene locus_tag LOCUS_09750 91625 93703 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530052.1 protein_id gnl|my_center|LOCUS_09750 93908 95176 gene locus_tag LOCUS_09760 93908 95176 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_09760 96546 95194 gene locus_tag LOCUS_09770 96546 95194 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963649.1 protein_id gnl|my_center|LOCUS_09770 97370 96543 gene locus_tag LOCUS_09780 97370 96543 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence009 670 1692 gene locus_tag LOCUS_09790 670 1692 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035548.1 protein_id gnl|my_center|LOCUS_09790 2808 1717 gene locus_tag LOCUS_09800 2808 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09800 3849 2815 gene locus_tag LOCUS_09810 3849 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09810 5054 3846 gene locus_tag LOCUS_09820 5054 3846 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933049.1 protein_id gnl|my_center|LOCUS_09820 7018 5144 gene locus_tag LOCUS_09830 7018 5144 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_09830 7305 8327 gene locus_tag LOCUS_09840 gene pstS 7305 8327 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479753.1 protein_id gnl|my_center|LOCUS_09840 8354 9343 gene locus_tag LOCUS_09850 gene pstC 8354 9343 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582860.1 protein_id gnl|my_center|LOCUS_09850 9340 10197 gene locus_tag LOCUS_09860 gene pstA 9340 10197 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_09860 10223 11053 gene locus_tag LOCUS_09870 gene pstB 10223 11053 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_09870 11207 12238 gene locus_tag LOCUS_09880 gene galK 11207 12238 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_09880 15639 12313 gene locus_tag LOCUS_09890 15639 12313 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_09890 19147 15818 gene locus_tag LOCUS_09900 19147 15818 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_09900 20293 19265 gene locus_tag LOCUS_09910 20293 19265 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256898.1 protein_id gnl|my_center|LOCUS_09910 22336 20381 gene locus_tag LOCUS_09920 22336 20381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 22420 23982 gene locus_tag LOCUS_09930 22420 23982 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943196.1 protein_id gnl|my_center|LOCUS_09930 24464 23934 gene locus_tag LOCUS_09940 24464 23934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 25359 24697 gene locus_tag LOCUS_09950 25359 24697 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122034.1 protein_id gnl|my_center|LOCUS_09950 26246 25404 gene locus_tag LOCUS_09960 26246 25404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 28782 26494 gene locus_tag LOCUS_09970 gene ppk1 28782 26494 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_09970 29185 30516 gene locus_tag LOCUS_09980 29185 30516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 30522 31859 gene locus_tag LOCUS_09990 30522 31859 CDS product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121732.1 protein_id gnl|my_center|LOCUS_09990 32479 32048 gene locus_tag LOCUS_10000 gene tadA 32479 32048 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073170.1 protein_id gnl|my_center|LOCUS_10000 35763 32554 gene locus_tag LOCUS_10010 35763 32554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 35764 36069 gene locus_tag LOCUS_10020 35764 36069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 36354 37166 gene locus_tag LOCUS_10030 36354 37166 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545324.1 protein_id gnl|my_center|LOCUS_10030 37192 37719 gene locus_tag LOCUS_10040 gene ruvC 37192 37719 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_10040 37781 39802 gene locus_tag LOCUS_10050 37781 39802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 39705 39977 gene locus_tag LOCUS_10060 39705 39977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 42088 41279 gene locus_tag LOCUS_10070 gene rsmA 42088 41279 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216839.1 protein_id gnl|my_center|LOCUS_10070 42258 43472 gene locus_tag LOCUS_10080 gene glgA 42258 43472 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258925.1 protein_id gnl|my_center|LOCUS_10080 44602 43490 gene locus_tag LOCUS_10090 44602 43490 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941380.1 protein_id gnl|my_center|LOCUS_10090 46363 44702 gene locus_tag LOCUS_10100 46363 44702 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_10100 46492 46953 gene locus_tag LOCUS_10110 46492 46953 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_10110 47800 46955 gene locus_tag LOCUS_10120 47800 46955 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_10120 48806 47865 gene locus_tag LOCUS_10130 gene dapA 48806 47865 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_10130 49593 48907 gene locus_tag LOCUS_10140 gene dapB 49593 48907 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_10140 51048 49600 gene locus_tag LOCUS_10150 gene lysC 51048 49600 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_10150 52151 51057 gene locus_tag LOCUS_10160 gene asd 52151 51057 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496420.1 protein_id gnl|my_center|LOCUS_10160 53223 52171 gene locus_tag LOCUS_10170 53223 52171 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_10170 53722 53279 gene locus_tag LOCUS_10180 gene nrdR 53722 53279 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459010.1 protein_id gnl|my_center|LOCUS_10180 56405 53775 gene locus_tag LOCUS_10190 56405 53775 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514554.1 protein_id gnl|my_center|LOCUS_10190 59090 56532 gene locus_tag LOCUS_10200 gene mrcB 59090 56532 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427455.1 protein_id gnl|my_center|LOCUS_10200 61235 59364 gene locus_tag LOCUS_10210 61235 59364 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_10210 62303 61374 gene locus_tag LOCUS_10220 62303 61374 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_10220 62846 66220 gene locus_tag LOCUS_10230 62846 66220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 66390 66187 gene locus_tag LOCUS_10240 66390 66187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 66440 67090 gene locus_tag LOCUS_10250 66440 67090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 67094 67627 gene locus_tag LOCUS_10260 67094 67627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 69408 67648 gene locus_tag LOCUS_10270 69408 67648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 70033 69749 gene locus_tag LOCUS_10280 70033 69749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 70681 70124 gene locus_tag LOCUS_10290 70681 70124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 71722 70799 gene locus_tag LOCUS_10300 71722 70799 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_10300 75653 71793 gene locus_tag LOCUS_10310 gene smc 75653 71793 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_10310 76591 75863 gene locus_tag LOCUS_10320 76591 75863 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896974.1 protein_id gnl|my_center|LOCUS_10320 77033 78337 gene locus_tag LOCUS_10330 77033 78337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 79219 78422 gene locus_tag LOCUS_10340 79219 78422 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_10340 79352 79831 gene locus_tag LOCUS_10350 79352 79831 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355791.1 protein_id gnl|my_center|LOCUS_10350 81061 79814 gene locus_tag LOCUS_10360 gene ispG 81061 79814 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887031.1 protein_id gnl|my_center|LOCUS_10360 81346 81870 gene locus_tag LOCUS_10370 81346 81870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 81923 83020 gene locus_tag LOCUS_10380 81923 83020 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583492.1 protein_id gnl|my_center|LOCUS_10380 84220 83027 gene locus_tag LOCUS_10390 gene rlmN 84220 83027 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864795.1 protein_id gnl|my_center|LOCUS_10390 84312 85658 gene locus_tag LOCUS_10400 84312 85658 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_10400 85706 86224 gene locus_tag LOCUS_10410 85706 86224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 86367 86987 gene locus_tag LOCUS_10420 86367 86987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 87027 88193 gene locus_tag LOCUS_10430 87027 88193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265561.1 protein_id gnl|my_center|LOCUS_10430 88199 89401 gene locus_tag LOCUS_10440 88199 89401 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_10440 89415 91049 gene locus_tag LOCUS_10450 89415 91049 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_10450 91052 91987 gene locus_tag LOCUS_10460 91052 91987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 91987 92730 gene locus_tag LOCUS_10470 91987 92730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 92727 93350 gene locus_tag LOCUS_10480 92727 93350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 93355 93966 gene locus_tag LOCUS_10490 93355 93966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence010 1059 262 gene locus_tag LOCUS_10500 1059 262 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_10500 1320 2420 gene locus_tag LOCUS_10510 1320 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3053 2433 gene locus_tag LOCUS_10520 3053 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4001 3078 gene locus_tag LOCUS_10530 4001 3078 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_10530 5581 4139 gene locus_tag LOCUS_10540 5581 4139 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889170.1 protein_id gnl|my_center|LOCUS_10540 5813 7267 gene locus_tag LOCUS_10550 gene hemY 5813 7267 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_10550 7287 8429 gene locus_tag LOCUS_10560 7287 8429 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_10560 9593 8607 gene locus_tag LOCUS_10570 9593 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 11746 9851 gene locus_tag LOCUS_10580 11746 9851 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921802.1 protein_id gnl|my_center|LOCUS_10580 11923 12363 gene locus_tag LOCUS_10590 11923 12363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 12398 13099 gene locus_tag LOCUS_10600 gene ccsA 12398 13099 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_10600 13495 13250 gene locus_tag LOCUS_10610 13495 13250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 13840 14043 gene locus_tag LOCUS_10620 13840 14043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 14859 14293 gene locus_tag LOCUS_10630 14859 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 15875 14856 gene locus_tag LOCUS_10640 gene rfaD 15875 14856 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_10640 16374 15868 gene locus_tag LOCUS_10650 gene rfaE2 16374 15868 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931903.1 protein_id gnl|my_center|LOCUS_10650 18328 16421 gene locus_tag LOCUS_10660 18328 16421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 19474 18533 gene locus_tag LOCUS_10670 19474 18533 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_10670 20911 19916 gene locus_tag LOCUS_10680 20911 19916 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_10680 21372 23657 gene locus_tag LOCUS_10690 21372 23657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 23843 24601 gene locus_tag LOCUS_10700 23843 24601 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_10700 24909 26018 gene locus_tag LOCUS_10710 24909 26018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 26015 27424 gene locus_tag LOCUS_10720 26015 27424 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087075.1 protein_id gnl|my_center|LOCUS_10720 27505 28773 gene locus_tag LOCUS_10730 27505 28773 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_10730 29328 30599 gene locus_tag LOCUS_10740 29328 30599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 30653 32221 gene locus_tag LOCUS_10750 30653 32221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 33119 32325 gene locus_tag LOCUS_10760 33119 32325 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_10760 34804 33188 gene locus_tag LOCUS_10770 34804 33188 CDS product glycoside hydrolase family 37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173519786.1 protein_id gnl|my_center|LOCUS_10770 36460 35138 gene locus_tag LOCUS_10780 36460 35138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 38781 36469 gene locus_tag LOCUS_10790 38781 36469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 41083 38888 gene locus_tag LOCUS_10800 41083 38888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 42082 41255 gene locus_tag LOCUS_10810 42082 41255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 42690 43928 gene locus_tag LOCUS_10820 42690 43928 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_10820 44029 45666 gene locus_tag LOCUS_10830 gene uxaA 44029 45666 CDS product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199376.1 protein_id gnl|my_center|LOCUS_10830 48269 45771 gene locus_tag LOCUS_10840 48269 45771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 49785 48358 gene locus_tag LOCUS_10850 49785 48358 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_10850 51600 50020 gene locus_tag LOCUS_10860 51600 50020 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243139.1 protein_id gnl|my_center|LOCUS_10860 53029 51605 gene locus_tag LOCUS_10870 53029 51605 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_10870 53272 53057 gene locus_tag LOCUS_10880 53272 53057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 55066 53312 gene locus_tag LOCUS_10890 55066 53312 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_10890 55828 55100 gene locus_tag LOCUS_10900 gene araD 55828 55100 CDS product L-ribulose-5-phosphate 4-epimerase AraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243028.1 protein_id gnl|my_center|LOCUS_10900 57101 55923 gene locus_tag LOCUS_10910 57101 55923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 58064 57102 gene locus_tag LOCUS_10920 58064 57102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 58447 58064 gene locus_tag LOCUS_10930 58447 58064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 58657 59343 gene locus_tag LOCUS_10940 58657 59343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 59336 60142 gene locus_tag LOCUS_10950 59336 60142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10950 60142 61092 gene locus_tag LOCUS_10960 60142 61092 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665997.1 protein_id gnl|my_center|LOCUS_10960 61102 62085 gene locus_tag LOCUS_10970 61102 62085 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039293.1 protein_id gnl|my_center|LOCUS_10970 63670 62069 gene locus_tag LOCUS_10980 gene nadB 63670 62069 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_10980 63768 64874 gene locus_tag LOCUS_10990 gene aroB 63768 64874 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208898.1 protein_id gnl|my_center|LOCUS_10990 64871 65632 gene locus_tag LOCUS_11000 gene ubiE 64871 65632 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889031.1 protein_id gnl|my_center|LOCUS_11000 65689 67122 gene locus_tag LOCUS_11010 65689 67122 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939066.1 protein_id gnl|my_center|LOCUS_11010 67156 67557 gene locus_tag LOCUS_11020 67156 67557 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257691.1 protein_id gnl|my_center|LOCUS_11020 67578 68381 gene locus_tag LOCUS_11030 67578 68381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 69822 68407 gene locus_tag LOCUS_11040 gene rsmB 69822 68407 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_11040 70715 69828 gene locus_tag LOCUS_11050 gene fmt 70715 69828 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_11050 71399 70890 gene locus_tag LOCUS_11060 gene def 71399 70890 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_11060 72517 71432 gene locus_tag LOCUS_11070 gene aroC 72517 71432 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_11070 73041 72664 gene locus_tag LOCUS_11080 73041 72664 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_11080 74039 73044 gene locus_tag LOCUS_11090 74039 73044 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_11090 75983 74100 gene locus_tag LOCUS_11100 75983 74100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 76292 77938 gene locus_tag LOCUS_11110 76292 77938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 78165 79802 gene locus_tag LOCUS_11120 78165 79802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 80202 81722 gene locus_tag LOCUS_11130 80202 81722 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223670054.1 protein_id gnl|my_center|LOCUS_11130 82221 82529 gene locus_tag LOCUS_11140 82221 82529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 82526 83827 gene locus_tag LOCUS_11150 gene purB 82526 83827 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733238.1 protein_id gnl|my_center|LOCUS_11150 83845 84450 gene locus_tag LOCUS_11160 83845 84450 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973807.1 protein_id gnl|my_center|LOCUS_11160 85413 84472 gene locus_tag LOCUS_11170 85413 84472 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 protein_id gnl|my_center|LOCUS_11170 85705 85632 gene locus_tag LOCUS_t00060 85705 85632 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 88406 85821 gene locus_tag LOCUS_11180 88406 85821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943051.1 protein_id gnl|my_center|LOCUS_11180 <89033 88403 gene locus_tag LOCUS_11190 <89033 88403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707237.1:ABC transporter ATP-binding protein >Feature sequence011 1054 800 gene locus_tag LOCUS_11200 1054 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1546 1446 gene locus_tag LOCUS_t00070 1546 1446 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1566 1862 gene locus_tag LOCUS_11210 1566 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2605 1994 gene locus_tag LOCUS_11220 2605 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 3271 3528 gene locus_tag LOCUS_11230 3271 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 5134 3839 gene locus_tag LOCUS_11240 5134 3839 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868206.1 protein_id gnl|my_center|LOCUS_11240 5433 6500 gene locus_tag LOCUS_11250 5433 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 8160 6919 gene locus_tag LOCUS_11260 gene acdA 8160 6919 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_11260 8266 10356 gene locus_tag LOCUS_11270 8266 10356 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030394.1 protein_id gnl|my_center|LOCUS_11270 10358 11278 gene locus_tag LOCUS_11280 10358 11278 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_11280 12697 11291 gene locus_tag LOCUS_11290 12697 11291 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_11290 14220 12688 gene locus_tag LOCUS_11300 14220 12688 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_11300 16663 14312 gene locus_tag LOCUS_11310 16663 14312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 17253 16735 gene locus_tag LOCUS_11320 17253 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 17448 17329 gene locus_tag LOCUS_11330 17448 17329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 17650 17432 gene locus_tag LOCUS_11340 17650 17432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 18661 17711 gene locus_tag LOCUS_11350 gene rsmH 18661 17711 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_11350 19152 18712 gene locus_tag LOCUS_11360 gene mraZ 19152 18712 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686427.1 protein_id gnl|my_center|LOCUS_11360 20089 19529 gene locus_tag LOCUS_11370 20089 19529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 20844 20092 gene locus_tag LOCUS_11380 20844 20092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 21110 22087 gene locus_tag LOCUS_11390 21110 22087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 23402 22296 gene locus_tag LOCUS_11400 23402 22296 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983707.1 protein_id gnl|my_center|LOCUS_11400 23759 24586 gene locus_tag LOCUS_11410 23759 24586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 24583 24855 gene locus_tag LOCUS_11420 24583 24855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 25674 25132 gene locus_tag LOCUS_11430 25674 25132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 27703 25811 gene locus_tag LOCUS_11440 gene dxs 27703 25811 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_11440 29040 27826 gene locus_tag LOCUS_11450 29040 27826 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391758.1 protein_id gnl|my_center|LOCUS_11450 29178 31211 gene locus_tag LOCUS_11460 29178 31211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 33191 31233 gene locus_tag LOCUS_11470 gene acs 33191 31233 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_11470 34261 33215 gene locus_tag LOCUS_11480 34261 33215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 35001 34369 gene locus_tag LOCUS_11490 35001 34369 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962904.1 protein_id gnl|my_center|LOCUS_11490 35159 37696 gene locus_tag LOCUS_11500 35159 37696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 38503 37817 gene locus_tag LOCUS_11510 38503 37817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 39485 38862 gene locus_tag LOCUS_11520 39485 38862 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_11520 40193 39639 gene locus_tag LOCUS_11530 gene dcd 40193 39639 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_11530 40370 40639 gene locus_tag LOCUS_11540 40370 40639 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_11540 40969 42822 gene locus_tag LOCUS_11550 gene msbA 40969 42822 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_11550 42819 43739 gene locus_tag LOCUS_11560 42819 43739 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_11560 43785 44492 gene locus_tag LOCUS_11570 gene gmk 43785 44492 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046966.1 protein_id gnl|my_center|LOCUS_11570 44570 44803 gene locus_tag LOCUS_11580 44570 44803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 44901 46145 gene locus_tag LOCUS_11590 gene coaBC 44901 46145 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392412.1 protein_id gnl|my_center|LOCUS_11590 46171 47013 gene locus_tag LOCUS_11600 46171 47013 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_11600 47080 47763 gene locus_tag LOCUS_11610 47080 47763 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037696.1 protein_id gnl|my_center|LOCUS_11610 47839 50328 gene locus_tag LOCUS_11620 gene priA 47839 50328 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_11620 51323 50343 gene locus_tag LOCUS_11630 gene rapZ 51323 50343 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289695.1 protein_id gnl|my_center|LOCUS_11630 52015 51434 gene locus_tag LOCUS_11640 52015 51434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 53836 52061 gene locus_tag LOCUS_11650 53836 52061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 54787 54059 gene locus_tag LOCUS_11660 gene lptB 54787 54059 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016586.1 protein_id gnl|my_center|LOCUS_11660 57357 54787 gene locus_tag LOCUS_11670 57357 54787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 57415 58017 gene locus_tag LOCUS_11680 57415 58017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 60182 58014 gene locus_tag LOCUS_11690 gene glyS 60182 58014 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_11690 61174 60218 gene locus_tag LOCUS_11700 gene glyQ 61174 60218 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869809.1 protein_id gnl|my_center|LOCUS_11700 61998 61255 gene locus_tag LOCUS_11710 gene recO 61998 61255 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 protein_id gnl|my_center|LOCUS_11710 62367 62107 gene locus_tag LOCUS_11720 62367 62107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 63380 62481 gene locus_tag LOCUS_11730 63380 62481 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_11730 63679 63377 gene locus_tag LOCUS_11740 63679 63377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 64644 63697 gene locus_tag LOCUS_11750 64644 63697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 65414 64647 gene locus_tag LOCUS_11760 65414 64647 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_11760 66324 65563 gene locus_tag LOCUS_11770 66324 65563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 67323 66451 gene locus_tag LOCUS_11780 67323 66451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 68707 67526 gene locus_tag LOCUS_11790 gene alaC 68707 67526 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_11790 69362 68946 gene locus_tag LOCUS_11800 69362 68946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 70328 69435 gene locus_tag LOCUS_11810 70328 69435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 70674 70444 gene locus_tag LOCUS_11820 70674 70444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 70899 70690 gene locus_tag LOCUS_11830 70899 70690 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_11830 74189 70896 gene locus_tag LOCUS_11840 74189 70896 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_11840 75295 74186 gene locus_tag LOCUS_11850 75295 74186 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_11850 76650 75292 gene locus_tag LOCUS_11860 76650 75292 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404713.1 protein_id gnl|my_center|LOCUS_11860 77313 77062 gene locus_tag LOCUS_11870 77313 77062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 77477 78784 gene locus_tag LOCUS_11880 77477 78784 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_11880 78785 82084 gene locus_tag LOCUS_11890 78785 82084 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_11890 82044 85478 gene locus_tag LOCUS_11900 82044 85478 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_11900 85475 86965 gene locus_tag LOCUS_11910 gene tolC 85475 86965 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735329.1 protein_id gnl|my_center|LOCUS_11910 86999 88024 gene locus_tag LOCUS_11920 gene lpxD 86999 88024 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142009.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence012 675 295 gene locus_tag LOCUS_11930 675 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2061 1018 gene locus_tag LOCUS_11940 2061 1018 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_11940 3981 2179 gene locus_tag LOCUS_11950 3981 2179 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403962.1 protein_id gnl|my_center|LOCUS_11950 4292 5266 gene locus_tag LOCUS_11960 4292 5266 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085034.1 protein_id gnl|my_center|LOCUS_11960 5742 6179 gene locus_tag LOCUS_11970 gene argR 5742 6179 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_11970 6179 7240 gene locus_tag LOCUS_11980 gene argC 6179 7240 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 protein_id gnl|my_center|LOCUS_11980 7237 8019 gene locus_tag LOCUS_11990 gene argB 7237 8019 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_11990 8016 9263 gene locus_tag LOCUS_12000 8016 9263 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082331.1 protein_id gnl|my_center|LOCUS_12000 9260 10381 gene locus_tag LOCUS_12010 gene argF 9260 10381 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257452.1 protein_id gnl|my_center|LOCUS_12010 10405 11619 gene locus_tag LOCUS_12020 10405 11619 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_12020 11616 13115 gene locus_tag LOCUS_12030 gene argH 11616 13115 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_12030 13102 13620 gene locus_tag LOCUS_12040 13102 13620 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_12040 14362 13640 gene locus_tag LOCUS_12050 14362 13640 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986856.1 protein_id gnl|my_center|LOCUS_12050 14454 15701 gene locus_tag LOCUS_12060 gene argJ 14454 15701 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938124.1 protein_id gnl|my_center|LOCUS_12060 15873 16943 gene locus_tag LOCUS_12070 gene pdhA 15873 16943 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_12070 16974 17966 gene locus_tag LOCUS_12080 gene bfmBAB 16974 17966 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290076.1 protein_id gnl|my_center|LOCUS_12080 18127 19557 gene locus_tag LOCUS_12090 18127 19557 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120884.1 protein_id gnl|my_center|LOCUS_12090 21855 19618 gene locus_tag LOCUS_12100 21855 19618 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_12100 24810 21904 gene locus_tag LOCUS_12110 24810 21904 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257050.1 protein_id gnl|my_center|LOCUS_12110 26720 24807 gene locus_tag LOCUS_12120 gene treZ 26720 24807 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403430.1 protein_id gnl|my_center|LOCUS_12120 28465 26717 gene locus_tag LOCUS_12130 28465 26717 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_12130 28807 30576 gene locus_tag LOCUS_12140 28807 30576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 protein_id gnl|my_center|LOCUS_12140 30573 35030 gene locus_tag LOCUS_12150 30573 35030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 36479 35061 gene locus_tag LOCUS_12160 36479 35061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 36797 36519 gene locus_tag LOCUS_12170 36797 36519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 37294 36794 gene locus_tag LOCUS_12180 37294 36794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 39346 37298 gene locus_tag LOCUS_12190 39346 37298 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_12190 40513 39593 gene locus_tag LOCUS_12200 40513 39593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 41414 42661 gene locus_tag LOCUS_12210 41414 42661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 42849 44165 gene locus_tag LOCUS_12220 42849 44165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 45241 44195 gene locus_tag LOCUS_12230 45241 44195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12230 45794 45177 gene locus_tag LOCUS_12240 45794 45177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12240 47146 46007 gene locus_tag LOCUS_12250 47146 46007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 48064 47843 gene locus_tag LOCUS_12260 48064 47843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 50708 48042 gene locus_tag LOCUS_12270 50708 48042 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202335.1 protein_id gnl|my_center|LOCUS_12270 51044 53062 gene locus_tag LOCUS_12280 51044 53062 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 protein_id gnl|my_center|LOCUS_12280 54696 53692 gene locus_tag LOCUS_12290 54696 53692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 54906 55898 gene locus_tag LOCUS_12300 54906 55898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 56106 57917 gene locus_tag LOCUS_12310 56106 57917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 58076 58882 gene locus_tag LOCUS_12320 58076 58882 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_12320 60405 59347 gene locus_tag LOCUS_12330 gene trpD 60405 59347 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_12330 60572 61750 gene locus_tag LOCUS_12340 gene sucC 60572 61750 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_12340 61747 62622 gene locus_tag LOCUS_12350 gene sucD 61747 62622 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_12350 62663 63076 gene locus_tag LOCUS_12360 gene ndk 62663 63076 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939606.1 protein_id gnl|my_center|LOCUS_12360 64294 63413 gene locus_tag LOCUS_12370 64294 63413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 65167 64370 gene locus_tag LOCUS_12380 gene kdsB 65167 64370 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545187.1 protein_id gnl|my_center|LOCUS_12380 65355 65431 gene locus_tag LOCUS_t00080 65355 65431 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 65823 65692 gene locus_tag LOCUS_12390 65823 65692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 65890 66363 gene locus_tag LOCUS_12400 65890 66363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 66360 66593 gene locus_tag LOCUS_12410 66360 66593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 67682 66705 gene locus_tag LOCUS_12420 67682 66705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 68031 70736 gene locus_tag LOCUS_12430 68031 70736 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038017.1 protein_id gnl|my_center|LOCUS_12430 71556 70807 gene locus_tag LOCUS_12440 gene pyrF 71556 70807 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420156.1 protein_id gnl|my_center|LOCUS_12440 73022 71553 gene locus_tag LOCUS_12450 gene gatA 73022 71553 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_12450 73499 73089 gene locus_tag LOCUS_12460 gene gatC 73499 73089 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933493.1 protein_id gnl|my_center|LOCUS_12460 73937 74233 gene locus_tag LOCUS_12470 73937 74233 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093079.1 protein_id gnl|my_center|LOCUS_12470 75288 74470 gene locus_tag LOCUS_12480 75288 74470 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_12480 76971 75517 gene locus_tag LOCUS_12490 76971 75517 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_12490 77603 80566 gene locus_tag LOCUS_12500 77603 80566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence013 1447 383 gene locus_tag LOCUS_12510 1447 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1813 1610 gene locus_tag LOCUS_12520 1813 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1864 3201 gene locus_tag LOCUS_12530 1864 3201 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_12530 3275 4063 gene locus_tag LOCUS_12540 3275 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4060 4734 gene locus_tag LOCUS_12550 4060 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4731 5588 gene locus_tag LOCUS_12560 gene murI 4731 5588 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938069.1 protein_id gnl|my_center|LOCUS_12560 5648 6415 gene locus_tag LOCUS_12570 5648 6415 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582796.1 protein_id gnl|my_center|LOCUS_12570 7110 6622 gene locus_tag LOCUS_12580 gene tsaE 7110 6622 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_12580 8447 7107 gene locus_tag LOCUS_12590 8447 7107 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_12590 8352 8753 gene locus_tag LOCUS_12600 8352 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 8950 8819 gene locus_tag LOCUS_12610 8950 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 9326 9156 gene locus_tag LOCUS_12620 9326 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 9889 9473 gene locus_tag LOCUS_12630 9889 9473 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140283.1 protein_id gnl|my_center|LOCUS_12630 10185 9886 gene locus_tag LOCUS_12640 10185 9886 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140282.1 protein_id gnl|my_center|LOCUS_12640 11242 10325 gene locus_tag LOCUS_12650 11242 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 12541 11483 gene locus_tag LOCUS_12660 gene aroF 12541 11483 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460211.1 protein_id gnl|my_center|LOCUS_12660 12873 12559 gene locus_tag LOCUS_12670 12873 12559 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942472.1 protein_id gnl|my_center|LOCUS_12670 13840 13052 gene locus_tag LOCUS_12680 gene trpA 13840 13052 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_12680 15083 13857 gene locus_tag LOCUS_12690 gene trpB 15083 13857 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258563.1 protein_id gnl|my_center|LOCUS_12690 15917 15210 gene locus_tag LOCUS_12700 15917 15210 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_12700 16739 15927 gene locus_tag LOCUS_12710 gene trpC 16739 15927 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186826.1 protein_id gnl|my_center|LOCUS_12710 17141 17644 gene locus_tag LOCUS_12720 17141 17644 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088607.1 protein_id gnl|my_center|LOCUS_12720 18014 19267 gene locus_tag LOCUS_12730 18014 19267 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534674.1 protein_id gnl|my_center|LOCUS_12730 19264 22584 gene locus_tag LOCUS_12740 19264 22584 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521877.1 protein_id gnl|my_center|LOCUS_12740 22581 25673 gene locus_tag LOCUS_12750 gene mdtC 22581 25673 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667528.1 protein_id gnl|my_center|LOCUS_12750 25756 27312 gene locus_tag LOCUS_12760 25756 27312 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196794.1 protein_id gnl|my_center|LOCUS_12760 27367 28725 gene locus_tag LOCUS_12770 27367 28725 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 protein_id gnl|my_center|LOCUS_12770 28848 30821 gene locus_tag LOCUS_12780 28848 30821 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 protein_id gnl|my_center|LOCUS_12780 31930 30836 gene locus_tag LOCUS_12790 31930 30836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 33421 32114 gene locus_tag LOCUS_12800 33421 32114 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_12800 34700 33561 gene locus_tag LOCUS_12810 34700 33561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 34946 35704 gene locus_tag LOCUS_12820 34946 35704 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_12820 35701 36765 gene locus_tag LOCUS_12830 35701 36765 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_12830 36762 37775 gene locus_tag LOCUS_12840 36762 37775 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_12840 37772 38884 gene locus_tag LOCUS_12850 37772 38884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 41251 39008 gene locus_tag LOCUS_12860 41251 39008 CDS product glycoside hydrolase family 92 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048697949.1 protein_id gnl|my_center|LOCUS_12860 41413 42423 gene locus_tag LOCUS_12870 41413 42423 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_12870 42441 44444 gene locus_tag LOCUS_12880 42441 44444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 44876 46216 gene locus_tag LOCUS_12890 44876 46216 CDS product glycosyl hydrolase family 79 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526730.1 protein_id gnl|my_center|LOCUS_12890 46368 46784 gene locus_tag LOCUS_12900 46368 46784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 49296 46813 gene locus_tag LOCUS_12910 49296 46813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 49786 53160 gene locus_tag LOCUS_12920 49786 53160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 53283 54731 gene locus_tag LOCUS_12930 53283 54731 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921847.1 protein_id gnl|my_center|LOCUS_12930 54885 56513 gene locus_tag LOCUS_12940 54885 56513 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 protein_id gnl|my_center|LOCUS_12940 59571 56710 gene locus_tag LOCUS_12950 59571 56710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12950 60094 59879 gene locus_tag LOCUS_12960 60094 59879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 61640 60165 gene locus_tag LOCUS_12970 61640 60165 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 protein_id gnl|my_center|LOCUS_12970 64906 61658 gene locus_tag LOCUS_12980 64906 61658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 66209 65355 gene locus_tag LOCUS_12990 66209 65355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 67365 66202 gene locus_tag LOCUS_13000 67365 66202 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533016.1 protein_id gnl|my_center|LOCUS_13000 68432 67362 gene locus_tag LOCUS_13010 68432 67362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 69640 68450 gene locus_tag LOCUS_13020 gene rhmD 69640 68450 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174589.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence014 437 512 gene locus_tag LOCUS_t00090 437 512 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 589 840 gene locus_tag LOCUS_13030 589 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 882 1490 gene locus_tag LOCUS_13040 gene nusG 882 1490 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 protein_id gnl|my_center|LOCUS_13040 1628 2065 gene locus_tag LOCUS_13050 gene rplK 1628 2065 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085809.1 protein_id gnl|my_center|LOCUS_13050 2278 2994 gene locus_tag LOCUS_13060 gene rplA 2278 2994 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_13060 3099 3641 gene locus_tag LOCUS_13070 gene rplJ 3099 3641 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287288.1 protein_id gnl|my_center|LOCUS_13070 3873 4253 gene locus_tag LOCUS_13080 gene rplL 3873 4253 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_13080 4841 9316 gene locus_tag LOCUS_13090 gene rpoB 4841 9316 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940188.1 protein_id gnl|my_center|LOCUS_13090 9627 13817 gene locus_tag LOCUS_13100 gene rpoC 9627 13817 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_13100 14069 14626 gene locus_tag LOCUS_13110 14069 14626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 14660 14956 gene locus_tag LOCUS_13120 14660 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 17303 14982 gene locus_tag LOCUS_13130 gene bglX 17303 14982 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658134.1 protein_id gnl|my_center|LOCUS_13130 17576 18373 gene locus_tag LOCUS_13140 17576 18373 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_13140 18496 20067 gene locus_tag LOCUS_13150 gene pyk 18496 20067 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943944.1 protein_id gnl|my_center|LOCUS_13150 20089 22122 gene locus_tag LOCUS_13160 gene mutL 20089 22122 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 protein_id gnl|my_center|LOCUS_13160 23620 23429 gene locus_tag LOCUS_13170 23620 23429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 24310 24642 gene locus_tag LOCUS_13180 24310 24642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 24639 25337 gene locus_tag LOCUS_13190 gene cmk 24639 25337 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_13190 25511 25807 gene locus_tag LOCUS_13200 25511 25807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 25895 28534 gene locus_tag LOCUS_13210 25895 28534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 28919 30589 gene locus_tag LOCUS_13220 28919 30589 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_13220 30786 31673 gene locus_tag LOCUS_13230 30786 31673 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121390.1 protein_id gnl|my_center|LOCUS_13230 31829 32893 gene locus_tag LOCUS_13240 gene gcvT 31829 32893 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_13240 32984 33376 gene locus_tag LOCUS_13250 gene gcvH 32984 33376 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_13250 33398 34756 gene locus_tag LOCUS_13260 gene gcvPA 33398 34756 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_13260 34771 36390 gene locus_tag LOCUS_13270 gene gcvPB 34771 36390 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722477.1 protein_id gnl|my_center|LOCUS_13270 36391 36657 gene locus_tag LOCUS_13280 36391 36657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 37831 36728 gene locus_tag LOCUS_13290 37831 36728 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900173.1 protein_id gnl|my_center|LOCUS_13290 38887 37862 gene locus_tag LOCUS_13300 38887 37862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 39805 38993 gene locus_tag LOCUS_13310 39805 38993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 41015 39774 gene locus_tag LOCUS_13320 41015 39774 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080341.1 protein_id gnl|my_center|LOCUS_13320 41920 41012 gene locus_tag LOCUS_13330 41920 41012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 42442 42621 gene locus_tag LOCUS_13340 42442 42621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 42650 42726 gene locus_tag LOCUS_t00100 42650 42726 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42854 43885 gene locus_tag LOCUS_13350 gene mgrA 42854 43885 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426913.1 protein_id gnl|my_center|LOCUS_13350 43961 45625 gene locus_tag LOCUS_13360 gene bshC 43961 45625 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_13360 45730 46041 gene locus_tag LOCUS_13370 45730 46041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 47031 46126 gene locus_tag LOCUS_13380 gene rfbD 47031 46126 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186608.1 protein_id gnl|my_center|LOCUS_13380 47903 47028 gene locus_tag LOCUS_13390 gene rfbA 47903 47028 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_13390 49006 47915 gene locus_tag LOCUS_13400 gene rfbB 49006 47915 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522250.1 protein_id gnl|my_center|LOCUS_13400 49297 49842 gene locus_tag LOCUS_13410 gene rfbC 49297 49842 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185665.1 protein_id gnl|my_center|LOCUS_13410 50382 53336 gene locus_tag LOCUS_13420 50382 53336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 53473 55095 gene locus_tag LOCUS_13430 53473 55095 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_13430 55731 56642 gene locus_tag LOCUS_13440 gene pgeF 55731 56642 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_13440 56765 56974 gene locus_tag LOCUS_13450 56765 56974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 57170 58936 gene locus_tag LOCUS_13460 57170 58936 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203736.1 protein_id gnl|my_center|LOCUS_13460 59040 60767 gene locus_tag LOCUS_13470 59040 60767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 62036 60837 gene locus_tag LOCUS_13480 62036 60837 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108695.1 protein_id gnl|my_center|LOCUS_13480 62400 64958 gene locus_tag LOCUS_13490 62400 64958 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_13490 65035 65364 gene locus_tag LOCUS_13500 65035 65364 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_13500 65366 68008 gene locus_tag LOCUS_13510 65366 68008 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_13510 68466 68053 gene locus_tag LOCUS_13520 68466 68053 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_13520 71456 68604 gene locus_tag LOCUS_13530 71456 68604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence015 277 438 gene locus_tag LOCUS_13540 277 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 600 1235 gene locus_tag LOCUS_13550 600 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1316 2011 gene locus_tag LOCUS_13560 1316 2011 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_13560 2381 3436 gene locus_tag LOCUS_13570 gene trpS 2381 3436 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_13570 3433 4443 gene locus_tag LOCUS_13580 3433 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 4490 5413 gene locus_tag LOCUS_13590 4490 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 5410 6417 gene locus_tag LOCUS_13600 5410 6417 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_13600 6499 6969 gene locus_tag LOCUS_13610 gene msrA 6499 6969 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943782.1 protein_id gnl|my_center|LOCUS_13610 7565 8242 gene locus_tag LOCUS_13620 7565 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 9742 8270 gene locus_tag LOCUS_13630 9742 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 11338 9755 gene locus_tag LOCUS_13640 11338 9755 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_13640 11529 12680 gene locus_tag LOCUS_13650 11529 12680 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225620.1 protein_id gnl|my_center|LOCUS_13650 13828 12722 gene locus_tag LOCUS_13660 13828 12722 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_13660 14118 14675 gene locus_tag LOCUS_13670 14118 14675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 14871 16049 gene locus_tag LOCUS_13680 gene metK 14871 16049 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_13680 16695 17252 gene locus_tag LOCUS_13690 16695 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 17351 18625 gene locus_tag LOCUS_13700 gene ahcY 17351 18625 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_13700 19454 18705 gene locus_tag LOCUS_13710 19454 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 20080 19910 gene locus_tag LOCUS_13720 20080 19910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 20537 20734 gene locus_tag LOCUS_13730 20537 20734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 21174 20731 gene locus_tag LOCUS_13740 21174 20731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13740 21675 21223 gene locus_tag LOCUS_13750 21675 21223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 21763 23460 gene locus_tag LOCUS_13760 21763 23460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13760 23503 24222 gene locus_tag LOCUS_13770 23503 24222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13770 24696 26966 gene locus_tag LOCUS_13780 24696 26966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 28003 27272 gene locus_tag LOCUS_13790 28003 27272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 29002 28019 gene locus_tag LOCUS_13800 29002 28019 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_13800 29990 29100 gene locus_tag LOCUS_13810 gene soj 29990 29100 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_13810 30970 30302 gene locus_tag LOCUS_13820 30970 30302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 31764 30979 gene locus_tag LOCUS_13830 31764 30979 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256367.1 protein_id gnl|my_center|LOCUS_13830 32678 31761 gene locus_tag LOCUS_13840 32678 31761 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789007.1 protein_id gnl|my_center|LOCUS_13840 34082 32682 gene locus_tag LOCUS_13850 34082 32682 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272524.1 protein_id gnl|my_center|LOCUS_13850 34126 35010 gene locus_tag LOCUS_13860 34126 35010 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 protein_id gnl|my_center|LOCUS_13860 35068 36339 gene locus_tag LOCUS_13870 gene larA 35068 36339 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224947.1 protein_id gnl|my_center|LOCUS_13870 36481 36816 gene locus_tag LOCUS_13880 36481 36816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 37108 37950 gene locus_tag LOCUS_13890 37108 37950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 38040 39392 gene locus_tag LOCUS_13900 38040 39392 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_13900 40253 39408 gene locus_tag LOCUS_13910 gene accD 40253 39408 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_13910 40834 40298 gene locus_tag LOCUS_13920 gene cobO 40834 40298 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531120.1 protein_id gnl|my_center|LOCUS_13920 41417 40944 gene locus_tag LOCUS_13930 41417 40944 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887264.1 protein_id gnl|my_center|LOCUS_13930 42157 45726 gene locus_tag LOCUS_13940 42157 45726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 46379 45822 gene locus_tag LOCUS_13950 46379 45822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 47267 46506 gene locus_tag LOCUS_13960 47267 46506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 48328 47297 gene locus_tag LOCUS_13970 gene obgE 48328 47297 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545625.1 protein_id gnl|my_center|LOCUS_13970 48619 51996 gene locus_tag LOCUS_13980 48619 51996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 53121 52003 gene locus_tag LOCUS_13990 53121 52003 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_13990 55271 53229 gene locus_tag LOCUS_14000 gene thrS 55271 53229 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_14000 55363 55857 gene locus_tag LOCUS_14010 55363 55857 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021261.1 protein_id gnl|my_center|LOCUS_14010 56897 55932 gene locus_tag LOCUS_14020 56897 55932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022102.1 protein_id gnl|my_center|LOCUS_14020 57107 58090 gene locus_tag LOCUS_14030 57107 58090 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_14030 59065 58124 gene locus_tag LOCUS_14040 gene hemB 59065 58124 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_14040 59710 59171 gene locus_tag LOCUS_14050 59710 59171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 60064 61746 gene locus_tag LOCUS_14060 60064 61746 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_14060 61743 62231 gene locus_tag LOCUS_14070 61743 62231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 62270 63271 gene locus_tag LOCUS_14080 62270 63271 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_14080 63283 64281 gene locus_tag LOCUS_14090 63283 64281 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_14090 64544 67213 gene locus_tag LOCUS_14100 64544 67213 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_14100 67513 70149 gene locus_tag LOCUS_14110 67513 70149 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403423.1 protein_id gnl|my_center|LOCUS_14110 70270 70881 gene locus_tag LOCUS_14120 70270 70881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence016 2642 153 gene locus_tag LOCUS_14130 2642 153 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_14130 3063 4358 gene locus_tag LOCUS_14140 3063 4358 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888818.1 protein_id gnl|my_center|LOCUS_14140 4386 5288 gene locus_tag LOCUS_14150 4386 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 5798 6967 gene locus_tag LOCUS_14160 gene dnaN 5798 6967 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083651.1 protein_id gnl|my_center|LOCUS_14160 7230 6997 gene locus_tag LOCUS_14170 7230 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 10601 7434 gene locus_tag LOCUS_14180 10601 7434 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444632.1 protein_id gnl|my_center|LOCUS_14180 12178 10598 gene locus_tag LOCUS_14190 12178 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 13533 12175 gene locus_tag LOCUS_14200 13533 12175 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928917.1 protein_id gnl|my_center|LOCUS_14200 13978 13643 gene locus_tag LOCUS_14210 13978 13643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 14656 14504 gene locus_tag LOCUS_14220 14656 14504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 14705 16708 gene locus_tag LOCUS_14230 14705 16708 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265628.1 protein_id gnl|my_center|LOCUS_14230 16840 19503 gene locus_tag LOCUS_14240 16840 19503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 19516 20400 gene locus_tag LOCUS_14250 19516 20400 CDS product CBU_1789 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958443.1 protein_id gnl|my_center|LOCUS_14250 20953 20459 gene locus_tag LOCUS_14260 20953 20459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 21793 21065 gene locus_tag LOCUS_14270 21793 21065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 22668 21940 gene locus_tag LOCUS_14280 22668 21940 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_14280 22799 23512 gene locus_tag LOCUS_14290 gene ric 22799 23512 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401371.1 protein_id gnl|my_center|LOCUS_14290 23509 24846 gene locus_tag LOCUS_14300 23509 24846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 24843 27134 gene locus_tag LOCUS_14310 24843 27134 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197954.1 protein_id gnl|my_center|LOCUS_14310 27203 28174 gene locus_tag LOCUS_14320 gene cysK 27203 28174 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_14320 28171 28932 gene locus_tag LOCUS_14330 gene cysE 28171 28932 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071396735.1 protein_id gnl|my_center|LOCUS_14330 29959 28979 gene locus_tag LOCUS_14340 29959 28979 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818458.1 protein_id gnl|my_center|LOCUS_14340 31179 30223 gene locus_tag LOCUS_14350 gene rbsK 31179 30223 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246357.1 protein_id gnl|my_center|LOCUS_14350 32198 31200 gene locus_tag LOCUS_14360 32198 31200 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471147.1 protein_id gnl|my_center|LOCUS_14360 32566 33249 gene locus_tag LOCUS_14370 32566 33249 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211429.1 protein_id gnl|my_center|LOCUS_14370 33287 34702 gene locus_tag LOCUS_14380 33287 34702 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545853.1 protein_id gnl|my_center|LOCUS_14380 34725 35771 gene locus_tag LOCUS_14390 gene cydB 34725 35771 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942286.1 protein_id gnl|my_center|LOCUS_14390 35888 38320 gene locus_tag LOCUS_14400 35888 38320 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 protein_id gnl|my_center|LOCUS_14400 38299 39570 gene locus_tag LOCUS_14410 38299 39570 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927045.1 protein_id gnl|my_center|LOCUS_14410 41335 39572 gene locus_tag LOCUS_14420 41335 39572 CDS product 1,4-alpha-glucan branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867884.1 protein_id gnl|my_center|LOCUS_14420 41798 42172 gene locus_tag LOCUS_14430 41798 42172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 42346 42867 gene locus_tag LOCUS_14440 42346 42867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 43866 42937 gene locus_tag LOCUS_14450 43866 42937 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_14450 44231 44512 gene locus_tag LOCUS_14460 44231 44512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 45661 44528 gene locus_tag LOCUS_14470 45661 44528 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403266.1 protein_id gnl|my_center|LOCUS_14470 46110 46940 gene locus_tag LOCUS_14480 46110 46940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 47573 47052 gene locus_tag LOCUS_14490 47573 47052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 49541 47721 gene locus_tag LOCUS_14500 gene polX 49541 47721 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615613.1 protein_id gnl|my_center|LOCUS_14500 49923 49699 gene locus_tag LOCUS_14510 gene cspC 49923 49699 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_14510 50900 50145 gene locus_tag LOCUS_14520 50900 50145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 51692 51108 gene locus_tag LOCUS_14530 51692 51108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 51801 52934 gene locus_tag LOCUS_14540 51801 52934 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_14540 53420 52956 gene locus_tag LOCUS_14550 53420 52956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 54690 53593 gene locus_tag LOCUS_14560 gene holB 54690 53593 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_14560 56153 54687 gene locus_tag LOCUS_14570 56153 54687 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_14570 56856 56194 gene locus_tag LOCUS_14580 gene tmk 56856 56194 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919690.1 protein_id gnl|my_center|LOCUS_14580 56933 57481 gene locus_tag LOCUS_14590 56933 57481 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_14590 57560 59461 gene locus_tag LOCUS_14600 57560 59461 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 protein_id gnl|my_center|LOCUS_14600 59557 61380 gene locus_tag LOCUS_14610 59557 61380 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_14610 62098 61508 gene locus_tag LOCUS_14620 62098 61508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 62248 63054 gene locus_tag LOCUS_14630 62248 63054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 65004 63136 gene locus_tag LOCUS_14640 gene recJ 65004 63136 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020281.1 protein_id gnl|my_center|LOCUS_14640 65507 65001 gene locus_tag LOCUS_14650 65507 65001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 65691 66050 gene locus_tag LOCUS_14660 65691 66050 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_14660 66108 66386 gene locus_tag LOCUS_14670 66108 66386 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013194.1 protein_id gnl|my_center|LOCUS_14670 66383 66658 gene locus_tag LOCUS_14680 66383 66658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 66697 68169 gene locus_tag LOCUS_14690 66697 68169 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939561.1 protein_id gnl|my_center|LOCUS_14690 68153 69094 gene locus_tag LOCUS_14700 68153 69094 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_14700 <70884 69157 gene locus_tag LOCUS_14710 <70884 69157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005767351.1:glycoside hydrolase family 3 C-terminal domain-containing protein >Feature sequence017 143 571 gene locus_tag LOCUS_14720 143 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 866 2017 gene locus_tag LOCUS_14730 gene nadA 866 2017 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389688.1 protein_id gnl|my_center|LOCUS_14730 2021 2455 gene locus_tag LOCUS_14740 2021 2455 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222744.1 protein_id gnl|my_center|LOCUS_14740 3193 2660 gene locus_tag LOCUS_14750 3193 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3414 3845 gene locus_tag LOCUS_14760 3414 3845 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_14760 3950 4561 gene locus_tag LOCUS_14770 gene dps 3950 4561 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144276.1 protein_id gnl|my_center|LOCUS_14770 4561 4926 gene locus_tag LOCUS_14780 4561 4926 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_14780 5074 5616 gene locus_tag LOCUS_14790 5074 5616 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844498.1 protein_id gnl|my_center|LOCUS_14790 5644 6198 gene locus_tag LOCUS_14800 5644 6198 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_14800 6219 7421 gene locus_tag LOCUS_14810 6219 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 7580 8707 gene locus_tag LOCUS_14820 7580 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 10880 8811 gene locus_tag LOCUS_14830 10880 8811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 12178 10973 gene locus_tag LOCUS_14840 12178 10973 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870391.1 protein_id gnl|my_center|LOCUS_14840 12571 12936 gene locus_tag LOCUS_14850 12571 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 12989 14452 gene locus_tag LOCUS_14860 12989 14452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 14912 15364 gene locus_tag LOCUS_14870 14912 15364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 15361 16167 gene locus_tag LOCUS_14880 15361 16167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 16168 16707 gene locus_tag LOCUS_14890 16168 16707 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_14890 16744 18375 gene locus_tag LOCUS_14900 gene atpA 16744 18375 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_14900 18379 19446 gene locus_tag LOCUS_14910 18379 19446 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125753.1 protein_id gnl|my_center|LOCUS_14910 19503 20945 gene locus_tag LOCUS_14920 gene atpD 19503 20945 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_14920 20961 21389 gene locus_tag LOCUS_14930 20961 21389 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529039.1 protein_id gnl|my_center|LOCUS_14930 21621 22010 gene locus_tag LOCUS_14940 21621 22010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 23046 22102 gene locus_tag LOCUS_14950 23046 22102 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_14950 24830 23043 gene locus_tag LOCUS_14960 24830 23043 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946763.1 protein_id gnl|my_center|LOCUS_14960 25175 24969 gene locus_tag LOCUS_14970 25175 24969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 25568 25227 gene locus_tag LOCUS_14980 25568 25227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 25783 25538 gene locus_tag LOCUS_14990 25783 25538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 27484 25808 gene locus_tag LOCUS_15000 27484 25808 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229143.1 protein_id gnl|my_center|LOCUS_15000 29577 27622 gene locus_tag LOCUS_15010 29577 27622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 32329 30218 gene locus_tag LOCUS_15020 32329 30218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 32605 33465 gene locus_tag LOCUS_15030 32605 33465 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_15030 34108 33638 gene locus_tag LOCUS_15040 34108 33638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 34266 35261 gene locus_tag LOCUS_15050 34266 35261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 35367 35825 gene locus_tag LOCUS_15060 35367 35825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 36334 36074 gene locus_tag LOCUS_15070 36334 36074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 37002 36331 gene locus_tag LOCUS_15080 37002 36331 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930688.1 protein_id gnl|my_center|LOCUS_15080 37598 39721 gene locus_tag LOCUS_15090 37598 39721 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_15090 39825 39911 gene locus_tag LOCUS_t00110 39825 39911 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 40699 42453 gene locus_tag LOCUS_15100 40699 42453 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225490.1 protein_id gnl|my_center|LOCUS_15100 42954 44834 gene locus_tag LOCUS_15110 42954 44834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 44831 51025 gene locus_tag LOCUS_15120 44831 51025 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152825375.1 protein_id gnl|my_center|LOCUS_15120 51243 51593 gene locus_tag LOCUS_15130 51243 51593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 54334 51839 gene locus_tag LOCUS_15140 54334 51839 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201960.1 protein_id gnl|my_center|LOCUS_15140 55920 55732 gene locus_tag LOCUS_15150 55920 55732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 55996 56295 gene locus_tag LOCUS_15160 55996 56295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 56341 59028 gene locus_tag LOCUS_15170 56341 59028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 61339 59099 gene locus_tag LOCUS_15180 61339 59099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 64596 61372 gene locus_tag LOCUS_15190 64596 61372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 65445 64870 gene locus_tag LOCUS_15200 65445 64870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 65858 66247 gene locus_tag LOCUS_15210 65858 66247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 68697 66301 gene locus_tag LOCUS_15220 68697 66301 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303124.1 protein_id gnl|my_center|LOCUS_15220 <69736 68864 gene locus_tag LOCUS_15230 <69736 68864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105322.1:GntP family permease >Feature sequence018 167 346 gene locus_tag LOCUS_15240 167 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 330 533 gene locus_tag LOCUS_15250 330 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 2181 1123 gene locus_tag LOCUS_15260 2181 1123 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_15260 4200 2272 gene locus_tag LOCUS_15270 4200 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 4905 4477 gene locus_tag LOCUS_15280 4905 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4982 5590 gene locus_tag LOCUS_15290 4982 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 5708 6682 gene locus_tag LOCUS_15300 5708 6682 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_15300 6903 7148 gene locus_tag LOCUS_15310 6903 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 7265 7510 gene locus_tag LOCUS_15320 7265 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 7710 8132 gene locus_tag LOCUS_15330 7710 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 8129 8617 gene locus_tag LOCUS_15340 8129 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 9218 8688 gene locus_tag LOCUS_15350 9218 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 9943 9611 gene locus_tag LOCUS_15360 9943 9611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 10307 9936 gene locus_tag LOCUS_15370 10307 9936 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_15370 10461 13193 gene locus_tag LOCUS_15380 gene mobF 10461 13193 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_15380 13301 13909 gene locus_tag LOCUS_15390 13301 13909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 14906 14025 gene locus_tag LOCUS_15400 14906 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 15336 15010 gene locus_tag LOCUS_15410 15336 15010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 15768 15340 gene locus_tag LOCUS_15420 15768 15340 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626168.1 protein_id gnl|my_center|LOCUS_15420 16478 17659 gene locus_tag LOCUS_15430 16478 17659 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861441.1 protein_id gnl|my_center|LOCUS_15430 18173 18574 gene locus_tag LOCUS_15440 18173 18574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 18576 19097 gene locus_tag LOCUS_15450 18576 19097 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971655.1 protein_id gnl|my_center|LOCUS_15450 19409 19636 gene locus_tag LOCUS_15460 19409 19636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 20003 19758 gene locus_tag LOCUS_15470 20003 19758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 19980 22448 gene locus_tag LOCUS_15480 19980 22448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 22466 23749 gene locus_tag LOCUS_15490 22466 23749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 24326 25183 gene locus_tag LOCUS_15500 24326 25183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 25436 25705 gene locus_tag LOCUS_15510 25436 25705 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140282.1 protein_id gnl|my_center|LOCUS_15510 25705 26115 gene locus_tag LOCUS_15520 25705 26115 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140283.1 protein_id gnl|my_center|LOCUS_15520 26768 26208 gene locus_tag LOCUS_15530 gene gmhB 26768 26208 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194255.1 protein_id gnl|my_center|LOCUS_15530 27460 26765 gene locus_tag LOCUS_15540 27460 26765 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194086.1 protein_id gnl|my_center|LOCUS_15540 28082 27465 gene locus_tag LOCUS_15550 gene gmhA2 28082 27465 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857991.1 protein_id gnl|my_center|LOCUS_15550 29113 28079 gene locus_tag LOCUS_15560 29113 28079 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194045.1 protein_id gnl|my_center|LOCUS_15560 30288 29188 gene locus_tag LOCUS_15570 30288 29188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 31067 30285 gene locus_tag LOCUS_15580 31067 30285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 32685 31417 gene locus_tag LOCUS_15590 32685 31417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 33030 32734 gene locus_tag LOCUS_15600 33030 32734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 33917 33096 gene locus_tag LOCUS_15610 33917 33096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15610 34208 33942 gene locus_tag LOCUS_15620 34208 33942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15620 34743 34246 gene locus_tag LOCUS_15630 34743 34246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15630 35097 34801 gene locus_tag LOCUS_15640 35097 34801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15640 35405 35094 gene locus_tag LOCUS_15650 35405 35094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15650 36094 35522 gene locus_tag LOCUS_15660 36094 35522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 37924 37451 gene locus_tag LOCUS_15670 37924 37451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 39015 39389 gene locus_tag LOCUS_15680 39015 39389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 39396 39611 gene locus_tag LOCUS_15690 39396 39611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 41082 39706 gene locus_tag LOCUS_15700 41082 39706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545573.1 protein_id gnl|my_center|LOCUS_15700 42212 41142 gene locus_tag LOCUS_15710 42212 41142 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_15710 44092 42362 gene locus_tag LOCUS_15720 44092 42362 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551340.1 protein_id gnl|my_center|LOCUS_15720 45614 44232 gene locus_tag LOCUS_15730 gene rfbH 45614 44232 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_15730 46591 45611 gene locus_tag LOCUS_15740 46591 45611 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546520.1 protein_id gnl|my_center|LOCUS_15740 47388 46612 gene locus_tag LOCUS_15750 gene rfbF 47388 46612 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_15750 47602 47952 gene locus_tag LOCUS_15760 47602 47952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 49346 48363 gene locus_tag LOCUS_15770 49346 48363 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113814.1 protein_id gnl|my_center|LOCUS_15770 49928 49662 gene locus_tag LOCUS_15780 49928 49662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 50182 49925 gene locus_tag LOCUS_15790 50182 49925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 50662 50249 gene locus_tag LOCUS_15800 50662 50249 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846680.1 protein_id gnl|my_center|LOCUS_15800 50946 50653 gene locus_tag LOCUS_15810 50946 50653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 51927 51025 gene locus_tag LOCUS_15820 51927 51025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 53960 51924 gene locus_tag LOCUS_15830 53960 51924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 54295 53978 gene locus_tag LOCUS_15840 54295 53978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 55609 54530 gene locus_tag LOCUS_15850 55609 54530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 56682 55609 gene locus_tag LOCUS_15860 56682 55609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 56972 56679 gene locus_tag LOCUS_15870 56972 56679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 57283 56975 gene locus_tag LOCUS_15880 57283 56975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 57176 57379 gene locus_tag LOCUS_15890 57176 57379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 57771 57376 gene locus_tag LOCUS_15900 57771 57376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 58210 57803 gene locus_tag LOCUS_15910 58210 57803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 59511 58795 gene locus_tag LOCUS_15920 59511 58795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 59816 59568 gene locus_tag LOCUS_15930 59816 59568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 60432 60779 gene locus_tag LOCUS_15940 60432 60779 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899954.1 protein_id gnl|my_center|LOCUS_15940 60795 61103 gene locus_tag LOCUS_15950 60795 61103 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 protein_id gnl|my_center|LOCUS_15950 61882 61205 gene locus_tag LOCUS_15960 61882 61205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 62709 61888 gene locus_tag LOCUS_15970 62709 61888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 63557 62727 gene locus_tag LOCUS_15980 63557 62727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 65047 63782 gene locus_tag LOCUS_15990 65047 63782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 65808 65056 gene locus_tag LOCUS_16000 65808 65056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 68282 65817 gene locus_tag LOCUS_16010 gene trbE 68282 65817 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090993.1 protein_id gnl|my_center|LOCUS_16010 66900 66974 gene locus_tag LOCUS_t00120 66900 66974 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 68580 68269 gene locus_tag LOCUS_16020 68580 68269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 68884 68621 gene locus_tag LOCUS_16030 68884 68621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence019 2427 676 gene locus_tag LOCUS_16040 2427 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2604 6827 gene locus_tag LOCUS_16050 2604 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 6839 8269 gene locus_tag LOCUS_16060 6839 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 8636 8427 gene locus_tag LOCUS_16070 8636 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 8984 8793 gene locus_tag LOCUS_16080 8984 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 8926 11448 gene locus_tag LOCUS_16090 8926 11448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 12437 11589 gene locus_tag LOCUS_16100 12437 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 12661 13836 gene locus_tag LOCUS_16110 12661 13836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 13852 14964 gene locus_tag LOCUS_16120 13852 14964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 15233 16192 gene locus_tag LOCUS_16130 15233 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 18508 16406 gene locus_tag LOCUS_16140 18508 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 20140 18962 gene locus_tag LOCUS_16150 20140 18962 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_16150 21139 20288 gene locus_tag LOCUS_16160 21139 20288 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186540.1 protein_id gnl|my_center|LOCUS_16160 21909 21136 gene locus_tag LOCUS_16170 21909 21136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 25290 22039 gene locus_tag LOCUS_16180 25290 22039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 28866 25531 gene locus_tag LOCUS_16190 28866 25531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 29084 29254 gene locus_tag LOCUS_16200 29084 29254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 31092 29263 gene locus_tag LOCUS_16210 31092 29263 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_16210 31467 33023 gene locus_tag LOCUS_16220 31467 33023 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_16220 33204 34898 gene locus_tag LOCUS_16230 33204 34898 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223815.1 protein_id gnl|my_center|LOCUS_16230 35139 35978 gene locus_tag LOCUS_16240 gene fabG 35139 35978 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_16240 36239 35964 gene locus_tag LOCUS_16250 36239 35964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 36301 36687 gene locus_tag LOCUS_16260 36301 36687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 37422 36658 gene locus_tag LOCUS_16270 37422 36658 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971207.1 protein_id gnl|my_center|LOCUS_16270 37997 37545 gene locus_tag LOCUS_16280 37997 37545 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_16280 38503 38784 gene locus_tag LOCUS_16290 38503 38784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 38813 39595 gene locus_tag LOCUS_16300 38813 39595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 39710 40198 gene locus_tag LOCUS_16310 39710 40198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 40253 40687 gene locus_tag LOCUS_16320 40253 40687 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537487.1 protein_id gnl|my_center|LOCUS_16320 40944 42122 gene locus_tag LOCUS_16330 40944 42122 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922457.1 protein_id gnl|my_center|LOCUS_16330 42143 43024 gene locus_tag LOCUS_16340 42143 43024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 44013 43261 gene locus_tag LOCUS_16350 44013 43261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 44340 46136 gene locus_tag LOCUS_16360 44340 46136 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_16360 46265 46705 gene locus_tag LOCUS_16370 46265 46705 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_16370 47375 46788 gene locus_tag LOCUS_16380 47375 46788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 47669 48127 gene locus_tag LOCUS_16390 47669 48127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 48404 49519 gene locus_tag LOCUS_16400 48404 49519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_16400 49516 49824 gene locus_tag LOCUS_16410 49516 49824 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258441.1 protein_id gnl|my_center|LOCUS_16410 49883 50356 gene locus_tag LOCUS_16420 49883 50356 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525695.1 protein_id gnl|my_center|LOCUS_16420 50443 50844 gene locus_tag LOCUS_16430 50443 50844 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_16430 51285 50854 gene locus_tag LOCUS_16440 51285 50854 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_16440 52106 51282 gene locus_tag LOCUS_16450 52106 51282 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_16450 53240 52368 gene locus_tag LOCUS_16460 53240 52368 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173573.1 protein_id gnl|my_center|LOCUS_16460 54190 53249 gene locus_tag LOCUS_16470 54190 53249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 55932 54307 gene locus_tag LOCUS_16480 55932 54307 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228762.1 protein_id gnl|my_center|LOCUS_16480 56143 56556 gene locus_tag LOCUS_16490 56143 56556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 57296 56553 gene locus_tag LOCUS_16500 57296 56553 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809659.1 protein_id gnl|my_center|LOCUS_16500 58208 57456 gene locus_tag LOCUS_16510 gene aqpZ 58208 57456 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185292.1 protein_id gnl|my_center|LOCUS_16510 58536 58345 gene locus_tag LOCUS_16520 58536 58345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 59358 58675 gene locus_tag LOCUS_16530 59358 58675 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_16530 59698 60075 gene locus_tag LOCUS_16540 59698 60075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 60377 61228 gene locus_tag LOCUS_16550 60377 61228 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942562.1 protein_id gnl|my_center|LOCUS_16550 61429 62253 gene locus_tag LOCUS_16560 61429 62253 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_16560 62439 63608 gene locus_tag LOCUS_16570 62439 63608 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_16570 63638 64999 gene locus_tag LOCUS_16580 gene rseP 63638 64999 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_16580 65631 64996 gene locus_tag LOCUS_16590 65631 64996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 66772 65735 gene locus_tag LOCUS_16600 gene lpxD 66772 65735 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583184.1 protein_id gnl|my_center|LOCUS_16600 66844 68127 gene locus_tag LOCUS_16610 66844 68127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence020 1056 184 gene locus_tag LOCUS_16620 1056 184 CDS product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460946.1 protein_id gnl|my_center|LOCUS_16620 1747 1214 gene locus_tag LOCUS_16630 1747 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 2343 1876 gene locus_tag LOCUS_16640 2343 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 3047 2340 gene locus_tag LOCUS_16650 gene sbrI 3047 2340 CDS product ECF family RNA polymerase sigma factor SbrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 protein_id gnl|my_center|LOCUS_16650 3165 3968 gene locus_tag LOCUS_16660 gene rlmB 3165 3968 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_16660 3965 5986 gene locus_tag LOCUS_16670 3965 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 6594 6055 gene locus_tag LOCUS_16680 6594 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921973.1 protein_id gnl|my_center|LOCUS_16680 7863 6766 gene locus_tag LOCUS_16690 7863 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 7940 9976 gene locus_tag LOCUS_16700 gene ligA 7940 9976 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_16700 11401 10076 gene locus_tag LOCUS_16710 11401 10076 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_16710 11755 12309 gene locus_tag LOCUS_16720 11755 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 13857 12313 gene locus_tag LOCUS_16730 13857 12313 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_16730 14217 17231 gene locus_tag LOCUS_16740 gene fdhF 14217 17231 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245240.1 protein_id gnl|my_center|LOCUS_16740 17247 17819 gene locus_tag LOCUS_16750 17247 17819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 17927 18832 gene locus_tag LOCUS_16760 17927 18832 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090737.1 protein_id gnl|my_center|LOCUS_16760 18837 21749 gene locus_tag LOCUS_16770 gene ligD 18837 21749 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970164.1 protein_id gnl|my_center|LOCUS_16770 21903 21700 gene locus_tag LOCUS_16780 21903 21700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 23362 22019 gene locus_tag LOCUS_16790 23362 22019 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087805.1 protein_id gnl|my_center|LOCUS_16790 24106 23438 gene locus_tag LOCUS_16800 24106 23438 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257014.1 protein_id gnl|my_center|LOCUS_16800 24835 27609 gene locus_tag LOCUS_16810 gene ppdK 24835 27609 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392144.1 protein_id gnl|my_center|LOCUS_16810 27838 28917 gene locus_tag LOCUS_16820 27838 28917 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533416.1 protein_id gnl|my_center|LOCUS_16820 30684 29191 gene locus_tag LOCUS_16830 gene xylB 30684 29191 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_16830 30873 32375 gene locus_tag LOCUS_16840 30873 32375 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_16840 33129 32383 gene locus_tag LOCUS_16850 33129 32383 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037420.1 protein_id gnl|my_center|LOCUS_16850 35443 33401 gene locus_tag LOCUS_16860 35443 33401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 36156 35563 gene locus_tag LOCUS_16870 36156 35563 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974186.1 protein_id gnl|my_center|LOCUS_16870 37314 36169 gene locus_tag LOCUS_16880 37314 36169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 38593 37346 gene locus_tag LOCUS_16890 38593 37346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 39706 38672 gene locus_tag LOCUS_16900 39706 38672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 41976 39706 gene locus_tag LOCUS_16910 gene vpsO 41976 39706 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_16910 42558 45023 gene locus_tag LOCUS_16920 42558 45023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 45507 45698 gene locus_tag LOCUS_16930 45507 45698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 45794 46570 gene locus_tag LOCUS_16940 45794 46570 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085032.1 protein_id gnl|my_center|LOCUS_16940 46975 47865 gene locus_tag LOCUS_16950 46975 47865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 49571 48027 gene locus_tag LOCUS_16960 49571 48027 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337061.1 protein_id gnl|my_center|LOCUS_16960 51856 49742 gene locus_tag LOCUS_16970 51856 49742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 52306 53748 gene locus_tag LOCUS_16980 52306 53748 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526016.1 protein_id gnl|my_center|LOCUS_16980 53831 54169 gene locus_tag LOCUS_16990 53831 54169 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_16990 54217 56868 gene locus_tag LOCUS_17000 54217 56868 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917903.1 protein_id gnl|my_center|LOCUS_17000 57222 59168 gene locus_tag LOCUS_17010 57222 59168 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767002.1 protein_id gnl|my_center|LOCUS_17010 59178 60152 gene locus_tag LOCUS_17020 59178 60152 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_17020 60643 60535 gene locus_tag LOCUS_r00010 60643 60535 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence021 881 1216 gene locus_tag LOCUS_17030 881 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1880 1671 gene locus_tag LOCUS_17040 1880 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2744 1980 gene locus_tag LOCUS_17050 2744 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 3260 3466 gene locus_tag LOCUS_17060 3260 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 3463 3984 gene locus_tag LOCUS_17070 3463 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 5431 8301 gene locus_tag LOCUS_17080 5431 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 8474 8710 gene locus_tag LOCUS_17090 8474 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 8707 9087 gene locus_tag LOCUS_17100 8707 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 9087 9479 gene locus_tag LOCUS_17110 9087 9479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 9509 9688 gene locus_tag LOCUS_17120 9509 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 9672 10292 gene locus_tag LOCUS_17130 9672 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 10376 11923 gene locus_tag LOCUS_17140 10376 11923 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143988.1 protein_id gnl|my_center|LOCUS_17140 12079 12921 gene locus_tag LOCUS_17150 12079 12921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 12983 13843 gene locus_tag LOCUS_17160 12983 13843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 13994 15283 gene locus_tag LOCUS_17170 13994 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 15384 15920 gene locus_tag LOCUS_17180 15384 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 16018 16464 gene locus_tag LOCUS_17190 16018 16464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 16617 17591 gene locus_tag LOCUS_17200 16617 17591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 17716 18339 gene locus_tag LOCUS_17210 17716 18339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 18343 18783 gene locus_tag LOCUS_17220 18343 18783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 18798 19286 gene locus_tag LOCUS_17230 18798 19286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 19283 20284 gene locus_tag LOCUS_17240 19283 20284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 20333 22666 gene locus_tag LOCUS_17250 20333 22666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 22702 22917 gene locus_tag LOCUS_17260 22702 22917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 23002 23169 gene locus_tag LOCUS_17270 23002 23169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 29062 24122 gene locus_tag LOCUS_17280 29062 24122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 30439 29462 gene locus_tag LOCUS_17290 30439 29462 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_17290 30725 31486 gene locus_tag LOCUS_17300 30725 31486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 32094 32414 gene locus_tag LOCUS_17310 32094 32414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 33242 32796 gene locus_tag LOCUS_17320 33242 32796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 33360 34190 gene locus_tag LOCUS_17330 gene dinD 33360 34190 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 protein_id gnl|my_center|LOCUS_17330 35943 34531 gene locus_tag LOCUS_17340 35943 34531 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402863.1 protein_id gnl|my_center|LOCUS_17340 36483 35986 gene locus_tag LOCUS_17350 36483 35986 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900471.1 protein_id gnl|my_center|LOCUS_17350 38006 36720 gene locus_tag LOCUS_17360 38006 36720 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880274.1 protein_id gnl|my_center|LOCUS_17360 38084 38389 gene locus_tag LOCUS_17370 38084 38389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 38653 39549 gene locus_tag LOCUS_17380 38653 39549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 39809 39648 gene locus_tag LOCUS_17390 39809 39648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 40804 39983 gene locus_tag LOCUS_17400 40804 39983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 42186 40912 gene locus_tag LOCUS_17410 42186 40912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 43207 42218 gene locus_tag LOCUS_17420 gene alr 43207 42218 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_17420 44774 43416 gene locus_tag LOCUS_17430 gene dnaB 44774 43416 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_17430 45140 45646 gene locus_tag LOCUS_17440 45140 45646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 47668 45665 gene locus_tag LOCUS_17450 gene mnmG 47668 45665 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_17450 47975 47760 gene locus_tag LOCUS_17460 47975 47760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 48067 48777 gene locus_tag LOCUS_17470 48067 48777 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036734.1 protein_id gnl|my_center|LOCUS_17470 49285 48854 gene locus_tag LOCUS_17480 49285 48854 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531558.1 protein_id gnl|my_center|LOCUS_17480 49800 50330 gene locus_tag LOCUS_17490 49800 50330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 50338 50844 gene locus_tag LOCUS_17500 gene purE 50338 50844 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_17500 50844 52019 gene locus_tag LOCUS_17510 50844 52019 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335445.1 protein_id gnl|my_center|LOCUS_17510 53829 52093 gene locus_tag LOCUS_17520 gene sucB 53829 52093 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110455.1 protein_id gnl|my_center|LOCUS_17520 54884 54129 gene locus_tag LOCUS_17530 gene lipB 54884 54129 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405264.1 protein_id gnl|my_center|LOCUS_17530 <55933 54959 gene locus_tag LOCUS_17540 <55933 54959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258694.1:dihydrolipoyl dehydrogenase >Feature sequence022 910 230 gene locus_tag LOCUS_17550 gene msrA 910 230 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928865.1 protein_id gnl|my_center|LOCUS_17550 1714 986 gene locus_tag LOCUS_17560 gene thiE 1714 986 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_17560 1903 3306 gene locus_tag LOCUS_17570 gene sthA 1903 3306 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_17570 3310 4206 gene locus_tag LOCUS_17580 3310 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 5630 4317 gene locus_tag LOCUS_17590 5630 4317 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_17590 6884 5715 gene locus_tag LOCUS_17600 6884 5715 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640418.1 protein_id gnl|my_center|LOCUS_17600 8713 7148 gene locus_tag LOCUS_17610 8713 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 9295 9056 gene locus_tag LOCUS_17620 9295 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 9207 11639 gene locus_tag LOCUS_17630 9207 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 11790 12749 gene locus_tag LOCUS_17640 11790 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 12840 13961 gene locus_tag LOCUS_17650 12840 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 14399 14136 gene locus_tag LOCUS_17660 14399 14136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17660 14784 14512 gene locus_tag LOCUS_17670 14784 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 14944 15222 gene locus_tag LOCUS_17680 14944 15222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 16029 15211 gene locus_tag LOCUS_17690 16029 15211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 16648 16214 gene locus_tag LOCUS_17700 gene tolR 16648 16214 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310275.1 protein_id gnl|my_center|LOCUS_17700 16671 16838 gene locus_tag LOCUS_17710 16671 16838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 17238 16765 gene locus_tag LOCUS_17720 17238 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 18141 17398 gene locus_tag LOCUS_17730 gene tolQ 18141 17398 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924836.1 protein_id gnl|my_center|LOCUS_17730 18939 18226 gene locus_tag LOCUS_17740 18939 18226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 20318 19113 gene locus_tag LOCUS_17750 20318 19113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 22015 20402 gene locus_tag LOCUS_17760 gene secD 22015 20402 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_17760 22384 22070 gene locus_tag LOCUS_17770 gene yajC 22384 22070 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_17770 23724 22570 gene locus_tag LOCUS_17780 gene tgt 23724 22570 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_17780 23812 24768 gene locus_tag LOCUS_17790 23812 24768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 25269 24820 gene locus_tag LOCUS_17800 25269 24820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 28195 25565 gene locus_tag LOCUS_17810 gene clpB 28195 25565 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_17810 28829 28323 gene locus_tag LOCUS_17820 28829 28323 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_17820 30473 29118 gene locus_tag LOCUS_17830 gene aldO 30473 29118 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_17830 31518 30880 gene locus_tag LOCUS_17840 31518 30880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 31989 33236 gene locus_tag LOCUS_17850 31989 33236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 34384 33443 gene locus_tag LOCUS_17860 34384 33443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 35402 34395 gene locus_tag LOCUS_17870 gene mltG 35402 34395 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880471.1 protein_id gnl|my_center|LOCUS_17870 35727 35416 gene locus_tag LOCUS_17880 35727 35416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 36015 35731 gene locus_tag LOCUS_17890 36015 35731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 37326 36073 gene locus_tag LOCUS_17900 37326 36073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 37342 37506 gene locus_tag LOCUS_17910 37342 37506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 37763 38236 gene locus_tag LOCUS_17920 gene greA 37763 38236 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941932.1 protein_id gnl|my_center|LOCUS_17920 38236 38904 gene locus_tag LOCUS_17930 38236 38904 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_17930 39034 39162 gene locus_tag LOCUS_17940 39034 39162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 39406 40368 gene locus_tag LOCUS_17950 39406 40368 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259348.1 protein_id gnl|my_center|LOCUS_17950 40664 40365 gene locus_tag LOCUS_17960 40664 40365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 40557 41021 gene locus_tag LOCUS_17970 40557 41021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 41297 43579 gene locus_tag LOCUS_17980 41297 43579 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765808.1 protein_id gnl|my_center|LOCUS_17980 43704 44120 gene locus_tag LOCUS_17990 43704 44120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 45275 44196 gene locus_tag LOCUS_18000 gene arsB 45275 44196 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943585.1 protein_id gnl|my_center|LOCUS_18000 45712 45275 gene locus_tag LOCUS_18010 gene arsR 45712 45275 CDS product As(III)-sensing metalloregulatory transcriptional repressor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540252.1 protein_id gnl|my_center|LOCUS_18010 45790 46671 gene locus_tag LOCUS_18020 45790 46671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 46747 47235 gene locus_tag LOCUS_18030 46747 47235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 48862 49056 gene locus_tag LOCUS_18040 48862 49056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 50267 49086 gene locus_tag LOCUS_18050 50267 49086 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_18050 50413 51318 gene locus_tag LOCUS_18060 gene lpxC 50413 51318 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035967.1 protein_id gnl|my_center|LOCUS_18060 51443 51910 gene locus_tag LOCUS_18070 51443 51910 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083867.1 protein_id gnl|my_center|LOCUS_18070 51965 52387 gene locus_tag LOCUS_18080 51965 52387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 52390 52932 gene locus_tag LOCUS_18090 gene folK 52390 52932 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_18090 53003 53704 gene locus_tag LOCUS_18100 53003 53704 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883398.1 protein_id gnl|my_center|LOCUS_18100 54617 54126 gene locus_tag LOCUS_18110 54617 54126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 55396 54620 gene locus_tag LOCUS_18120 55396 54620 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929490.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence023 2431 257 gene locus_tag LOCUS_18130 2431 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 3780 2608 gene locus_tag LOCUS_18140 3780 2608 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929121.1 protein_id gnl|my_center|LOCUS_18140 4775 4299 gene locus_tag LOCUS_18150 4775 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 5363 4905 gene locus_tag LOCUS_18160 5363 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 5506 6951 gene locus_tag LOCUS_18170 gene mtaB 5506 6951 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_18170 7056 7745 gene locus_tag LOCUS_18180 gene infC 7056 7745 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256288.1 protein_id gnl|my_center|LOCUS_18180 9280 7853 gene locus_tag LOCUS_18190 9280 7853 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404687.1 protein_id gnl|my_center|LOCUS_18190 9367 10434 gene locus_tag LOCUS_18200 9367 10434 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_18200 12074 10506 gene locus_tag LOCUS_18210 12074 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 12820 12278 gene locus_tag LOCUS_18220 gene bcp 12820 12278 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_18220 13823 12897 gene locus_tag LOCUS_18230 gene lpxI 13823 12897 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_18230 14636 13842 gene locus_tag LOCUS_18240 gene lpxA 14636 13842 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946259.1 protein_id gnl|my_center|LOCUS_18240 15184 14633 gene locus_tag LOCUS_18250 15184 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 15736 15230 gene locus_tag LOCUS_18260 15736 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 16462 15758 gene locus_tag LOCUS_18270 16462 15758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 17402 16554 gene locus_tag LOCUS_18280 gene fabG 17402 16554 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_18280 18065 17463 gene locus_tag LOCUS_18290 18065 17463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 19379 18126 gene locus_tag LOCUS_18300 19379 18126 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921469.1 protein_id gnl|my_center|LOCUS_18300 19378 20637 gene locus_tag LOCUS_18310 gene tyrS 19378 20637 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_18310 20790 21503 gene locus_tag LOCUS_18320 20790 21503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 22647 21631 gene locus_tag LOCUS_18330 22647 21631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 23763 22771 gene locus_tag LOCUS_18340 23763 22771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 23822 24463 gene locus_tag LOCUS_18350 23822 24463 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_18350 25317 24712 gene locus_tag LOCUS_18360 25317 24712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 27260 25485 gene locus_tag LOCUS_18370 27260 25485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 27485 29290 gene locus_tag LOCUS_18380 gene lepA 27485 29290 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_18380 30278 29613 gene locus_tag LOCUS_18390 30278 29613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 33682 30710 gene locus_tag LOCUS_18400 33682 30710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 33996 33808 gene locus_tag LOCUS_18410 33996 33808 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143465.1 protein_id gnl|my_center|LOCUS_18410 36158 34002 gene locus_tag LOCUS_18420 36158 34002 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_18420 36886 36299 gene locus_tag LOCUS_18430 gene frr 36886 36299 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_18430 37045 37362 gene locus_tag LOCUS_18440 37045 37362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 38329 37400 gene locus_tag LOCUS_18450 gene lipA 38329 37400 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_18450 40050 38380 gene locus_tag LOCUS_18460 40050 38380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 40839 40210 gene locus_tag LOCUS_18470 40839 40210 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_18470 41471 40854 gene locus_tag LOCUS_18480 41471 40854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 42314 44569 gene locus_tag LOCUS_18490 42314 44569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 46427 45240 gene locus_tag LOCUS_18500 46427 45240 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107852.1 protein_id gnl|my_center|LOCUS_18500 47137 46433 gene locus_tag LOCUS_18510 gene pyrH 47137 46433 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_18510 47242 48297 gene locus_tag LOCUS_18520 47242 48297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 48943 48491 gene locus_tag LOCUS_18530 48943 48491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 49875 49087 gene locus_tag LOCUS_18540 49875 49087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 51040 50405 gene locus_tag LOCUS_18550 gene tsf 51040 50405 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_18550 52150 51242 gene locus_tag LOCUS_18560 gene rpsB 52150 51242 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_18560 52718 52323 gene locus_tag LOCUS_18570 gene rpsI 52718 52323 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228699.1 protein_id gnl|my_center|LOCUS_18570 53195 52737 gene locus_tag LOCUS_18580 gene rplM 53195 52737 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence024 1860 235 gene locus_tag LOCUS_18590 1860 235 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827567.1 protein_id gnl|my_center|LOCUS_18590 2095 3117 gene locus_tag LOCUS_18600 gene meaB 2095 3117 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255953.1 protein_id gnl|my_center|LOCUS_18600 3284 3697 gene locus_tag LOCUS_18610 gene mce 3284 3697 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_18610 3697 4482 gene locus_tag LOCUS_18620 3697 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4479 5066 gene locus_tag LOCUS_18630 4479 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 5164 5379 gene locus_tag LOCUS_18640 5164 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 5462 6169 gene locus_tag LOCUS_18650 5462 6169 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532543.1 protein_id gnl|my_center|LOCUS_18650 6166 7032 gene locus_tag LOCUS_18660 gene pssA 6166 7032 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_18660 7085 8218 gene locus_tag LOCUS_18670 gene asd 7085 8218 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414849.1 protein_id gnl|my_center|LOCUS_18670 8247 9620 gene locus_tag LOCUS_18680 8247 9620 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_18680 9722 11341 gene locus_tag LOCUS_18690 9722 11341 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918459.1 protein_id gnl|my_center|LOCUS_18690 12806 11448 gene locus_tag LOCUS_18700 12806 11448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 13497 15161 gene locus_tag LOCUS_18710 gene sirA 13497 15161 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_18710 15188 15820 gene locus_tag LOCUS_18720 15188 15820 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_18720 15817 16611 gene locus_tag LOCUS_18730 15817 16611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18730 17854 16670 gene locus_tag LOCUS_18740 17854 16670 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836306.1 protein_id gnl|my_center|LOCUS_18740 18003 18968 gene locus_tag LOCUS_18750 18003 18968 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384840.1 protein_id gnl|my_center|LOCUS_18750 20442 19147 gene locus_tag LOCUS_18760 20442 19147 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886532.1 protein_id gnl|my_center|LOCUS_18760 20730 21569 gene locus_tag LOCUS_18770 20730 21569 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_18770 21648 22478 gene locus_tag LOCUS_18780 gene kduI 21648 22478 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383224.1 protein_id gnl|my_center|LOCUS_18780 22600 23067 gene locus_tag LOCUS_18790 22600 23067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 23351 24310 gene locus_tag LOCUS_18800 23351 24310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 24307 25185 gene locus_tag LOCUS_18810 24307 25185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 25274 26566 gene locus_tag LOCUS_18820 25274 26566 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767112.1 protein_id gnl|my_center|LOCUS_18820 27339 26593 gene locus_tag LOCUS_18830 27339 26593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 28566 27409 gene locus_tag LOCUS_18840 gene hypE 28566 27409 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_18840 29702 28563 gene locus_tag LOCUS_18850 gene hypD 29702 28563 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_18850 30006 29686 gene locus_tag LOCUS_18860 30006 29686 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_18860 32382 30022 gene locus_tag LOCUS_18870 gene hypF 32382 30022 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_18870 32551 32922 gene locus_tag LOCUS_18880 32551 32922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 34503 32992 gene locus_tag LOCUS_18890 34503 32992 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332236.1 protein_id gnl|my_center|LOCUS_18890 34895 34701 gene locus_tag LOCUS_18900 34895 34701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18900 36298 35114 gene locus_tag LOCUS_18910 36298 35114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 38245 36785 gene locus_tag LOCUS_18920 38245 36785 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092177.1 protein_id gnl|my_center|LOCUS_18920 39983 38451 gene locus_tag LOCUS_18930 39983 38451 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 protein_id gnl|my_center|LOCUS_18930 41809 40196 gene locus_tag LOCUS_18940 41809 40196 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_18940 45377 41973 gene locus_tag LOCUS_18950 45377 41973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 46990 45848 gene locus_tag LOCUS_18960 46990 45848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 47346 50717 gene locus_tag LOCUS_18970 47346 50717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 50829 52367 gene locus_tag LOCUS_18980 gene betC 50829 52367 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807791.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence025 1001 144 gene locus_tag LOCUS_18990 1001 144 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_18990 1938 1273 gene locus_tag LOCUS_19000 1938 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 4366 2069 gene locus_tag LOCUS_19010 4366 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 5436 4501 gene locus_tag LOCUS_19020 5436 4501 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_19020 7183 5609 gene locus_tag LOCUS_19030 7183 5609 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_19030 9801 7462 gene locus_tag LOCUS_19040 9801 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 10745 10506 gene locus_tag LOCUS_19050 10745 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 11752 11240 gene locus_tag LOCUS_19060 11752 11240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19060 13053 11749 gene locus_tag LOCUS_19070 13053 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225642.1 protein_id gnl|my_center|LOCUS_19070 13703 13050 gene locus_tag LOCUS_19080 13703 13050 CDS product DUF6084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225643.1 protein_id gnl|my_center|LOCUS_19080 14361 13696 gene locus_tag LOCUS_19090 14361 13696 CDS product DUF5947 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467021.1 protein_id gnl|my_center|LOCUS_19090 15166 14612 gene locus_tag LOCUS_19100 15166 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 16968 15166 gene locus_tag LOCUS_19110 16968 15166 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894103.1 protein_id gnl|my_center|LOCUS_19110 18045 16984 gene locus_tag LOCUS_19120 18045 16984 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225647.1 protein_id gnl|my_center|LOCUS_19120 19032 19517 gene locus_tag LOCUS_19130 gene def 19032 19517 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530150.1 protein_id gnl|my_center|LOCUS_19130 19946 19626 gene locus_tag LOCUS_19140 19946 19626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 20301 20023 gene locus_tag LOCUS_19150 20301 20023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 22211 20640 gene locus_tag LOCUS_19160 22211 20640 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_19160 22662 22231 gene locus_tag LOCUS_19170 22662 22231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 22763 22942 gene locus_tag LOCUS_19180 22763 22942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 23044 23352 gene locus_tag LOCUS_19190 23044 23352 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978053.1 protein_id gnl|my_center|LOCUS_19190 24993 23926 gene locus_tag LOCUS_19200 24993 23926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 25046 25210 gene locus_tag LOCUS_19210 25046 25210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 25207 26625 gene locus_tag LOCUS_19220 25207 26625 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_19220 26622 27374 gene locus_tag LOCUS_19230 26622 27374 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_19230 28136 27447 gene locus_tag LOCUS_19240 28136 27447 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_19240 29108 28212 gene locus_tag LOCUS_19250 29108 28212 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_19250 29884 29105 gene locus_tag LOCUS_19260 29884 29105 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958120.1 protein_id gnl|my_center|LOCUS_19260 30941 29907 gene locus_tag LOCUS_19270 30941 29907 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921854.1 protein_id gnl|my_center|LOCUS_19270 31350 31129 gene locus_tag LOCUS_19280 31350 31129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 31820 31731 gene locus_tag LOCUS_t00130 31820 31731 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 33631 32102 gene locus_tag LOCUS_19290 33631 32102 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_19290 35172 33628 gene locus_tag LOCUS_19300 35172 33628 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_19300 37163 35187 gene locus_tag LOCUS_19310 gene nuoL 37163 35187 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_19310 37491 37186 gene locus_tag LOCUS_19320 gene nuoK 37491 37186 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_19320 37987 37493 gene locus_tag LOCUS_19330 37987 37493 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_19330 39067 38021 gene locus_tag LOCUS_19340 gene nuoH 39067 38021 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104353.1 protein_id gnl|my_center|LOCUS_19340 41504 39156 gene locus_tag LOCUS_19350 gene nuoG 41504 39156 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396812.1 protein_id gnl|my_center|LOCUS_19350 42867 41536 gene locus_tag LOCUS_19360 gene nuoF 42867 41536 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969255.1 protein_id gnl|my_center|LOCUS_19360 43396 42872 gene locus_tag LOCUS_19370 43396 42872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 43770 43393 gene locus_tag LOCUS_19380 43770 43393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 44975 43767 gene locus_tag LOCUS_19390 gene nuoD 44975 43767 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_19390 45475 44975 gene locus_tag LOCUS_19400 45475 44975 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941008.1 protein_id gnl|my_center|LOCUS_19400 45910 45488 gene locus_tag LOCUS_19410 45910 45488 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_19410 46175 46774 gene locus_tag LOCUS_19420 46175 46774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 46809 47021 gene locus_tag LOCUS_19430 gene thiS 46809 47021 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_19430 47184 47873 gene locus_tag LOCUS_19440 47184 47873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 48012 48173 gene locus_tag LOCUS_19450 48012 48173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 48786 48199 gene locus_tag LOCUS_19460 48786 48199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 49879 49169 gene locus_tag LOCUS_19470 gene pdxT 49879 49169 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081494.1 protein_id gnl|my_center|LOCUS_19470 50887 49934 gene locus_tag LOCUS_19480 gene pdxS 50887 49934 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583836.1 protein_id gnl|my_center|LOCUS_19480 51465 50935 gene locus_tag LOCUS_19490 51465 50935 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_19490 52134 51481 gene locus_tag LOCUS_19500 52134 51481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 52874 52134 gene locus_tag LOCUS_19510 52874 52134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence026 118 786 gene locus_tag LOCUS_19520 gene eda 118 786 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_19520 872 1984 gene locus_tag LOCUS_19530 872 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2062 2832 gene locus_tag LOCUS_19540 2062 2832 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_19540 2917 3195 gene locus_tag LOCUS_19550 2917 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 3292 4284 gene locus_tag LOCUS_19560 3292 4284 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816053.1 protein_id gnl|my_center|LOCUS_19560 4294 6018 gene locus_tag LOCUS_19570 4294 6018 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_19570 6105 7178 gene locus_tag LOCUS_19580 gene moaA 6105 7178 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 protein_id gnl|my_center|LOCUS_19580 7289 8401 gene locus_tag LOCUS_19590 7289 8401 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942515.1 protein_id gnl|my_center|LOCUS_19590 9800 8418 gene locus_tag LOCUS_19600 9800 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 10281 9916 gene locus_tag LOCUS_19610 10281 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 11180 10278 gene locus_tag LOCUS_19620 11180 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 12352 11177 gene locus_tag LOCUS_19630 12352 11177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 12963 12352 gene locus_tag LOCUS_19640 12963 12352 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_19640 13052 13270 gene locus_tag LOCUS_19650 13052 13270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 14460 13216 gene locus_tag LOCUS_19660 gene glgC 14460 13216 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_19660 14979 14683 gene locus_tag LOCUS_19670 14979 14683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 15599 17242 gene locus_tag LOCUS_19680 15599 17242 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_19680 17363 17956 gene locus_tag LOCUS_19690 17363 17956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 18185 18883 gene locus_tag LOCUS_19700 18185 18883 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811810.1 protein_id gnl|my_center|LOCUS_19700 19119 19346 gene locus_tag LOCUS_19710 19119 19346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 19443 20615 gene locus_tag LOCUS_19720 19443 20615 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_19720 21294 20659 gene locus_tag LOCUS_19730 21294 20659 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230784.1 protein_id gnl|my_center|LOCUS_19730 22178 21423 gene locus_tag LOCUS_19740 gene tpiA 22178 21423 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_19740 23395 22175 gene locus_tag LOCUS_19750 23395 22175 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_19750 23788 23417 gene locus_tag LOCUS_19760 23788 23417 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_19760 24890 23886 gene locus_tag LOCUS_19770 gene gap 24890 23886 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161236.1 protein_id gnl|my_center|LOCUS_19770 25122 26066 gene locus_tag LOCUS_19780 25122 26066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 26205 26738 gene locus_tag LOCUS_19790 26205 26738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 27247 26735 gene locus_tag LOCUS_19800 27247 26735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 27465 28823 gene locus_tag LOCUS_19810 27465 28823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 29932 28790 gene locus_tag LOCUS_19820 gene bshA 29932 28790 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_19820 30963 29998 gene locus_tag LOCUS_19830 30963 29998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 31910 31011 gene locus_tag LOCUS_19840 31910 31011 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416945.1 protein_id gnl|my_center|LOCUS_19840 32032 32108 gene locus_tag LOCUS_t00140 32032 32108 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 33265 32123 gene locus_tag LOCUS_19850 33265 32123 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463959.1 protein_id gnl|my_center|LOCUS_19850 33549 33274 gene locus_tag LOCUS_19860 33549 33274 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 protein_id gnl|my_center|LOCUS_19860 33744 33562 gene locus_tag LOCUS_19870 33744 33562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 34256 33891 gene locus_tag LOCUS_19880 34256 33891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 35034 34258 gene locus_tag LOCUS_19890 35034 34258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 35120 35308 gene locus_tag LOCUS_19900 35120 35308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 35305 35877 gene locus_tag LOCUS_19910 35305 35877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 35890 37632 gene locus_tag LOCUS_19920 35890 37632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 37632 38090 gene locus_tag LOCUS_19930 37632 38090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 38131 38331 gene locus_tag LOCUS_19940 38131 38331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 38328 38507 gene locus_tag LOCUS_19950 38328 38507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 38554 39330 gene locus_tag LOCUS_19960 38554 39330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 39341 39601 gene locus_tag LOCUS_19970 39341 39601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 39693 40055 gene locus_tag LOCUS_19980 39693 40055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 40646 40095 gene locus_tag LOCUS_19990 40646 40095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 41620 40643 gene locus_tag LOCUS_20000 41620 40643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 42352 42819 gene locus_tag LOCUS_20010 42352 42819 CDS product DUF2321 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965246.1 protein_id gnl|my_center|LOCUS_20010 43507 43304 gene locus_tag LOCUS_20020 43507 43304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 46471 44084 gene locus_tag LOCUS_20030 46471 44084 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965877.1 protein_id gnl|my_center|LOCUS_20030 48135 46660 gene locus_tag LOCUS_20040 48135 46660 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_20040 52018 48416 gene locus_tag LOCUS_20050 52018 48416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence027 322 1896 gene locus_tag LOCUS_20060 322 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2032 2967 gene locus_tag LOCUS_20070 2032 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 3058 4002 gene locus_tag LOCUS_20080 3058 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 4888 4043 gene locus_tag LOCUS_20090 4888 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 6522 5062 gene locus_tag LOCUS_20100 6522 5062 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_20100 7831 6623 gene locus_tag LOCUS_20110 7831 6623 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_20110 9258 7843 gene locus_tag LOCUS_20120 9258 7843 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_20120 10451 9255 gene locus_tag LOCUS_20130 10451 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 10549 10878 gene locus_tag LOCUS_20140 10549 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 11355 10888 gene locus_tag LOCUS_20150 11355 10888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 12800 11391 gene locus_tag LOCUS_20160 12800 11391 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_20160 13703 14728 gene locus_tag LOCUS_20170 13703 14728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 14725 15438 gene locus_tag LOCUS_20180 14725 15438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 15480 16832 gene locus_tag LOCUS_20190 15480 16832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 16832 18316 gene locus_tag LOCUS_20200 16832 18316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 18374 19231 gene locus_tag LOCUS_20210 18374 19231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 19233 20618 gene locus_tag LOCUS_20220 19233 20618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 20678 21838 gene locus_tag LOCUS_20230 20678 21838 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942620.1 protein_id gnl|my_center|LOCUS_20230 21825 22883 gene locus_tag LOCUS_20240 21825 22883 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337572.1 protein_id gnl|my_center|LOCUS_20240 23927 22905 gene locus_tag LOCUS_20250 23927 22905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 24780 25454 gene locus_tag LOCUS_20260 24780 25454 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787337.1 protein_id gnl|my_center|LOCUS_20260 25466 26650 gene locus_tag LOCUS_20270 25466 26650 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942601.1 protein_id gnl|my_center|LOCUS_20270 26681 28123 gene locus_tag LOCUS_20280 26681 28123 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427766.1 protein_id gnl|my_center|LOCUS_20280 28487 30565 gene locus_tag LOCUS_20290 28487 30565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 30562 38712 gene locus_tag LOCUS_20300 30562 38712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 38847 42914 gene locus_tag LOCUS_20310 38847 42914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 42914 44335 gene locus_tag LOCUS_20320 42914 44335 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_20320 45098 44346 gene locus_tag LOCUS_20330 45098 44346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 45229 46170 gene locus_tag LOCUS_20340 45229 46170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 46392 47633 gene locus_tag LOCUS_20350 46392 47633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 48912 47716 gene locus_tag LOCUS_20360 48912 47716 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_20360 50075 48903 gene locus_tag LOCUS_20370 50075 48903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 50361 51593 gene locus_tag LOCUS_20380 50361 51593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 51742 52047 gene locus_tag LOCUS_20390 51742 52047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence028 1139 843 gene locus_tag LOCUS_20400 1139 843 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249168.1 protein_id gnl|my_center|LOCUS_20400 1639 1136 gene locus_tag LOCUS_20410 1639 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2171 3112 gene locus_tag LOCUS_20420 2171 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 3131 4780 gene locus_tag LOCUS_20430 3131 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 5031 4789 gene locus_tag LOCUS_20440 5031 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 6590 4941 gene locus_tag LOCUS_20450 6590 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 7637 6618 gene locus_tag LOCUS_20460 7637 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 8122 7712 gene locus_tag LOCUS_20470 gene merR 8122 7712 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166628.1 protein_id gnl|my_center|LOCUS_20470 8185 8535 gene locus_tag LOCUS_20480 8185 8535 CDS product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294663.1 protein_id gnl|my_center|LOCUS_20480 8552 8923 gene locus_tag LOCUS_20490 8552 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 8967 9254 gene locus_tag LOCUS_20500 gene merP 8967 9254 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732292.1 protein_id gnl|my_center|LOCUS_20500 9251 10726 gene locus_tag LOCUS_20510 gene merA 9251 10726 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20510 10856 13492 gene locus_tag LOCUS_20520 10856 13492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 13489 14796 gene locus_tag LOCUS_20530 13489 14796 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258390.1 protein_id gnl|my_center|LOCUS_20530 15454 14888 gene locus_tag LOCUS_20540 15454 14888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 15722 16018 gene locus_tag LOCUS_20550 15722 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 16197 17453 gene locus_tag LOCUS_20560 16197 17453 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143607.1 protein_id gnl|my_center|LOCUS_20560 17454 18692 gene locus_tag LOCUS_20570 17454 18692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 18695 21793 gene locus_tag LOCUS_20580 18695 21793 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142029.1 protein_id gnl|my_center|LOCUS_20580 22587 21889 gene locus_tag LOCUS_20590 22587 21889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 23147 22578 gene locus_tag LOCUS_20600 23147 22578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 23313 23819 gene locus_tag LOCUS_20610 23313 23819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 24130 24750 gene locus_tag LOCUS_20620 24130 24750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 26435 24885 gene locus_tag LOCUS_20630 26435 24885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20630 26652 26470 gene locus_tag LOCUS_20640 26652 26470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 27756 28415 gene locus_tag LOCUS_20650 27756 28415 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391060.1 protein_id gnl|my_center|LOCUS_20650 28653 28462 gene locus_tag LOCUS_20660 28653 28462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 28739 28939 gene locus_tag LOCUS_20670 28739 28939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 28959 29495 gene locus_tag LOCUS_20680 28959 29495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 29492 30031 gene locus_tag LOCUS_20690 29492 30031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 30191 30496 gene locus_tag LOCUS_20700 30191 30496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 31996 30848 gene locus_tag LOCUS_20710 31996 30848 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_20710 32268 32047 gene locus_tag LOCUS_20720 32268 32047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 36500 32712 gene locus_tag LOCUS_20730 36500 32712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871158.1 protein_id gnl|my_center|LOCUS_20730 39501 36652 gene locus_tag LOCUS_20740 gene mobF 39501 36652 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_20740 40515 39769 gene locus_tag LOCUS_20750 40515 39769 CDS product TIGR02391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189846505.1 protein_id gnl|my_center|LOCUS_20750 41481 40567 gene locus_tag LOCUS_20760 41481 40567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 42588 41641 gene locus_tag LOCUS_20770 42588 41641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 44128 42638 gene locus_tag LOCUS_20780 44128 42638 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_20780 45063 44245 gene locus_tag LOCUS_20790 45063 44245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 45785 45060 gene locus_tag LOCUS_20800 45785 45060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 46192 45782 gene locus_tag LOCUS_20810 46192 45782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence029 907 125 gene locus_tag LOCUS_20820 907 125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405168.1 protein_id gnl|my_center|LOCUS_20820 1601 900 gene locus_tag LOCUS_20830 1601 900 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405169.1 protein_id gnl|my_center|LOCUS_20830 1927 2610 gene locus_tag LOCUS_20840 1927 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3060 3689 gene locus_tag LOCUS_20850 3060 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3818 4345 gene locus_tag LOCUS_20860 3818 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 4520 5323 gene locus_tag LOCUS_20870 4520 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 5429 6016 gene locus_tag LOCUS_20880 5429 6016 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_20880 6441 6091 gene locus_tag LOCUS_20890 6441 6091 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_20890 6896 6456 gene locus_tag LOCUS_20900 6896 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20900 7459 8760 gene locus_tag LOCUS_20910 7459 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 8778 9884 gene locus_tag LOCUS_20920 8778 9884 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113398.1 protein_id gnl|my_center|LOCUS_20920 9881 11521 gene locus_tag LOCUS_20930 9881 11521 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919511.1 protein_id gnl|my_center|LOCUS_20930 11514 12503 gene locus_tag LOCUS_20940 11514 12503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 12561 13802 gene locus_tag LOCUS_20950 12561 13802 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_20950 14242 13799 gene locus_tag LOCUS_20960 gene mutT 14242 13799 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459573.1 protein_id gnl|my_center|LOCUS_20960 15114 14263 gene locus_tag LOCUS_20970 15114 14263 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902189.1 protein_id gnl|my_center|LOCUS_20970 15650 15114 gene locus_tag LOCUS_20980 15650 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 15534 15824 gene locus_tag LOCUS_20990 15534 15824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 16071 17036 gene locus_tag LOCUS_21000 gene xerD 16071 17036 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806652.1 protein_id gnl|my_center|LOCUS_21000 17033 18013 gene locus_tag LOCUS_21010 gene xerC 17033 18013 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 protein_id gnl|my_center|LOCUS_21010 18186 21227 gene locus_tag LOCUS_21020 gene secA 18186 21227 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_21020 21338 22153 gene locus_tag LOCUS_21030 21338 22153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 22889 22206 gene locus_tag LOCUS_21040 22889 22206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 23632 22952 gene locus_tag LOCUS_21050 23632 22952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 24152 25798 gene locus_tag LOCUS_21060 24152 25798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 26099 26680 gene locus_tag LOCUS_21070 26099 26680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 26655 26879 gene locus_tag LOCUS_21080 26655 26879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 27854 26931 gene locus_tag LOCUS_21090 27854 26931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 28807 28232 gene locus_tag LOCUS_21100 28807 28232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 29986 29216 gene locus_tag LOCUS_21110 29986 29216 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880556.1 protein_id gnl|my_center|LOCUS_21110 30064 30444 gene locus_tag LOCUS_21120 30064 30444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 30525 31694 gene locus_tag LOCUS_21130 gene dusB 30525 31694 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_21130 33283 31706 gene locus_tag LOCUS_21140 33283 31706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 33807 33277 gene locus_tag LOCUS_21150 gene bstA 33807 33277 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999070.1 protein_id gnl|my_center|LOCUS_21150 33986 35428 gene locus_tag LOCUS_21160 gene tldD 33986 35428 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268865.1 protein_id gnl|my_center|LOCUS_21160 35459 36835 gene locus_tag LOCUS_21170 35459 36835 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174621.1 protein_id gnl|my_center|LOCUS_21170 37924 36875 gene locus_tag LOCUS_21180 gene egtD 37924 36875 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027441.1 protein_id gnl|my_center|LOCUS_21180 39222 37921 gene locus_tag LOCUS_21190 gene egtB 39222 37921 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_21190 39961 39242 gene locus_tag LOCUS_21200 39961 39242 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_21200 41990 40299 gene locus_tag LOCUS_21210 gene murJ 41990 40299 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_21210 42169 44154 gene locus_tag LOCUS_21220 42169 44154 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_21220 45213 44215 gene locus_tag LOCUS_21230 45213 44215 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810847.1 protein_id gnl|my_center|LOCUS_21230 45980 45432 gene locus_tag LOCUS_21240 gene thpR 45980 45432 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404315.1 protein_id gnl|my_center|LOCUS_21240 46506 46024 gene locus_tag LOCUS_21250 46506 46024 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243551.1 protein_id gnl|my_center|LOCUS_21250 46551 46928 gene locus_tag LOCUS_21260 46551 46928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence030 167 412 gene locus_tag LOCUS_21270 167 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 467 2740 gene locus_tag LOCUS_21280 467 2740 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_21280 3644 2742 gene locus_tag LOCUS_21290 3644 2742 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838714.1 protein_id gnl|my_center|LOCUS_21290 5196 3880 gene locus_tag LOCUS_21300 5196 3880 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_21300 5678 5821 gene locus_tag LOCUS_21310 5678 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 6064 6939 gene locus_tag LOCUS_21320 6064 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 6923 7696 gene locus_tag LOCUS_21330 6923 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 9280 8015 gene locus_tag LOCUS_21340 gene sat 9280 8015 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_21340 9490 10389 gene locus_tag LOCUS_21350 9490 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 10854 11300 gene locus_tag LOCUS_21360 gene aprB 10854 11300 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938146.1 protein_id gnl|my_center|LOCUS_21360 11314 13242 gene locus_tag LOCUS_21370 gene aprA 11314 13242 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_21370 13310 13597 gene locus_tag LOCUS_21380 13310 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926944.1 protein_id gnl|my_center|LOCUS_21380 13590 14414 gene locus_tag LOCUS_21390 13590 14414 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_21390 14421 15695 gene locus_tag LOCUS_21400 14421 15695 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_21400 15688 17943 gene locus_tag LOCUS_21410 15688 17943 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_21410 17946 19124 gene locus_tag LOCUS_21420 gene qmoC 17946 19124 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545389.1 protein_id gnl|my_center|LOCUS_21420 19501 20685 gene locus_tag LOCUS_21430 gene dsrA 19501 20685 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877930.1 protein_id gnl|my_center|LOCUS_21430 20740 21822 gene locus_tag LOCUS_21440 gene dsrB 20740 21822 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810503.1 protein_id gnl|my_center|LOCUS_21440 21832 22080 gene locus_tag LOCUS_21450 21832 22080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 22134 22586 gene locus_tag LOCUS_21460 22134 22586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 22601 24259 gene locus_tag LOCUS_21470 22601 24259 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933900.1 protein_id gnl|my_center|LOCUS_21470 24281 24598 gene locus_tag LOCUS_21480 24281 24598 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_21480 24665 25153 gene locus_tag LOCUS_21490 24665 25153 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393113.1 protein_id gnl|my_center|LOCUS_21490 25150 26151 gene locus_tag LOCUS_21500 gene dsrM 25150 26151 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_21500 26154 27782 gene locus_tag LOCUS_21510 26154 27782 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_21510 27806 28201 gene locus_tag LOCUS_21520 gene dsrJ 27806 28201 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938584.1 protein_id gnl|my_center|LOCUS_21520 28198 28962 gene locus_tag LOCUS_21530 28198 28962 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393110.1 protein_id gnl|my_center|LOCUS_21530 28973 30211 gene locus_tag LOCUS_21540 gene nrfD 28973 30211 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272193.1 protein_id gnl|my_center|LOCUS_21540 30345 31292 gene locus_tag LOCUS_21550 30345 31292 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878052.1 protein_id gnl|my_center|LOCUS_21550 31289 32977 gene locus_tag LOCUS_21560 31289 32977 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761935.1 protein_id gnl|my_center|LOCUS_21560 33064 33897 gene locus_tag LOCUS_21570 33064 33897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 34091 34876 gene locus_tag LOCUS_21580 34091 34876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 34959 36371 gene locus_tag LOCUS_21590 gene cobB 34959 36371 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272194.1 protein_id gnl|my_center|LOCUS_21590 36747 38402 gene locus_tag LOCUS_21600 gene cdr 36747 38402 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087584.1 protein_id gnl|my_center|LOCUS_21600 38590 38369 gene locus_tag LOCUS_21610 38590 38369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 39267 38761 gene locus_tag LOCUS_21620 39267 38761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21620 39560 39264 gene locus_tag LOCUS_21630 39560 39264 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139205698.1 protein_id gnl|my_center|LOCUS_21630 40813 39755 gene locus_tag LOCUS_21640 40813 39755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 41186 40755 gene locus_tag LOCUS_21650 41186 40755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 41914 41489 gene locus_tag LOCUS_21660 41914 41489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 42141 42227 gene locus_tag LOCUS_t00150 42141 42227 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43455 42673 gene locus_tag LOCUS_21670 43455 42673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 44293 43718 gene locus_tag LOCUS_21680 44293 43718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 45599 45039 gene locus_tag LOCUS_21690 45599 45039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 45952 45596 gene locus_tag LOCUS_21700 45952 45596 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224021.1 protein_id gnl|my_center|LOCUS_21700 46064 46363 gene locus_tag LOCUS_21710 46064 46363 CDS product multiubiquitin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224020.1 protein_id gnl|my_center|LOCUS_21710 46376 46630 gene locus_tag LOCUS_21720 46376 46630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence031 2464 263 gene locus_tag LOCUS_21730 2464 263 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_21730 2982 3251 gene locus_tag LOCUS_21740 2982 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 3239 3391 gene locus_tag LOCUS_21750 3239 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 3417 3776 gene locus_tag LOCUS_21760 3417 3776 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023831.1 protein_id gnl|my_center|LOCUS_21760 3875 4639 gene locus_tag LOCUS_21770 gene kduD 3875 4639 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035409.1 protein_id gnl|my_center|LOCUS_21770 4761 6401 gene locus_tag LOCUS_21780 4761 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 6709 7785 gene locus_tag LOCUS_21790 6709 7785 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529657.1 protein_id gnl|my_center|LOCUS_21790 7785 8645 gene locus_tag LOCUS_21800 7785 8645 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529656.1 protein_id gnl|my_center|LOCUS_21800 8630 9442 gene locus_tag LOCUS_21810 8630 9442 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970485.1 protein_id gnl|my_center|LOCUS_21810 9444 10151 gene locus_tag LOCUS_21820 9444 10151 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532941.1 protein_id gnl|my_center|LOCUS_21820 10172 11143 gene locus_tag LOCUS_21830 10172 11143 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_21830 11797 11627 gene locus_tag LOCUS_21840 11797 11627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 11745 13544 gene locus_tag LOCUS_21850 11745 13544 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119127.1 protein_id gnl|my_center|LOCUS_21850 13672 15501 gene locus_tag LOCUS_21860 13672 15501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 16305 15598 gene locus_tag LOCUS_21870 16305 15598 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085895.1 protein_id gnl|my_center|LOCUS_21870 17923 16292 gene locus_tag LOCUS_21880 17923 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 19025 17961 gene locus_tag LOCUS_21890 19025 17961 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_21890 19367 19152 gene locus_tag LOCUS_21900 19367 19152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 19806 19600 gene locus_tag LOCUS_21910 19806 19600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 20666 20256 gene locus_tag LOCUS_21920 20666 20256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 20743 20964 gene locus_tag LOCUS_21930 20743 20964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 21034 21252 gene locus_tag LOCUS_21940 21034 21252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 21394 21579 gene locus_tag LOCUS_21950 21394 21579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 23239 21827 gene locus_tag LOCUS_21960 23239 21827 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337067.1 protein_id gnl|my_center|LOCUS_21960 24234 23389 gene locus_tag LOCUS_21970 gene cpaB 24234 23389 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939395.1 protein_id gnl|my_center|LOCUS_21970 24671 26038 gene locus_tag LOCUS_21980 24671 26038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 26676 26257 gene locus_tag LOCUS_21990 26676 26257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 27290 26847 gene locus_tag LOCUS_22000 27290 26847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 28664 27384 gene locus_tag LOCUS_22010 28664 27384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 29227 28787 gene locus_tag LOCUS_22020 29227 28787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 29736 29224 gene locus_tag LOCUS_22030 29736 29224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 30982 30071 gene locus_tag LOCUS_22040 30982 30071 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792065.1 protein_id gnl|my_center|LOCUS_22040 31964 30993 gene locus_tag LOCUS_22050 31964 30993 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939400.1 protein_id gnl|my_center|LOCUS_22050 33268 31988 gene locus_tag LOCUS_22060 33268 31988 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932125.1 protein_id gnl|my_center|LOCUS_22060 34516 33305 gene locus_tag LOCUS_22070 34516 33305 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_22070 35124 34609 gene locus_tag LOCUS_22080 35124 34609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 35697 37091 gene locus_tag LOCUS_22090 35697 37091 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_22090 37088 38632 gene locus_tag LOCUS_22100 37088 38632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089877.1 protein_id gnl|my_center|LOCUS_22100 39172 38783 gene locus_tag LOCUS_22110 39172 38783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 40332 39205 gene locus_tag LOCUS_22120 40332 39205 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975759.1 protein_id gnl|my_center|LOCUS_22120 43152 40333 gene locus_tag LOCUS_22130 43152 40333 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054625.1 protein_id gnl|my_center|LOCUS_22130 43392 44837 gene locus_tag LOCUS_22140 43392 44837 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_22140 44846 45589 gene locus_tag LOCUS_22150 44846 45589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence032 1779 520 gene locus_tag LOCUS_22160 1779 520 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928727.1 protein_id gnl|my_center|LOCUS_22160 2067 2411 gene locus_tag LOCUS_22170 2067 2411 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_22170 2484 2618 gene locus_tag LOCUS_22180 2484 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2612 2959 gene locus_tag LOCUS_22190 2612 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22190 5825 3162 gene locus_tag LOCUS_22200 5825 3162 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141271.1 protein_id gnl|my_center|LOCUS_22200 6208 5828 gene locus_tag LOCUS_22210 6208 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 6230 6490 gene locus_tag LOCUS_22220 6230 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 6701 9298 gene locus_tag LOCUS_22230 6701 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 9295 9510 gene locus_tag LOCUS_22240 9295 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 9548 10207 gene locus_tag LOCUS_22250 9548 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 10240 11202 gene locus_tag LOCUS_22260 10240 11202 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978086.1 protein_id gnl|my_center|LOCUS_22260 11213 12007 gene locus_tag LOCUS_22270 11213 12007 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103565.1 protein_id gnl|my_center|LOCUS_22270 13927 12182 gene locus_tag LOCUS_22280 gene araD 13927 12182 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039575.1 protein_id gnl|my_center|LOCUS_22280 15251 13905 gene locus_tag LOCUS_22290 15251 13905 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206175.1 protein_id gnl|my_center|LOCUS_22290 15609 20138 gene locus_tag LOCUS_22300 15609 20138 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_22300 21722 20280 gene locus_tag LOCUS_22310 21722 20280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 22226 21795 gene locus_tag LOCUS_22320 22226 21795 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929155.1 protein_id gnl|my_center|LOCUS_22320 22908 24293 gene locus_tag LOCUS_22330 gene hpnO 22908 24293 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_22330 24337 25479 gene locus_tag LOCUS_22340 24337 25479 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_22340 25490 26110 gene locus_tag LOCUS_22350 25490 26110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 26197 27582 gene locus_tag LOCUS_22360 26197 27582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 29085 27733 gene locus_tag LOCUS_22370 gene gudD 29085 27733 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 protein_id gnl|my_center|LOCUS_22370 29515 30501 gene locus_tag LOCUS_22380 29515 30501 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397899.1 protein_id gnl|my_center|LOCUS_22380 30620 31963 gene locus_tag LOCUS_22390 30620 31963 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038346.1 protein_id gnl|my_center|LOCUS_22390 32076 32858 gene locus_tag LOCUS_22400 gene hpaI 32076 32858 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_22400 32876 33778 gene locus_tag LOCUS_22410 gene garR 32876 33778 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369560.1 protein_id gnl|my_center|LOCUS_22410 34023 34586 gene locus_tag LOCUS_22420 34023 34586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 35851 34628 gene locus_tag LOCUS_22430 35851 34628 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939431.1 protein_id gnl|my_center|LOCUS_22430 37834 36224 gene locus_tag LOCUS_22440 37834 36224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 38327 37827 gene locus_tag LOCUS_22450 38327 37827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 38943 38398 gene locus_tag LOCUS_22460 38943 38398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 39947 39048 gene locus_tag LOCUS_22470 39947 39048 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035329735.1 protein_id gnl|my_center|LOCUS_22470 40410 43079 gene locus_tag LOCUS_22480 40410 43079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 43097 44383 gene locus_tag LOCUS_22490 43097 44383 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_22490 45091 45720 gene locus_tag LOCUS_22500 45091 45720 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922186.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence033 440 2890 gene locus_tag LOCUS_22510 440 2890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_22510 2905 5334 gene locus_tag LOCUS_22520 2905 5334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_22520 5345 7828 gene locus_tag LOCUS_22530 5345 7828 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_22530 7840 10308 gene locus_tag LOCUS_22540 7840 10308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_22540 10345 11100 gene locus_tag LOCUS_22550 10345 11100 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_22550 11100 13013 gene locus_tag LOCUS_22560 11100 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 13020 14456 gene locus_tag LOCUS_22570 13020 14456 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107494.1 protein_id gnl|my_center|LOCUS_22570 14446 15921 gene locus_tag LOCUS_22580 14446 15921 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107493.1 protein_id gnl|my_center|LOCUS_22580 16351 16019 gene locus_tag LOCUS_22590 16351 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 17964 16501 gene locus_tag LOCUS_22600 17964 16501 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899732.1 protein_id gnl|my_center|LOCUS_22600 22540 17957 gene locus_tag LOCUS_22610 gene gltB 22540 17957 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_22610 25561 22916 gene locus_tag LOCUS_22620 25561 22916 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_22620 25911 25561 gene locus_tag LOCUS_22630 25911 25561 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_22630 26834 26034 gene locus_tag LOCUS_22640 26834 26034 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731334.1 protein_id gnl|my_center|LOCUS_22640 26929 28245 gene locus_tag LOCUS_22650 26929 28245 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_22650 28426 28259 gene locus_tag LOCUS_22660 28426 28259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 28490 28711 gene locus_tag LOCUS_22670 28490 28711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 28724 30958 gene locus_tag LOCUS_22680 28724 30958 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764525.1 protein_id gnl|my_center|LOCUS_22680 31387 32031 gene locus_tag LOCUS_22690 31387 32031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 34254 32302 gene locus_tag LOCUS_22700 34254 32302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 34717 38082 gene locus_tag LOCUS_22710 34717 38082 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_22710 38147 39307 gene locus_tag LOCUS_22720 38147 39307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 39548 40786 gene locus_tag LOCUS_22730 39548 40786 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020966.1 protein_id gnl|my_center|LOCUS_22730 40779 41771 gene locus_tag LOCUS_22740 40779 41771 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_22740 41790 42002 gene locus_tag LOCUS_22750 41790 42002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 42359 46024 gene locus_tag LOCUS_22760 42359 46024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence034 133 360 gene locus_tag LOCUS_22770 133 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 605 435 gene locus_tag LOCUS_22780 605 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 589 822 gene locus_tag LOCUS_22790 589 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 864 1550 gene locus_tag LOCUS_22800 864 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2720 2259 gene locus_tag LOCUS_22810 2720 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 3789 3571 gene locus_tag LOCUS_22820 3789 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 4659 5744 gene locus_tag LOCUS_22830 4659 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 6362 6907 gene locus_tag LOCUS_22840 6362 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 7392 6952 gene locus_tag LOCUS_22850 7392 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 9245 7896 gene locus_tag LOCUS_22860 9245 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 9586 9894 gene locus_tag LOCUS_22870 9586 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 9985 11700 gene locus_tag LOCUS_22880 9985 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 11781 13538 gene locus_tag LOCUS_22890 11781 13538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 13694 14908 gene locus_tag LOCUS_22900 13694 14908 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_22900 14989 15771 gene locus_tag LOCUS_22910 14989 15771 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880557.1 protein_id gnl|my_center|LOCUS_22910 15774 16445 gene locus_tag LOCUS_22920 15774 16445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 17191 16481 gene locus_tag LOCUS_22930 17191 16481 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_22930 18657 17188 gene locus_tag LOCUS_22940 gene mpl 18657 17188 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_22940 19601 18660 gene locus_tag LOCUS_22950 19601 18660 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640062.1 protein_id gnl|my_center|LOCUS_22950 20434 19631 gene locus_tag LOCUS_22960 gene dapF 20434 19631 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 protein_id gnl|my_center|LOCUS_22960 21069 20431 gene locus_tag LOCUS_22970 gene purN 21069 20431 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_22970 22077 21076 gene locus_tag LOCUS_22980 gene purM 22077 21076 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_22980 22531 23757 gene locus_tag LOCUS_22990 gene hemL 22531 23757 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_22990 24050 23754 gene locus_tag LOCUS_23000 24050 23754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 25086 24271 gene locus_tag LOCUS_23010 25086 24271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 26921 25605 gene locus_tag LOCUS_23020 gene dinB 26921 25605 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392743.1 protein_id gnl|my_center|LOCUS_23020 27160 27330 gene locus_tag LOCUS_23030 27160 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 28313 27543 gene locus_tag LOCUS_23040 28313 27543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 28511 30067 gene locus_tag LOCUS_23050 28511 30067 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528841.1 protein_id gnl|my_center|LOCUS_23050 31009 30101 gene locus_tag LOCUS_23060 31009 30101 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_23060 33278 31023 gene locus_tag LOCUS_23070 33278 31023 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_23070 33460 34275 gene locus_tag LOCUS_23080 33460 34275 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_23080 34288 34815 gene locus_tag LOCUS_23090 34288 34815 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197262.1 protein_id gnl|my_center|LOCUS_23090 35662 34847 gene locus_tag LOCUS_23100 35662 34847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 36055 36795 gene locus_tag LOCUS_23110 36055 36795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 37168 38250 gene locus_tag LOCUS_23120 37168 38250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 38285 39082 gene locus_tag LOCUS_23130 38285 39082 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929384.1 protein_id gnl|my_center|LOCUS_23130 39166 39525 gene locus_tag LOCUS_23140 39166 39525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 39896 40909 gene locus_tag LOCUS_23150 39896 40909 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141596.1 protein_id gnl|my_center|LOCUS_23150 41270 41836 gene locus_tag LOCUS_23160 41270 41836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 42020 41829 gene locus_tag LOCUS_23170 42020 41829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 42156 42593 gene locus_tag LOCUS_23180 42156 42593 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418942.1 protein_id gnl|my_center|LOCUS_23180 42626 43198 gene locus_tag LOCUS_23190 42626 43198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 43195 43566 gene locus_tag LOCUS_23200 43195 43566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 43586 44419 gene locus_tag LOCUS_23210 43586 44419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 44477 45220 gene locus_tag LOCUS_23220 44477 45220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 45608 45348 gene locus_tag LOCUS_23230 45608 45348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence035 252 461 gene locus_tag LOCUS_23240 252 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 576 734 gene locus_tag LOCUS_23250 576 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2233 1925 gene locus_tag LOCUS_23260 gene atpE 2233 1925 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792634.1 protein_id gnl|my_center|LOCUS_23260 3092 2361 gene locus_tag LOCUS_23270 3092 2361 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_23270 3641 3159 gene locus_tag LOCUS_23280 3641 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 3892 3638 gene locus_tag LOCUS_23290 3892 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 5672 4029 gene locus_tag LOCUS_23300 5672 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 5853 7550 gene locus_tag LOCUS_23310 gene lysS 5853 7550 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_23310 7720 9186 gene locus_tag LOCUS_23320 7720 9186 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_23320 9421 9239 gene locus_tag LOCUS_23330 9421 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 9767 9336 gene locus_tag LOCUS_23340 9767 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 10997 9786 gene locus_tag LOCUS_23350 gene cruC 10997 9786 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_23350 12311 11064 gene locus_tag LOCUS_23360 12311 11064 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_23360 13509 12376 gene locus_tag LOCUS_23370 13509 12376 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973241.1 protein_id gnl|my_center|LOCUS_23370 14008 13592 gene locus_tag LOCUS_23380 14008 13592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 14209 15459 gene locus_tag LOCUS_23390 14209 15459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 15550 16491 gene locus_tag LOCUS_23400 15550 16491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 16611 18089 gene locus_tag LOCUS_23410 16611 18089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 18226 19701 gene locus_tag LOCUS_23420 gene hpnJ 18226 19701 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_23420 19844 20308 gene locus_tag LOCUS_23430 19844 20308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 20305 20694 gene locus_tag LOCUS_23440 20305 20694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 22163 20709 gene locus_tag LOCUS_23450 gene hpnE 22163 20709 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 protein_id gnl|my_center|LOCUS_23450 23127 22180 gene locus_tag LOCUS_23460 23127 22180 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_23460 24044 23124 gene locus_tag LOCUS_23470 gene hpnC 24044 23124 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061007.1 protein_id gnl|my_center|LOCUS_23470 25149 24085 gene locus_tag LOCUS_23480 25149 24085 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140373.1 protein_id gnl|my_center|LOCUS_23480 26337 25231 gene locus_tag LOCUS_23490 26337 25231 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920875.1 protein_id gnl|my_center|LOCUS_23490 27016 26339 gene locus_tag LOCUS_23500 27016 26339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 27870 27013 gene locus_tag LOCUS_23510 27870 27013 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_23510 27799 28110 gene locus_tag LOCUS_23520 27799 28110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 28671 28234 gene locus_tag LOCUS_23530 28671 28234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 29792 28668 gene locus_tag LOCUS_23540 gene hpnH 29792 28668 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_23540 31889 29862 gene locus_tag LOCUS_23550 gene shc 31889 29862 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_23550 33090 31978 gene locus_tag LOCUS_23560 33090 31978 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776295.1 protein_id gnl|my_center|LOCUS_23560 35995 34304 gene locus_tag LOCUS_23570 gene recN 35995 34304 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_23570 36102 36905 gene locus_tag LOCUS_23580 gene tolQ 36102 36905 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_23580 36889 37317 gene locus_tag LOCUS_23590 gene tolR 36889 37317 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546534.1 protein_id gnl|my_center|LOCUS_23590 37324 38127 gene locus_tag LOCUS_23600 37324 38127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 38260 39606 gene locus_tag LOCUS_23610 gene tolB 38260 39606 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_23610 39692 40432 gene locus_tag LOCUS_23620 39692 40432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 40604 41548 gene locus_tag LOCUS_23630 40604 41548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 41602 41814 gene locus_tag LOCUS_23640 41602 41814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 41853 42590 gene locus_tag LOCUS_23650 41853 42590 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345437.1 protein_id gnl|my_center|LOCUS_23650 42820 43494 gene locus_tag LOCUS_23660 42820 43494 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_23660 44391 43612 gene locus_tag LOCUS_23670 44391 43612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 44669 45625 gene locus_tag LOCUS_23680 44669 45625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence036 697 245 gene locus_tag LOCUS_23690 697 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 1009 722 gene locus_tag LOCUS_23700 1009 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 3271 1166 gene locus_tag LOCUS_23710 gene pheT 3271 1166 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037596.1 protein_id gnl|my_center|LOCUS_23710 4422 3268 gene locus_tag LOCUS_23720 gene pheS 4422 3268 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_23720 4666 4454 gene locus_tag LOCUS_23730 4666 4454 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_23730 4983 5486 gene locus_tag LOCUS_23740 4983 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 5911 5543 gene locus_tag LOCUS_23750 gene rplT 5911 5543 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_23750 6277 6080 gene locus_tag LOCUS_23760 gene rpmI 6277 6080 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_23760 8185 6410 gene locus_tag LOCUS_23770 gene glgP 8185 6410 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545636.1 protein_id gnl|my_center|LOCUS_23770 9798 8413 gene locus_tag LOCUS_23780 9798 8413 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403984.1 protein_id gnl|my_center|LOCUS_23780 10033 10233 gene locus_tag LOCUS_23790 10033 10233 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_23790 10780 10388 gene locus_tag LOCUS_23800 10780 10388 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_23800 11045 10851 gene locus_tag LOCUS_23810 11045 10851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 11104 11817 gene locus_tag LOCUS_23820 11104 11817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 14103 11863 gene locus_tag LOCUS_23830 14103 11863 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_23830 14490 15335 gene locus_tag LOCUS_23840 gene thiL 14490 15335 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_23840 16495 15653 gene locus_tag LOCUS_23850 16495 15653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 16695 18242 gene locus_tag LOCUS_23860 gene gltX 16695 18242 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_23860 18273 18959 gene locus_tag LOCUS_23870 18273 18959 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_23870 18999 20123 gene locus_tag LOCUS_23880 18999 20123 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029309.1 protein_id gnl|my_center|LOCUS_23880 20144 20740 gene locus_tag LOCUS_23890 20144 20740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 21530 20820 gene locus_tag LOCUS_23900 21530 20820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 22317 21754 gene locus_tag LOCUS_23910 gene rsmD 22317 21754 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_23910 22523 23632 gene locus_tag LOCUS_23920 22523 23632 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_23920 23639 24562 gene locus_tag LOCUS_23930 gene rsmI 23639 24562 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_23930 25034 24597 gene locus_tag LOCUS_23940 25034 24597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 25271 26239 gene locus_tag LOCUS_23950 25271 26239 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_23950 26248 26730 gene locus_tag LOCUS_23960 26248 26730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 26789 28237 gene locus_tag LOCUS_23970 gene moeB 26789 28237 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_23970 29524 28283 gene locus_tag LOCUS_23980 29524 28283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 30621 29569 gene locus_tag LOCUS_23990 30621 29569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 32471 30729 gene locus_tag LOCUS_24000 32471 30729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 33686 32496 gene locus_tag LOCUS_24010 gene nrfD 33686 32496 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_24010 34462 33728 gene locus_tag LOCUS_24020 34462 33728 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_24020 34896 34459 gene locus_tag LOCUS_24030 34896 34459 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940746.1 protein_id gnl|my_center|LOCUS_24030 35173 36024 gene locus_tag LOCUS_24040 gene thiM 35173 36024 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256281.1 protein_id gnl|my_center|LOCUS_24040 36420 37292 gene locus_tag LOCUS_24050 36420 37292 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_24050 39847 37544 gene locus_tag LOCUS_24060 39847 37544 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583217.1 protein_id gnl|my_center|LOCUS_24060 41528 40005 gene locus_tag LOCUS_24070 gene guaB 41528 40005 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_24070 41938 41741 gene locus_tag LOCUS_24080 41938 41741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 42100 42606 gene locus_tag LOCUS_24090 42100 42606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence037 183 722 gene locus_tag LOCUS_24100 183 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2781 970 gene locus_tag LOCUS_24110 2781 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3848 2778 gene locus_tag LOCUS_24120 3848 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 4398 6233 gene locus_tag LOCUS_24130 4398 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 7159 6317 gene locus_tag LOCUS_24140 7159 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 7524 8330 gene locus_tag LOCUS_24150 7524 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 8382 9383 gene locus_tag LOCUS_24160 8382 9383 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223960.1 protein_id gnl|my_center|LOCUS_24160 12337 9377 gene locus_tag LOCUS_24170 12337 9377 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 protein_id gnl|my_center|LOCUS_24170 12943 12398 gene locus_tag LOCUS_24180 12943 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 13776 12982 gene locus_tag LOCUS_24190 13776 12982 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_24190 13904 14794 gene locus_tag LOCUS_24200 13904 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 14798 15253 gene locus_tag LOCUS_24210 gene nusB 14798 15253 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_24210 18067 15518 gene locus_tag LOCUS_24220 18067 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 19454 18339 gene locus_tag LOCUS_24230 gene ald 19454 18339 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_24230 20984 19485 gene locus_tag LOCUS_24240 20984 19485 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153932.1 protein_id gnl|my_center|LOCUS_24240 21615 21187 gene locus_tag LOCUS_24250 21615 21187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24250 22039 23103 gene locus_tag LOCUS_24260 22039 23103 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_24260 23283 24491 gene locus_tag LOCUS_24270 23283 24491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 24494 25015 gene locus_tag LOCUS_24280 24494 25015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 25055 27280 gene locus_tag LOCUS_24290 gene mrdA 25055 27280 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_24290 27284 28378 gene locus_tag LOCUS_24300 gene rodA 27284 28378 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_24300 28844 32107 gene locus_tag LOCUS_24310 28844 32107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 32455 33282 gene locus_tag LOCUS_24320 32455 33282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 35072 33342 gene locus_tag LOCUS_24330 35072 33342 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_24330 35190 35783 gene locus_tag LOCUS_24340 35190 35783 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035734.1 protein_id gnl|my_center|LOCUS_24340 35901 36233 gene locus_tag LOCUS_24350 35901 36233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 37314 36268 gene locus_tag LOCUS_24360 gene mqnC 37314 36268 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_24360 37630 37421 gene locus_tag LOCUS_24370 37630 37421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 37817 38917 gene locus_tag LOCUS_24380 37817 38917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 39527 38997 gene locus_tag LOCUS_24390 39527 38997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence038 446 1354 gene locus_tag LOCUS_24400 446 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1436 3031 gene locus_tag LOCUS_24410 1436 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 3617 3306 gene locus_tag LOCUS_24420 3617 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 3888 3601 gene locus_tag LOCUS_24430 3888 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 5493 4072 gene locus_tag LOCUS_24440 5493 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 6033 5587 gene locus_tag LOCUS_24450 6033 5587 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413460.1 protein_id gnl|my_center|LOCUS_24450 6262 6011 gene locus_tag LOCUS_24460 6262 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 6709 6341 gene locus_tag LOCUS_24470 6709 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 6808 7950 gene locus_tag LOCUS_24480 6808 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 8206 8655 gene locus_tag LOCUS_24490 8206 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 8883 9428 gene locus_tag LOCUS_24500 8883 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 9509 12268 gene locus_tag LOCUS_24510 gene mobF 9509 12268 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_24510 12649 12470 gene locus_tag LOCUS_24520 12649 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 13611 14513 gene locus_tag LOCUS_24530 13611 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24530 14588 15097 gene locus_tag LOCUS_24540 14588 15097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 15413 19951 gene locus_tag LOCUS_24550 15413 19951 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933286.1 protein_id gnl|my_center|LOCUS_24550 20047 19886 gene locus_tag LOCUS_24560 20047 19886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 20188 20580 gene locus_tag LOCUS_24570 20188 20580 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106968.1 protein_id gnl|my_center|LOCUS_24570 20558 20938 gene locus_tag LOCUS_24580 20558 20938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 21603 21358 gene locus_tag LOCUS_24590 21603 21358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 22299 21676 gene locus_tag LOCUS_24600 22299 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 22344 23294 gene locus_tag LOCUS_24610 22344 23294 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_24610 23551 23291 gene locus_tag LOCUS_24620 23551 23291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 26667 23575 gene locus_tag LOCUS_24630 26667 23575 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947845.1 protein_id gnl|my_center|LOCUS_24630 27737 26691 gene locus_tag LOCUS_24640 27737 26691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 29143 27749 gene locus_tag LOCUS_24650 29143 27749 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143607.1 protein_id gnl|my_center|LOCUS_24650 29555 29223 gene locus_tag LOCUS_24660 29555 29223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 29654 30193 gene locus_tag LOCUS_24670 29654 30193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 30508 30891 gene locus_tag LOCUS_24680 30508 30891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24680 31469 31627 gene locus_tag LOCUS_24690 31469 31627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 31681 31872 gene locus_tag LOCUS_24700 31681 31872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24700 31875 32177 gene locus_tag LOCUS_24710 31875 32177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 32143 32517 gene locus_tag LOCUS_24720 32143 32517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 32837 32658 gene locus_tag LOCUS_24730 32837 32658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 32928 33707 gene locus_tag LOCUS_24740 32928 33707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 33887 33711 gene locus_tag LOCUS_24750 33887 33711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 34429 33896 gene locus_tag LOCUS_24760 34429 33896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24760 36155 34701 gene locus_tag LOCUS_24770 36155 34701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 36511 38535 gene locus_tag LOCUS_24780 36511 38535 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223614.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence039 51 692 gene locus_tag LOCUS_24790 51 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 813 1466 gene locus_tag LOCUS_24800 813 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 1657 3054 gene locus_tag LOCUS_24810 1657 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3154 3909 gene locus_tag LOCUS_24820 3154 3909 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_24820 3919 4776 gene locus_tag LOCUS_24830 3919 4776 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_24830 5418 4813 gene locus_tag LOCUS_24840 5418 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 7382 5490 gene locus_tag LOCUS_24850 7382 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 8880 7504 gene locus_tag LOCUS_24860 8880 7504 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_24860 9053 9394 gene locus_tag LOCUS_24870 9053 9394 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_24870 9436 10827 gene locus_tag LOCUS_24880 9436 10827 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_24880 10871 11605 gene locus_tag LOCUS_24890 10871 11605 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258361.1 protein_id gnl|my_center|LOCUS_24890 11664 12452 gene locus_tag LOCUS_24900 11664 12452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_24900 12846 14387 gene locus_tag LOCUS_24910 12846 14387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 14514 16169 gene locus_tag LOCUS_24920 14514 16169 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_24920 16200 17234 gene locus_tag LOCUS_24930 16200 17234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 19793 17325 gene locus_tag LOCUS_24940 19793 17325 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038019.1 protein_id gnl|my_center|LOCUS_24940 20174 19995 gene locus_tag LOCUS_24950 20174 19995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 21489 20413 gene locus_tag LOCUS_24960 21489 20413 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053621.1 protein_id gnl|my_center|LOCUS_24960 22481 21627 gene locus_tag LOCUS_24970 22481 21627 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_24970 22798 23439 gene locus_tag LOCUS_24980 22798 23439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 24273 23488 gene locus_tag LOCUS_24990 24273 23488 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_24990 25240 24332 gene locus_tag LOCUS_25000 25240 24332 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767320.1 protein_id gnl|my_center|LOCUS_25000 25456 26844 gene locus_tag LOCUS_25010 gene uxaC 25456 26844 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338259.1 protein_id gnl|my_center|LOCUS_25010 28248 27595 gene locus_tag LOCUS_25020 28248 27595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 28668 28399 gene locus_tag LOCUS_25030 28668 28399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 29752 28673 gene locus_tag LOCUS_25040 29752 28673 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038014.1 protein_id gnl|my_center|LOCUS_25040 31604 29922 gene locus_tag LOCUS_25050 31604 29922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 31993 32238 gene locus_tag LOCUS_25060 31993 32238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 33630 32335 gene locus_tag LOCUS_25070 33630 32335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 33970 35499 gene locus_tag LOCUS_25080 33970 35499 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226019.1 protein_id gnl|my_center|LOCUS_25080 35515 36528 gene locus_tag LOCUS_25090 35515 36528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 36888 36694 gene locus_tag LOCUS_25100 36888 36694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 37006 37653 gene locus_tag LOCUS_25110 37006 37653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 37577 37855 gene locus_tag LOCUS_25120 37577 37855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence040 914 264 gene locus_tag LOCUS_25130 914 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 1718 1002 gene locus_tag LOCUS_25140 1718 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2752 3681 gene locus_tag LOCUS_25150 2752 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 3678 4115 gene locus_tag LOCUS_25160 3678 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 4183 4863 gene locus_tag LOCUS_25170 4183 4863 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 protein_id gnl|my_center|LOCUS_25170 4900 6120 gene locus_tag LOCUS_25180 4900 6120 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056143.1 protein_id gnl|my_center|LOCUS_25180 6147 7262 gene locus_tag LOCUS_25190 6147 7262 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_25190 7290 7640 gene locus_tag LOCUS_25200 7290 7640 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 protein_id gnl|my_center|LOCUS_25200 8253 7627 gene locus_tag LOCUS_25210 8253 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 8866 8492 gene locus_tag LOCUS_25220 8866 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 9168 9899 gene locus_tag LOCUS_25230 9168 9899 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_25230 9941 11221 gene locus_tag LOCUS_25240 9941 11221 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189668.1 protein_id gnl|my_center|LOCUS_25240 11218 12180 gene locus_tag LOCUS_25250 11218 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 12309 14018 gene locus_tag LOCUS_25260 12309 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 14297 14022 gene locus_tag LOCUS_25270 14297 14022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 15137 14388 gene locus_tag LOCUS_25280 15137 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 15688 15161 gene locus_tag LOCUS_25290 15688 15161 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259161.1 protein_id gnl|my_center|LOCUS_25290 16093 17295 gene locus_tag LOCUS_25300 16093 17295 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_25300 17668 19119 gene locus_tag LOCUS_25310 17668 19119 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_25310 19116 20636 gene locus_tag LOCUS_25320 19116 20636 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_25320 22491 20737 gene locus_tag LOCUS_25330 22491 20737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 22851 22498 gene locus_tag LOCUS_25340 22851 22498 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023831.1 protein_id gnl|my_center|LOCUS_25340 23588 22866 gene locus_tag LOCUS_25350 23588 22866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 24165 23599 gene locus_tag LOCUS_25360 24165 23599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 24539 24162 gene locus_tag LOCUS_25370 gene crcB 24539 24162 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227866.1 protein_id gnl|my_center|LOCUS_25370 26646 24556 gene locus_tag LOCUS_25380 26646 24556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 28035 26731 gene locus_tag LOCUS_25390 gene eno 28035 26731 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142119.1 protein_id gnl|my_center|LOCUS_25390 28571 28380 gene locus_tag LOCUS_25400 28571 28380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 28712 29659 gene locus_tag LOCUS_25410 28712 29659 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_25410 29670 30350 gene locus_tag LOCUS_25420 29670 30350 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_25420 30357 31826 gene locus_tag LOCUS_25430 30357 31826 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181950125.1 protein_id gnl|my_center|LOCUS_25430 31847 33316 gene locus_tag LOCUS_25440 31847 33316 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272520.1 protein_id gnl|my_center|LOCUS_25440 33332 34135 gene locus_tag LOCUS_25450 33332 34135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 34125 36119 gene locus_tag LOCUS_25460 gene hyfB 34125 36119 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_25460 36808 37719 gene locus_tag LOCUS_25470 gene hcaR 36808 37719 CDS product DNA-binding transcriptional regulator HcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423249.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence041 1100 327 gene locus_tag LOCUS_25480 1100 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 1242 2018 gene locus_tag LOCUS_25490 1242 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 2180 3280 gene locus_tag LOCUS_25500 2180 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 3571 4650 gene locus_tag LOCUS_25510 3571 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 6160 4811 gene locus_tag LOCUS_25520 6160 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 7104 9215 gene locus_tag LOCUS_25530 7104 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 9414 10514 gene locus_tag LOCUS_25540 gene mutY 9414 10514 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140868.1 protein_id gnl|my_center|LOCUS_25540 10583 11176 gene locus_tag LOCUS_25550 10583 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 11397 12686 gene locus_tag LOCUS_25560 gene serS 11397 12686 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_25560 12856 13041 gene locus_tag LOCUS_25570 12856 13041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 12980 13345 gene locus_tag LOCUS_25580 12980 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 13357 14091 gene locus_tag LOCUS_25590 13357 14091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 15512 14121 gene locus_tag LOCUS_25600 15512 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 15654 19118 gene locus_tag LOCUS_25610 15654 19118 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414323.1 protein_id gnl|my_center|LOCUS_25610 19222 19626 gene locus_tag LOCUS_25620 19222 19626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 19629 20204 gene locus_tag LOCUS_25630 19629 20204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 20150 21886 gene locus_tag LOCUS_25640 20150 21886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 21928 23523 gene locus_tag LOCUS_25650 gene pruA 21928 23523 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257665.1 protein_id gnl|my_center|LOCUS_25650 23628 23975 gene locus_tag LOCUS_25660 23628 23975 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390568.1 protein_id gnl|my_center|LOCUS_25660 24751 24086 gene locus_tag LOCUS_25670 24751 24086 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975328.1 protein_id gnl|my_center|LOCUS_25670 25213 26955 gene locus_tag LOCUS_25680 25213 26955 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_25680 27003 28481 gene locus_tag LOCUS_25690 27003 28481 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_25690 31522 28598 gene locus_tag LOCUS_25700 31522 28598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 32872 31898 gene locus_tag LOCUS_25710 32872 31898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 33036 33626 gene locus_tag LOCUS_25720 33036 33626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 33706 34698 gene locus_tag LOCUS_25730 33706 34698 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_25730 34730 36319 gene locus_tag LOCUS_25740 34730 36319 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence042 1401 676 gene locus_tag LOCUS_25750 1401 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2016 1405 gene locus_tag LOCUS_25760 2016 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3305 2076 gene locus_tag LOCUS_25770 3305 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3931 3641 gene locus_tag LOCUS_25780 3931 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 5941 5015 gene locus_tag LOCUS_25790 5941 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 6932 6576 gene locus_tag LOCUS_25800 6932 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 7792 7502 gene locus_tag LOCUS_25810 7792 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 11179 8183 gene locus_tag LOCUS_25820 11179 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 15402 11866 gene locus_tag LOCUS_25830 15402 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 15780 16001 gene locus_tag LOCUS_25840 15780 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 18945 16402 gene locus_tag LOCUS_25850 18945 16402 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038016.1 protein_id gnl|my_center|LOCUS_25850 19386 20465 gene locus_tag LOCUS_25860 19386 20465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 21687 21262 gene locus_tag LOCUS_25870 21687 21262 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929155.1 protein_id gnl|my_center|LOCUS_25870 22955 23980 gene locus_tag LOCUS_25880 22955 23980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 24590 24030 gene locus_tag LOCUS_25890 24590 24030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 24746 25711 gene locus_tag LOCUS_25900 24746 25711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 25708 26259 gene locus_tag LOCUS_25910 25708 26259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 26996 26523 gene locus_tag LOCUS_25920 26996 26523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 28515 27199 gene locus_tag LOCUS_25930 28515 27199 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369218.1 protein_id gnl|my_center|LOCUS_25930 28736 30718 gene locus_tag LOCUS_25940 gene yagF 28736 30718 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_25940 30715 31542 gene locus_tag LOCUS_25950 30715 31542 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_25950 31543 33159 gene locus_tag LOCUS_25960 31543 33159 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731065.1 protein_id gnl|my_center|LOCUS_25960 33766 33302 gene locus_tag LOCUS_25970 33766 33302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 35242 33770 gene locus_tag LOCUS_25980 35242 33770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence043 <1 1045 gene locus_tag LOCUS_25990 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326180.1:Gfo/Idh/MocA family oxidoreductase 1085 1945 gene locus_tag LOCUS_26000 1085 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2511 1942 gene locus_tag LOCUS_26010 2511 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2729 2974 gene locus_tag LOCUS_26020 2729 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 4172 3192 gene locus_tag LOCUS_26030 4172 3192 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546739.1 protein_id gnl|my_center|LOCUS_26030 4831 4175 gene locus_tag LOCUS_26040 4831 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 5638 5003 gene locus_tag LOCUS_26050 5638 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 6580 5690 gene locus_tag LOCUS_26060 6580 5690 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_26060 6936 8600 gene locus_tag LOCUS_26070 6936 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 8677 9540 gene locus_tag LOCUS_26080 gene mtnP 8677 9540 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_26080 9603 10538 gene locus_tag LOCUS_26090 9603 10538 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_26090 10528 12174 gene locus_tag LOCUS_26100 10528 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 13279 12356 gene locus_tag LOCUS_26110 13279 12356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 13986 15278 gene locus_tag LOCUS_26120 gene eno 13986 15278 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_26120 17448 15331 gene locus_tag LOCUS_26130 17448 15331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 17927 17853 gene locus_tag LOCUS_t00160 17927 17853 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 18059 19123 gene locus_tag LOCUS_26140 18059 19123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 19151 19669 gene locus_tag LOCUS_26150 19151 19669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 20609 20685 gene locus_tag LOCUS_t00170 20609 20685 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21906 20761 gene locus_tag LOCUS_26160 21906 20761 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287688.1 protein_id gnl|my_center|LOCUS_26160 22244 22011 gene locus_tag LOCUS_26170 22244 22011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 22645 23595 gene locus_tag LOCUS_26180 22645 23595 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392214.1 protein_id gnl|my_center|LOCUS_26180 24195 25100 gene locus_tag LOCUS_26190 24195 25100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 25097 26953 gene locus_tag LOCUS_26200 25097 26953 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099124864.1 protein_id gnl|my_center|LOCUS_26200 28994 27399 gene locus_tag LOCUS_26210 28994 27399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 29983 29075 gene locus_tag LOCUS_26220 29983 29075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 30500 33031 gene locus_tag LOCUS_26230 30500 33031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 33040 35448 gene locus_tag LOCUS_26240 33040 35448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence044 371 36 gene locus_tag LOCUS_26250 371 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 532 1437 gene locus_tag LOCUS_26260 532 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 1607 1521 gene locus_tag LOCUS_t00180 1607 1521 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2409 1813 gene locus_tag LOCUS_26270 gene kdpC 2409 1813 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973321.1 protein_id gnl|my_center|LOCUS_26270 4467 2419 gene locus_tag LOCUS_26280 gene kdpB 4467 2419 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405320.1 protein_id gnl|my_center|LOCUS_26280 6269 4494 gene locus_tag LOCUS_26290 gene kdpA 6269 4494 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973323.1 protein_id gnl|my_center|LOCUS_26290 6985 6449 gene locus_tag LOCUS_26300 6985 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 7813 7067 gene locus_tag LOCUS_26310 7813 7067 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223789.1 protein_id gnl|my_center|LOCUS_26310 8968 7820 gene locus_tag LOCUS_26320 8968 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 9023 10462 gene locus_tag LOCUS_26330 9023 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 10605 11030 gene locus_tag LOCUS_26340 10605 11030 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_26340 11397 11155 gene locus_tag LOCUS_26350 11397 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 11618 11704 gene locus_tag LOCUS_t00190 11618 11704 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11991 12470 gene locus_tag LOCUS_26360 11991 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 12669 12499 gene locus_tag LOCUS_26370 12669 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 13986 13123 gene locus_tag LOCUS_26380 13986 13123 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334461.1 protein_id gnl|my_center|LOCUS_26380 15097 14132 gene locus_tag LOCUS_26390 15097 14132 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_26390 15567 18917 gene locus_tag LOCUS_26400 15567 18917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 18919 20226 gene locus_tag LOCUS_26410 18919 20226 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113702.1 protein_id gnl|my_center|LOCUS_26410 20397 23804 gene locus_tag LOCUS_26420 20397 23804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 23952 26609 gene locus_tag LOCUS_26430 23952 26609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 26879 29512 gene locus_tag LOCUS_26440 26879 29512 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776932.1 protein_id gnl|my_center|LOCUS_26440 29731 33582 gene locus_tag LOCUS_26450 29731 33582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 33739 33993 gene locus_tag LOCUS_26460 33739 33993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26460 33990 34226 gene locus_tag LOCUS_26470 33990 34226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence045 271 1065 gene locus_tag LOCUS_26480 271 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1282 3852 gene locus_tag LOCUS_26490 1282 3852 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_26490 3939 5639 gene locus_tag LOCUS_26500 3939 5639 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_26500 5951 5700 gene locus_tag LOCUS_26510 5951 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 5859 6455 gene locus_tag LOCUS_26520 5859 6455 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699609.1 protein_id gnl|my_center|LOCUS_26520 6452 7894 gene locus_tag LOCUS_26530 6452 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 7947 9008 gene locus_tag LOCUS_26540 7947 9008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 8998 9294 gene locus_tag LOCUS_26550 8998 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 9291 10544 gene locus_tag LOCUS_26560 9291 10544 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812525.1 protein_id gnl|my_center|LOCUS_26560 12070 10577 gene locus_tag LOCUS_26570 gene hemY 12070 10577 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_26570 13188 12067 gene locus_tag LOCUS_26580 gene hemH 13188 12067 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887774.1 protein_id gnl|my_center|LOCUS_26580 14315 13185 gene locus_tag LOCUS_26590 gene hemE 14315 13185 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258456.1 protein_id gnl|my_center|LOCUS_26590 14492 15250 gene locus_tag LOCUS_26600 14492 15250 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888542.1 protein_id gnl|my_center|LOCUS_26600 15250 16749 gene locus_tag LOCUS_26610 15250 16749 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027372.1 protein_id gnl|my_center|LOCUS_26610 16742 17437 gene locus_tag LOCUS_26620 16742 17437 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727052.1 protein_id gnl|my_center|LOCUS_26620 17517 18617 gene locus_tag LOCUS_26630 17517 18617 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103982.1 protein_id gnl|my_center|LOCUS_26630 18873 21083 gene locus_tag LOCUS_26640 18873 21083 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258146.1 protein_id gnl|my_center|LOCUS_26640 21370 21161 gene locus_tag LOCUS_26650 21370 21161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 21449 22648 gene locus_tag LOCUS_26660 21449 22648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 22654 23859 gene locus_tag LOCUS_26670 gene rhaI 22654 23859 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 protein_id gnl|my_center|LOCUS_26670 23981 25042 gene locus_tag LOCUS_26680 23981 25042 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_26680 25064 26023 gene locus_tag LOCUS_26690 25064 26023 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_26690 26097 27245 gene locus_tag LOCUS_26700 26097 27245 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_26700 28240 27317 gene locus_tag LOCUS_26710 28240 27317 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764761.1 protein_id gnl|my_center|LOCUS_26710 28452 29384 gene locus_tag LOCUS_26720 28452 29384 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_26720 29481 30530 gene locus_tag LOCUS_26730 29481 30530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 30690 30615 gene locus_tag LOCUS_t00200 30690 30615 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31843 30734 gene locus_tag LOCUS_26740 31843 30734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 32058 31861 gene locus_tag LOCUS_26750 32058 31861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 33360 32629 gene locus_tag LOCUS_26760 33360 32629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence046 186 2894 gene locus_tag LOCUS_26770 gene aceE 186 2894 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_26770 3581 4084 gene locus_tag LOCUS_26780 3581 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 4106 5389 gene locus_tag LOCUS_26790 gene aldA 4106 5389 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115933.1 protein_id gnl|my_center|LOCUS_26790 5541 7151 gene locus_tag LOCUS_26800 5541 7151 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922209.1 protein_id gnl|my_center|LOCUS_26800 7164 8234 gene locus_tag LOCUS_26810 7164 8234 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525324.1 protein_id gnl|my_center|LOCUS_26810 8231 9031 gene locus_tag LOCUS_26820 8231 9031 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926031.1 protein_id gnl|my_center|LOCUS_26820 9140 9373 gene locus_tag LOCUS_26830 9140 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 9459 10082 gene locus_tag LOCUS_26840 gene mtgA 9459 10082 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023518284.1 protein_id gnl|my_center|LOCUS_26840 10498 10950 gene locus_tag LOCUS_26850 10498 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 11995 11153 gene locus_tag LOCUS_26860 11995 11153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881399.1 protein_id gnl|my_center|LOCUS_26860 12766 11999 gene locus_tag LOCUS_26870 12766 11999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_26870 15108 12955 gene locus_tag LOCUS_26880 15108 12955 CDS product transferrin receptor-like dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928760.1 protein_id gnl|my_center|LOCUS_26880 15357 15677 gene locus_tag LOCUS_26890 15357 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 15632 16228 gene locus_tag LOCUS_26900 15632 16228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 16201 16458 gene locus_tag LOCUS_26910 16201 16458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 18297 16723 gene locus_tag LOCUS_26920 18297 16723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 18865 18290 gene locus_tag LOCUS_26930 18865 18290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 19481 20968 gene locus_tag LOCUS_26940 19481 20968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 21275 21595 gene locus_tag LOCUS_26950 21275 21595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 21891 23057 gene locus_tag LOCUS_26960 21891 23057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26960 23061 23948 gene locus_tag LOCUS_26970 23061 23948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26970 24187 25611 gene locus_tag LOCUS_26980 24187 25611 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_26980 26818 25868 gene locus_tag LOCUS_26990 26818 25868 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_26990 27887 26985 gene locus_tag LOCUS_27000 27887 26985 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838714.1 protein_id gnl|my_center|LOCUS_27000 28210 29172 gene locus_tag LOCUS_27010 28210 29172 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086241.1 protein_id gnl|my_center|LOCUS_27010 29338 30636 gene locus_tag LOCUS_27020 gene hisS 29338 30636 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703166.1 protein_id gnl|my_center|LOCUS_27020 30694 32526 gene locus_tag LOCUS_27030 gene aspS 30694 32526 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_27030 33371 32595 gene locus_tag LOCUS_27040 33371 32595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 33410 33649 gene locus_tag LOCUS_27050 33410 33649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence047 800 207 gene locus_tag LOCUS_27060 800 207 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_27060 2190 1855 gene locus_tag LOCUS_27070 2190 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2484 3047 gene locus_tag LOCUS_27080 2484 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 3166 4128 gene locus_tag LOCUS_27090 3166 4128 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404481.1 protein_id gnl|my_center|LOCUS_27090 4387 5103 gene locus_tag LOCUS_27100 4387 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 5569 5192 gene locus_tag LOCUS_27110 5569 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 6139 5591 gene locus_tag LOCUS_27120 6139 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 6354 6992 gene locus_tag LOCUS_27130 6354 6992 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545398.1 protein_id gnl|my_center|LOCUS_27130 7055 7606 gene locus_tag LOCUS_27140 7055 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 7593 8993 gene locus_tag LOCUS_27150 7593 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 8986 10413 gene locus_tag LOCUS_27160 8986 10413 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_27160 10464 12260 gene locus_tag LOCUS_27170 10464 12260 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969667.1 protein_id gnl|my_center|LOCUS_27170 12383 12307 gene locus_tag LOCUS_t00210 12383 12307 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13134 12532 gene locus_tag LOCUS_27180 13134 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 14221 13136 gene locus_tag LOCUS_27190 14221 13136 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_27190 14373 14299 gene locus_tag LOCUS_t00220 14373 14299 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 14533 14967 gene locus_tag LOCUS_27200 14533 14967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 15027 15103 gene locus_tag LOCUS_t00230 15027 15103 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17085 15598 gene locus_tag LOCUS_27210 17085 15598 CDS product PhoPQ-activated protein PqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817293.1 protein_id gnl|my_center|LOCUS_27210 21035 17616 gene locus_tag LOCUS_27220 21035 17616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 22701 23012 gene locus_tag LOCUS_27230 22701 23012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27230 23545 23982 gene locus_tag LOCUS_27240 23545 23982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 24155 24541 gene locus_tag LOCUS_27250 24155 24541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27250 24801 24538 gene locus_tag LOCUS_27260 24801 24538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27260 25316 24927 gene locus_tag LOCUS_27270 25316 24927 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403882.1 protein_id gnl|my_center|LOCUS_27270 25753 26508 gene locus_tag LOCUS_27280 25753 26508 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249123.1 protein_id gnl|my_center|LOCUS_27280 27761 26796 gene locus_tag LOCUS_27290 27761 26796 CDS product IS5-like element ISPssy family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923181.1 protein_id gnl|my_center|LOCUS_27290 28071 30419 gene locus_tag LOCUS_27300 28071 30419 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272544.1 protein_id gnl|my_center|LOCUS_27300 30430 31614 gene locus_tag LOCUS_27310 30430 31614 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_27310 31628 32302 gene locus_tag LOCUS_27320 31628 32302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27320 32339 33157 gene locus_tag LOCUS_27330 32339 33157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27330 >Feature sequence048 <1 1236 gene locus_tag LOCUS_27340 <1 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944627.1:acetyl-CoA carboxylase biotin carboxylase subunit 1242 1889 gene locus_tag LOCUS_27350 1242 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2007 3536 gene locus_tag LOCUS_27360 2007 3536 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_27360 3732 4700 gene locus_tag LOCUS_27370 3732 4700 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942950.1 protein_id gnl|my_center|LOCUS_27370 4753 5577 gene locus_tag LOCUS_27380 4753 5577 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967364.1 protein_id gnl|my_center|LOCUS_27380 6190 5708 gene locus_tag LOCUS_27390 6190 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 8031 6334 gene locus_tag LOCUS_27400 8031 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 9697 8219 gene locus_tag LOCUS_27410 9697 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 9998 10330 gene locus_tag LOCUS_27420 9998 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 10370 11143 gene locus_tag LOCUS_27430 10370 11143 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943654.1 protein_id gnl|my_center|LOCUS_27430 11140 12042 gene locus_tag LOCUS_27440 11140 12042 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943655.1 protein_id gnl|my_center|LOCUS_27440 13004 12111 gene locus_tag LOCUS_27450 13004 12111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 14454 13039 gene locus_tag LOCUS_27460 gene flgK 14454 13039 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_27460 14816 14550 gene locus_tag LOCUS_27470 14816 14550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 15187 14891 gene locus_tag LOCUS_27480 15187 14891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 15906 15325 gene locus_tag LOCUS_27490 15906 15325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 16964 15909 gene locus_tag LOCUS_27500 16964 15909 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_27500 17933 17205 gene locus_tag LOCUS_27510 17933 17205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 18580 17930 gene locus_tag LOCUS_27520 18580 17930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 19423 18635 gene locus_tag LOCUS_27530 gene flgG 19423 18635 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_27530 20284 19514 gene locus_tag LOCUS_27540 20284 19514 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385144.1 protein_id gnl|my_center|LOCUS_27540 21456 20452 gene locus_tag LOCUS_27550 21456 20452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 22710 21655 gene locus_tag LOCUS_27560 22710 21655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 23752 22775 gene locus_tag LOCUS_27570 gene fliM 23752 22775 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987033.1 protein_id gnl|my_center|LOCUS_27570 24743 23817 gene locus_tag LOCUS_27580 24743 23817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 26950 24791 gene locus_tag LOCUS_27590 gene flhA 26950 24791 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_27590 28244 27096 gene locus_tag LOCUS_27600 gene flhB 28244 27096 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870058.1 protein_id gnl|my_center|LOCUS_27600 29018 28251 gene locus_tag LOCUS_27610 gene fliR 29018 28251 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405298.1 protein_id gnl|my_center|LOCUS_27610 29338 29069 gene locus_tag LOCUS_27620 gene fliQ 29338 29069 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367302.1 protein_id gnl|my_center|LOCUS_27620 30100 29399 gene locus_tag LOCUS_27630 gene fliP 30100 29399 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_27630 30513 30097 gene locus_tag LOCUS_27640 30513 30097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 30916 30593 gene locus_tag LOCUS_27650 30916 30593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 31238 30957 gene locus_tag LOCUS_27660 31238 30957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence049 645 944 gene locus_tag LOCUS_27670 645 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 941 1363 gene locus_tag LOCUS_27680 941 1363 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888169.1 protein_id gnl|my_center|LOCUS_27680 2377 1661 gene locus_tag LOCUS_27690 2377 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 3475 2663 gene locus_tag LOCUS_27700 3475 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 3709 5823 gene locus_tag LOCUS_27710 3709 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 6015 5848 gene locus_tag LOCUS_27720 6015 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 6682 6518 gene locus_tag LOCUS_27730 6682 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 6657 7415 gene locus_tag LOCUS_27740 6657 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 7490 8317 gene locus_tag LOCUS_27750 7490 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 9122 9361 gene locus_tag LOCUS_27760 9122 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 9428 10171 gene locus_tag LOCUS_27770 9428 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27770 10201 10554 gene locus_tag LOCUS_27780 10201 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27780 10646 10571 gene locus_tag LOCUS_t00240 10646 10571 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10789 11751 gene locus_tag LOCUS_27790 gene cysK 10789 11751 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_27790 11761 12963 gene locus_tag LOCUS_27800 11761 12963 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229810.1 protein_id gnl|my_center|LOCUS_27800 14449 12998 gene locus_tag LOCUS_27810 14449 12998 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_27810 17288 14442 gene locus_tag LOCUS_27820 17288 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27820 19026 17680 gene locus_tag LOCUS_27830 19026 17680 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339017.1 protein_id gnl|my_center|LOCUS_27830 19730 19059 gene locus_tag LOCUS_27840 gene coxH3 19730 19059 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_27840 19899 20924 gene locus_tag LOCUS_27850 19899 20924 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266619.1 protein_id gnl|my_center|LOCUS_27850 20969 23152 gene locus_tag LOCUS_27860 20969 23152 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879233.1 protein_id gnl|my_center|LOCUS_27860 23204 24091 gene locus_tag LOCUS_27870 23204 24091 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_27870 24297 24809 gene locus_tag LOCUS_27880 24297 24809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 25529 24870 gene locus_tag LOCUS_27890 25529 24870 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_27890 26599 25691 gene locus_tag LOCUS_27900 26599 25691 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_27900 27791 26715 gene locus_tag LOCUS_27910 27791 26715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 28139 27825 gene locus_tag LOCUS_27920 28139 27825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 28087 30843 gene locus_tag LOCUS_27930 28087 30843 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140279.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence050 353 607 gene locus_tag LOCUS_27940 353 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 1828 806 gene locus_tag LOCUS_27950 1828 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 2024 2248 gene locus_tag LOCUS_27960 2024 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 2307 3140 gene locus_tag LOCUS_27970 2307 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 3137 4327 gene locus_tag LOCUS_27980 3137 4327 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_27980 4324 5730 gene locus_tag LOCUS_27990 gene galK 4324 5730 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_27990 5727 6668 gene locus_tag LOCUS_28000 5727 6668 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938246.1 protein_id gnl|my_center|LOCUS_28000 6904 7152 gene locus_tag LOCUS_28010 6904 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28010 7622 7870 gene locus_tag LOCUS_28020 7622 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 8344 8664 gene locus_tag LOCUS_28030 8344 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 9530 8775 gene locus_tag LOCUS_28040 gene istB 9530 8775 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_28040 9922 9527 gene locus_tag LOCUS_28050 9922 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 9815 10162 gene locus_tag LOCUS_28060 9815 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 10409 10182 gene locus_tag LOCUS_28070 10409 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 10666 11028 gene locus_tag LOCUS_28080 10666 11028 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349611.1 protein_id gnl|my_center|LOCUS_28080 11037 13664 gene locus_tag LOCUS_28090 11037 13664 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_28090 13782 14117 gene locus_tag LOCUS_28100 13782 14117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 15257 14298 gene locus_tag LOCUS_28110 gene rocF 15257 14298 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258791.1 protein_id gnl|my_center|LOCUS_28110 16731 15379 gene locus_tag LOCUS_28120 gene asnS 16731 15379 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257312.1 protein_id gnl|my_center|LOCUS_28120 17641 16775 gene locus_tag LOCUS_28130 17641 16775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 17782 18855 gene locus_tag LOCUS_28140 gene ispE 17782 18855 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056351.1 protein_id gnl|my_center|LOCUS_28140 18859 18932 gene locus_tag LOCUS_t00250 18859 18932 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 19124 20236 gene locus_tag LOCUS_28150 19124 20236 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_28150 20396 21082 gene locus_tag LOCUS_28160 20396 21082 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546254.1 protein_id gnl|my_center|LOCUS_28160 21095 21754 gene locus_tag LOCUS_28170 gene pth 21095 21754 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_28170 21828 22331 gene locus_tag LOCUS_28180 21828 22331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 22579 22761 gene locus_tag LOCUS_28190 22579 22761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 22804 23259 gene locus_tag LOCUS_28200 gene rplI 22804 23259 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_28200 24112 23330 gene locus_tag LOCUS_28210 24112 23330 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_28210 24277 25785 gene locus_tag LOCUS_28220 24277 25785 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_28220 25956 27212 gene locus_tag LOCUS_28230 25956 27212 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_28230 27377 29716 gene locus_tag LOCUS_28240 27377 29716 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546286.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence051 1772 180 gene locus_tag LOCUS_28250 gene dacB 1772 180 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279147.1 protein_id gnl|my_center|LOCUS_28250 1982 2830 gene locus_tag LOCUS_28260 gene folP 1982 2830 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_28260 4260 2920 gene locus_tag LOCUS_28270 4260 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 5004 4315 gene locus_tag LOCUS_28280 5004 4315 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063765.1 protein_id gnl|my_center|LOCUS_28280 5343 6758 gene locus_tag LOCUS_28290 gene rmuC 5343 6758 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039276.1 protein_id gnl|my_center|LOCUS_28290 7039 7281 gene locus_tag LOCUS_28300 gene acpP 7039 7281 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_28300 7363 8646 gene locus_tag LOCUS_28310 gene fabF 7363 8646 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_28310 9245 8715 gene locus_tag LOCUS_28320 9245 8715 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_28320 11082 9427 gene locus_tag LOCUS_28330 11082 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 11636 11914 gene locus_tag LOCUS_28340 11636 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 12014 12979 gene locus_tag LOCUS_28350 12014 12979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 14665 13151 gene locus_tag LOCUS_28360 14665 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 14987 16396 gene locus_tag LOCUS_28370 gene glmU 14987 16396 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287346.1 protein_id gnl|my_center|LOCUS_28370 17556 16393 gene locus_tag LOCUS_28380 gene opgC 17556 16393 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973266.1 protein_id gnl|my_center|LOCUS_28380 17979 17692 gene locus_tag LOCUS_28390 17979 17692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 18268 19506 gene locus_tag LOCUS_28400 18268 19506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 19548 22412 gene locus_tag LOCUS_28410 19548 22412 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 protein_id gnl|my_center|LOCUS_28410 22504 23085 gene locus_tag LOCUS_28420 gene pyrR 22504 23085 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172875.1 protein_id gnl|my_center|LOCUS_28420 23142 24329 gene locus_tag LOCUS_28430 23142 24329 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_28430 24326 25657 gene locus_tag LOCUS_28440 24326 25657 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_28440 27080 25863 gene locus_tag LOCUS_28450 27080 25863 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_28450 27310 29451 gene locus_tag LOCUS_28460 27310 29451 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018575409.1 protein_id gnl|my_center|LOCUS_28460 >Feature sequence052 143 286 gene locus_tag LOCUS_28470 143 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 882 310 gene locus_tag LOCUS_28480 882 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1874 879 gene locus_tag LOCUS_28490 1874 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 2288 1878 gene locus_tag LOCUS_28500 2288 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 2426 3565 gene locus_tag LOCUS_28510 2426 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 4107 4958 gene locus_tag LOCUS_28520 4107 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 7866 5149 gene locus_tag LOCUS_28530 gene mobF 7866 5149 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_28530 9861 7870 gene locus_tag LOCUS_28540 9861 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 10255 9854 gene locus_tag LOCUS_28550 10255 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 10770 10450 gene locus_tag LOCUS_28560 10770 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 11020 10757 gene locus_tag LOCUS_28570 11020 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 11997 11014 gene locus_tag LOCUS_28580 11997 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 12452 12063 gene locus_tag LOCUS_28590 12452 12063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 13647 12946 gene locus_tag LOCUS_28600 13647 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 14503 13658 gene locus_tag LOCUS_28610 14503 13658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 15355 14528 gene locus_tag LOCUS_28620 15355 14528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 15651 15400 gene locus_tag LOCUS_28630 15651 15400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 17005 15662 gene locus_tag LOCUS_28640 17005 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 17775 17005 gene locus_tag LOCUS_28650 17775 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 20301 17788 gene locus_tag LOCUS_28660 gene trbE 20301 17788 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 protein_id gnl|my_center|LOCUS_28660 20609 20301 gene locus_tag LOCUS_28670 20609 20301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 20999 20658 gene locus_tag LOCUS_28680 20999 20658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 21568 23478 gene locus_tag LOCUS_28690 21568 23478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161138665.1 protein_id gnl|my_center|LOCUS_28690 23516 23707 gene locus_tag LOCUS_28700 23516 23707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 23965 24273 gene locus_tag LOCUS_28710 23965 24273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 24943 24284 gene locus_tag LOCUS_28720 24943 24284 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 protein_id gnl|my_center|LOCUS_28720 26730 25399 gene locus_tag LOCUS_28730 26730 25399 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_28730 27044 26727 gene locus_tag LOCUS_28740 27044 26727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 27298 27041 gene locus_tag LOCUS_28750 27298 27041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 27542 27961 gene locus_tag LOCUS_28760 27542 27961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 28338 28904 gene locus_tag LOCUS_28770 28338 28904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence053 259 113 gene locus_tag LOCUS_28780 259 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 336 2228 gene locus_tag LOCUS_28790 336 2228 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083040.1 protein_id gnl|my_center|LOCUS_28790 2533 2859 gene locus_tag LOCUS_28800 2533 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 2976 4007 gene locus_tag LOCUS_28810 2976 4007 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994093.1 protein_id gnl|my_center|LOCUS_28810 4963 4040 gene locus_tag LOCUS_28820 gene motB 4963 4040 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402902.1 protein_id gnl|my_center|LOCUS_28820 5883 4975 gene locus_tag LOCUS_28830 gene motA 5883 4975 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546161.1 protein_id gnl|my_center|LOCUS_28830 6827 5868 gene locus_tag LOCUS_28840 6827 5868 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943599.1 protein_id gnl|my_center|LOCUS_28840 7648 7388 gene locus_tag LOCUS_28850 7648 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28850 10184 7878 gene locus_tag LOCUS_28860 10184 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 11171 10221 gene locus_tag LOCUS_28870 11171 10221 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887615.1 protein_id gnl|my_center|LOCUS_28870 11926 11168 gene locus_tag LOCUS_28880 11926 11168 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887616.1 protein_id gnl|my_center|LOCUS_28880 13784 11973 gene locus_tag LOCUS_28890 13784 11973 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_28890 14975 13803 gene locus_tag LOCUS_28900 14975 13803 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_28900 17358 15010 gene locus_tag LOCUS_28910 17358 15010 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272544.1 protein_id gnl|my_center|LOCUS_28910 17689 17474 gene locus_tag LOCUS_28920 17689 17474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 18609 19280 gene locus_tag LOCUS_28930 18609 19280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 19405 20037 gene locus_tag LOCUS_28940 19405 20037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 20851 20012 gene locus_tag LOCUS_28950 20851 20012 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_28950 21200 20859 gene locus_tag LOCUS_28960 21200 20859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 22319 21408 gene locus_tag LOCUS_28970 gene thiD 22319 21408 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055440.1 protein_id gnl|my_center|LOCUS_28970 22481 23086 gene locus_tag LOCUS_28980 22481 23086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 23924 23088 gene locus_tag LOCUS_28990 23924 23088 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243756.1 protein_id gnl|my_center|LOCUS_28990 26425 23924 gene locus_tag LOCUS_29000 26425 23924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 <29003 26752 gene locus_tag LOCUS_29010 <29003 26752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928424.1:alpha-mannosidase >Feature sequence054 1381 203 gene locus_tag LOCUS_29020 1381 203 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_29020 1629 2591 gene locus_tag LOCUS_29030 1629 2591 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_29030 2790 3020 gene locus_tag LOCUS_29040 2790 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 3421 3831 gene locus_tag LOCUS_29050 3421 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 5452 3923 gene locus_tag LOCUS_29060 5452 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 6341 5559 gene locus_tag LOCUS_29070 6341 5559 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_29070 6891 7217 gene locus_tag LOCUS_29080 6891 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 7299 7223 gene locus_tag LOCUS_t00260 7299 7223 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7401 7970 gene locus_tag LOCUS_29090 7401 7970 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_29090 8227 8066 gene locus_tag LOCUS_29100 8227 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 8352 8603 gene locus_tag LOCUS_29110 8352 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 8755 9243 gene locus_tag LOCUS_29120 8755 9243 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_29120 9288 10541 gene locus_tag LOCUS_29130 9288 10541 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_29130 10618 11046 gene locus_tag LOCUS_29140 gene iscU 10618 11046 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_29140 11124 11579 gene locus_tag LOCUS_29150 11124 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 11664 12383 gene locus_tag LOCUS_29160 11664 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 12418 14379 gene locus_tag LOCUS_29170 gene dnaK 12418 14379 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_29170 14389 14850 gene locus_tag LOCUS_29180 14389 14850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 14872 15087 gene locus_tag LOCUS_29190 gene iscX 14872 15087 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142213.1 protein_id gnl|my_center|LOCUS_29190 16519 15554 gene locus_tag LOCUS_29200 16519 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 17580 20894 gene locus_tag LOCUS_29210 17580 20894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 21320 24436 gene locus_tag LOCUS_29220 21320 24436 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766599.1 protein_id gnl|my_center|LOCUS_29220 24758 25324 gene locus_tag LOCUS_29230 24758 25324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 25661 26065 gene locus_tag LOCUS_29240 25661 26065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 26185 26484 gene locus_tag LOCUS_29250 26185 26484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29250 26693 26514 gene locus_tag LOCUS_29260 26693 26514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 26839 26648 gene locus_tag LOCUS_29270 26839 26648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29270 26970 27959 gene locus_tag LOCUS_29280 26970 27959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29280 27956 28417 gene locus_tag LOCUS_29290 27956 28417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29290 >Feature sequence055 482 183 gene locus_tag LOCUS_29300 482 183 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390589.1 protein_id gnl|my_center|LOCUS_29300 828 502 gene locus_tag LOCUS_29310 828 502 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390588.1 protein_id gnl|my_center|LOCUS_29310 1266 1015 gene locus_tag LOCUS_29320 1266 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1232 2239 gene locus_tag LOCUS_29330 1232 2239 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163274.1 protein_id gnl|my_center|LOCUS_29330 2655 2257 gene locus_tag LOCUS_29340 2655 2257 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140252.1 protein_id gnl|my_center|LOCUS_29340 2942 2652 gene locus_tag LOCUS_29350 2942 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 4376 3066 gene locus_tag LOCUS_29360 4376 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 5870 5040 gene locus_tag LOCUS_29370 5870 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 6141 5923 gene locus_tag LOCUS_29380 6141 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 6165 6590 gene locus_tag LOCUS_29390 6165 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 6587 8572 gene locus_tag LOCUS_29400 6587 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 8617 8913 gene locus_tag LOCUS_29410 8617 8913 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067437.1 protein_id gnl|my_center|LOCUS_29410 8916 9221 gene locus_tag LOCUS_29420 8916 9221 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114441661.1 protein_id gnl|my_center|LOCUS_29420 9248 12022 gene locus_tag LOCUS_29430 gene mobF 9248 12022 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_29430 12026 12247 gene locus_tag LOCUS_29440 12026 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 13553 12234 gene locus_tag LOCUS_29450 13553 12234 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013581307.1 protein_id gnl|my_center|LOCUS_29450 13852 13550 gene locus_tag LOCUS_29460 13852 13550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 13790 14179 gene locus_tag LOCUS_29470 13790 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 15304 14279 gene locus_tag LOCUS_29480 15304 14279 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_29480 16119 15625 gene locus_tag LOCUS_29490 16119 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 16835 16188 gene locus_tag LOCUS_29500 16835 16188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 17340 17615 gene locus_tag LOCUS_29510 gene rpsT 17340 17615 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_29510 18960 17884 gene locus_tag LOCUS_29520 18960 17884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 20586 19054 gene locus_tag LOCUS_29530 20586 19054 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814808.1 protein_id gnl|my_center|LOCUS_29530 21794 20607 gene locus_tag LOCUS_29540 21794 20607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 22737 21952 gene locus_tag LOCUS_29550 22737 21952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 22618 22851 gene locus_tag LOCUS_29560 22618 22851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 23405 24799 gene locus_tag LOCUS_29570 23405 24799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 24806 25747 gene locus_tag LOCUS_29580 24806 25747 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729048.1 protein_id gnl|my_center|LOCUS_29580 27576 25771 gene locus_tag LOCUS_29590 27576 25771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 27968 27768 gene locus_tag LOCUS_29600 27968 27768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence056 1766 1479 gene locus_tag LOCUS_29610 1766 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_29610 2198 2025 gene locus_tag LOCUS_29620 2198 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 3449 2256 gene locus_tag LOCUS_29630 3449 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 6766 3950 gene locus_tag LOCUS_29640 6766 3950 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038744192.1 protein_id gnl|my_center|LOCUS_29640 6999 8240 gene locus_tag LOCUS_29650 6999 8240 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968487.1 protein_id gnl|my_center|LOCUS_29650 9008 8466 gene locus_tag LOCUS_29660 9008 8466 CDS product hydrogenase/oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528368.1 protein_id gnl|my_center|LOCUS_29660 10620 9016 gene locus_tag LOCUS_29670 10620 9016 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528369.1 protein_id gnl|my_center|LOCUS_29670 12068 10617 gene locus_tag LOCUS_29680 12068 10617 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_29680 12738 12070 gene locus_tag LOCUS_29690 12738 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_29690 13694 12741 gene locus_tag LOCUS_29700 13694 12741 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_29700 15730 13691 gene locus_tag LOCUS_29710 gene hyfB 15730 13691 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532947.1 protein_id gnl|my_center|LOCUS_29710 16145 15831 gene locus_tag LOCUS_29720 16145 15831 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785422.1 protein_id gnl|my_center|LOCUS_29720 16445 18973 gene locus_tag LOCUS_29730 16445 18973 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_29730 19246 20565 gene locus_tag LOCUS_29740 19246 20565 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036845.1 protein_id gnl|my_center|LOCUS_29740 20575 21129 gene locus_tag LOCUS_29750 20575 21129 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230627.1 protein_id gnl|my_center|LOCUS_29750 21138 23807 gene locus_tag LOCUS_29760 21138 23807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 24094 24276 gene locus_tag LOCUS_29770 24094 24276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 26870 24675 gene locus_tag LOCUS_29780 26870 24675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 27876 26920 gene locus_tag LOCUS_29790 27876 26920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence057 2780 63 gene locus_tag LOCUS_29800 gene mobF 2780 63 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_29800 4785 2788 gene locus_tag LOCUS_29810 4785 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 5192 4782 gene locus_tag LOCUS_29820 5192 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 6427 5306 gene locus_tag LOCUS_29830 gene tadA 6427 5306 CDS product type 4b pilus Flp biogenesis ATPase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103953.1 protein_id gnl|my_center|LOCUS_29830 6871 6482 gene locus_tag LOCUS_29840 6871 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 8094 7408 gene locus_tag LOCUS_29850 8094 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 8956 8105 gene locus_tag LOCUS_29860 8956 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 9763 8972 gene locus_tag LOCUS_29870 9763 8972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 10021 9776 gene locus_tag LOCUS_29880 10021 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 11402 10041 gene locus_tag LOCUS_29890 11402 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 12179 11421 gene locus_tag LOCUS_29900 12179 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 14684 12198 gene locus_tag LOCUS_29910 gene trbE 14684 12198 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090993.1 protein_id gnl|my_center|LOCUS_29910 14970 14671 gene locus_tag LOCUS_29920 14970 14671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 15301 14984 gene locus_tag LOCUS_29930 15301 14984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 15454 15711 gene locus_tag LOCUS_29940 15454 15711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 16221 16601 gene locus_tag LOCUS_29950 16221 16601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 16601 17104 gene locus_tag LOCUS_29960 16601 17104 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 protein_id gnl|my_center|LOCUS_29960 17251 20553 gene locus_tag LOCUS_29970 17251 20553 CDS product DUF4020 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106004657.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29970 20472 20810 gene locus_tag LOCUS_29980 20472 20810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 21990 20998 gene locus_tag LOCUS_29990 21990 20998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 21955 23427 gene locus_tag LOCUS_30000 21955 23427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 23952 25088 gene locus_tag LOCUS_30010 23952 25088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 25094 25185 gene locus_tag LOCUS_t00270 25094 25185 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25604 25302 gene locus_tag LOCUS_30020 25604 25302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 25683 26639 gene locus_tag LOCUS_30030 25683 26639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 26845 27081 gene locus_tag LOCUS_30040 26845 27081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence058 131 1744 gene locus_tag LOCUS_30050 131 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 1752 2189 gene locus_tag LOCUS_30060 1752 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 2374 2619 gene locus_tag LOCUS_30070 2374 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 2907 3218 gene locus_tag LOCUS_30080 2907 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 3502 3759 gene locus_tag LOCUS_30090 3502 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 4186 4623 gene locus_tag LOCUS_30100 4186 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 9041 4620 gene locus_tag LOCUS_30110 9041 4620 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467599.1 protein_id gnl|my_center|LOCUS_30110 9415 9630 gene locus_tag LOCUS_30120 9415 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 10061 9678 gene locus_tag LOCUS_30130 10061 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 10355 10083 gene locus_tag LOCUS_30140 10355 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 11359 14442 gene locus_tag LOCUS_30150 11359 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 14751 14569 gene locus_tag LOCUS_30160 14751 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 15167 14871 gene locus_tag LOCUS_30170 15167 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 15779 15438 gene locus_tag LOCUS_30180 15779 15438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30180 18557 15792 gene locus_tag LOCUS_30190 18557 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30190 19105 20991 gene locus_tag LOCUS_30200 gene pabB 19105 20991 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927074.1 protein_id gnl|my_center|LOCUS_30200 21549 21136 gene locus_tag LOCUS_30210 21549 21136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 21812 21540 gene locus_tag LOCUS_30220 21812 21540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 22538 22407 gene locus_tag LOCUS_30230 22538 22407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 22709 22539 gene locus_tag LOCUS_30240 22709 22539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 22656 23975 gene locus_tag LOCUS_30250 22656 23975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 25180 23900 gene locus_tag LOCUS_30260 25180 23900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 25740 25177 gene locus_tag LOCUS_30270 25740 25177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 >Feature sequence059 203 412 gene locus_tag LOCUS_30280 203 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 464 673 gene locus_tag LOCUS_30290 464 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 1677 1117 gene locus_tag LOCUS_30300 1677 1117 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208128.1 protein_id gnl|my_center|LOCUS_30300 4407 1741 gene locus_tag LOCUS_30310 4407 1741 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404951.1 protein_id gnl|my_center|LOCUS_30310 4902 6206 gene locus_tag LOCUS_30320 4902 6206 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526010.1 protein_id gnl|my_center|LOCUS_30320 6295 7350 gene locus_tag LOCUS_30330 6295 7350 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039520.1 protein_id gnl|my_center|LOCUS_30330 8281 7409 gene locus_tag LOCUS_30340 8281 7409 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921844.1 protein_id gnl|my_center|LOCUS_30340 11665 8282 gene locus_tag LOCUS_30350 11665 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 12208 13512 gene locus_tag LOCUS_30360 12208 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 15208 13685 gene locus_tag LOCUS_30370 15208 13685 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528279.1 protein_id gnl|my_center|LOCUS_30370 16934 16536 gene locus_tag LOCUS_30380 16934 16536 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929155.1 protein_id gnl|my_center|LOCUS_30380 17682 17143 gene locus_tag LOCUS_30390 17682 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 17907 18065 gene locus_tag LOCUS_30400 17907 18065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 18318 18578 gene locus_tag LOCUS_30410 18318 18578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 18741 20297 gene locus_tag LOCUS_30420 18741 20297 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_30420 20352 22484 gene locus_tag LOCUS_30430 20352 22484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 22789 22499 gene locus_tag LOCUS_30440 22789 22499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 23386 23461 gene locus_tag LOCUS_t00280 23386 23461 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23862 23557 gene locus_tag LOCUS_30450 23862 23557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 24322 23795 gene locus_tag LOCUS_30460 24322 23795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 24331 24522 gene locus_tag LOCUS_30470 24331 24522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 25014 24781 gene locus_tag LOCUS_30480 25014 24781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 >Feature sequence060 728 315 gene locus_tag LOCUS_30490 728 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 1090 767 gene locus_tag LOCUS_30500 1090 767 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939100.1 protein_id gnl|my_center|LOCUS_30500 1906 1157 gene locus_tag LOCUS_30510 1906 1157 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_30510 3560 1899 gene locus_tag LOCUS_30520 gene ctaD 3560 1899 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258008.1 protein_id gnl|my_center|LOCUS_30520 4630 3557 gene locus_tag LOCUS_30530 gene coxB 4630 3557 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_30530 5509 4637 gene locus_tag LOCUS_30540 5509 4637 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_30540 6288 5563 gene locus_tag LOCUS_30550 6288 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 7564 6275 gene locus_tag LOCUS_30560 7564 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_30560 8338 7568 gene locus_tag LOCUS_30570 8338 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 8894 8343 gene locus_tag LOCUS_30580 8894 8343 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_30580 10318 8894 gene locus_tag LOCUS_30590 gene nrfD 10318 8894 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_30590 13660 10400 gene locus_tag LOCUS_30600 13660 10400 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_30600 14562 13657 gene locus_tag LOCUS_30610 14562 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 14819 15580 gene locus_tag LOCUS_30620 14819 15580 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064359.1 protein_id gnl|my_center|LOCUS_30620 15577 18036 gene locus_tag LOCUS_30630 15577 18036 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257049.1 protein_id gnl|my_center|LOCUS_30630 18238 18065 gene locus_tag LOCUS_30640 18238 18065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 18918 18235 gene locus_tag LOCUS_30650 18918 18235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 19193 18915 gene locus_tag LOCUS_30660 19193 18915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 19549 19196 gene locus_tag LOCUS_30670 19549 19196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 19826 19647 gene locus_tag LOCUS_30680 19826 19647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 19896 20312 gene locus_tag LOCUS_30690 19896 20312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30690 21536 20397 gene locus_tag LOCUS_30700 21536 20397 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640051.1 protein_id gnl|my_center|LOCUS_30700 22806 21613 gene locus_tag LOCUS_30710 gene hpnI 22806 21613 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941358.1 protein_id gnl|my_center|LOCUS_30710 22958 23191 gene locus_tag LOCUS_30720 22958 23191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 23349 23546 gene locus_tag LOCUS_30730 23349 23546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 <24573 23650 gene locus_tag LOCUS_30740 <24573 23650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057223.1:ABC transporter permease >Feature sequence061 425 799 gene locus_tag LOCUS_30750 425 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 1441 2025 gene locus_tag LOCUS_30760 1441 2025 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545395.1 protein_id gnl|my_center|LOCUS_30760 2065 3684 gene locus_tag LOCUS_30770 gene nusA 2065 3684 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083607.1 protein_id gnl|my_center|LOCUS_30770 4856 5005 gene locus_tag LOCUS_30780 4856 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 5116 7011 gene locus_tag LOCUS_30790 5116 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 8287 7040 gene locus_tag LOCUS_30800 8287 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 8605 10230 gene locus_tag LOCUS_30810 8605 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 10888 10238 gene locus_tag LOCUS_30820 10888 10238 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_30820 11634 10888 gene locus_tag LOCUS_30830 11634 10888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 13022 11646 gene locus_tag LOCUS_30840 gene ffh 13022 11646 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946149.1 protein_id gnl|my_center|LOCUS_30840 15180 13066 gene locus_tag LOCUS_30850 gene prlC 15180 13066 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 protein_id gnl|my_center|LOCUS_30850 15806 15300 gene locus_tag LOCUS_30860 15806 15300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 16019 16276 gene locus_tag LOCUS_30870 16019 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 17085 16315 gene locus_tag LOCUS_30880 17085 16315 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_30880 18604 17225 gene locus_tag LOCUS_30890 18604 17225 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393835.1 protein_id gnl|my_center|LOCUS_30890 18902 20611 gene locus_tag LOCUS_30900 18902 20611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 20844 22412 gene locus_tag LOCUS_30910 20844 22412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 22521 22596 gene locus_tag LOCUS_t00290 22521 22596 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 23579 22614 gene locus_tag LOCUS_30920 23579 22614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 24024 23773 gene locus_tag LOCUS_30930 24024 23773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 >Feature sequence062 194 1147 gene locus_tag LOCUS_30940 194 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 2496 1363 gene locus_tag LOCUS_30950 2496 1363 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392821.1 protein_id gnl|my_center|LOCUS_30950 3823 2507 gene locus_tag LOCUS_30960 3823 2507 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_30960 4451 4095 gene locus_tag LOCUS_30970 4451 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 4517 5542 gene locus_tag LOCUS_30980 4517 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 5654 7489 gene locus_tag LOCUS_30990 5654 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 9052 7838 gene locus_tag LOCUS_31000 9052 7838 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027774.1 protein_id gnl|my_center|LOCUS_31000 9189 9818 gene locus_tag LOCUS_31010 9189 9818 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529467.1 protein_id gnl|my_center|LOCUS_31010 9904 12282 gene locus_tag LOCUS_31020 9904 12282 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918421.1 protein_id gnl|my_center|LOCUS_31020 12527 16207 gene locus_tag LOCUS_31030 12527 16207 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941263.1 protein_id gnl|my_center|LOCUS_31030 16226 16396 gene locus_tag LOCUS_31040 16226 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 16639 18584 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq actagggatggccgggattcaccgctcaagtacact 18973 18635 gene locus_tag LOCUS_31050 gene cas2 18973 18635 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 protein_id gnl|my_center|LOCUS_31050 19963 18983 gene locus_tag LOCUS_31060 gene cas1 19963 18983 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_31060 23198 19956 gene locus_tag LOCUS_31070 gene cas9 23198 19956 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_31070 23969 23355 gene locus_tag LOCUS_31080 23969 23355 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence063 455 1540 gene locus_tag LOCUS_31090 455 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 3250 1862 gene locus_tag LOCUS_31100 3250 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 4536 3250 gene locus_tag LOCUS_31110 4536 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 4994 4539 gene locus_tag LOCUS_31120 4994 4539 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226054.1 protein_id gnl|my_center|LOCUS_31120 6845 5007 gene locus_tag LOCUS_31130 6845 5007 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_31130 7400 6993 gene locus_tag LOCUS_31140 7400 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 8732 7413 gene locus_tag LOCUS_31150 8732 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 10242 8842 gene locus_tag LOCUS_31160 10242 8842 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_31160 11255 10239 gene locus_tag LOCUS_31170 11255 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31170 11631 11434 gene locus_tag LOCUS_31180 11631 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 12856 11738 gene locus_tag LOCUS_31190 12856 11738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_31190 13971 12856 gene locus_tag LOCUS_31200 13971 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 15701 13968 gene locus_tag LOCUS_31210 15701 13968 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 protein_id gnl|my_center|LOCUS_31210 16788 15703 gene locus_tag LOCUS_31220 16788 15703 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_31220 18217 16820 gene locus_tag LOCUS_31230 gene tolC 18217 16820 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735274.1 protein_id gnl|my_center|LOCUS_31230 18541 18350 gene locus_tag LOCUS_31240 18541 18350 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_31240 19689 18607 gene locus_tag LOCUS_31250 19689 18607 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933388.1 protein_id gnl|my_center|LOCUS_31250 20589 19747 gene locus_tag LOCUS_31260 20589 19747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 20879 20586 gene locus_tag LOCUS_31270 20879 20586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 21339 21536 gene locus_tag LOCUS_31280 21339 21536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 21511 22179 gene locus_tag LOCUS_31290 21511 22179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 23483 22776 gene locus_tag LOCUS_31300 23483 22776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence064 585 974 gene locus_tag LOCUS_31310 585 974 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003678450.1 protein_id gnl|my_center|LOCUS_31310 1070 1462 gene locus_tag LOCUS_31320 1070 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 1470 1727 gene locus_tag LOCUS_31330 1470 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 2007 2291 gene locus_tag LOCUS_31340 2007 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 2314 3003 gene locus_tag LOCUS_31350 2314 3003 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064970.1 protein_id gnl|my_center|LOCUS_31350 3000 4619 gene locus_tag LOCUS_31360 3000 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 4627 5292 gene locus_tag LOCUS_31370 4627 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 5733 6002 gene locus_tag LOCUS_31380 5733 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 6046 6357 gene locus_tag LOCUS_31390 6046 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 6344 8812 gene locus_tag LOCUS_31400 6344 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 8821 9573 gene locus_tag LOCUS_31410 8821 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 9582 10853 gene locus_tag LOCUS_31420 9582 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 11090 11905 gene locus_tag LOCUS_31430 11090 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 11923 12744 gene locus_tag LOCUS_31440 11923 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 12750 13427 gene locus_tag LOCUS_31450 12750 13427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 13431 13823 gene locus_tag LOCUS_31460 13431 13823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 13820 15376 gene locus_tag LOCUS_31470 13820 15376 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186448606.1 protein_id gnl|my_center|LOCUS_31470 15739 15485 gene locus_tag LOCUS_31480 15739 15485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 15926 16369 gene locus_tag LOCUS_31490 15926 16369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 16402 16800 gene locus_tag LOCUS_31500 16402 16800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 17006 16797 gene locus_tag LOCUS_31510 17006 16797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 16899 17195 gene locus_tag LOCUS_31520 16899 17195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 17143 17463 gene locus_tag LOCUS_31530 17143 17463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 17463 18518 gene locus_tag LOCUS_31540 17463 18518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 18515 19372 gene locus_tag LOCUS_31550 18515 19372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 19664 19972 gene locus_tag LOCUS_31560 19664 19972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 19989 22028 gene locus_tag LOCUS_31570 19989 22028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 22025 22945 gene locus_tag LOCUS_31580 22025 22945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 >Feature sequence065 205 1800 gene locus_tag LOCUS_31590 gene pckA 205 1800 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_31590 1807 2094 gene locus_tag LOCUS_31600 1807 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 2447 2223 gene locus_tag LOCUS_31610 2447 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 3777 2464 gene locus_tag LOCUS_31620 3777 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3950 3768 gene locus_tag LOCUS_31630 3950 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 4303 4578 gene locus_tag LOCUS_31640 4303 4578 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886866.1 protein_id gnl|my_center|LOCUS_31640 4634 4873 gene locus_tag LOCUS_31650 4634 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 7615 4964 gene locus_tag LOCUS_31660 7615 4964 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929460.1 protein_id gnl|my_center|LOCUS_31660 8263 7853 gene locus_tag LOCUS_31670 8263 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 8783 10138 gene locus_tag LOCUS_31680 8783 10138 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_31680 11345 10218 gene locus_tag LOCUS_31690 11345 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 12653 12369 gene locus_tag LOCUS_31700 12653 12369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 15076 12899 gene locus_tag LOCUS_31710 gene prlC 15076 12899 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_31710 15348 16913 gene locus_tag LOCUS_31720 gene aroE 15348 16913 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_31720 16915 17418 gene locus_tag LOCUS_31730 16915 17418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 17671 17462 gene locus_tag LOCUS_31740 17671 17462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 17793 18539 gene locus_tag LOCUS_31750 17793 18539 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230355.1 protein_id gnl|my_center|LOCUS_31750 19366 18710 gene locus_tag LOCUS_31760 gene pgsA 19366 18710 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_31760 21473 19518 gene locus_tag LOCUS_31770 21473 19518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 22562 21567 gene locus_tag LOCUS_31780 22562 21567 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399008.1 protein_id gnl|my_center|LOCUS_31780 >Feature sequence066 338 1399 gene locus_tag LOCUS_31790 338 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1474 1923 gene locus_tag LOCUS_31800 1474 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 2150 3034 gene locus_tag LOCUS_31810 2150 3034 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113650.1 protein_id gnl|my_center|LOCUS_31810 4685 3090 gene locus_tag LOCUS_31820 4685 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 5355 4813 gene locus_tag LOCUS_31830 5355 4813 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_31830 5683 5360 gene locus_tag LOCUS_31840 5683 5360 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_31840 6017 5733 gene locus_tag LOCUS_31850 6017 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 6650 6090 gene locus_tag LOCUS_31860 gene efp 6650 6090 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226377.1 protein_id gnl|my_center|LOCUS_31860 7659 6790 gene locus_tag LOCUS_31870 7659 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980443.1 protein_id gnl|my_center|LOCUS_31870 8181 7828 gene locus_tag LOCUS_31880 8181 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 8565 10292 gene locus_tag LOCUS_31890 8565 10292 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948656.1 protein_id gnl|my_center|LOCUS_31890 10338 10532 gene locus_tag LOCUS_31900 10338 10532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 11612 10482 gene locus_tag LOCUS_31910 11612 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 12234 11617 gene locus_tag LOCUS_31920 12234 11617 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_31920 12539 12231 gene locus_tag LOCUS_31930 12539 12231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 12822 12523 gene locus_tag LOCUS_31940 12822 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 13898 13176 gene locus_tag LOCUS_31950 13898 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 15395 13899 gene locus_tag LOCUS_31960 gene trpE 15395 13899 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_31960 15668 16399 gene locus_tag LOCUS_31970 15668 16399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 16790 16578 gene locus_tag LOCUS_31980 16790 16578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 16884 17672 gene locus_tag LOCUS_31990 16884 17672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 17665 18234 gene locus_tag LOCUS_32000 17665 18234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230935.1 protein_id gnl|my_center|LOCUS_32000 18241 18654 gene locus_tag LOCUS_32010 18241 18654 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537487.1 protein_id gnl|my_center|LOCUS_32010 19402 18683 gene locus_tag LOCUS_32020 19402 18683 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072507.1 protein_id gnl|my_center|LOCUS_32020 19811 20542 gene locus_tag LOCUS_32030 19811 20542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 20871 22136 gene locus_tag LOCUS_32040 20871 22136 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_32040 >Feature sequence067 682 924 gene locus_tag LOCUS_32050 682 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 941 1750 gene locus_tag LOCUS_32060 941 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 1766 2620 gene locus_tag LOCUS_32070 1766 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 2634 3323 gene locus_tag LOCUS_32080 2634 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 3357 3770 gene locus_tag LOCUS_32090 3357 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 3809 4198 gene locus_tag LOCUS_32100 3809 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 4266 5249 gene locus_tag LOCUS_32110 4266 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 5472 5810 gene locus_tag LOCUS_32120 5472 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 6078 6362 gene locus_tag LOCUS_32130 6078 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 6367 8352 gene locus_tag LOCUS_32140 6367 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 8356 11076 gene locus_tag LOCUS_32150 gene mobF 8356 11076 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_32150 11154 11306 gene locus_tag LOCUS_32160 11154 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 12018 11425 gene locus_tag LOCUS_32170 12018 11425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 13026 12529 gene locus_tag LOCUS_32180 13026 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 13451 13023 gene locus_tag LOCUS_32190 13451 13023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 15768 13687 gene locus_tag LOCUS_32200 15768 13687 CDS product isoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120158.1 protein_id gnl|my_center|LOCUS_32200 17696 15855 gene locus_tag LOCUS_32210 gene glgP 17696 15855 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869295.1 protein_id gnl|my_center|LOCUS_32210 18002 17772 gene locus_tag LOCUS_32220 18002 17772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 18614 18054 gene locus_tag LOCUS_32230 18614 18054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 19918 18992 gene locus_tag LOCUS_32240 gene pfkA 19918 18992 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_32240 20624 20202 gene locus_tag LOCUS_32250 20624 20202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 21308 20910 gene locus_tag LOCUS_32260 21308 20910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 <22450 21837 gene locus_tag LOCUS_32270 <22450 21837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930426.1:sigma-54 dependent transcriptional regulator >Feature sequence068 488 2512 gene locus_tag LOCUS_32280 488 2512 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_32280 2988 2596 gene locus_tag LOCUS_32290 2988 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 3198 3004 gene locus_tag LOCUS_32300 3198 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 3446 4828 gene locus_tag LOCUS_32310 3446 4828 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222156.1 protein_id gnl|my_center|LOCUS_32310 4863 5690 gene locus_tag LOCUS_32320 4863 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 8000 5760 gene locus_tag LOCUS_32330 8000 5760 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_32330 9474 8263 gene locus_tag LOCUS_32340 gene mqnE 9474 8263 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_32340 9571 10143 gene locus_tag LOCUS_32350 9571 10143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 10720 10169 gene locus_tag LOCUS_32360 10720 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 12850 10841 gene locus_tag LOCUS_32370 12850 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 14763 13000 gene locus_tag LOCUS_32380 14763 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 15620 15042 gene locus_tag LOCUS_32390 15620 15042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 18231 15769 gene locus_tag LOCUS_32400 18231 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_32400 18574 20721 gene locus_tag LOCUS_32410 gene fusA 18574 20721 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_32410 20972 21394 gene locus_tag LOCUS_32420 20972 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 >Feature sequence069 36 1502 gene locus_tag LOCUS_32430 36 1502 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_32430 1499 2161 gene locus_tag LOCUS_32440 1499 2161 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850688.1 protein_id gnl|my_center|LOCUS_32440 2505 2867 gene locus_tag LOCUS_32450 2505 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 3721 2903 gene locus_tag LOCUS_32460 3721 2903 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_32460 4882 3773 gene locus_tag LOCUS_32470 gene rfbG 4882 3773 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 protein_id gnl|my_center|LOCUS_32470 5541 5110 gene locus_tag LOCUS_32480 5541 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 5955 7685 gene locus_tag LOCUS_32490 5955 7685 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839978.1 protein_id gnl|my_center|LOCUS_32490 7838 8908 gene locus_tag LOCUS_32500 gene gmd 7838 8908 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_32500 8859 9065 gene locus_tag LOCUS_32510 8859 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 9226 9420 gene locus_tag LOCUS_32520 9226 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 10492 9488 gene locus_tag LOCUS_32530 10492 9488 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693667.1 protein_id gnl|my_center|LOCUS_32530 10826 10599 gene locus_tag LOCUS_32540 10826 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 12581 10860 gene locus_tag LOCUS_32550 12581 10860 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_32550 12963 12634 gene locus_tag LOCUS_32560 12963 12634 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039139.1 protein_id gnl|my_center|LOCUS_32560 13994 13047 gene locus_tag LOCUS_32570 13994 13047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 15302 14067 gene locus_tag LOCUS_32580 15302 14067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_32580 15640 15873 gene locus_tag LOCUS_32590 15640 15873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 15864 16244 gene locus_tag LOCUS_32600 15864 16244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 16587 20267 gene locus_tag LOCUS_32610 16587 20267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 20381 21361 gene locus_tag LOCUS_32620 20381 21361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 >Feature sequence070 527 306 gene locus_tag LOCUS_32630 527 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 754 536 gene locus_tag LOCUS_32640 754 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 1263 730 gene locus_tag LOCUS_32650 1263 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 1493 1263 gene locus_tag LOCUS_32660 1493 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 1786 1496 gene locus_tag LOCUS_32670 1786 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 2208 1816 gene locus_tag LOCUS_32680 2208 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 3886 2429 gene locus_tag LOCUS_32690 3886 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 5568 3883 gene locus_tag LOCUS_32700 5568 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 6986 5565 gene locus_tag LOCUS_32710 6986 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 8384 6990 gene locus_tag LOCUS_32720 8384 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 8838 8386 gene locus_tag LOCUS_32730 8838 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 9041 8835 gene locus_tag LOCUS_32740 9041 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 9252 9004 gene locus_tag LOCUS_32750 9252 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 11020 10448 gene locus_tag LOCUS_32760 11020 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 12459 11020 gene locus_tag LOCUS_32770 12459 11020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 13502 12525 gene locus_tag LOCUS_32780 13502 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 14009 13506 gene locus_tag LOCUS_32790 14009 13506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 14212 14012 gene locus_tag LOCUS_32800 14212 14012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 14998 14261 gene locus_tag LOCUS_32810 14998 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 16250 15003 gene locus_tag LOCUS_32820 16250 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 17231 16251 gene locus_tag LOCUS_32830 17231 16251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 19327 17240 gene locus_tag LOCUS_32840 19327 17240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 19892 19308 gene locus_tag LOCUS_32850 19892 19308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 20040 19879 gene locus_tag LOCUS_32860 20040 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 20309 20043 gene locus_tag LOCUS_32870 20309 20043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 20511 20311 gene locus_tag LOCUS_32880 20511 20311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 <21394 20513 gene locus_tag LOCUS_32890 <21394 20513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014580143.1:PBSX family phage terminase large subunit >Feature sequence071 3088 314 gene locus_tag LOCUS_32900 gene mobF 3088 314 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_32900 4346 3126 gene locus_tag LOCUS_32910 4346 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 4759 4457 gene locus_tag LOCUS_32920 4759 4457 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967243.1 protein_id gnl|my_center|LOCUS_32920 5059 4763 gene locus_tag LOCUS_32930 5059 4763 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067437.1 protein_id gnl|my_center|LOCUS_32930 7083 5107 gene locus_tag LOCUS_32940 7083 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 7505 7080 gene locus_tag LOCUS_32950 7505 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 7613 7780 gene locus_tag LOCUS_32960 7613 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 8081 7857 gene locus_tag LOCUS_32970 8081 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 8379 8095 gene locus_tag LOCUS_32980 8379 8095 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_32980 10030 8990 gene locus_tag LOCUS_32990 10030 8990 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387740.1 protein_id gnl|my_center|LOCUS_32990 10309 10043 gene locus_tag LOCUS_33000 10309 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 10952 10296 gene locus_tag LOCUS_33010 10952 10296 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090916.1 protein_id gnl|my_center|LOCUS_33010 11071 11472 gene locus_tag LOCUS_33020 11071 11472 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969959.1 protein_id gnl|my_center|LOCUS_33020 11453 11782 gene locus_tag LOCUS_33030 11453 11782 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969960.1 protein_id gnl|my_center|LOCUS_33030 11947 12243 gene locus_tag LOCUS_33040 11947 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 12246 12647 gene locus_tag LOCUS_33050 12246 12647 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817440.1 protein_id gnl|my_center|LOCUS_33050 12708 12992 gene locus_tag LOCUS_33060 12708 12992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 13958 13005 gene locus_tag LOCUS_33070 13958 13005 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_33070 14122 13958 gene locus_tag LOCUS_33080 14122 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 16081 15647 gene locus_tag LOCUS_33090 16081 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 16925 16677 gene locus_tag LOCUS_33100 16925 16677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 17842 17024 gene locus_tag LOCUS_33110 17842 17024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 20051 18480 gene locus_tag LOCUS_33120 20051 18480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 21045 20134 gene locus_tag LOCUS_33130 21045 20134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 >Feature sequence072 1885 641 gene locus_tag LOCUS_33140 1885 641 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391568.1 protein_id gnl|my_center|LOCUS_33140 1981 2451 gene locus_tag LOCUS_33150 1981 2451 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_33150 2592 3671 gene locus_tag LOCUS_33160 2592 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 4467 3727 gene locus_tag LOCUS_33170 4467 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 4690 5286 gene locus_tag LOCUS_33180 gene rpoE 4690 5286 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_33180 5330 6316 gene locus_tag LOCUS_33190 5330 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 6721 7488 gene locus_tag LOCUS_33200 6721 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 8793 7528 gene locus_tag LOCUS_33210 8793 7528 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089309.1 protein_id gnl|my_center|LOCUS_33210 12070 8993 gene locus_tag LOCUS_33220 12070 8993 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085816.1 protein_id gnl|my_center|LOCUS_33220 13151 12072 gene locus_tag LOCUS_33230 13151 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 14413 13148 gene locus_tag LOCUS_33240 14413 13148 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020595682.1 protein_id gnl|my_center|LOCUS_33240 15597 15355 gene locus_tag LOCUS_33250 15597 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 15964 16899 gene locus_tag LOCUS_33260 15964 16899 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162927877.1 protein_id gnl|my_center|LOCUS_33260 16920 17606 gene locus_tag LOCUS_33270 gene coaE 16920 17606 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393338.1 protein_id gnl|my_center|LOCUS_33270 17775 18977 gene locus_tag LOCUS_33280 17775 18977 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583661.1 protein_id gnl|my_center|LOCUS_33280 20264 19065 gene locus_tag LOCUS_33290 gene fdhA 20264 19065 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523135.1 protein_id gnl|my_center|LOCUS_33290 20649 20281 gene locus_tag LOCUS_33300 20649 20281 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence073 1441 188 gene locus_tag LOCUS_33310 1441 188 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_33310 3872 1575 gene locus_tag LOCUS_33320 3872 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 4012 5280 gene locus_tag LOCUS_33330 4012 5280 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 protein_id gnl|my_center|LOCUS_33330 5962 5411 gene locus_tag LOCUS_33340 5962 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 7052 5955 gene locus_tag LOCUS_33350 7052 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 10034 7374 gene locus_tag LOCUS_33360 10034 7374 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_33360 11334 10327 gene locus_tag LOCUS_33370 gene ahr 11334 10327 CDS product NADPH-dependent aldehyde reductase Ahr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061766.1 protein_id gnl|my_center|LOCUS_33370 13254 11422 gene locus_tag LOCUS_33380 13254 11422 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_33380 13443 15314 gene locus_tag LOCUS_33390 13443 15314 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804055.1 protein_id gnl|my_center|LOCUS_33390 15336 15602 gene locus_tag LOCUS_33400 15336 15602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 16900 15626 gene locus_tag LOCUS_33410 16900 15626 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_33410 17097 16924 gene locus_tag LOCUS_33420 17097 16924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 17226 18107 gene locus_tag LOCUS_33430 17226 18107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 18111 18881 gene locus_tag LOCUS_33440 18111 18881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 18897 19985 gene locus_tag LOCUS_33450 18897 19985 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_33450 >Feature sequence074 862 335 gene locus_tag LOCUS_33460 gene accB 862 335 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522044.1 protein_id gnl|my_center|LOCUS_33460 2067 1006 gene locus_tag LOCUS_33470 2067 1006 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_33470 3384 2182 gene locus_tag LOCUS_33480 3384 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899909.1 protein_id gnl|my_center|LOCUS_33480 3741 5513 gene locus_tag LOCUS_33490 3741 5513 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_33490 5532 5924 gene locus_tag LOCUS_33500 5532 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 6969 6031 gene locus_tag LOCUS_33510 6969 6031 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387212.1 protein_id gnl|my_center|LOCUS_33510 7786 7232 gene locus_tag LOCUS_33520 7786 7232 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706187.1 protein_id gnl|my_center|LOCUS_33520 8186 9670 gene locus_tag LOCUS_33530 8186 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 10893 9721 gene locus_tag LOCUS_33540 10893 9721 CDS product phosphatidylinositol-specific phospholipase C1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038314.1 protein_id gnl|my_center|LOCUS_33540 12851 11061 gene locus_tag LOCUS_33550 12851 11061 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_33550 13318 12893 gene locus_tag LOCUS_33560 gene fucU 13318 12893 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 protein_id gnl|my_center|LOCUS_33560 14422 13319 gene locus_tag LOCUS_33570 14422 13319 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631126.1 protein_id gnl|my_center|LOCUS_33570 15441 14419 gene locus_tag LOCUS_33580 15441 14419 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_33580 15534 16553 gene locus_tag LOCUS_33590 15534 16553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 <19307 16908 gene locus_tag LOCUS_33600 <19307 16908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948085.1:magnesium-translocating P-type ATPase >Feature sequence075 1746 220 gene locus_tag LOCUS_33610 gene flgE 1746 220 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_33610 2540 1872 gene locus_tag LOCUS_33620 2540 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 3067 2576 gene locus_tag LOCUS_33630 3067 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 3144 3431 gene locus_tag LOCUS_33640 3144 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 4833 4522 gene locus_tag LOCUS_33650 4833 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 4855 5082 gene locus_tag LOCUS_33660 4855 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 6729 5119 gene locus_tag LOCUS_33670 gene fliI 6729 5119 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_33670 7640 6780 gene locus_tag LOCUS_33680 7640 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 8831 7737 gene locus_tag LOCUS_33690 gene fliG 8831 7737 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870078.1 protein_id gnl|my_center|LOCUS_33690 10583 8916 gene locus_tag LOCUS_33700 gene fliF 10583 8916 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_33700 10935 10600 gene locus_tag LOCUS_33710 10935 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 11460 10999 gene locus_tag LOCUS_33720 gene flgC 11460 10999 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_33720 11919 11497 gene locus_tag LOCUS_33730 11919 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 13491 12079 gene locus_tag LOCUS_33740 13491 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 14238 13555 gene locus_tag LOCUS_33750 14238 13555 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_33750 18326 15087 gene locus_tag LOCUS_33760 18326 15087 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_33760 >Feature sequence076 359 1579 gene locus_tag LOCUS_33770 359 1579 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_33770 2787 1921 gene locus_tag LOCUS_33780 2787 1921 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_33780 3629 2784 gene locus_tag LOCUS_33790 3629 2784 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120708963.1 protein_id gnl|my_center|LOCUS_33790 4173 3688 gene locus_tag LOCUS_33800 4173 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33800 4339 4106 gene locus_tag LOCUS_33810 4339 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33810 4402 4794 gene locus_tag LOCUS_33820 4402 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 5075 5302 gene locus_tag LOCUS_33830 5075 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 6245 6045 gene locus_tag LOCUS_33840 6245 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 6268 6663 gene locus_tag LOCUS_33850 6268 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 10138 7058 gene locus_tag LOCUS_33860 10138 7058 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_33860 10928 10164 gene locus_tag LOCUS_33870 10928 10164 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_33870 11362 10925 gene locus_tag LOCUS_33880 11362 10925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062537442.1 protein_id gnl|my_center|LOCUS_33880 12285 11380 gene locus_tag LOCUS_33890 12285 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 12848 12282 gene locus_tag LOCUS_33900 12848 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 14121 12841 gene locus_tag LOCUS_33910 14121 12841 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103419.1 protein_id gnl|my_center|LOCUS_33910 15226 14111 gene locus_tag LOCUS_33920 gene rhuM 15226 14111 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280585.1 protein_id gnl|my_center|LOCUS_33920 16766 15216 gene locus_tag LOCUS_33930 16766 15216 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_33930 16820 16972 gene locus_tag LOCUS_33940 16820 16972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 18580 16976 gene locus_tag LOCUS_33950 18580 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 >Feature sequence077 137 367 gene locus_tag LOCUS_33960 137 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 2906 423 gene locus_tag LOCUS_33970 2906 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 4217 3108 gene locus_tag LOCUS_33980 4217 3108 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086615.1 protein_id gnl|my_center|LOCUS_33980 7602 4960 gene locus_tag LOCUS_33990 gene gyrB 7602 4960 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_33990 8449 9351 gene locus_tag LOCUS_34000 8449 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 9757 9491 gene locus_tag LOCUS_34010 gene rpmA 9757 9491 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228914.1 protein_id gnl|my_center|LOCUS_34010 10166 9831 gene locus_tag LOCUS_34020 gene rplU 10166 9831 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964569.1 protein_id gnl|my_center|LOCUS_34020 11721 10360 gene locus_tag LOCUS_34030 11721 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 11991 12179 gene locus_tag LOCUS_34040 gene rpmB 11991 12179 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_34040 12517 12248 gene locus_tag LOCUS_34050 12517 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 12498 13544 gene locus_tag LOCUS_34060 12498 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 13774 14823 gene locus_tag LOCUS_34070 13774 14823 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408248.1 protein_id gnl|my_center|LOCUS_34070 14950 15027 gene locus_tag LOCUS_t00300 14950 15027 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16254 15097 gene locus_tag LOCUS_34080 16254 15097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 16871 17824 gene locus_tag LOCUS_34090 16871 17824 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257188.1 protein_id gnl|my_center|LOCUS_34090 18348 17962 gene locus_tag LOCUS_34100 18348 17962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 >Feature sequence078 737 78 gene locus_tag LOCUS_34110 737 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 2546 1182 gene locus_tag LOCUS_34120 2546 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 2899 4452 gene locus_tag LOCUS_34130 2899 4452 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390841.1 protein_id gnl|my_center|LOCUS_34130 4698 6584 gene locus_tag LOCUS_34140 4698 6584 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_34140 7285 6767 gene locus_tag LOCUS_34150 7285 6767 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087107.1 protein_id gnl|my_center|LOCUS_34150 9981 7297 gene locus_tag LOCUS_34160 9981 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 10264 11097 gene locus_tag LOCUS_34170 10264 11097 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932424.1 protein_id gnl|my_center|LOCUS_34170 11099 11473 gene locus_tag LOCUS_34180 11099 11473 CDS product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932425.1 protein_id gnl|my_center|LOCUS_34180 11720 13054 gene locus_tag LOCUS_34190 gene rfbH 11720 13054 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_34190 13051 14685 gene locus_tag LOCUS_34200 13051 14685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 14707 15480 gene locus_tag LOCUS_34210 gene rfbF 14707 15480 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261038.1 protein_id gnl|my_center|LOCUS_34210 15474 16571 gene locus_tag LOCUS_34220 gene rfbG 15474 16571 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_34220 17577 16525 gene locus_tag LOCUS_34230 17577 16525 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061609.1 protein_id gnl|my_center|LOCUS_34230 >Feature sequence079 161 394 gene locus_tag LOCUS_34240 161 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 1956 349 gene locus_tag LOCUS_34250 1956 349 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828465.1 protein_id gnl|my_center|LOCUS_34250 3215 2205 gene locus_tag LOCUS_34260 3215 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34260 3547 3918 gene locus_tag LOCUS_34270 3547 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 4154 3921 gene locus_tag LOCUS_34280 4154 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 5217 4189 gene locus_tag LOCUS_34290 5217 4189 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_34290 7625 5214 gene locus_tag LOCUS_34300 7625 5214 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245994.1 protein_id gnl|my_center|LOCUS_34300 8364 7636 gene locus_tag LOCUS_34310 8364 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 10536 8683 gene locus_tag LOCUS_34320 10536 8683 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038020.1 protein_id gnl|my_center|LOCUS_34320 10821 11588 gene locus_tag LOCUS_34330 10821 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 11591 11893 gene locus_tag LOCUS_34340 11591 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 12085 12567 gene locus_tag LOCUS_34350 12085 12567 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_34350 13288 12581 gene locus_tag LOCUS_34360 13288 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 14287 13316 gene locus_tag LOCUS_34370 gene fabD 14287 13316 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_34370 15325 14297 gene locus_tag LOCUS_34380 gene plsX 15325 14297 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_34380 15524 15336 gene locus_tag LOCUS_34390 gene rpmF 15524 15336 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_34390 16196 15630 gene locus_tag LOCUS_34400 16196 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 16373 16837 gene locus_tag LOCUS_34410 16373 16837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 >Feature sequence080 <1 1220 gene locus_tag LOCUS_34420 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027060.1:twin-arginine translocation signal domain-containing protein 2769 1678 gene locus_tag LOCUS_34430 2769 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 4040 2850 gene locus_tag LOCUS_34440 gene rhaI 4040 2850 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 protein_id gnl|my_center|LOCUS_34440 4558 5814 gene locus_tag LOCUS_34450 gene rhaT 4558 5814 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099333.1 protein_id gnl|my_center|LOCUS_34450 5852 6172 gene locus_tag LOCUS_34460 5852 6172 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978053.1 protein_id gnl|my_center|LOCUS_34460 7036 12804 gene locus_tag LOCUS_34470 7036 12804 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085385.1 protein_id gnl|my_center|LOCUS_34470 12850 14877 gene locus_tag LOCUS_34480 12850 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 15400 16728 gene locus_tag LOCUS_34490 15400 16728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 >Feature sequence081 465 139 gene locus_tag LOCUS_34500 465 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 1427 609 gene locus_tag LOCUS_34510 1427 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 4364 1479 gene locus_tag LOCUS_34520 gene uvrA 4364 1479 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_34520 4627 4785 gene locus_tag LOCUS_34530 4627 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 5460 5071 gene locus_tag LOCUS_34540 5460 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 6018 6665 gene locus_tag LOCUS_34550 gene nox 6018 6665 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227925.1 protein_id gnl|my_center|LOCUS_34550 6765 7268 gene locus_tag LOCUS_34560 6765 7268 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_34560 8474 7329 gene locus_tag LOCUS_34570 8474 7329 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_34570 9383 8481 gene locus_tag LOCUS_34580 9383 8481 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_34580 9751 9386 gene locus_tag LOCUS_34590 9751 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 10052 9804 gene locus_tag LOCUS_34600 10052 9804 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143788.1 protein_id gnl|my_center|LOCUS_34600 10686 10129 gene locus_tag LOCUS_34610 10686 10129 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_34610 11792 10950 gene locus_tag LOCUS_34620 11792 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 12830 11844 gene locus_tag LOCUS_34630 12830 11844 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 protein_id gnl|my_center|LOCUS_34630 12884 13327 gene locus_tag LOCUS_34640 12884 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 13269 13463 gene locus_tag LOCUS_34650 13269 13463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 14315 13584 gene locus_tag LOCUS_34660 14315 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 15087 14569 gene locus_tag LOCUS_34670 15087 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 <16702 15566 gene locus_tag LOCUS_34680 <16702 15566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545192.1:chaperonin GroEL >Feature sequence082 304 2577 gene locus_tag LOCUS_34690 304 2577 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_34690 2574 3932 gene locus_tag LOCUS_34700 2574 3932 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_34700 5057 3948 gene locus_tag LOCUS_34710 gene era 5057 3948 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_34710 6506 5097 gene locus_tag LOCUS_34720 6506 5097 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225277.1 protein_id gnl|my_center|LOCUS_34720 6732 9563 gene locus_tag LOCUS_34730 6732 9563 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_34730 9711 10880 gene locus_tag LOCUS_34740 gene acdA 9711 10880 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_34740 11152 10910 gene locus_tag LOCUS_34750 11152 10910 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_34750 13103 11139 gene locus_tag LOCUS_34760 13103 11139 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_34760 13382 13182 gene locus_tag LOCUS_34770 13382 13182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 13410 14738 gene locus_tag LOCUS_34780 13410 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 14834 15550 gene locus_tag LOCUS_34790 gene bshB1 14834 15550 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228508.1 protein_id gnl|my_center|LOCUS_34790 15974 15582 gene locus_tag LOCUS_34800 15974 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 >Feature sequence083 1063 677 gene locus_tag LOCUS_34810 1063 677 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189219.1 protein_id gnl|my_center|LOCUS_34810 2568 1114 gene locus_tag LOCUS_34820 2568 1114 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550877.1 protein_id gnl|my_center|LOCUS_34820 2685 3983 gene locus_tag LOCUS_34830 2685 3983 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550878.1 protein_id gnl|my_center|LOCUS_34830 4531 4073 gene locus_tag LOCUS_34840 4531 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 6841 4676 gene locus_tag LOCUS_34850 6841 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 7317 6838 gene locus_tag LOCUS_34860 7317 6838 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_34860 10256 7449 gene locus_tag LOCUS_34870 10256 7449 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_34870 10653 10294 gene locus_tag LOCUS_34880 10653 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 11581 10805 gene locus_tag LOCUS_34890 11581 10805 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612357.1 protein_id gnl|my_center|LOCUS_34890 11768 12409 gene locus_tag LOCUS_34900 gene cynT 11768 12409 CDS product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658640.1 protein_id gnl|my_center|LOCUS_34900 12892 12422 gene locus_tag LOCUS_34910 12892 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 14476 13061 gene locus_tag LOCUS_34920 14476 13061 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143837.1 protein_id gnl|my_center|LOCUS_34920 >Feature sequence084 2441 336 gene locus_tag LOCUS_34930 2441 336 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_34930 3690 2614 gene locus_tag LOCUS_34940 3690 2614 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_34940 4385 3897 gene locus_tag LOCUS_34950 gene acpS 4385 3897 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211568.1 protein_id gnl|my_center|LOCUS_34950 6645 4363 gene locus_tag LOCUS_34960 gene recG 6645 4363 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_34960 6989 7420 gene locus_tag LOCUS_34970 6989 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 7730 8224 gene locus_tag LOCUS_34980 7730 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 8793 9695 gene locus_tag LOCUS_34990 8793 9695 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_34990 9688 10977 gene locus_tag LOCUS_35000 9688 10977 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_35000 11203 12027 gene locus_tag LOCUS_35010 11203 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 12334 12993 gene locus_tag LOCUS_35020 12334 12993 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_35020 14016 13189 gene locus_tag LOCUS_35030 14016 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 14627 14046 gene locus_tag LOCUS_35040 14627 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 15439 14630 gene locus_tag LOCUS_35050 15439 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 >Feature sequence085 1626 355 gene locus_tag LOCUS_35060 1626 355 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_35060 2651 1641 gene locus_tag LOCUS_35070 2651 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 3771 2770 gene locus_tag LOCUS_35080 3771 2770 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_35080 5179 3818 gene locus_tag LOCUS_35090 5179 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 8488 5222 gene locus_tag LOCUS_35100 8488 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 8953 9213 gene locus_tag LOCUS_35110 8953 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 9237 9392 gene locus_tag LOCUS_35120 9237 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 9553 9918 gene locus_tag LOCUS_35130 9553 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 10438 11340 gene locus_tag LOCUS_35140 gene cytR 10438 11340 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 protein_id gnl|my_center|LOCUS_35140 11998 11570 gene locus_tag LOCUS_35150 11998 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35150 12326 12012 gene locus_tag LOCUS_35160 12326 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 13785 12697 gene locus_tag LOCUS_35170 13785 12697 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762549.1 protein_id gnl|my_center|LOCUS_35170 14816 13872 gene locus_tag LOCUS_35180 14816 13872 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_35180 >Feature sequence086 1567 1325 gene locus_tag LOCUS_35190 1567 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 4955 1572 gene locus_tag LOCUS_35200 4955 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 5133 7811 gene locus_tag LOCUS_35210 5133 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 7863 8189 gene locus_tag LOCUS_35220 7863 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 8567 8289 gene locus_tag LOCUS_35230 8567 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35230 9046 8639 gene locus_tag LOCUS_35240 9046 8639 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403882.1 protein_id gnl|my_center|LOCUS_35240 9731 9644 gene locus_tag LOCUS_t00310 9731 9644 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10093 11103 gene locus_tag LOCUS_35250 10093 11103 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_35250 11148 12116 gene locus_tag LOCUS_35260 11148 12116 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_35260 13181 12318 gene locus_tag LOCUS_35270 13181 12318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 14180 13386 gene locus_tag LOCUS_35280 14180 13386 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 protein_id gnl|my_center|LOCUS_35280 14906 14208 gene locus_tag LOCUS_35290 gene purQ 14906 14208 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_35290 15073 15513 gene locus_tag LOCUS_35300 15073 15513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence087 168 1856 gene locus_tag LOCUS_35310 168 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 1975 4776 gene locus_tag LOCUS_35320 1975 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 7134 4927 gene locus_tag LOCUS_35330 7134 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 7700 9991 gene locus_tag LOCUS_35340 7700 9991 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178933861.1 protein_id gnl|my_center|LOCUS_35340 10387 11610 gene locus_tag LOCUS_35350 10387 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 11836 11920 gene locus_tag LOCUS_t00320 11836 11920 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13188 12973 gene locus_tag LOCUS_35360 13188 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 13477 14523 gene locus_tag LOCUS_35370 13477 14523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence088 1232 105 gene locus_tag LOCUS_35380 1232 105 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_35380 2307 1321 gene locus_tag LOCUS_35390 2307 1321 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257709.1 protein_id gnl|my_center|LOCUS_35390 3526 2333 gene locus_tag LOCUS_35400 3526 2333 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_35400 4201 3626 gene locus_tag LOCUS_35410 gene coaD 4201 3626 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545514.1 protein_id gnl|my_center|LOCUS_35410 6726 4207 gene locus_tag LOCUS_35420 6726 4207 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_35420 8089 7004 gene locus_tag LOCUS_35430 gene recA 8089 7004 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_35430 9911 8316 gene locus_tag LOCUS_35440 9911 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 10110 10877 gene locus_tag LOCUS_35450 10110 10877 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_35450 10976 11722 gene locus_tag LOCUS_35460 gene fabG 10976 11722 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_35460 11881 12669 gene locus_tag LOCUS_35470 11881 12669 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_35470 13095 12721 gene locus_tag LOCUS_35480 13095 12721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 13424 13092 gene locus_tag LOCUS_35490 13424 13092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 13965 13528 gene locus_tag LOCUS_35500 13965 13528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 >Feature sequence089 777 1085 gene locus_tag LOCUS_35510 777 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 2593 1343 gene locus_tag LOCUS_35520 2593 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 2911 3372 gene locus_tag LOCUS_35530 2911 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 3566 4507 gene locus_tag LOCUS_35540 3566 4507 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_35540 6013 4640 gene locus_tag LOCUS_35550 6013 4640 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_35550 6238 7173 gene locus_tag LOCUS_35560 gene trxB 6238 7173 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_35560 7184 7903 gene locus_tag LOCUS_35570 7184 7903 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_35570 7900 8241 gene locus_tag LOCUS_35580 gene yggU 7900 8241 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073225.1 protein_id gnl|my_center|LOCUS_35580 8312 9757 gene locus_tag LOCUS_35590 8312 9757 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224493.1 protein_id gnl|my_center|LOCUS_35590 9808 11007 gene locus_tag LOCUS_35600 gene nifS 9808 11007 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_35600 11034 12146 gene locus_tag LOCUS_35610 gene mnmA 11034 12146 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_35610 13174 12218 gene locus_tag LOCUS_35620 13174 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 >Feature sequence090 144 1766 gene locus_tag LOCUS_35630 144 1766 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942185.1 protein_id gnl|my_center|LOCUS_35630 2039 2347 gene locus_tag LOCUS_35640 2039 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 2633 2400 gene locus_tag LOCUS_35650 2633 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 3670 2684 gene locus_tag LOCUS_35660 3670 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 5041 3785 gene locus_tag LOCUS_35670 5041 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 5952 5191 gene locus_tag LOCUS_35680 gene larB 5952 5191 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_35680 7262 5973 gene locus_tag LOCUS_35690 gene larC 7262 5973 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_35690 8160 7324 gene locus_tag LOCUS_35700 gene larE 8160 7324 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_35700 9177 8185 gene locus_tag LOCUS_35710 9177 8185 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141892.1 protein_id gnl|my_center|LOCUS_35710 10227 9253 gene locus_tag LOCUS_35720 10227 9253 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_35720 10395 11579 gene locus_tag LOCUS_35730 10395 11579 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664911.1 protein_id gnl|my_center|LOCUS_35730 12359 11727 gene locus_tag LOCUS_35740 12359 11727 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881398.1 protein_id gnl|my_center|LOCUS_35740 12802 12491 gene locus_tag LOCUS_35750 gene secG 12802 12491 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942271.1 protein_id gnl|my_center|LOCUS_35750 12942 12859 gene locus_tag LOCUS_t00330 12942 12859 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence091 2038 1775 gene locus_tag LOCUS_35760 2038 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 2500 2769 gene locus_tag LOCUS_35770 2500 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 2766 4148 gene locus_tag LOCUS_35780 gene noeA 2766 4148 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127582344.1 protein_id gnl|my_center|LOCUS_35780 4902 4465 gene locus_tag LOCUS_35790 4902 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 5308 5087 gene locus_tag LOCUS_35800 5308 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 6546 5407 gene locus_tag LOCUS_35810 6546 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 6944 6543 gene locus_tag LOCUS_35820 6944 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 7330 7028 gene locus_tag LOCUS_35830 7330 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 9754 7832 gene locus_tag LOCUS_35840 9754 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 10769 9957 gene locus_tag LOCUS_35850 10769 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 10827 11051 gene locus_tag LOCUS_35860 10827 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 11411 11337 gene locus_tag LOCUS_t00340 11411 11337 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence092 129 581 gene locus_tag LOCUS_35870 129 581 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355850.1 protein_id gnl|my_center|LOCUS_35870 1355 687 gene locus_tag LOCUS_35880 1355 687 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140230840.1 protein_id gnl|my_center|LOCUS_35880 1563 2084 gene locus_tag LOCUS_35890 1563 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 3514 2339 gene locus_tag LOCUS_35900 3514 2339 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_35900 5766 3517 gene locus_tag LOCUS_35910 5766 3517 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932893.1 protein_id gnl|my_center|LOCUS_35910 6625 5885 gene locus_tag LOCUS_35920 6625 5885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926963.1 protein_id gnl|my_center|LOCUS_35920 7340 6714 gene locus_tag LOCUS_35930 7340 6714 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_35930 7739 7482 gene locus_tag LOCUS_35940 7739 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 8463 7807 gene locus_tag LOCUS_35950 8463 7807 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 protein_id gnl|my_center|LOCUS_35950 10350 8722 gene locus_tag LOCUS_35960 gene groL 10350 8722 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087406.1 protein_id gnl|my_center|LOCUS_35960 11046 10513 gene locus_tag LOCUS_35970 11046 10513 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_35970 >Feature sequence093 248 997 gene locus_tag LOCUS_35980 248 997 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_35980 1143 1862 gene locus_tag LOCUS_35990 1143 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 1876 2790 gene locus_tag LOCUS_36000 gene ftcD 1876 2790 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681237.1 protein_id gnl|my_center|LOCUS_36000 2948 3907 gene locus_tag LOCUS_36010 2948 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 4526 4047 gene locus_tag LOCUS_36020 gene bfr 4526 4047 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_36020 4660 4584 gene locus_tag LOCUS_t00350 4660 4584 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4931 5590 gene locus_tag LOCUS_36030 4931 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 6390 5515 gene locus_tag LOCUS_36040 6390 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 6709 6437 gene locus_tag LOCUS_36050 6709 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 7311 6799 gene locus_tag LOCUS_36060 7311 6799 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_36060 7366 8433 gene locus_tag LOCUS_36070 7366 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 8515 8922 gene locus_tag LOCUS_36080 8515 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36080 8922 9329 gene locus_tag LOCUS_36090 8922 9329 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_36090 9388 10005 gene locus_tag LOCUS_36100 gene folE 9388 10005 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633832.1 protein_id gnl|my_center|LOCUS_36100 10104 10988 gene locus_tag LOCUS_36110 gene truB 10104 10988 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_36110 11740 10976 gene locus_tag LOCUS_36120 11740 10976 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_36120 >Feature sequence094 1535 210 gene locus_tag LOCUS_36130 1535 210 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811495.1 protein_id gnl|my_center|LOCUS_36130 1770 2708 gene locus_tag LOCUS_36140 gene mutM 1770 2708 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_36140 3819 2920 gene locus_tag LOCUS_36150 3819 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 4192 3875 gene locus_tag LOCUS_36160 4192 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 4653 5273 gene locus_tag LOCUS_36170 4653 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 6406 7419 gene locus_tag LOCUS_36180 6406 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 7887 7549 gene locus_tag LOCUS_36190 7887 7549 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085225.1 protein_id gnl|my_center|LOCUS_36190 9409 8039 gene locus_tag LOCUS_36200 9409 8039 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233175.1 protein_id gnl|my_center|LOCUS_36200 9625 10392 gene locus_tag LOCUS_36210 9625 10392 CDS product type-2 restriction enzyme DpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418960.1 protein_id gnl|my_center|LOCUS_36210 10510 10743 gene locus_tag LOCUS_36220 10510 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 11194 10721 gene locus_tag LOCUS_36230 11194 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 >Feature sequence095 932 174 gene locus_tag LOCUS_36240 932 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 2482 1028 gene locus_tag LOCUS_36250 2482 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 3135 2479 gene locus_tag LOCUS_36260 3135 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 5204 3150 gene locus_tag LOCUS_36270 5204 3150 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_36270 5362 5201 gene locus_tag LOCUS_36280 5362 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 6491 5886 gene locus_tag LOCUS_36290 6491 5886 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 protein_id gnl|my_center|LOCUS_36290 7013 6765 gene locus_tag LOCUS_36300 7013 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 7146 8114 gene locus_tag LOCUS_36310 7146 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 9471 8362 gene locus_tag LOCUS_36320 9471 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 10582 9461 gene locus_tag LOCUS_36330 10582 9461 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 protein_id gnl|my_center|LOCUS_36330 11367 10579 gene locus_tag LOCUS_36340 gene lgt 11367 10579 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772080.1 protein_id gnl|my_center|LOCUS_36340 >Feature sequence096 1966 899 gene locus_tag LOCUS_36350 1966 899 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_36350 3357 2785 gene locus_tag LOCUS_36360 3357 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 4114 3437 gene locus_tag LOCUS_36370 4114 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 6264 4258 gene locus_tag LOCUS_36380 gene pcoA 6264 4258 CDS product multicopper oxidase PcoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925240.1 protein_id gnl|my_center|LOCUS_36380 7688 6915 gene locus_tag LOCUS_36390 7688 6915 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227530.1 protein_id gnl|my_center|LOCUS_36390 8396 8590 gene locus_tag LOCUS_36400 8396 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 8611 9024 gene locus_tag LOCUS_36410 8611 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 9301 9795 gene locus_tag LOCUS_36420 9301 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 9958 10599 gene locus_tag LOCUS_36430 9958 10599 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257034.1 protein_id gnl|my_center|LOCUS_36430 11182 10757 gene locus_tag LOCUS_36440 11182 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 >Feature sequence097 219 863 gene locus_tag LOCUS_36450 219 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 1107 2321 gene locus_tag LOCUS_36460 1107 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 2896 2552 gene locus_tag LOCUS_36470 2896 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36470 3220 3699 gene locus_tag LOCUS_36480 3220 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 4004 3870 gene locus_tag LOCUS_36490 4004 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 4742 7096 gene locus_tag LOCUS_36500 4742 7096 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229634.1 protein_id gnl|my_center|LOCUS_36500 7536 7186 gene locus_tag LOCUS_36510 7536 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 9550 7667 gene locus_tag LOCUS_36520 9550 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 10102 9686 gene locus_tag LOCUS_36530 10102 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 10370 10176 gene locus_tag LOCUS_36540 10370 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 11043 10345 gene locus_tag LOCUS_36550 11043 10345 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36550 >Feature sequence098 236 667 gene locus_tag LOCUS_36560 236 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 697 789 gene locus_tag LOCUS_t00360 697 789 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 984 808 gene locus_tag LOCUS_36570 984 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 1165 2130 gene locus_tag LOCUS_36580 1165 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 2387 3631 gene locus_tag LOCUS_36590 2387 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 3914 4063 gene locus_tag LOCUS_36600 3914 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 4148 4345 gene locus_tag LOCUS_36610 4148 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 5287 4727 gene locus_tag LOCUS_36620 5287 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 6532 5315 gene locus_tag LOCUS_36630 gene qmoC 6532 5315 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545389.1 protein_id gnl|my_center|LOCUS_36630 6866 6549 gene locus_tag LOCUS_36640 6866 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 8914 6896 gene locus_tag LOCUS_36650 8914 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 10296 8953 gene locus_tag LOCUS_36660 10296 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 10799 10293 gene locus_tag LOCUS_36670 10799 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 11163 10909 gene locus_tag LOCUS_36680 11163 10909 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence099 1612 182 gene locus_tag LOCUS_36690 1612 182 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_36690 3062 1719 gene locus_tag LOCUS_36700 3062 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 4301 3618 gene locus_tag LOCUS_36710 4301 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 5235 6314 gene locus_tag LOCUS_36720 5235 6314 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976071.1 protein_id gnl|my_center|LOCUS_36720 7184 7996 gene locus_tag LOCUS_36730 7184 7996 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967027.1 protein_id gnl|my_center|LOCUS_36730 7999 8763 gene locus_tag LOCUS_36740 7999 8763 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_36740 8862 9716 gene locus_tag LOCUS_36750 8862 9716 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528568.1 protein_id gnl|my_center|LOCUS_36750 9819 10868 gene locus_tag LOCUS_36760 gene uxuA 9819 10868 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_36760 >Feature sequence100 888 1610 gene locus_tag LOCUS_36770 888 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 1811 2434 gene locus_tag LOCUS_36780 1811 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 2844 2491 gene locus_tag LOCUS_36790 2844 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 4107 2857 gene locus_tag LOCUS_36800 gene fucP 4107 2857 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_36800 5567 4305 gene locus_tag LOCUS_36810 gene fucP 5567 4305 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_36810 5473 5679 gene locus_tag LOCUS_36820 5473 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 6373 5771 gene locus_tag LOCUS_36830 6373 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070541142.1 protein_id gnl|my_center|LOCUS_36830 7373 6453 gene locus_tag LOCUS_36840 7373 6453 CDS product Kdo hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210901.1 protein_id gnl|my_center|LOCUS_36840 7713 7387 gene locus_tag LOCUS_36850 7713 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 7841 8713 gene locus_tag LOCUS_36860 7841 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 8779 9366 gene locus_tag LOCUS_36870 gene ruvA 8779 9366 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_36870 9809 9414 gene locus_tag LOCUS_36880 9809 9414 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123164.1 protein_id gnl|my_center|LOCUS_36880 10057 10440 gene locus_tag LOCUS_36890 10057 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 10788 10540 gene locus_tag LOCUS_36900 10788 10540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 >Feature sequence101 1025 303 gene locus_tag LOCUS_36910 1025 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 1603 1037 gene locus_tag LOCUS_36920 1603 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 1983 1600 gene locus_tag LOCUS_36930 gene crcB 1983 1600 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258331.1 protein_id gnl|my_center|LOCUS_36930 4082 1980 gene locus_tag LOCUS_36940 4082 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 5471 4167 gene locus_tag LOCUS_36950 gene eno 5471 4167 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142119.1 protein_id gnl|my_center|LOCUS_36950 5682 5464 gene locus_tag LOCUS_36960 5682 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 6154 7101 gene locus_tag LOCUS_36970 6154 7101 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460863.1 protein_id gnl|my_center|LOCUS_36970 7113 7793 gene locus_tag LOCUS_36980 7113 7793 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_36980 7801 9267 gene locus_tag LOCUS_36990 7801 9267 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181950125.1 protein_id gnl|my_center|LOCUS_36990 9264 10757 gene locus_tag LOCUS_37000 9264 10757 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272520.1 protein_id gnl|my_center|LOCUS_37000 >Feature sequence102 373 1281 gene locus_tag LOCUS_37010 373 1281 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838396.1 protein_id gnl|my_center|LOCUS_37010 1792 1487 gene locus_tag LOCUS_37020 1792 1487 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545454.1 protein_id gnl|my_center|LOCUS_37020 2105 1812 gene locus_tag LOCUS_37030 2105 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 2459 2184 gene locus_tag LOCUS_37040 2459 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 3133 2456 gene locus_tag LOCUS_37050 3133 2456 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_37050 3814 3278 gene locus_tag LOCUS_37060 gene cysC 3814 3278 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479712.1 protein_id gnl|my_center|LOCUS_37060 4910 3816 gene locus_tag LOCUS_37070 4910 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 5660 4998 gene locus_tag LOCUS_37080 5660 4998 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946938.1 protein_id gnl|my_center|LOCUS_37080 6266 6012 gene locus_tag LOCUS_37090 6266 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 7161 6532 gene locus_tag LOCUS_37100 7161 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37100 7614 9944 gene locus_tag LOCUS_37110 7614 9944 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942320.1 protein_id gnl|my_center|LOCUS_37110 10051 10179 gene locus_tag LOCUS_37120 10051 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 10449 10213 gene locus_tag LOCUS_37130 10449 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 >Feature sequence103 525 367 gene locus_tag LOCUS_37140 525 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 904 1680 gene locus_tag LOCUS_37150 904 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 1811 2146 gene locus_tag LOCUS_37160 1811 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 5225 2346 gene locus_tag LOCUS_37170 5225 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 6707 5643 gene locus_tag LOCUS_37180 6707 5643 CDS product IS630-like element ISMsm2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003887303.1 protein_id gnl|my_center|LOCUS_37180 7132 6800 gene locus_tag LOCUS_37190 7132 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 7570 7358 gene locus_tag LOCUS_37200 7570 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 8554 8417 gene locus_tag LOCUS_37210 8554 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 8762 8571 gene locus_tag LOCUS_37220 8762 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 9025 8759 gene locus_tag LOCUS_37230 9025 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 >Feature sequence104 290 736 gene locus_tag LOCUS_37240 290 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 801 1262 gene locus_tag LOCUS_37250 801 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 1336 1527 gene locus_tag LOCUS_37260 1336 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 2315 2917 gene locus_tag LOCUS_37270 2315 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37270 2901 3167 gene locus_tag LOCUS_37280 2901 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 3969 4100 gene locus_tag LOCUS_37290 3969 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 4623 4249 gene locus_tag LOCUS_37300 4623 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 5216 4518 gene locus_tag LOCUS_37310 5216 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 5729 5358 gene locus_tag LOCUS_37320 5729 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 5732 6013 gene locus_tag LOCUS_37330 5732 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 7209 6229 gene locus_tag LOCUS_37340 7209 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 7292 7642 gene locus_tag LOCUS_37350 7292 7642 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 protein_id gnl|my_center|LOCUS_37350 7676 7990 gene locus_tag LOCUS_37360 7676 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 8484 8014 gene locus_tag LOCUS_37370 8484 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 8507 9007 gene locus_tag LOCUS_37380 8507 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 9175 9100 gene locus_tag LOCUS_t00370 9175 9100 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9730 10218 gene locus_tag LOCUS_37390 9730 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 >Feature sequence105 211 891 gene locus_tag LOCUS_37400 211 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 980 1699 gene locus_tag LOCUS_37410 980 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 1901 3094 gene locus_tag LOCUS_37420 1901 3094 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161427.1 protein_id gnl|my_center|LOCUS_37420 3095 4474 gene locus_tag LOCUS_37430 3095 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 4561 5007 gene locus_tag LOCUS_37440 4561 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 6138 5029 gene locus_tag LOCUS_37450 6138 5029 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187228.1 protein_id gnl|my_center|LOCUS_37450 6580 6305 gene locus_tag LOCUS_37460 6580 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 6853 6671 gene locus_tag LOCUS_37470 6853 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 7135 7740 gene locus_tag LOCUS_37480 7135 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37480 8976 7777 gene locus_tag LOCUS_37490 8976 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 >Feature sequence106 1903 314 gene locus_tag LOCUS_37500 1903 314 CDS product acyl--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728060.1 protein_id gnl|my_center|LOCUS_37500 3216 1936 gene locus_tag LOCUS_37510 3216 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 6479 4089 gene locus_tag LOCUS_37520 6479 4089 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480098.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37520 7469 6519 gene locus_tag LOCUS_37530 7469 6519 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887615.1 protein_id gnl|my_center|LOCUS_37530 8224 7466 gene locus_tag LOCUS_37540 8224 7466 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887616.1 protein_id gnl|my_center|LOCUS_37540 8423 9601 gene locus_tag LOCUS_37550 gene acdA 8423 9601 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_37550 9944 9642 gene locus_tag LOCUS_37560 9944 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 >Feature sequence107 566 757 gene locus_tag LOCUS_37570 566 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 769 2577 gene locus_tag LOCUS_37580 769 2577 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879160.1 protein_id gnl|my_center|LOCUS_37580 3865 3437 gene locus_tag LOCUS_37590 3865 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 4147 4156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4390 4632 gene locus_tag LOCUS_37600 4390 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 4645 5172 gene locus_tag LOCUS_37610 4645 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 5327 5253 gene locus_tag LOCUS_t00380 5327 5253 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5466 5392 gene locus_tag LOCUS_t00390 5466 5392 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6269 5544 gene locus_tag LOCUS_37620 6269 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 6765 6331 gene locus_tag LOCUS_37630 6765 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 7413 7697 gene locus_tag LOCUS_37640 7413 7697 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023253.1 protein_id gnl|my_center|LOCUS_37640 8090 7743 gene locus_tag LOCUS_37650 8090 7743 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193399.1 protein_id gnl|my_center|LOCUS_37650 8225 8503 gene locus_tag LOCUS_37660 8225 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 8514 8924 gene locus_tag LOCUS_37670 8514 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 8933 9703 gene locus_tag LOCUS_37680 8933 9703 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_37680 >Feature sequence108 448 248 gene locus_tag LOCUS_37690 448 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 447 1565 gene locus_tag LOCUS_37700 447 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 2042 2380 gene locus_tag LOCUS_37710 2042 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 2395 2838 gene locus_tag LOCUS_37720 2395 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 2953 3426 gene locus_tag LOCUS_37730 2953 3426 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_37730 4700 3576 gene locus_tag LOCUS_37740 gene fbp 4700 3576 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228346.1 protein_id gnl|my_center|LOCUS_37740 5100 5750 gene locus_tag LOCUS_37750 5100 5750 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833887.1 protein_id gnl|my_center|LOCUS_37750 5819 6721 gene locus_tag LOCUS_37760 5819 6721 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_37760 8123 6780 gene locus_tag LOCUS_37770 8123 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 9570 8194 gene locus_tag LOCUS_37780 9570 8194 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_37780 >Feature sequence109 521 93 gene locus_tag LOCUS_37790 521 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 3256 539 gene locus_tag LOCUS_37800 gene mobF 3256 539 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_37800 5257 3260 gene locus_tag LOCUS_37810 5257 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 5639 5250 gene locus_tag LOCUS_37820 5639 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 5840 5664 gene locus_tag LOCUS_37830 5840 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 6138 5818 gene locus_tag LOCUS_37840 6138 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 7135 6125 gene locus_tag LOCUS_37850 7135 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 7602 7213 gene locus_tag LOCUS_37860 7602 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 8743 8060 gene locus_tag LOCUS_37870 8743 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 9610 8756 gene locus_tag LOCUS_37880 9610 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 >Feature sequence110 1787 177 gene locus_tag LOCUS_37890 gene hslU 1787 177 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_37890 2366 1836 gene locus_tag LOCUS_37900 gene hslV 2366 1836 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114726.1 protein_id gnl|my_center|LOCUS_37900 2591 3064 gene locus_tag LOCUS_37910 2591 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 3069 4010 gene locus_tag LOCUS_37920 3069 4010 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 protein_id gnl|my_center|LOCUS_37920 4276 4770 gene locus_tag LOCUS_37930 4276 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 4884 5972 gene locus_tag LOCUS_37940 4884 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 6179 7264 gene locus_tag LOCUS_37950 gene prfA 6179 7264 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_37950 7270 8136 gene locus_tag LOCUS_37960 gene prmC 7270 8136 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933153.1 protein_id gnl|my_center|LOCUS_37960 8592 8182 gene locus_tag LOCUS_37970 8592 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 8855 8583 gene locus_tag LOCUS_37980 8855 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 >Feature sequence111 3262 122 gene locus_tag LOCUS_37990 3262 122 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202770.1 protein_id gnl|my_center|LOCUS_37990 4398 3259 gene locus_tag LOCUS_38000 4398 3259 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085815.1 protein_id gnl|my_center|LOCUS_38000 5624 4395 gene locus_tag LOCUS_38010 5624 4395 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_38010 5974 7365 gene locus_tag LOCUS_38020 5974 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 7362 8033 gene locus_tag LOCUS_38030 7362 8033 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_38030 8715 8386 gene locus_tag LOCUS_38040 8715 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 >Feature sequence112 448 690 gene locus_tag LOCUS_38050 448 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 1917 751 gene locus_tag LOCUS_38060 1917 751 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_38060 3822 2056 gene locus_tag LOCUS_38070 gene polX 3822 2056 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_38070 4454 4807 gene locus_tag LOCUS_38080 4454 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 6319 4811 gene locus_tag LOCUS_38090 6319 4811 CDS product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973126.1 protein_id gnl|my_center|LOCUS_38090 7722 8579 gene locus_tag LOCUS_38100 7722 8579 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931878.1 protein_id gnl|my_center|LOCUS_38100 >Feature sequence113 1261 152 gene locus_tag LOCUS_38110 1261 152 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_38110 1468 3093 gene locus_tag LOCUS_38120 1468 3093 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_38120 3183 5129 gene locus_tag LOCUS_38130 3183 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 5217 6254 gene locus_tag LOCUS_38140 5217 6254 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873148.1 protein_id gnl|my_center|LOCUS_38140 6257 6880 gene locus_tag LOCUS_38150 6257 6880 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037891.1 protein_id gnl|my_center|LOCUS_38150 <8714 7006 gene locus_tag LOCUS_38160 <8714 7006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814586.1:ATP-binding cassette domain-containing protein >Feature sequence114 1586 168 gene locus_tag LOCUS_38170 gene dnaA 1586 168 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_38170 3343 2027 gene locus_tag LOCUS_38180 3343 2027 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_38180 3422 3634 gene locus_tag LOCUS_38190 3422 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 5056 3614 gene locus_tag LOCUS_38200 5056 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 5313 6632 gene locus_tag LOCUS_38210 5313 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 6746 6889 gene locus_tag LOCUS_38220 6746 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 7048 7800 gene locus_tag LOCUS_38230 7048 7800 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_38230 >Feature sequence115 1116 598 gene locus_tag LOCUS_38240 1116 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 2587 1124 gene locus_tag LOCUS_38250 2587 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 3936 2584 gene locus_tag LOCUS_38260 3936 2584 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_38260 4723 3929 gene locus_tag LOCUS_38270 4723 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 6104 5595 gene locus_tag LOCUS_38280 6104 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 6532 7584 gene locus_tag LOCUS_38290 6532 7584 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_38290 >Feature sequence116 1586 162 gene locus_tag LOCUS_38300 1586 162 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_38300 3010 1673 gene locus_tag LOCUS_38310 3010 1673 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_38310 4422 3085 gene locus_tag LOCUS_38320 gene fucP 4422 3085 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039140.1 protein_id gnl|my_center|LOCUS_38320 5983 4505 gene locus_tag LOCUS_38330 gene aldA 5983 4505 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115933.1 protein_id gnl|my_center|LOCUS_38330 7693 6041 gene locus_tag LOCUS_38340 7693 6041 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_38340 >Feature sequence117 431 246 gene locus_tag LOCUS_38350 431 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 1460 594 gene locus_tag LOCUS_38360 1460 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 2016 3587 gene locus_tag LOCUS_38370 2016 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 3654 5225 gene locus_tag LOCUS_38380 3654 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 5246 6463 gene locus_tag LOCUS_38390 5246 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_38390 6476 7528 gene locus_tag LOCUS_38400 6476 7528 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_38400 >Feature sequence118 925 59 gene locus_tag LOCUS_38410 925 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 1407 922 gene locus_tag LOCUS_38420 1407 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38420 1567 1316 gene locus_tag LOCUS_38430 1567 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38430 2470 1757 gene locus_tag LOCUS_38440 2470 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38440 3911 2697 gene locus_tag LOCUS_38450 3911 2697 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_38450 4295 4579 gene locus_tag LOCUS_38460 4295 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 4727 4548 gene locus_tag LOCUS_38470 4727 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 6109 4724 gene locus_tag LOCUS_38480 6109 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 6318 6109 gene locus_tag LOCUS_38490 6318 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 6421 7188 gene locus_tag LOCUS_38500 6421 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 7169 7660 gene locus_tag LOCUS_38510 7169 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 >Feature sequence119 411 1223 gene locus_tag LOCUS_38520 411 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 1569 2846 gene locus_tag LOCUS_38530 1569 2846 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_38530 3227 3454 gene locus_tag LOCUS_38540 3227 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 3420 3800 gene locus_tag LOCUS_38550 3420 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38550 3814 4203 gene locus_tag LOCUS_38560 3814 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38560 4361 4570 gene locus_tag LOCUS_38570 4361 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 4799 6013 gene locus_tag LOCUS_38580 4799 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 6010 6390 gene locus_tag LOCUS_38590 6010 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 7072 6302 gene locus_tag LOCUS_38600 7072 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 >Feature sequence120 <1 818 gene locus_tag LOCUS_38610 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071025.1:IS256-like element ISSod18 family transposase 990 1529 gene locus_tag LOCUS_38620 990 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 1807 1526 gene locus_tag LOCUS_38630 1807 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38630 1949 1749 gene locus_tag LOCUS_38640 1949 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 2211 2393 gene locus_tag LOCUS_38650 2211 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 2428 2685 gene locus_tag LOCUS_38660 2428 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 2742 3041 gene locus_tag LOCUS_38670 2742 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 3041 5527 gene locus_tag LOCUS_38680 3041 5527 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028755117.1 protein_id gnl|my_center|LOCUS_38680 5524 6288 gene locus_tag LOCUS_38690 5524 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 >Feature sequence121 45 1520 gene locus_tag LOCUS_38700 gene purF 45 1520 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_38700 1517 1990 gene locus_tag LOCUS_38710 1517 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 2707 2012 gene locus_tag LOCUS_38720 2707 2012 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811176.1 protein_id gnl|my_center|LOCUS_38720 3398 2877 gene locus_tag LOCUS_38730 3398 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 3688 6240 gene locus_tag LOCUS_38740 gene rnr 3688 6240 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391817.1 protein_id gnl|my_center|LOCUS_38740 6299 6814 gene locus_tag LOCUS_38750 6299 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 >Feature sequence122 429 205 gene locus_tag LOCUS_38760 429 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 428 742 gene locus_tag LOCUS_38770 428 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 951 1394 gene locus_tag LOCUS_38780 951 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 1481 1963 gene locus_tag LOCUS_38790 1481 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 2004 3005 gene locus_tag LOCUS_38800 2004 3005 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_38800 3135 3326 gene locus_tag LOCUS_38810 3135 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 3478 5388 gene locus_tag LOCUS_38820 3478 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 5535 5873 gene locus_tag LOCUS_38830 5535 5873 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531187.1 protein_id gnl|my_center|LOCUS_38830 5870 6328 gene locus_tag LOCUS_38840 5870 6328 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975965.1 protein_id gnl|my_center|LOCUS_38840 6331 6762 gene locus_tag LOCUS_38850 6331 6762 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_38850 >Feature sequence123 906 583 gene locus_tag LOCUS_38860 906 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 1164 2132 gene locus_tag LOCUS_38870 1164 2132 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142979.1 protein_id gnl|my_center|LOCUS_38870 2357 2617 gene locus_tag LOCUS_38880 2357 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 2674 2976 gene locus_tag LOCUS_38890 2674 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 2976 5480 gene locus_tag LOCUS_38900 2976 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 5477 6241 gene locus_tag LOCUS_38910 5477 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 >Feature sequence124 1096 260 gene locus_tag LOCUS_38920 1096 260 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_38920 1368 2666 gene locus_tag LOCUS_38930 1368 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 2683 3768 gene locus_tag LOCUS_38940 2683 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 3799 4770 gene locus_tag LOCUS_38950 3799 4770 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_38950 4845 5615 gene locus_tag LOCUS_38960 4845 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 6172 5624 gene locus_tag LOCUS_38970 6172 5624 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_38970 6334 6408 gene locus_tag LOCUS_t00400 6334 6408 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence125 218 784 gene locus_tag LOCUS_38980 218 784 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461318.1 protein_id gnl|my_center|LOCUS_38980 1046 1927 gene locus_tag LOCUS_38990 gene lolD 1046 1927 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367168.1 protein_id gnl|my_center|LOCUS_38990 1942 4401 gene locus_tag LOCUS_39000 1942 4401 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545172.1 protein_id gnl|my_center|LOCUS_39000 4839 4576 gene locus_tag LOCUS_39010 4839 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 5040 5939 gene locus_tag LOCUS_39020 5040 5939 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944030.1 protein_id gnl|my_center|LOCUS_39020 >Feature sequence126 583 786 gene locus_tag LOCUS_39030 583 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39030 928 2661 gene locus_tag LOCUS_39040 928 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 2755 3120 gene locus_tag LOCUS_39050 2755 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 4221 3472 gene locus_tag LOCUS_39060 gene istB 4221 3472 CDS product IS21-like element ISSme2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970475.1 protein_id gnl|my_center|LOCUS_39060 5863 4274 gene locus_tag LOCUS_39070 5863 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 >Feature sequence127 222 377 gene locus_tag LOCUS_39080 gene rpmH 222 377 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888783.1 protein_id gnl|my_center|LOCUS_39080 514 993 gene locus_tag LOCUS_39090 514 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 983 1255 gene locus_tag LOCUS_39100 983 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 1543 3348 gene locus_tag LOCUS_39110 gene yidC 1543 3348 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_39110 3381 3938 gene locus_tag LOCUS_39120 3381 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 3978 5402 gene locus_tag LOCUS_39130 gene mnmE 3978 5402 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546495.1 protein_id gnl|my_center|LOCUS_39130 >Feature sequence128 541 47 gene locus_tag LOCUS_39140 541 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 848 534 gene locus_tag LOCUS_39150 848 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 2703 877 gene locus_tag LOCUS_39160 2703 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 4019 2943 gene locus_tag LOCUS_39170 4019 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 4554 4841 gene locus_tag LOCUS_39180 4554 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 5116 5394 gene locus_tag LOCUS_39190 5116 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 >Feature sequence129 499 1218 gene locus_tag LOCUS_39200 499 1218 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195790.1 protein_id gnl|my_center|LOCUS_39200 1340 1630 gene locus_tag LOCUS_39210 1340 1630 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529693.1 protein_id gnl|my_center|LOCUS_39210 2206 1946 gene locus_tag LOCUS_39220 2206 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 2840 2223 gene locus_tag LOCUS_39230 2840 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 3856 4431 gene locus_tag LOCUS_39240 3856 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 4972 4490 gene locus_tag LOCUS_39250 4972 4490 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530635.1 protein_id gnl|my_center|LOCUS_39250 >Feature sequence130 2316 250 gene locus_tag LOCUS_39260 2316 250 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210266672.1 protein_id gnl|my_center|LOCUS_39260 3586 2705 gene locus_tag LOCUS_39270 3586 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 4197 3586 gene locus_tag LOCUS_39280 4197 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 >Feature sequence131 470 81 gene locus_tag LOCUS_39290 470 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 2289 985 gene locus_tag LOCUS_39300 2289 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 2409 3386 gene locus_tag LOCUS_39310 2409 3386 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_39310 4248 4105 gene locus_tag LOCUS_39320 4248 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 >Feature sequence132 1149 2453 gene locus_tag LOCUS_39330 1149 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 2725 3084 gene locus_tag LOCUS_39340 2725 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 >Feature sequence133 1432 1842 gene locus_tag LOCUS_39350 1432 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 2035 2163 gene locus_tag LOCUS_39360 2035 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 2244 3680 gene locus_tag LOCUS_39370 2244 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 >Feature sequence134 108 575 gene locus_tag LOCUS_39380 108 575 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942971.1 protein_id gnl|my_center|LOCUS_39380 1124 981 gene locus_tag LOCUS_39390 1124 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 2728 1214 gene locus_tag LOCUS_39400 2728 1214 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036607.1 protein_id gnl|my_center|LOCUS_39400 3394 2789 gene locus_tag LOCUS_39410 3394 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 >Feature sequence135 1501 803 gene locus_tag LOCUS_39420 1501 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 2334 3107 gene locus_tag LOCUS_39430 2334 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 3089 3301 gene locus_tag LOCUS_39440 3089 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 >Feature sequence136 185 337 gene locus_tag LOCUS_39450 185 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 1205 804 gene locus_tag LOCUS_39460 1205 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 1965 1483 gene locus_tag LOCUS_39470 1965 1483 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_39470 2287 1979 gene locus_tag LOCUS_39480 2287 1979 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_39480 3007 2300 gene locus_tag LOCUS_39490 3007 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 >Feature sequence137 431 2917 gene locus_tag LOCUS_39500 431 2917 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201935.1 protein_id gnl|my_center|LOCUS_39500