>Feature sequence001 123 563 gene locus_tag LOCUS_00010 123 563 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404877.1 protein_id gnl|my_center|LOCUS_00010 724 1863 gene locus_tag LOCUS_00020 724 1863 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_00020 1958 3544 gene locus_tag LOCUS_00030 1958 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4254 3694 gene locus_tag LOCUS_00040 4254 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5756 4623 gene locus_tag LOCUS_00050 5756 4623 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405266.1 protein_id gnl|my_center|LOCUS_00050 6895 5891 gene locus_tag LOCUS_00060 6895 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8511 6877 gene locus_tag LOCUS_00070 8511 6877 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_00070 9855 8767 gene locus_tag LOCUS_00080 9855 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11324 9852 gene locus_tag LOCUS_00090 11324 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12291 11317 gene locus_tag LOCUS_00100 12291 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13600 12332 gene locus_tag LOCUS_00110 13600 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14803 13808 gene locus_tag LOCUS_00120 14803 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15797 14952 gene locus_tag LOCUS_00130 15797 14952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15904 16281 gene locus_tag LOCUS_00140 15904 16281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18874 16346 gene locus_tag LOCUS_00150 gene gyrA 18874 16346 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_00150 19937 19170 gene locus_tag LOCUS_00160 19937 19170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20695 19943 gene locus_tag LOCUS_00170 20695 19943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21883 20729 gene locus_tag LOCUS_00180 21883 20729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22204 21968 gene locus_tag LOCUS_00190 22204 21968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23241 22201 gene locus_tag LOCUS_00200 23241 22201 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_00200 23463 24773 gene locus_tag LOCUS_00210 gene odhB 23463 24773 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538105.1 protein_id gnl|my_center|LOCUS_00210 24925 26331 gene locus_tag LOCUS_00220 gene lpdA 24925 26331 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_00220 26978 26451 gene locus_tag LOCUS_00230 26978 26451 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036581840.1 protein_id gnl|my_center|LOCUS_00230 30114 27409 gene locus_tag LOCUS_00240 30114 27409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30466 30146 gene locus_tag LOCUS_00250 30466 30146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30899 30558 gene locus_tag LOCUS_00260 30899 30558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438863.1 protein_id gnl|my_center|LOCUS_00260 31423 30896 gene locus_tag LOCUS_00270 31423 30896 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036486.1 protein_id gnl|my_center|LOCUS_00270 31911 31627 gene locus_tag LOCUS_00280 31911 31627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32519 31911 gene locus_tag LOCUS_00290 32519 31911 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405461.1 protein_id gnl|my_center|LOCUS_00290 33861 32632 gene locus_tag LOCUS_00300 33861 32632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 35136 34087 gene locus_tag LOCUS_00310 35136 34087 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259183.1 protein_id gnl|my_center|LOCUS_00310 35464 36030 gene locus_tag LOCUS_00320 35464 36030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36112 37278 gene locus_tag LOCUS_00330 36112 37278 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_00330 37279 37494 gene locus_tag LOCUS_00340 37279 37494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 37491 38102 gene locus_tag LOCUS_00350 gene rnhA 37491 38102 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225009.1 protein_id gnl|my_center|LOCUS_00350 38123 38338 gene locus_tag LOCUS_00360 38123 38338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38339 39190 gene locus_tag LOCUS_00370 38339 39190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 39319 40149 gene locus_tag LOCUS_00380 39319 40149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40258 40626 gene locus_tag LOCUS_00390 40258 40626 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_00390 40705 41760 gene locus_tag LOCUS_00400 40705 41760 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920814.1 protein_id gnl|my_center|LOCUS_00400 41765 43414 gene locus_tag LOCUS_00410 41765 43414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 43596 44351 gene locus_tag LOCUS_00420 gene thyX 43596 44351 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728526.1 protein_id gnl|my_center|LOCUS_00420 44601 48602 gene locus_tag LOCUS_00430 44601 48602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 50889 48784 gene locus_tag LOCUS_00440 gene fusA 50889 48784 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_00440 51591 51049 gene locus_tag LOCUS_00450 51591 51049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 51966 53807 gene locus_tag LOCUS_00460 51966 53807 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_00460 53814 55064 gene locus_tag LOCUS_00470 53814 55064 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_00470 55112 56005 gene locus_tag LOCUS_00480 55112 56005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 56617 56027 gene locus_tag LOCUS_00490 56617 56027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 57048 58625 gene locus_tag LOCUS_00500 57048 58625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 59549 58683 gene locus_tag LOCUS_00510 59549 58683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 60790 59552 gene locus_tag LOCUS_00520 60790 59552 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_00520 62526 60928 gene locus_tag LOCUS_00530 62526 60928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 62557 64641 gene locus_tag LOCUS_00540 62557 64641 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_00540 65717 64803 gene locus_tag LOCUS_00550 gene nadC 65717 64803 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_00550 66730 65714 gene locus_tag LOCUS_00560 gene nadA 66730 65714 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257284.1 protein_id gnl|my_center|LOCUS_00560 66814 67812 gene locus_tag LOCUS_00570 66814 67812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 69337 67826 gene locus_tag LOCUS_00580 gene nadB 69337 67826 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140848.1 protein_id gnl|my_center|LOCUS_00580 69441 70346 gene locus_tag LOCUS_00590 69441 70346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 70350 71624 gene locus_tag LOCUS_00600 70350 71624 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_00600 72429 71794 gene locus_tag LOCUS_00610 72429 71794 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583472.1 protein_id gnl|my_center|LOCUS_00610 73168 72440 gene locus_tag LOCUS_00620 73168 72440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 74436 73165 gene locus_tag LOCUS_00630 74436 73165 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_00630 <75792 74439 gene locus_tag LOCUS_00640 <75792 74439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860915.1:sodium:solute symporter >Feature sequence002 757 2448 gene locus_tag LOCUS_00650 757 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 2445 3608 gene locus_tag LOCUS_00660 2445 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 3616 5049 gene locus_tag LOCUS_00670 3616 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 6672 5224 gene locus_tag LOCUS_00680 6672 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 7862 6681 gene locus_tag LOCUS_00690 7862 6681 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143735.1 protein_id gnl|my_center|LOCUS_00690 8773 7859 gene locus_tag LOCUS_00700 gene murQ 8773 7859 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726731.1 protein_id gnl|my_center|LOCUS_00700 8796 9482 gene locus_tag LOCUS_00710 8796 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 9507 11234 gene locus_tag LOCUS_00720 gene ggt 9507 11234 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_00720 12254 11391 gene locus_tag LOCUS_00730 12254 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 12297 14069 gene locus_tag LOCUS_00740 12297 14069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933167.1 protein_id gnl|my_center|LOCUS_00740 14794 14066 gene locus_tag LOCUS_00750 14794 14066 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_00750 15255 14791 gene locus_tag LOCUS_00760 15255 14791 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_00760 15650 15237 gene locus_tag LOCUS_00770 15650 15237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 18054 15796 gene locus_tag LOCUS_00780 gene priA 18054 15796 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_00780 19112 18051 gene locus_tag LOCUS_00790 19112 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00790 20160 19114 gene locus_tag LOCUS_00800 gene corA 20160 19114 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_00800 21160 20234 gene locus_tag LOCUS_00810 21160 20234 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532793.1 protein_id gnl|my_center|LOCUS_00810 21478 21197 gene locus_tag LOCUS_00820 21478 21197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 22836 21502 gene locus_tag LOCUS_00830 22836 21502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 23700 22840 gene locus_tag LOCUS_00840 23700 22840 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403318.1 protein_id gnl|my_center|LOCUS_00840 25596 24046 gene locus_tag LOCUS_00850 25596 24046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 27100 25604 gene locus_tag LOCUS_00860 27100 25604 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_00860 27180 30341 gene locus_tag LOCUS_00870 27180 30341 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979182.1 protein_id gnl|my_center|LOCUS_00870 30338 31117 gene locus_tag LOCUS_00880 30338 31117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 31114 31677 gene locus_tag LOCUS_00890 31114 31677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 31923 32501 gene locus_tag LOCUS_00900 31923 32501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 32800 33102 gene locus_tag LOCUS_00910 32800 33102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 34303 33203 gene locus_tag LOCUS_00920 34303 33203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 34631 35116 gene locus_tag LOCUS_00930 34631 35116 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615575.1 protein_id gnl|my_center|LOCUS_00930 36320 35163 gene locus_tag LOCUS_00940 36320 35163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 37093 36323 gene locus_tag LOCUS_00950 37093 36323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 38717 37260 gene locus_tag LOCUS_00960 38717 37260 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_00960 39908 38838 gene locus_tag LOCUS_00970 39908 38838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 39954 40469 gene locus_tag LOCUS_00980 39954 40469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 40785 40456 gene locus_tag LOCUS_00990 40785 40456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 41901 40819 gene locus_tag LOCUS_01000 41901 40819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 42881 41946 gene locus_tag LOCUS_01010 42881 41946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 43121 44905 gene locus_tag LOCUS_01020 43121 44905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 44908 46281 gene locus_tag LOCUS_01030 44908 46281 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_01030 47039 46350 gene locus_tag LOCUS_01040 47039 46350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 47058 47846 gene locus_tag LOCUS_01050 47058 47846 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245289.1 protein_id gnl|my_center|LOCUS_01050 47836 48561 gene locus_tag LOCUS_01060 47836 48561 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037113771.1 protein_id gnl|my_center|LOCUS_01060 49096 48593 gene locus_tag LOCUS_01070 49096 48593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 >Feature sequence003 135 614 gene locus_tag LOCUS_01080 135 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 927 2693 gene locus_tag LOCUS_01090 927 2693 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_01090 3390 2935 gene locus_tag LOCUS_01100 3390 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 3905 3405 gene locus_tag LOCUS_01110 3905 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 4426 3929 gene locus_tag LOCUS_01120 4426 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 5021 4428 gene locus_tag LOCUS_01130 5021 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 5187 7127 gene locus_tag LOCUS_01140 5187 7127 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_01140 9895 7196 gene locus_tag LOCUS_01150 9895 7196 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_01150 10491 10006 gene locus_tag LOCUS_01160 10491 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 11331 10561 gene locus_tag LOCUS_01170 11331 10561 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_01170 12226 11318 gene locus_tag LOCUS_01180 12226 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837916.1 protein_id gnl|my_center|LOCUS_01180 13612 12278 gene locus_tag LOCUS_01190 gene fahA 13612 12278 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818932.1 protein_id gnl|my_center|LOCUS_01190 12985 12902 gene locus_tag LOCUS_t00010 12985 12902 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14475 13609 gene locus_tag LOCUS_01200 14475 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840171.1 protein_id gnl|my_center|LOCUS_01200 16594 14516 gene locus_tag LOCUS_01210 16594 14516 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925700.1 protein_id gnl|my_center|LOCUS_01210 17114 16629 gene locus_tag LOCUS_01220 17114 16629 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037583.1 protein_id gnl|my_center|LOCUS_01220 17848 17111 gene locus_tag LOCUS_01230 17848 17111 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142748.1 protein_id gnl|my_center|LOCUS_01230 18932 17916 gene locus_tag LOCUS_01240 18932 17916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 20145 18937 gene locus_tag LOCUS_01250 20145 18937 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_01250 20196 21632 gene locus_tag LOCUS_01260 gene sthA 20196 21632 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135175071.1 protein_id gnl|my_center|LOCUS_01260 22055 21636 gene locus_tag LOCUS_01270 22055 21636 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405066.1 protein_id gnl|my_center|LOCUS_01270 22711 22130 gene locus_tag LOCUS_01280 gene yjjX 22711 22130 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250698.1 protein_id gnl|my_center|LOCUS_01280 22733 23371 gene locus_tag LOCUS_01290 22733 23371 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931294.1 protein_id gnl|my_center|LOCUS_01290 25955 23400 gene locus_tag LOCUS_01300 25955 23400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 26686 26204 gene locus_tag LOCUS_01310 26686 26204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 27805 26729 gene locus_tag LOCUS_01320 27805 26729 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_01320 28360 28115 gene locus_tag LOCUS_01330 28360 28115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 28518 28943 gene locus_tag LOCUS_01340 28518 28943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 30399 29092 gene locus_tag LOCUS_01350 30399 29092 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_01350 31305 30406 gene locus_tag LOCUS_01360 31305 30406 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_01360 32473 31340 gene locus_tag LOCUS_01370 32473 31340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 32639 33454 gene locus_tag LOCUS_01380 32639 33454 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060909735.1 protein_id gnl|my_center|LOCUS_01380 34198 33455 gene locus_tag LOCUS_01390 34198 33455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 35055 34255 gene locus_tag LOCUS_01400 35055 34255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 37139 35127 gene locus_tag LOCUS_01410 37139 35127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 39088 37136 gene locus_tag LOCUS_01420 39088 37136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 39398 41962 gene locus_tag LOCUS_01430 gene lon 39398 41962 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880103.1 protein_id gnl|my_center|LOCUS_01430 >Feature sequence004 <1 2376 gene locus_tag LOCUS_01440 <1 2376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203196.1:carboxypeptidase-like regulatory domain-containing protein 2373 3896 gene locus_tag LOCUS_01450 2373 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5968 4139 gene locus_tag LOCUS_01460 5968 4139 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_01460 6197 7186 gene locus_tag LOCUS_01470 6197 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 7984 7376 gene locus_tag LOCUS_01480 7984 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 8219 8926 gene locus_tag LOCUS_01490 8219 8926 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887642.1 protein_id gnl|my_center|LOCUS_01490 8923 10356 gene locus_tag LOCUS_01500 gene sufB 8923 10356 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 protein_id gnl|my_center|LOCUS_01500 10475 11233 gene locus_tag LOCUS_01510 gene sufC 10475 11233 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_01510 11230 12537 gene locus_tag LOCUS_01520 gene sufD 11230 12537 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_01520 12548 13012 gene locus_tag LOCUS_01530 12548 13012 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_01530 13020 14255 gene locus_tag LOCUS_01540 13020 14255 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485415.1 protein_id gnl|my_center|LOCUS_01540 14267 14725 gene locus_tag LOCUS_01550 14267 14725 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_01550 15104 14841 gene locus_tag LOCUS_01560 15104 14841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 15067 16410 gene locus_tag LOCUS_01570 15067 16410 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01570 18059 16641 gene locus_tag LOCUS_01580 18059 16641 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_01580 18307 20196 gene locus_tag LOCUS_01590 18307 20196 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_01590 21181 20273 gene locus_tag LOCUS_01600 21181 20273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 22983 21196 gene locus_tag LOCUS_01610 22983 21196 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485975.1 protein_id gnl|my_center|LOCUS_01610 23125 25038 gene locus_tag LOCUS_01620 23125 25038 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_01620 25041 25334 gene locus_tag LOCUS_01630 25041 25334 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229766.1 protein_id gnl|my_center|LOCUS_01630 25408 26397 gene locus_tag LOCUS_01640 25408 26397 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_01640 26397 27632 gene locus_tag LOCUS_01650 gene nirJ2 26397 27632 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392759.1 protein_id gnl|my_center|LOCUS_01650 27629 28432 gene locus_tag LOCUS_01660 27629 28432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 28440 28802 gene locus_tag LOCUS_01670 28440 28802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 28805 29098 gene locus_tag LOCUS_01680 28805 29098 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096224.1 protein_id gnl|my_center|LOCUS_01680 29088 30914 gene locus_tag LOCUS_01690 29088 30914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 31018 31788 gene locus_tag LOCUS_01700 gene rfbF 31018 31788 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435696.1 protein_id gnl|my_center|LOCUS_01700 31770 32774 gene locus_tag LOCUS_01710 31770 32774 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546520.1 protein_id gnl|my_center|LOCUS_01710 32767 34092 gene locus_tag LOCUS_01720 gene rfbH 32767 34092 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_01720 34168 35241 gene locus_tag LOCUS_01730 34168 35241 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_01730 35238 36323 gene locus_tag LOCUS_01740 35238 36323 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870578.1 protein_id gnl|my_center|LOCUS_01740 36331 37536 gene locus_tag LOCUS_01750 36331 37536 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073147.1 protein_id gnl|my_center|LOCUS_01750 37533 39368 gene locus_tag LOCUS_01760 gene ilvB 37533 39368 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703882.1 protein_id gnl|my_center|LOCUS_01760 39365 40513 gene locus_tag LOCUS_01770 39365 40513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 >Feature sequence005 330 55 gene locus_tag LOCUS_01780 330 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 247 1677 gene locus_tag LOCUS_01790 247 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 1692 3176 gene locus_tag LOCUS_01800 1692 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 3306 3695 gene locus_tag LOCUS_01810 3306 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 4757 3744 gene locus_tag LOCUS_01820 4757 3744 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528460.1 protein_id gnl|my_center|LOCUS_01820 5315 4851 gene locus_tag LOCUS_01830 5315 4851 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_01830 6481 5312 gene locus_tag LOCUS_01840 6481 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 6855 7514 gene locus_tag LOCUS_01850 6855 7514 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_01850 7667 7873 gene locus_tag LOCUS_01860 7667 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 7876 8454 gene locus_tag LOCUS_01870 7876 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 8747 9379 gene locus_tag LOCUS_01880 8747 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 9429 11747 gene locus_tag LOCUS_01890 9429 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 11817 12866 gene locus_tag LOCUS_01900 11817 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 12971 13261 gene locus_tag LOCUS_01910 12971 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 13274 13423 gene locus_tag LOCUS_01920 13274 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 13437 13655 gene locus_tag LOCUS_01930 13437 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 13718 14401 gene locus_tag LOCUS_01940 13718 14401 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838096.1 protein_id gnl|my_center|LOCUS_01940 14455 15477 gene locus_tag LOCUS_01950 14455 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 17530 15722 gene locus_tag LOCUS_01960 17530 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 18522 17785 gene locus_tag LOCUS_01970 18522 17785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 19061 18648 gene locus_tag LOCUS_01980 19061 18648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 19426 19058 gene locus_tag LOCUS_01990 19426 19058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 19767 19438 gene locus_tag LOCUS_02000 19767 19438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 19925 20494 gene locus_tag LOCUS_02010 19925 20494 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531897.1 protein_id gnl|my_center|LOCUS_02010 21120 20506 gene locus_tag LOCUS_02020 21120 20506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 21195 21569 gene locus_tag LOCUS_02030 21195 21569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 22840 21671 gene locus_tag LOCUS_02040 22840 21671 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_02040 23132 22893 gene locus_tag LOCUS_02050 23132 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 23572 23910 gene locus_tag LOCUS_02060 23572 23910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 24618 24067 gene locus_tag LOCUS_02070 24618 24067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 24735 24992 gene locus_tag LOCUS_02080 24735 24992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 25102 25368 gene locus_tag LOCUS_02090 25102 25368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 26599 25448 gene locus_tag LOCUS_02100 26599 25448 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_02100 27705 26740 gene locus_tag LOCUS_02110 gene queG 27705 26740 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266491.1 protein_id gnl|my_center|LOCUS_02110 27950 27702 gene locus_tag LOCUS_02120 27950 27702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 28125 29414 gene locus_tag LOCUS_02130 28125 29414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 30934 29477 gene locus_tag LOCUS_02140 30934 29477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 30933 31937 gene locus_tag LOCUS_02150 30933 31937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 31958 33178 gene locus_tag LOCUS_02160 gene speY 31958 33178 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_02160 34256 33531 gene locus_tag LOCUS_02170 34256 33531 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_02170 35160 34393 gene locus_tag LOCUS_02180 35160 34393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 >Feature sequence006 250 480 gene locus_tag LOCUS_02190 250 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 477 1013 gene locus_tag LOCUS_02200 477 1013 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117134.1 protein_id gnl|my_center|LOCUS_02200 3183 1114 gene locus_tag LOCUS_02210 3183 1114 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403313.1 protein_id gnl|my_center|LOCUS_02210 3747 3325 gene locus_tag LOCUS_02220 3747 3325 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228632.1 protein_id gnl|my_center|LOCUS_02220 4204 3872 gene locus_tag LOCUS_02230 4204 3872 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316382.1 protein_id gnl|my_center|LOCUS_02230 4469 4816 gene locus_tag LOCUS_02240 4469 4816 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014431504.1 protein_id gnl|my_center|LOCUS_02240 7677 4819 gene locus_tag LOCUS_02250 7677 4819 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_02250 7763 8110 gene locus_tag LOCUS_02260 7763 8110 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014431504.1 protein_id gnl|my_center|LOCUS_02260 8173 8442 gene locus_tag LOCUS_02270 8173 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 8502 8822 gene locus_tag LOCUS_02280 8502 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 8833 10452 gene locus_tag LOCUS_02290 8833 10452 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_02290 10484 10903 gene locus_tag LOCUS_02300 10484 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 11733 11278 gene locus_tag LOCUS_02310 11733 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 12316 11822 gene locus_tag LOCUS_02320 12316 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 14548 12437 gene locus_tag LOCUS_02330 14548 12437 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_02330 14755 17163 gene locus_tag LOCUS_02340 14755 17163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 17187 17405 gene locus_tag LOCUS_02350 17187 17405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 17845 18315 gene locus_tag LOCUS_02360 17845 18315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 18319 18711 gene locus_tag LOCUS_02370 18319 18711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 18704 19738 gene locus_tag LOCUS_02380 18704 19738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 19751 20809 gene locus_tag LOCUS_02390 19751 20809 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921037.1 protein_id gnl|my_center|LOCUS_02390 20909 21283 gene locus_tag LOCUS_02400 20909 21283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 22040 21315 gene locus_tag LOCUS_02410 22040 21315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02410 22220 22041 gene locus_tag LOCUS_02420 22220 22041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 23288 22518 gene locus_tag LOCUS_02430 23288 22518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 24031 23291 gene locus_tag LOCUS_02440 24031 23291 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_02440 24636 24028 gene locus_tag LOCUS_02450 24636 24028 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405521.1 protein_id gnl|my_center|LOCUS_02450 25092 24742 gene locus_tag LOCUS_02460 25092 24742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 25679 26080 gene locus_tag LOCUS_02470 25679 26080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 27036 26176 gene locus_tag LOCUS_02480 27036 26176 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338675.1 protein_id gnl|my_center|LOCUS_02480 27197 27973 gene locus_tag LOCUS_02490 27197 27973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 28003 28335 gene locus_tag LOCUS_02500 28003 28335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 <30036 28392 gene locus_tag LOCUS_02510 <30036 28392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173912.1:NAD+ synthase >Feature sequence007 <1 940 gene locus_tag LOCUS_02520 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938997.1:type I restriction-modification system subunit M 937 2139 gene locus_tag LOCUS_02530 937 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 2136 2810 gene locus_tag LOCUS_02540 2136 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 3212 2940 gene locus_tag LOCUS_02550 3212 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 3093 4112 gene locus_tag LOCUS_02560 3093 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02560 4112 6217 gene locus_tag LOCUS_02570 4112 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02570 6466 6915 gene locus_tag LOCUS_02580 6466 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 7268 8830 gene locus_tag LOCUS_02590 7268 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 8944 9987 gene locus_tag LOCUS_02600 8944 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 12868 10115 gene locus_tag LOCUS_02610 12868 10115 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041976239.1 protein_id gnl|my_center|LOCUS_02610 15053 13134 gene locus_tag LOCUS_02620 15053 13134 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_02620 15885 15292 gene locus_tag LOCUS_02630 15885 15292 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530152.1 protein_id gnl|my_center|LOCUS_02630 16270 16899 gene locus_tag LOCUS_02640 16270 16899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 18161 16938 gene locus_tag LOCUS_02650 18161 16938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_02650 19946 18165 gene locus_tag LOCUS_02660 19946 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 21286 19982 gene locus_tag LOCUS_02670 21286 19982 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268788.1 protein_id gnl|my_center|LOCUS_02670 21655 21290 gene locus_tag LOCUS_02680 21655 21290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 22064 21684 gene locus_tag LOCUS_02690 22064 21684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 22672 22061 gene locus_tag LOCUS_02700 gene sigM 22672 22061 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_02700 23450 22869 gene locus_tag LOCUS_02710 23450 22869 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_02710 27398 23580 gene locus_tag LOCUS_02720 27398 23580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 27997 27488 gene locus_tag LOCUS_02730 27997 27488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 28383 27994 gene locus_tag LOCUS_02740 28383 27994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 28958 28380 gene locus_tag LOCUS_02750 28958 28380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 >Feature sequence008 481 1662 gene locus_tag LOCUS_02760 481 1662 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_02760 1733 2815 gene locus_tag LOCUS_02770 1733 2815 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889453.1 protein_id gnl|my_center|LOCUS_02770 2812 3996 gene locus_tag LOCUS_02780 2812 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 4544 3993 gene locus_tag LOCUS_02790 4544 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 4652 5245 gene locus_tag LOCUS_02800 4652 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 5449 6144 gene locus_tag LOCUS_02810 5449 6144 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224998.1 protein_id gnl|my_center|LOCUS_02810 6141 7535 gene locus_tag LOCUS_02820 6141 7535 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926923.1 protein_id gnl|my_center|LOCUS_02820 7538 8662 gene locus_tag LOCUS_02830 7538 8662 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974032.1 protein_id gnl|my_center|LOCUS_02830 8664 11909 gene locus_tag LOCUS_02840 8664 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 11975 12577 gene locus_tag LOCUS_02850 11975 12577 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_02850 12686 14794 gene locus_tag LOCUS_02860 12686 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 14791 15324 gene locus_tag LOCUS_02870 14791 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 16733 15528 gene locus_tag LOCUS_02880 16733 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 16918 19089 gene locus_tag LOCUS_02890 16918 19089 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_02890 19181 19582 gene locus_tag LOCUS_02900 19181 19582 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943560.1 protein_id gnl|my_center|LOCUS_02900 19677 19892 gene locus_tag LOCUS_02910 19677 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 22690 19940 gene locus_tag LOCUS_02920 22690 19940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 23406 23897 gene locus_tag LOCUS_02930 23406 23897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 23941 24264 gene locus_tag LOCUS_02940 23941 24264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 24778 25314 gene locus_tag LOCUS_02950 24778 25314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 25340 25630 gene locus_tag LOCUS_02960 25340 25630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 25627 26169 gene locus_tag LOCUS_02970 25627 26169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 26265 26588 gene locus_tag LOCUS_02980 26265 26588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 27701 27171 gene locus_tag LOCUS_02990 27701 27171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 >Feature sequence009 1852 587 gene locus_tag LOCUS_03000 1852 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2142 3395 gene locus_tag LOCUS_03010 2142 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03010 3395 4771 gene locus_tag LOCUS_03020 3395 4771 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973486.1 protein_id gnl|my_center|LOCUS_03020 4846 5358 gene locus_tag LOCUS_03030 4846 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 5430 6401 gene locus_tag LOCUS_03040 5430 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 6413 6904 gene locus_tag LOCUS_03050 6413 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 7028 8467 gene locus_tag LOCUS_03060 7028 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 8483 9136 gene locus_tag LOCUS_03070 8483 9136 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225626.1 protein_id gnl|my_center|LOCUS_03070 11306 9462 gene locus_tag LOCUS_03080 11306 9462 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935691.1 protein_id gnl|my_center|LOCUS_03080 11765 11490 gene locus_tag LOCUS_03090 11765 11490 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886866.1 protein_id gnl|my_center|LOCUS_03090 12311 12066 gene locus_tag LOCUS_03100 12311 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 12691 12458 gene locus_tag LOCUS_03110 12691 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 12749 13981 gene locus_tag LOCUS_03120 12749 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 14001 15122 gene locus_tag LOCUS_03130 14001 15122 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144157.1 protein_id gnl|my_center|LOCUS_03130 15119 18205 gene locus_tag LOCUS_03140 15119 18205 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_03140 18202 18546 gene locus_tag LOCUS_03150 gene glnB 18202 18546 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_03150 18543 20507 gene locus_tag LOCUS_03160 18543 20507 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_03160 23727 20524 gene locus_tag LOCUS_03170 23727 20524 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524131.1 protein_id gnl|my_center|LOCUS_03170 25020 23740 gene locus_tag LOCUS_03180 25020 23740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 26470 25013 gene locus_tag LOCUS_03190 26470 25013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 26692 26994 gene locus_tag LOCUS_03200 26692 26994 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145023062.1 protein_id gnl|my_center|LOCUS_03200 >Feature sequence010 3903 5540 gene locus_tag LOCUS_03210 3903 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 5540 6625 gene locus_tag LOCUS_03220 gene lptG 5540 6625 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_03220 6696 7142 gene locus_tag LOCUS_03230 6696 7142 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340660.1 protein_id gnl|my_center|LOCUS_03230 10438 7232 gene locus_tag LOCUS_03240 10438 7232 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_03240 12002 10629 gene locus_tag LOCUS_03250 12002 10629 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_03250 12164 12421 gene locus_tag LOCUS_03260 12164 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 12418 13314 gene locus_tag LOCUS_03270 12418 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 14763 13447 gene locus_tag LOCUS_03280 14763 13447 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_03280 16167 14989 gene locus_tag LOCUS_03290 16167 14989 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479553.1 protein_id gnl|my_center|LOCUS_03290 16801 16172 gene locus_tag LOCUS_03300 16801 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 16934 17734 gene locus_tag LOCUS_03310 16934 17734 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 protein_id gnl|my_center|LOCUS_03310 17722 18222 gene locus_tag LOCUS_03320 17722 18222 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_03320 18319 19023 gene locus_tag LOCUS_03330 18319 19023 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_03330 19188 19802 gene locus_tag LOCUS_03340 19188 19802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 20394 19846 gene locus_tag LOCUS_03350 20394 19846 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259161.1 protein_id gnl|my_center|LOCUS_03350 22626 20746 gene locus_tag LOCUS_03360 gene ggt 22626 20746 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639997.1 protein_id gnl|my_center|LOCUS_03360 22947 22636 gene locus_tag LOCUS_03370 22947 22636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 23430 23194 gene locus_tag LOCUS_03380 23430 23194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 23449 25413 gene locus_tag LOCUS_03390 gene acs 23449 25413 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_03390 25522 26496 gene locus_tag LOCUS_03400 25522 26496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 26527 26889 gene locus_tag LOCUS_03410 26527 26889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 >Feature sequence011 3982 428 gene locus_tag LOCUS_03420 gene metH 3982 428 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259744.1 protein_id gnl|my_center|LOCUS_03420 4793 4389 gene locus_tag LOCUS_03430 4793 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 5118 4819 gene locus_tag LOCUS_03440 5118 4819 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_03440 5708 5118 gene locus_tag LOCUS_03450 5708 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 7344 5752 gene locus_tag LOCUS_03460 7344 5752 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_03460 7543 8244 gene locus_tag LOCUS_03470 gene rpoE 7543 8244 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_03470 8246 8833 gene locus_tag LOCUS_03480 8246 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8833 9477 gene locus_tag LOCUS_03490 8833 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 9512 10633 gene locus_tag LOCUS_03500 9512 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 10821 12110 gene locus_tag LOCUS_03510 10821 12110 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_03510 12176 13678 gene locus_tag LOCUS_03520 12176 13678 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256316.1 protein_id gnl|my_center|LOCUS_03520 13959 14405 gene locus_tag LOCUS_03530 13959 14405 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110309.1 protein_id gnl|my_center|LOCUS_03530 14411 14614 gene locus_tag LOCUS_03540 14411 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 14627 14953 gene locus_tag LOCUS_03550 14627 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 15012 16940 gene locus_tag LOCUS_03560 15012 16940 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_03560 18623 17142 gene locus_tag LOCUS_03570 18623 17142 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_03570 18915 18775 gene locus_tag LOCUS_03580 18915 18775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 18899 19999 gene locus_tag LOCUS_03590 18899 19999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 20083 23400 gene locus_tag LOCUS_03600 20083 23400 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_03600 24318 23515 gene locus_tag LOCUS_03610 24318 23515 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258719.1 protein_id gnl|my_center|LOCUS_03610 24565 25908 gene locus_tag LOCUS_03620 24565 25908 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909504.1 protein_id gnl|my_center|LOCUS_03620 26779 26033 gene locus_tag LOCUS_03630 26779 26033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence012 939 91 gene locus_tag LOCUS_03640 939 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 2872 2384 gene locus_tag LOCUS_03650 2872 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 6775 2951 gene locus_tag LOCUS_03660 6775 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221109609.1 protein_id gnl|my_center|LOCUS_03660 7539 8603 gene locus_tag LOCUS_03670 7539 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 8720 9892 gene locus_tag LOCUS_03680 8720 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 11639 11923 gene locus_tag LOCUS_03690 11639 11923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 12910 12449 gene locus_tag LOCUS_03700 12910 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 15108 13129 gene locus_tag LOCUS_03710 15108 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 15500 15105 gene locus_tag LOCUS_03720 15500 15105 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_03720 15628 16095 gene locus_tag LOCUS_03730 15628 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03730 17259 16090 gene locus_tag LOCUS_03740 17259 16090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 18542 17262 gene locus_tag LOCUS_03750 18542 17262 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223621.1 protein_id gnl|my_center|LOCUS_03750 24248 18645 gene locus_tag LOCUS_03760 24248 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 24649 24404 gene locus_tag LOCUS_03770 24649 24404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 >Feature sequence013 65 1312 gene locus_tag LOCUS_03780 65 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 1388 2110 gene locus_tag LOCUS_03790 1388 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 2254 2595 gene locus_tag LOCUS_03800 2254 2595 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_03800 2732 3310 gene locus_tag LOCUS_03810 gene sigR 2732 3310 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_03810 3307 3564 gene locus_tag LOCUS_03820 3307 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4123 3539 gene locus_tag LOCUS_03830 4123 3539 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_03830 4281 5723 gene locus_tag LOCUS_03840 4281 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 5811 6440 gene locus_tag LOCUS_03850 5811 6440 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974638.1 protein_id gnl|my_center|LOCUS_03850 6532 7077 gene locus_tag LOCUS_03860 6532 7077 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_03860 7088 7567 gene locus_tag LOCUS_03870 7088 7567 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076559.1 protein_id gnl|my_center|LOCUS_03870 7564 8208 gene locus_tag LOCUS_03880 7564 8208 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529020.1 protein_id gnl|my_center|LOCUS_03880 8991 8290 gene locus_tag LOCUS_03890 8991 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 10418 9147 gene locus_tag LOCUS_03900 10418 9147 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583067.1 protein_id gnl|my_center|LOCUS_03900 11332 10418 gene locus_tag LOCUS_03910 11332 10418 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_03910 12015 11332 gene locus_tag LOCUS_03920 12015 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 13256 12012 gene locus_tag LOCUS_03930 13256 12012 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_03930 14114 13395 gene locus_tag LOCUS_03940 14114 13395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 14743 14186 gene locus_tag LOCUS_03950 14743 14186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 14742 14993 gene locus_tag LOCUS_03960 14742 14993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 16350 15001 gene locus_tag LOCUS_03970 16350 15001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 16776 17981 gene locus_tag LOCUS_03980 16776 17981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 18490 18023 gene locus_tag LOCUS_03990 18490 18023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 18962 19579 gene locus_tag LOCUS_04000 18962 19579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 20196 19816 gene locus_tag LOCUS_04010 20196 19816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 20429 22408 gene locus_tag LOCUS_04020 20429 22408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 22405 23058 gene locus_tag LOCUS_04030 22405 23058 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_04030 23137 23532 gene locus_tag LOCUS_04040 23137 23532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence014 215 685 gene locus_tag LOCUS_04050 215 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 1134 775 gene locus_tag LOCUS_04060 gene mce 1134 775 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_04060 1271 1600 gene locus_tag LOCUS_04070 gene trxA 1271 1600 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_04070 1918 2676 gene locus_tag LOCUS_04080 1918 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 2670 3497 gene locus_tag LOCUS_04090 gene rsmI 2670 3497 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_04090 3500 4192 gene locus_tag LOCUS_04100 3500 4192 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403539.1 protein_id gnl|my_center|LOCUS_04100 4189 7530 gene locus_tag LOCUS_04110 4189 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 7556 9280 gene locus_tag LOCUS_04120 7556 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 9567 10748 gene locus_tag LOCUS_04130 9567 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404588.1 protein_id gnl|my_center|LOCUS_04130 10745 13267 gene locus_tag LOCUS_04140 10745 13267 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941031.1 protein_id gnl|my_center|LOCUS_04140 13338 13925 gene locus_tag LOCUS_04150 13338 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 13922 14791 gene locus_tag LOCUS_04160 13922 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 15424 14795 gene locus_tag LOCUS_04170 gene lexA 15424 14795 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080401.1 protein_id gnl|my_center|LOCUS_04170 16889 15429 gene locus_tag LOCUS_04180 gene gltX 16889 15429 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_04180 17180 17088 gene locus_tag LOCUS_t00020 17180 17088 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18443 17427 gene locus_tag LOCUS_04190 18443 17427 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093830137.1 protein_id gnl|my_center|LOCUS_04190 18913 18825 gene locus_tag LOCUS_t00030 18913 18825 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19173 22133 gene locus_tag LOCUS_04200 19173 22133 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838102.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence015 <1 1346 gene locus_tag LOCUS_04210 <1 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120149.1:sulfatase 1705 1409 gene locus_tag LOCUS_04220 1705 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 1914 3083 gene locus_tag LOCUS_04230 1914 3083 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 protein_id gnl|my_center|LOCUS_04230 3776 3183 gene locus_tag LOCUS_04240 3776 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 5287 3773 gene locus_tag LOCUS_04250 5287 3773 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_04250 6213 5284 gene locus_tag LOCUS_04260 6213 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 8722 6215 gene locus_tag LOCUS_04270 8722 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 9240 8824 gene locus_tag LOCUS_04280 9240 8824 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 protein_id gnl|my_center|LOCUS_04280 10748 9240 gene locus_tag LOCUS_04290 10748 9240 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_04290 11191 10745 gene locus_tag LOCUS_04300 11191 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 12833 11196 gene locus_tag LOCUS_04310 12833 11196 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728834.1 protein_id gnl|my_center|LOCUS_04310 13840 12833 gene locus_tag LOCUS_04320 13840 12833 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_04320 14868 13837 gene locus_tag LOCUS_04330 14868 13837 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_04330 15144 16073 gene locus_tag LOCUS_04340 15144 16073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04340 16340 16128 gene locus_tag LOCUS_04350 16340 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 17430 16405 gene locus_tag LOCUS_04360 17430 16405 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444931.1 protein_id gnl|my_center|LOCUS_04360 20495 17757 gene locus_tag LOCUS_04370 20495 17757 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_04370 20699 22192 gene locus_tag LOCUS_04380 20699 22192 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_04380 <23502 22214 gene locus_tag LOCUS_04390 <23502 22214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197524104.1:PDZ domain-containing protein >Feature sequence016 2889 1585 gene locus_tag LOCUS_04400 2889 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 4291 2966 gene locus_tag LOCUS_04410 gene miaB 4291 2966 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114512.1 protein_id gnl|my_center|LOCUS_04410 5619 4456 gene locus_tag LOCUS_04420 5619 4456 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_04420 6751 5624 gene locus_tag LOCUS_04430 6751 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 8016 6751 gene locus_tag LOCUS_04440 8016 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8447 8037 gene locus_tag LOCUS_04450 8447 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 9619 8447 gene locus_tag LOCUS_04460 9619 8447 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_04460 9239 9248 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10716 9616 gene locus_tag LOCUS_04470 10716 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 10752 11594 gene locus_tag LOCUS_04480 gene mazG 10752 11594 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880171.1 protein_id gnl|my_center|LOCUS_04480 12350 11766 gene locus_tag LOCUS_04490 12350 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 12847 12371 gene locus_tag LOCUS_04500 12847 12371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 13911 13036 gene locus_tag LOCUS_04510 gene tesB 13911 13036 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_04510 16291 13901 gene locus_tag LOCUS_04520 16291 13901 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254325.1 protein_id gnl|my_center|LOCUS_04520 17250 16297 gene locus_tag LOCUS_04530 gene deoC 17250 16297 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974219.1 protein_id gnl|my_center|LOCUS_04530 18593 17247 gene locus_tag LOCUS_04540 gene asnS 18593 17247 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870400.1 protein_id gnl|my_center|LOCUS_04540 19863 18556 gene locus_tag LOCUS_04550 19863 18556 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_04550 20006 20428 gene locus_tag LOCUS_04560 20006 20428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 23086 20519 gene locus_tag LOCUS_04570 23086 20519 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence017 152 442 gene locus_tag LOCUS_04580 152 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04580 534 950 gene locus_tag LOCUS_04590 534 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04590 1326 1940 gene locus_tag LOCUS_04600 1326 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 3127 2219 gene locus_tag LOCUS_04610 3127 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 4253 3267 gene locus_tag LOCUS_04620 4253 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4445 5545 gene locus_tag LOCUS_04630 4445 5545 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_04630 5551 7287 gene locus_tag LOCUS_04640 5551 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 7284 7682 gene locus_tag LOCUS_04650 7284 7682 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_04650 8568 7666 gene locus_tag LOCUS_04660 8568 7666 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065352.1 protein_id gnl|my_center|LOCUS_04660 8725 9582 gene locus_tag LOCUS_04670 8725 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 9607 10515 gene locus_tag LOCUS_04680 gene cysK 9607 10515 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 protein_id gnl|my_center|LOCUS_04680 10690 13863 gene locus_tag LOCUS_04690 10690 13863 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_04690 13863 15431 gene locus_tag LOCUS_04700 13863 15431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 15777 15541 gene locus_tag LOCUS_04710 15777 15541 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_04710 16262 15798 gene locus_tag LOCUS_04720 16262 15798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04720 16851 16228 gene locus_tag LOCUS_04730 16851 16228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04730 17630 16848 gene locus_tag LOCUS_04740 17630 16848 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_04740 18774 17692 gene locus_tag LOCUS_04750 gene arsB 18774 17692 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393695.1 protein_id gnl|my_center|LOCUS_04750 18976 18794 gene locus_tag LOCUS_04760 18976 18794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 20024 18993 gene locus_tag LOCUS_04770 20024 18993 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_04770 20434 20093 gene locus_tag LOCUS_04780 20434 20093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 20608 22215 gene locus_tag LOCUS_04790 20608 22215 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_04790 22776 22387 gene locus_tag LOCUS_04800 22776 22387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04800 >Feature sequence018 592 1950 gene locus_tag LOCUS_04810 592 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 1963 3225 gene locus_tag LOCUS_04820 1963 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3929 3438 gene locus_tag LOCUS_04830 3929 3438 CDS product Isopropylmalate/citramalate isomerase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870790.1 protein_id gnl|my_center|LOCUS_04830 5238 3952 gene locus_tag LOCUS_04840 gene hacA 5238 3952 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_04840 6446 5253 gene locus_tag LOCUS_04850 6446 5253 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 protein_id gnl|my_center|LOCUS_04850 7450 6530 gene locus_tag LOCUS_04860 7450 6530 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808120.1 protein_id gnl|my_center|LOCUS_04860 8594 7476 gene locus_tag LOCUS_04870 8594 7476 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104435.1 protein_id gnl|my_center|LOCUS_04870 9050 12223 gene locus_tag LOCUS_04880 9050 12223 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130858180.1 protein_id gnl|my_center|LOCUS_04880 12234 13841 gene locus_tag LOCUS_04890 12234 13841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 13984 14610 gene locus_tag LOCUS_04900 13984 14610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04900 14607 15854 gene locus_tag LOCUS_04910 14607 15854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04910 15962 16477 gene locus_tag LOCUS_04920 15962 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 16443 16919 gene locus_tag LOCUS_04930 16443 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 16922 18142 gene locus_tag LOCUS_04940 16922 18142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 18284 21523 gene locus_tag LOCUS_04950 18284 21523 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201854.1 protein_id gnl|my_center|LOCUS_04950 21520 22551 gene locus_tag LOCUS_04960 21520 22551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 >Feature sequence019 528 82 gene locus_tag LOCUS_04970 528 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 928 515 gene locus_tag LOCUS_04980 928 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 1221 1799 gene locus_tag LOCUS_04990 1221 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 5227 1886 gene locus_tag LOCUS_05000 5227 1886 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_05000 6462 5296 gene locus_tag LOCUS_05010 6462 5296 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986854.1 protein_id gnl|my_center|LOCUS_05010 7962 6784 gene locus_tag LOCUS_05020 7962 6784 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 protein_id gnl|my_center|LOCUS_05020 9509 7959 gene locus_tag LOCUS_05030 9509 7959 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_05030 10365 9643 gene locus_tag LOCUS_05040 10365 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 11120 10347 gene locus_tag LOCUS_05050 11120 10347 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391038.1 protein_id gnl|my_center|LOCUS_05050 11808 11194 gene locus_tag LOCUS_05060 11808 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 11912 13969 gene locus_tag LOCUS_05070 gene cstA 11912 13969 CDS product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259563.1 protein_id gnl|my_center|LOCUS_05070 15053 14025 gene locus_tag LOCUS_05080 15053 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 16084 15050 gene locus_tag LOCUS_05090 16084 15050 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_05090 17427 16081 gene locus_tag LOCUS_05100 17427 16081 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_05100 17486 17495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18017 20371 gene locus_tag LOCUS_05110 18017 20371 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838717.1 protein_id gnl|my_center|LOCUS_05110 20368 20592 gene locus_tag LOCUS_05120 20368 20592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 21959 20676 gene locus_tag LOCUS_05130 21959 20676 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 protein_id gnl|my_center|LOCUS_05130 <22495 21956 gene locus_tag LOCUS_05140 <22495 21956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776792.1:galactokinase family protein >Feature sequence020 1838 1464 gene locus_tag LOCUS_05150 1838 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 2100 2618 gene locus_tag LOCUS_05160 2100 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 2663 3274 gene locus_tag LOCUS_05170 2663 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05170 3302 3460 gene locus_tag LOCUS_05180 3302 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3568 4077 gene locus_tag LOCUS_05190 3568 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 4263 6356 gene locus_tag LOCUS_05200 4263 6356 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 protein_id gnl|my_center|LOCUS_05200 6489 7733 gene locus_tag LOCUS_05210 6489 7733 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107381.1 protein_id gnl|my_center|LOCUS_05210 9213 7711 gene locus_tag LOCUS_05220 9213 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 10592 9210 gene locus_tag LOCUS_05230 10592 9210 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_05230 11357 10593 gene locus_tag LOCUS_05240 11357 10593 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776489.1 protein_id gnl|my_center|LOCUS_05240 12382 11354 gene locus_tag LOCUS_05250 12382 11354 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731241.1 protein_id gnl|my_center|LOCUS_05250 13083 12397 gene locus_tag LOCUS_05260 13083 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 13264 14715 gene locus_tag LOCUS_05270 13264 14715 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 protein_id gnl|my_center|LOCUS_05270 14808 16865 gene locus_tag LOCUS_05280 14808 16865 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070840.1 protein_id gnl|my_center|LOCUS_05280 16885 17244 gene locus_tag LOCUS_05290 16885 17244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 18076 17276 gene locus_tag LOCUS_05300 18076 17276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 18424 19149 gene locus_tag LOCUS_05310 18424 19149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 19130 19657 gene locus_tag LOCUS_05320 19130 19657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 19761 21974 gene locus_tag LOCUS_05330 19761 21974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence021 2737 1277 gene locus_tag LOCUS_05340 2737 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 3704 2739 gene locus_tag LOCUS_05350 3704 2739 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_05350 7188 3706 gene locus_tag LOCUS_05360 7188 3706 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_05360 7320 9491 gene locus_tag LOCUS_05370 7320 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 9581 10585 gene locus_tag LOCUS_05380 9581 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 10549 11664 gene locus_tag LOCUS_05390 10549 11664 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266146.1 protein_id gnl|my_center|LOCUS_05390 11670 11578 gene locus_tag LOCUS_t00040 11670 11578 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13745 11661 gene locus_tag LOCUS_05400 13745 11661 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532458.1 protein_id gnl|my_center|LOCUS_05400 15132 13909 gene locus_tag LOCUS_05410 15132 13909 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_05410 15490 16275 gene locus_tag LOCUS_05420 15490 16275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 17408 16272 gene locus_tag LOCUS_05430 17408 16272 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531324.1 protein_id gnl|my_center|LOCUS_05430 18130 17408 gene locus_tag LOCUS_05440 gene lipB 18130 17408 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144397.1 protein_id gnl|my_center|LOCUS_05440 18307 19086 gene locus_tag LOCUS_05450 18307 19086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 20388 19093 gene locus_tag LOCUS_05460 20388 19093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 21949 20546 gene locus_tag LOCUS_05470 gene lpdA 21949 20546 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258694.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence022 3042 1360 gene locus_tag LOCUS_05480 3042 1360 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_05480 3183 3617 gene locus_tag LOCUS_05490 gene arfB 3183 3617 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635546.1 protein_id gnl|my_center|LOCUS_05490 4376 3666 gene locus_tag LOCUS_05500 4376 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 6930 4480 gene locus_tag LOCUS_05510 6930 4480 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839793.1 protein_id gnl|my_center|LOCUS_05510 7811 7059 gene locus_tag LOCUS_05520 7811 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 8485 7970 gene locus_tag LOCUS_05530 8485 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 8496 8912 gene locus_tag LOCUS_05540 8496 8912 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895698.1 protein_id gnl|my_center|LOCUS_05540 9022 9180 gene locus_tag LOCUS_05550 9022 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 9484 9263 gene locus_tag LOCUS_05560 gene infA 9484 9263 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356224.1 protein_id gnl|my_center|LOCUS_05560 9693 11117 gene locus_tag LOCUS_05570 9693 11117 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640497.1 protein_id gnl|my_center|LOCUS_05570 11118 11747 gene locus_tag LOCUS_05580 gene pnuC 11118 11747 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088340.1 protein_id gnl|my_center|LOCUS_05580 11744 12280 gene locus_tag LOCUS_05590 11744 12280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 12277 13578 gene locus_tag LOCUS_05600 12277 13578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 13575 14243 gene locus_tag LOCUS_05610 13575 14243 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941342.1 protein_id gnl|my_center|LOCUS_05610 14363 16528 gene locus_tag LOCUS_05620 gene phuR 14363 16528 CDS product heme/hemoglobin uptake receptor PhuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113453.1 protein_id gnl|my_center|LOCUS_05620 17719 16766 gene locus_tag LOCUS_05630 17719 16766 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_05630 18125 17775 gene locus_tag LOCUS_05640 18125 17775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 20545 18125 gene locus_tag LOCUS_05650 20545 18125 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404341.1 protein_id gnl|my_center|LOCUS_05650 20770 20555 gene locus_tag LOCUS_05660 20770 20555 CDS product copper ion binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082089387.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence023 939 1394 gene locus_tag LOCUS_05670 939 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 1408 2250 gene locus_tag LOCUS_05680 1408 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2791 2504 gene locus_tag LOCUS_05690 2791 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 2901 4271 gene locus_tag LOCUS_05700 2901 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 4274 5791 gene locus_tag LOCUS_05710 4274 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 5803 9114 gene locus_tag LOCUS_05720 5803 9114 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_05720 9148 9705 gene locus_tag LOCUS_05730 9148 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 9900 10391 gene locus_tag LOCUS_05740 9900 10391 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403905.1 protein_id gnl|my_center|LOCUS_05740 10411 10998 gene locus_tag LOCUS_05750 10411 10998 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036835.1 protein_id gnl|my_center|LOCUS_05750 10995 12014 gene locus_tag LOCUS_05760 10995 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 12307 13359 gene locus_tag LOCUS_05770 12307 13359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 13403 13807 gene locus_tag LOCUS_05780 13403 13807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 13908 14561 gene locus_tag LOCUS_05790 13908 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 14558 15169 gene locus_tag LOCUS_05800 14558 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 15240 15797 gene locus_tag LOCUS_05810 15240 15797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 16034 16351 gene locus_tag LOCUS_05820 16034 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 16435 16899 gene locus_tag LOCUS_05830 16435 16899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 16896 18380 gene locus_tag LOCUS_05840 16896 18380 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877655.1 protein_id gnl|my_center|LOCUS_05840 18392 19444 gene locus_tag LOCUS_05850 18392 19444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 19569 20060 gene locus_tag LOCUS_05860 19569 20060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 20126 20632 gene locus_tag LOCUS_05870 20126 20632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence024 298 1773 gene locus_tag LOCUS_05880 298 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 1929 2504 gene locus_tag LOCUS_05890 1929 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 2508 4877 gene locus_tag LOCUS_05900 2508 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 4895 5542 gene locus_tag LOCUS_05910 4895 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 5558 7045 gene locus_tag LOCUS_05920 5558 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540305.1 protein_id gnl|my_center|LOCUS_05920 7049 7897 gene locus_tag LOCUS_05930 7049 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 7894 9051 gene locus_tag LOCUS_05940 7894 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 9048 9908 gene locus_tag LOCUS_05950 9048 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 9905 10864 gene locus_tag LOCUS_05960 9905 10864 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552051.1 protein_id gnl|my_center|LOCUS_05960 10908 12035 gene locus_tag LOCUS_05970 10908 12035 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552050.1 protein_id gnl|my_center|LOCUS_05970 12056 15139 gene locus_tag LOCUS_05980 12056 15139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 15136 16287 gene locus_tag LOCUS_05990 15136 16287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05990 17396 16380 gene locus_tag LOCUS_06000 17396 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 18210 17443 gene locus_tag LOCUS_06010 18210 17443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 20727 18655 gene locus_tag LOCUS_06020 20727 18655 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401304.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence025 <1 958 gene locus_tag LOCUS_06030 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943451.1:ABC transporter ATP-binding protein 962 2083 gene locus_tag LOCUS_06040 962 2083 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_06040 2080 3219 gene locus_tag LOCUS_06050 2080 3219 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_06050 4316 3231 gene locus_tag LOCUS_06060 4316 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 6272 4485 gene locus_tag LOCUS_06070 6272 4485 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_06070 7033 6269 gene locus_tag LOCUS_06080 gene otsB 7033 6269 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533988.1 protein_id gnl|my_center|LOCUS_06080 9249 7033 gene locus_tag LOCUS_06090 9249 7033 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942973.1 protein_id gnl|my_center|LOCUS_06090 9542 9469 gene locus_tag LOCUS_t00050 9542 9469 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10686 9895 gene locus_tag LOCUS_06100 10686 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 10787 12139 gene locus_tag LOCUS_06110 10787 12139 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_06110 12828 12274 gene locus_tag LOCUS_06120 12828 12274 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142741.1 protein_id gnl|my_center|LOCUS_06120 13130 12825 gene locus_tag LOCUS_06130 13130 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 13777 13115 gene locus_tag LOCUS_06140 13777 13115 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583746.1 protein_id gnl|my_center|LOCUS_06140 14520 13759 gene locus_tag LOCUS_06150 gene surE 14520 13759 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698379.1 protein_id gnl|my_center|LOCUS_06150 14888 14520 gene locus_tag LOCUS_06160 14888 14520 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831050.1 protein_id gnl|my_center|LOCUS_06160 15880 14888 gene locus_tag LOCUS_06170 15880 14888 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_06170 16518 15877 gene locus_tag LOCUS_06180 gene plsY 16518 15877 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531489.1 protein_id gnl|my_center|LOCUS_06180 17837 16515 gene locus_tag LOCUS_06190 gene der 17837 16515 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_06190 19138 17834 gene locus_tag LOCUS_06200 19138 17834 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_06200 20776 19277 gene locus_tag LOCUS_06210 20776 19277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 <21347 20848 gene locus_tag LOCUS_06220 <21347 20848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015146.1:nickel pincer cofactor biosynthesis protein LarC >Feature sequence026 <1 876 gene locus_tag LOCUS_06230 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016267339.1:SGNH/GDSL hydrolase family protein 1427 903 gene locus_tag LOCUS_06240 1427 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225144.1 protein_id gnl|my_center|LOCUS_06240 2684 1584 gene locus_tag LOCUS_06250 2684 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_06250 3741 2701 gene locus_tag LOCUS_06260 gene cydB 3741 2701 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_06260 5096 3744 gene locus_tag LOCUS_06270 5096 3744 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_06270 5226 7391 gene locus_tag LOCUS_06280 5226 7391 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_06280 7422 8207 gene locus_tag LOCUS_06290 7422 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 8204 10135 gene locus_tag LOCUS_06300 8204 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 11176 10211 gene locus_tag LOCUS_06310 11176 10211 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037942.1 protein_id gnl|my_center|LOCUS_06310 12574 11231 gene locus_tag LOCUS_06320 12574 11231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_06320 13755 12571 gene locus_tag LOCUS_06330 13755 12571 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_06330 14803 13748 gene locus_tag LOCUS_06340 14803 13748 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_06340 15365 14958 gene locus_tag LOCUS_06350 15365 14958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 15699 15920 gene locus_tag LOCUS_06360 15699 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 15917 17176 gene locus_tag LOCUS_06370 15917 17176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 17416 17343 gene locus_tag LOCUS_t00060 17416 17343 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18869 17553 gene locus_tag LOCUS_06380 18869 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 20105 18957 gene locus_tag LOCUS_06390 20105 18957 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_06390 20147 21208 gene locus_tag LOCUS_06400 20147 21208 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038014.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence027 86 556 gene locus_tag LOCUS_06410 86 556 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776788.1 protein_id gnl|my_center|LOCUS_06410 606 1523 gene locus_tag LOCUS_06420 606 1523 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023517.1 protein_id gnl|my_center|LOCUS_06420 2123 1605 gene locus_tag LOCUS_06430 2123 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 2993 2640 gene locus_tag LOCUS_06440 2993 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 3703 2990 gene locus_tag LOCUS_06450 3703 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4603 4133 gene locus_tag LOCUS_06460 4603 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5143 7644 gene locus_tag LOCUS_06470 5143 7644 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257621.1 protein_id gnl|my_center|LOCUS_06470 7819 8082 gene locus_tag LOCUS_06480 7819 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 8293 8442 gene locus_tag LOCUS_06490 8293 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 8477 8716 gene locus_tag LOCUS_06500 8477 8716 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404326.1 protein_id gnl|my_center|LOCUS_06500 8713 9147 gene locus_tag LOCUS_06510 8713 9147 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_06510 9144 9515 gene locus_tag LOCUS_06520 9144 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 9519 10394 gene locus_tag LOCUS_06530 9519 10394 CDS product DUF3883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338943.1 protein_id gnl|my_center|LOCUS_06530 10945 10451 gene locus_tag LOCUS_06540 10945 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 12220 10958 gene locus_tag LOCUS_06550 12220 10958 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929488.1 protein_id gnl|my_center|LOCUS_06550 12530 13138 gene locus_tag LOCUS_06560 12530 13138 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_06560 13135 13428 gene locus_tag LOCUS_06570 13135 13428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06570 13830 14069 gene locus_tag LOCUS_06580 13830 14069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 14386 14168 gene locus_tag LOCUS_06590 14386 14168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 14981 14379 gene locus_tag LOCUS_06600 14981 14379 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807607.1 protein_id gnl|my_center|LOCUS_06600 15214 15579 gene locus_tag LOCUS_06610 15214 15579 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311774.1 protein_id gnl|my_center|LOCUS_06610 15557 16063 gene locus_tag LOCUS_06620 15557 16063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 16120 16548 gene locus_tag LOCUS_06630 16120 16548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 16545 17024 gene locus_tag LOCUS_06640 16545 17024 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_06640 17987 17097 gene locus_tag LOCUS_06650 17987 17097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 17868 18158 gene locus_tag LOCUS_06660 17868 18158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 18250 18708 gene locus_tag LOCUS_06670 18250 18708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 18712 19848 gene locus_tag LOCUS_06680 18712 19848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 19845 20954 gene locus_tag LOCUS_06690 19845 20954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence028 580 1473 gene locus_tag LOCUS_06700 580 1473 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403665.1 protein_id gnl|my_center|LOCUS_06700 1470 2324 gene locus_tag LOCUS_06710 gene panC 1470 2324 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_06710 2321 3169 gene locus_tag LOCUS_06720 gene panB 2321 3169 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_06720 4099 3182 gene locus_tag LOCUS_06730 gene xerC 4099 3182 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_06730 4266 4583 gene locus_tag LOCUS_06740 4266 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 6419 4899 gene locus_tag LOCUS_06750 6419 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 6646 7335 gene locus_tag LOCUS_06760 6646 7335 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053585.1 protein_id gnl|my_center|LOCUS_06760 7371 7673 gene locus_tag LOCUS_06770 7371 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 9063 7675 gene locus_tag LOCUS_06780 gene trmFO 9063 7675 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_06780 10658 9060 gene locus_tag LOCUS_06790 10658 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06790 11453 10665 gene locus_tag LOCUS_06800 11453 10665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06800 11694 11458 gene locus_tag LOCUS_06810 11694 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 12289 11771 gene locus_tag LOCUS_06820 12289 11771 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393065.1 protein_id gnl|my_center|LOCUS_06820 13484 12291 gene locus_tag LOCUS_06830 gene aroC 13484 12291 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_06830 15511 13592 gene locus_tag LOCUS_06840 15511 13592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 16125 15508 gene locus_tag LOCUS_06850 16125 15508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 16769 16122 gene locus_tag LOCUS_06860 16769 16122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 17518 16772 gene locus_tag LOCUS_06870 17518 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 18581 17538 gene locus_tag LOCUS_06880 gene pilM 18581 17538 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_06880 19310 18861 gene locus_tag LOCUS_06890 19310 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 20062 19307 gene locus_tag LOCUS_06900 20062 19307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 20400 20059 gene locus_tag LOCUS_06910 20400 20059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence029 300 950 gene locus_tag LOCUS_06920 300 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1865 1104 gene locus_tag LOCUS_06930 1865 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2832 3464 gene locus_tag LOCUS_06940 2832 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 3897 5522 gene locus_tag LOCUS_06950 3897 5522 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966827.1 protein_id gnl|my_center|LOCUS_06950 6437 6129 gene locus_tag LOCUS_06960 6437 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 6324 6656 gene locus_tag LOCUS_06970 6324 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 6888 7517 gene locus_tag LOCUS_06980 6888 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 7642 9093 gene locus_tag LOCUS_06990 7642 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 9090 10277 gene locus_tag LOCUS_07000 9090 10277 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706768.1 protein_id gnl|my_center|LOCUS_07000 10290 13454 gene locus_tag LOCUS_07010 10290 13454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 14992 13565 gene locus_tag LOCUS_07020 14992 13565 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_07020 15175 16422 gene locus_tag LOCUS_07030 15175 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 16523 18934 gene locus_tag LOCUS_07040 16523 18934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 18974 20320 gene locus_tag LOCUS_07050 18974 20320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence030 <1 1812 gene locus_tag LOCUS_07060 <1 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083633.1:SulP family inorganic anion transporter 1812 2771 gene locus_tag LOCUS_07070 1812 2771 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_07070 3411 2779 gene locus_tag LOCUS_07080 3411 2779 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_07080 3668 3477 gene locus_tag LOCUS_07090 3668 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 5061 3733 gene locus_tag LOCUS_07100 5061 3733 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_07100 6559 5090 gene locus_tag LOCUS_07110 6559 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 8626 6620 gene locus_tag LOCUS_07120 8626 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 9542 8790 gene locus_tag LOCUS_07130 9542 8790 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919502.1 protein_id gnl|my_center|LOCUS_07130 9949 9749 gene locus_tag LOCUS_07140 9949 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 11759 9957 gene locus_tag LOCUS_07150 11759 9957 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_07150 11856 12596 gene locus_tag LOCUS_07160 11856 12596 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922086.1 protein_id gnl|my_center|LOCUS_07160 12593 13990 gene locus_tag LOCUS_07170 12593 13990 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_07170 13987 14499 gene locus_tag LOCUS_07180 13987 14499 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922085.1 protein_id gnl|my_center|LOCUS_07180 14985 14554 gene locus_tag LOCUS_07190 14985 14554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 17092 15008 gene locus_tag LOCUS_07200 17092 15008 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404722.1 protein_id gnl|my_center|LOCUS_07200 17268 18332 gene locus_tag LOCUS_07210 17268 18332 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267750.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07210 18329 18586 gene locus_tag LOCUS_07220 18329 18586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07220 18601 19503 gene locus_tag LOCUS_07230 18601 19503 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729776.1 protein_id gnl|my_center|LOCUS_07230 20094 19573 gene locus_tag LOCUS_07240 20094 19573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 >Feature sequence031 1391 282 gene locus_tag LOCUS_07250 1391 282 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243509.1 protein_id gnl|my_center|LOCUS_07250 3762 1396 gene locus_tag LOCUS_07260 3762 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 3834 4802 gene locus_tag LOCUS_07270 3834 4802 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_07270 5393 4866 gene locus_tag LOCUS_07280 5393 4866 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551114.1 protein_id gnl|my_center|LOCUS_07280 5490 6875 gene locus_tag LOCUS_07290 5490 6875 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_07290 8599 6872 gene locus_tag LOCUS_07300 8599 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 12602 8652 gene locus_tag LOCUS_07310 12602 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 12775 13467 gene locus_tag LOCUS_07320 12775 13467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 13596 15062 gene locus_tag LOCUS_07330 13596 15062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 15075 16349 gene locus_tag LOCUS_07340 15075 16349 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840043.1 protein_id gnl|my_center|LOCUS_07340 16346 17164 gene locus_tag LOCUS_07350 16346 17164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_07350 17379 18626 gene locus_tag LOCUS_07360 17379 18626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_07360 18629 19885 gene locus_tag LOCUS_07370 18629 19885 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339253.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence032 3737 339 gene locus_tag LOCUS_07380 3737 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_07380 7136 3891 gene locus_tag LOCUS_07390 7136 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 7275 10448 gene locus_tag LOCUS_07400 7275 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_07400 10586 12595 gene locus_tag LOCUS_07410 10586 12595 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_07410 13488 12622 gene locus_tag LOCUS_07420 13488 12622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 14661 13543 gene locus_tag LOCUS_07430 14661 13543 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_07430 15914 14658 gene locus_tag LOCUS_07440 15914 14658 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640575.1 protein_id gnl|my_center|LOCUS_07440 16310 16170 gene locus_tag LOCUS_07450 16310 16170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 17467 16448 gene locus_tag LOCUS_07460 gene nrfD 17467 16448 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937840.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07460 18426 17560 gene locus_tag LOCUS_07470 18426 17560 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937841.1 protein_id gnl|my_center|LOCUS_07470 18457 19143 gene locus_tag LOCUS_07480 18457 19143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence033 537 1349 gene locus_tag LOCUS_07490 537 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 1582 1499 gene locus_tag LOCUS_t00070 1582 1499 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2207 3421 gene locus_tag LOCUS_07500 2207 3421 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_07500 3418 4596 gene locus_tag LOCUS_07510 3418 4596 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064824.1 protein_id gnl|my_center|LOCUS_07510 4973 7279 gene locus_tag LOCUS_07520 4973 7279 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_07520 7293 8213 gene locus_tag LOCUS_07530 7293 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 8210 8380 gene locus_tag LOCUS_07540 8210 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 9178 8315 gene locus_tag LOCUS_07550 gene chbG 9178 8315 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593496.1 protein_id gnl|my_center|LOCUS_07550 9945 9175 gene locus_tag LOCUS_07560 9945 9175 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249319.1 protein_id gnl|my_center|LOCUS_07560 11063 9942 gene locus_tag LOCUS_07570 11063 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 11895 11203 gene locus_tag LOCUS_07580 11895 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 12671 11892 gene locus_tag LOCUS_07590 12671 11892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 13179 12658 gene locus_tag LOCUS_07600 13179 12658 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892873.1 protein_id gnl|my_center|LOCUS_07600 15640 13334 gene locus_tag LOCUS_07610 15640 13334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 19111 16052 gene locus_tag LOCUS_07620 19111 16052 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_07620 <19927 19108 gene locus_tag LOCUS_07630 <19927 19108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035814.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence034 2071 92 gene locus_tag LOCUS_07640 2071 92 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881096.1 protein_id gnl|my_center|LOCUS_07640 3091 2147 gene locus_tag LOCUS_07650 3091 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3129 4070 gene locus_tag LOCUS_07660 3129 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 4472 4188 gene locus_tag LOCUS_07670 4472 4188 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480331.1 protein_id gnl|my_center|LOCUS_07670 5717 4536 gene locus_tag LOCUS_07680 5717 4536 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_07680 5828 7429 gene locus_tag LOCUS_07690 5828 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 7426 8031 gene locus_tag LOCUS_07700 7426 8031 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583168.1 protein_id gnl|my_center|LOCUS_07700 10470 8224 gene locus_tag LOCUS_07710 10470 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 11600 10467 gene locus_tag LOCUS_07720 11600 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 11986 11600 gene locus_tag LOCUS_07730 11986 11600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 12145 12948 gene locus_tag LOCUS_07740 12145 12948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 12945 14333 gene locus_tag LOCUS_07750 12945 14333 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_07750 14912 14394 gene locus_tag LOCUS_07760 14912 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 14982 15599 gene locus_tag LOCUS_07770 gene coaE 14982 15599 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_07770 15658 16062 gene locus_tag LOCUS_07780 gene gcvH 15658 16062 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_07780 <19106 16199 gene locus_tag LOCUS_07790 <19106 16199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140250.1:aminomethyl-transferring glycine dehydrogenase >Feature sequence035 924 280 gene locus_tag LOCUS_07800 924 280 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_07800 2876 921 gene locus_tag LOCUS_07810 2876 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 3964 2960 gene locus_tag LOCUS_07820 3964 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 5157 3961 gene locus_tag LOCUS_07830 5157 3961 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_07830 10921 5189 gene locus_tag LOCUS_07840 10921 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07840 11092 12063 gene locus_tag LOCUS_07850 11092 12063 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_07850 13263 12067 gene locus_tag LOCUS_07860 13263 12067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 13615 14739 gene locus_tag LOCUS_07870 gene hppD 13615 14739 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_07870 14739 15920 gene locus_tag LOCUS_07880 14739 15920 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258372.1 protein_id gnl|my_center|LOCUS_07880 16026 17207 gene locus_tag LOCUS_07890 16026 17207 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065191.1 protein_id gnl|my_center|LOCUS_07890 17480 18868 gene locus_tag LOCUS_07900 17480 18868 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07900 >Feature sequence036 3980 1488 gene locus_tag LOCUS_07910 3980 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 4796 3984 gene locus_tag LOCUS_07920 4796 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 5697 4897 gene locus_tag LOCUS_07930 5697 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 7192 5744 gene locus_tag LOCUS_07940 7192 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 7540 11139 gene locus_tag LOCUS_07950 7540 11139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 11212 11763 gene locus_tag LOCUS_07960 gene msrA 11212 11763 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421586.1 protein_id gnl|my_center|LOCUS_07960 11863 12369 gene locus_tag LOCUS_07970 11863 12369 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284980.1 protein_id gnl|my_center|LOCUS_07970 12377 12730 gene locus_tag LOCUS_07980 12377 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 12727 13932 gene locus_tag LOCUS_07990 12727 13932 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 protein_id gnl|my_center|LOCUS_07990 14003 14521 gene locus_tag LOCUS_08000 14003 14521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 14521 15462 gene locus_tag LOCUS_08010 14521 15462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 15467 16321 gene locus_tag LOCUS_08020 15467 16321 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_08020 18008 16518 gene locus_tag LOCUS_08030 gene pap 18008 16518 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence037 924 28 gene locus_tag LOCUS_08040 924 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2414 921 gene locus_tag LOCUS_08050 2414 921 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_08050 3537 2644 gene locus_tag LOCUS_08060 3537 2644 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880940.1 protein_id gnl|my_center|LOCUS_08060 4878 3799 gene locus_tag LOCUS_08070 gene aroB 4878 3799 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056627.1 protein_id gnl|my_center|LOCUS_08070 5423 4872 gene locus_tag LOCUS_08080 5423 4872 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_08080 6532 5492 gene locus_tag LOCUS_08090 6532 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 6612 7628 gene locus_tag LOCUS_08100 6612 7628 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227955.1 protein_id gnl|my_center|LOCUS_08100 8128 7652 gene locus_tag LOCUS_08110 8128 7652 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404877.1 protein_id gnl|my_center|LOCUS_08110 8295 10541 gene locus_tag LOCUS_08120 8295 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 9803 9878 gene locus_tag LOCUS_t00080 9803 9878 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10543 15090 gene locus_tag LOCUS_08130 10543 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 15078 15992 gene locus_tag LOCUS_08140 15078 15992 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence038 142 1110 gene locus_tag LOCUS_08150 142 1110 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_08150 1094 4321 gene locus_tag LOCUS_08160 gene carB 1094 4321 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_08160 4503 5039 gene locus_tag LOCUS_08170 4503 5039 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_08170 5036 6076 gene locus_tag LOCUS_08180 gene wlbA 5036 6076 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_08180 6326 7438 gene locus_tag LOCUS_08190 6326 7438 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_08190 7500 8849 gene locus_tag LOCUS_08200 7500 8849 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257976.1 protein_id gnl|my_center|LOCUS_08200 8910 10214 gene locus_tag LOCUS_08210 8910 10214 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817149.1 protein_id gnl|my_center|LOCUS_08210 10211 11170 gene locus_tag LOCUS_08220 10211 11170 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_08220 11211 12005 gene locus_tag LOCUS_08230 11211 12005 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546017.1 protein_id gnl|my_center|LOCUS_08230 12009 12572 gene locus_tag LOCUS_08240 gene nadD 12009 12572 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_08240 12583 15825 gene locus_tag LOCUS_08250 gene secA 12583 15825 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_08250 15957 17324 gene locus_tag LOCUS_08260 15957 17324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 17393 18115 gene locus_tag LOCUS_08270 gene radC 17393 18115 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence039 2153 51 gene locus_tag LOCUS_08280 2153 51 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_08280 2305 2820 gene locus_tag LOCUS_08290 2305 2820 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 protein_id gnl|my_center|LOCUS_08290 2817 3812 gene locus_tag LOCUS_08300 2817 3812 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174253.1 protein_id gnl|my_center|LOCUS_08300 3954 4748 gene locus_tag LOCUS_08310 3954 4748 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035417.1 protein_id gnl|my_center|LOCUS_08310 4745 7267 gene locus_tag LOCUS_08320 4745 7267 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_08320 7270 7617 gene locus_tag LOCUS_08330 7270 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 7731 8231 gene locus_tag LOCUS_08340 7731 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 11306 8235 gene locus_tag LOCUS_08350 11306 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 13410 11365 gene locus_tag LOCUS_08360 13410 11365 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_08360 13732 16566 gene locus_tag LOCUS_08370 13732 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 16697 17245 gene locus_tag LOCUS_08380 16697 17245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 <18108 17395 gene locus_tag LOCUS_08390 <18108 17395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926111.1:SDR family oxidoreductase >Feature sequence040 640 1212 gene locus_tag LOCUS_08400 640 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1921 1469 gene locus_tag LOCUS_08410 1921 1469 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770938.1 protein_id gnl|my_center|LOCUS_08410 2365 1925 gene locus_tag LOCUS_08420 2365 1925 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976218.1 protein_id gnl|my_center|LOCUS_08420 2719 3003 gene locus_tag LOCUS_08430 2719 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 3727 3533 gene locus_tag LOCUS_08440 3727 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08440 4114 3887 gene locus_tag LOCUS_08450 4114 3887 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_08450 4165 4308 gene locus_tag LOCUS_08460 4165 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 4861 4424 gene locus_tag LOCUS_08470 4861 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 4799 5170 gene locus_tag LOCUS_08480 4799 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 5167 5556 gene locus_tag LOCUS_08490 5167 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 5853 6164 gene locus_tag LOCUS_08500 5853 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 6187 6669 gene locus_tag LOCUS_08510 6187 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 7328 6891 gene locus_tag LOCUS_08520 7328 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 7209 8087 gene locus_tag LOCUS_08530 7209 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 8320 8679 gene locus_tag LOCUS_08540 8320 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 8867 9118 gene locus_tag LOCUS_08550 8867 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 9168 9461 gene locus_tag LOCUS_08560 9168 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 9605 9853 gene locus_tag LOCUS_08570 9605 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 9978 10211 gene locus_tag LOCUS_08580 9978 10211 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898525.1 protein_id gnl|my_center|LOCUS_08580 11602 10313 gene locus_tag LOCUS_08590 gene hflX 11602 10313 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933052.1 protein_id gnl|my_center|LOCUS_08590 11973 12131 gene locus_tag LOCUS_08600 11973 12131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 12085 12477 gene locus_tag LOCUS_08610 12085 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 12560 12883 gene locus_tag LOCUS_08620 12560 12883 CDS product type II toxin-antitoxin system PrlF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087280.1 protein_id gnl|my_center|LOCUS_08620 12943 13329 gene locus_tag LOCUS_08630 12943 13329 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 protein_id gnl|my_center|LOCUS_08630 13413 13922 gene locus_tag LOCUS_08640 13413 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 13956 14180 gene locus_tag LOCUS_08650 13956 14180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 14773 14372 gene locus_tag LOCUS_08660 14773 14372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 14918 15241 gene locus_tag LOCUS_08670 14918 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 15235 15654 gene locus_tag LOCUS_08680 15235 15654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 15707 16234 gene locus_tag LOCUS_08690 15707 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 16231 16401 gene locus_tag LOCUS_08700 16231 16401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 17790 16489 gene locus_tag LOCUS_08710 17790 16489 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence041 1548 1057 gene locus_tag LOCUS_08720 1548 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 2636 1755 gene locus_tag LOCUS_08730 gene catE 2636 1755 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 protein_id gnl|my_center|LOCUS_08730 2858 3181 gene locus_tag LOCUS_08740 2858 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 4585 3251 gene locus_tag LOCUS_08750 4585 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 6132 4801 gene locus_tag LOCUS_08760 6132 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 7831 6275 gene locus_tag LOCUS_08770 7831 6275 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_08770 8366 7947 gene locus_tag LOCUS_08780 8366 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 8650 8411 gene locus_tag LOCUS_08790 8650 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 10340 8796 gene locus_tag LOCUS_08800 10340 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 11063 10524 gene locus_tag LOCUS_08810 11063 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 11503 11117 gene locus_tag LOCUS_08820 11503 11117 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857681.1 protein_id gnl|my_center|LOCUS_08820 11739 11503 gene locus_tag LOCUS_08830 11739 11503 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_08830 14038 12017 gene locus_tag LOCUS_08840 14038 12017 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_08840 15030 14677 gene locus_tag LOCUS_08850 15030 14677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 16080 15079 gene locus_tag LOCUS_08860 16080 15079 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265901.1 protein_id gnl|my_center|LOCUS_08860 16786 16208 gene locus_tag LOCUS_08870 gene rsxA 16786 16208 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133204.1 protein_id gnl|my_center|LOCUS_08870 17469 16783 gene locus_tag LOCUS_08880 17469 16783 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_08880 <18035 17466 gene locus_tag LOCUS_08890 <18035 17466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583455.1:RnfABCDGE type electron transport complex subunit G >Feature sequence042 1712 3334 gene locus_tag LOCUS_08900 1712 3334 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_08900 3334 3501 gene locus_tag LOCUS_08910 3334 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5113 3650 gene locus_tag LOCUS_08920 gene guaB 5113 3650 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227931.1 protein_id gnl|my_center|LOCUS_08920 6020 5226 gene locus_tag LOCUS_08930 6020 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 6765 6310 gene locus_tag LOCUS_08940 6765 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 7947 6937 gene locus_tag LOCUS_08950 7947 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 8861 7950 gene locus_tag LOCUS_08960 8861 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 9981 9115 gene locus_tag LOCUS_08970 9981 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 10568 9981 gene locus_tag LOCUS_08980 10568 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 11641 10565 gene locus_tag LOCUS_08990 11641 10565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 11740 13275 gene locus_tag LOCUS_09000 gene gpmI 11740 13275 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_09000 13280 13966 gene locus_tag LOCUS_09010 13280 13966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 13971 14393 gene locus_tag LOCUS_09020 13971 14393 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_09020 14410 15126 gene locus_tag LOCUS_09030 14410 15126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09030 15140 15745 gene locus_tag LOCUS_09040 15140 15745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09040 15742 16272 gene locus_tag LOCUS_09050 gene mobB 15742 16272 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328558.1 protein_id gnl|my_center|LOCUS_09050 16275 17768 gene locus_tag LOCUS_09060 gene dacB 16275 17768 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403836.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence043 1401 46 gene locus_tag LOCUS_09070 1401 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1593 1423 gene locus_tag LOCUS_09080 1593 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1719 1946 gene locus_tag LOCUS_09090 1719 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3487 2120 gene locus_tag LOCUS_09100 3487 2120 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640670.1 protein_id gnl|my_center|LOCUS_09100 4890 3556 gene locus_tag LOCUS_09110 4890 3556 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_09110 5139 5912 gene locus_tag LOCUS_09120 gene ddaH 5139 5912 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972278.1 protein_id gnl|my_center|LOCUS_09120 6343 5936 gene locus_tag LOCUS_09130 6343 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 6479 8446 gene locus_tag LOCUS_09140 6479 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 8957 8502 gene locus_tag LOCUS_09150 8957 8502 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660532.1 protein_id gnl|my_center|LOCUS_09150 9773 8976 gene locus_tag LOCUS_09160 9773 8976 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729258.1 protein_id gnl|my_center|LOCUS_09160 10613 9816 gene locus_tag LOCUS_09170 10613 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 11101 10610 gene locus_tag LOCUS_09180 11101 10610 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022592.1 protein_id gnl|my_center|LOCUS_09180 11536 11126 gene locus_tag LOCUS_09190 11536 11126 CDS product DUF3224 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071754.1 protein_id gnl|my_center|LOCUS_09190 12625 11612 gene locus_tag LOCUS_09200 12625 11612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 13619 12732 gene locus_tag LOCUS_09210 13619 12732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 13779 15035 gene locus_tag LOCUS_09220 13779 15035 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_09220 16802 15042 gene locus_tag LOCUS_09230 16802 15042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 17432 16830 gene locus_tag LOCUS_09240 17432 16830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence044 <1 1882 gene locus_tag LOCUS_09250 <1 1882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082850.1:ATP-dependent Clp protease ATP-binding subunit 1966 4383 gene locus_tag LOCUS_09260 gene bamA 1966 4383 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_09260 4399 5046 gene locus_tag LOCUS_09270 4399 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5078 6130 gene locus_tag LOCUS_09280 gene lpxD 5078 6130 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_09280 6127 7395 gene locus_tag LOCUS_09290 6127 7395 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_09290 7392 8168 gene locus_tag LOCUS_09300 gene lpxA 7392 8168 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_09300 8165 9199 gene locus_tag LOCUS_09310 8165 9199 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771932.1 protein_id gnl|my_center|LOCUS_09310 9192 10313 gene locus_tag LOCUS_09320 gene lpxB 9192 10313 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_09320 10310 10996 gene locus_tag LOCUS_09330 10310 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 10989 11999 gene locus_tag LOCUS_09340 10989 11999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 12041 13351 gene locus_tag LOCUS_09350 12041 13351 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403282.1 protein_id gnl|my_center|LOCUS_09350 13364 13828 gene locus_tag LOCUS_09360 gene rlmH 13364 13828 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989404.1 protein_id gnl|my_center|LOCUS_09360 13988 15535 gene locus_tag LOCUS_09370 gene bshC 13988 15535 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933222.1 protein_id gnl|my_center|LOCUS_09370 15576 17189 gene locus_tag LOCUS_09380 gene murJ 15576 17189 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence045 127 1677 gene locus_tag LOCUS_09390 127 1677 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_09390 2141 3703 gene locus_tag LOCUS_09400 2141 3703 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_09400 3700 4062 gene locus_tag LOCUS_09410 3700 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4059 4502 gene locus_tag LOCUS_09420 4059 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4541 6427 gene locus_tag LOCUS_09430 4541 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 7274 6627 gene locus_tag LOCUS_09440 7274 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 7331 8062 gene locus_tag LOCUS_09450 7331 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 8161 9996 gene locus_tag LOCUS_09460 8161 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 10133 11200 gene locus_tag LOCUS_09470 10133 11200 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943997.1 protein_id gnl|my_center|LOCUS_09470 11329 12462 gene locus_tag LOCUS_09480 11329 12462 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704969.1 protein_id gnl|my_center|LOCUS_09480 14054 12459 gene locus_tag LOCUS_09490 14054 12459 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_09490 14639 14106 gene locus_tag LOCUS_09500 14639 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 15740 14823 gene locus_tag LOCUS_09510 15740 14823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence046 1148 144 gene locus_tag LOCUS_09520 1148 144 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_09520 2473 1145 gene locus_tag LOCUS_09530 gene rsxC 2473 1145 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_09530 7509 2473 gene locus_tag LOCUS_09540 7509 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 8348 7506 gene locus_tag LOCUS_09550 8348 7506 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_09550 9364 8363 gene locus_tag LOCUS_09560 9364 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 10307 9354 gene locus_tag LOCUS_09570 10307 9354 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_09570 12190 10304 gene locus_tag LOCUS_09580 12190 10304 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896022.1 protein_id gnl|my_center|LOCUS_09580 12531 13064 gene locus_tag LOCUS_09590 12531 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 13601 16351 gene locus_tag LOCUS_09600 13601 16351 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942970.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence047 1368 523 gene locus_tag LOCUS_09610 1368 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1546 2730 gene locus_tag LOCUS_09620 1546 2730 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460346.1 protein_id gnl|my_center|LOCUS_09620 2823 4013 gene locus_tag LOCUS_09630 2823 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 6183 4051 gene locus_tag LOCUS_09640 gene ppk1 6183 4051 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_09640 7230 6199 gene locus_tag LOCUS_09650 7230 6199 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086819.1 protein_id gnl|my_center|LOCUS_09650 7847 7233 gene locus_tag LOCUS_09660 7847 7233 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_09660 8816 8037 gene locus_tag LOCUS_09670 8816 8037 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_09670 9188 11116 gene locus_tag LOCUS_09680 gene dnaK 9188 11116 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_09680 11314 12855 gene locus_tag LOCUS_09690 gene mucD 11314 12855 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_09690 12984 13065 gene locus_tag LOCUS_t00090 12984 13065 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13341 14585 gene locus_tag LOCUS_09700 gene tig 13341 14585 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144179.1 protein_id gnl|my_center|LOCUS_09700 14599 15306 gene locus_tag LOCUS_09710 gene clpP 14599 15306 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193408.1 protein_id gnl|my_center|LOCUS_09710 15441 16694 gene locus_tag LOCUS_09720 gene clpX 15441 16694 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence048 561 1472 gene locus_tag LOCUS_09730 561 1472 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257188.1 protein_id gnl|my_center|LOCUS_09730 1594 1926 gene locus_tag LOCUS_09740 1594 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2290 3693 gene locus_tag LOCUS_09750 2290 3693 CDS product IS701-like element ISBj9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087945.1 protein_id gnl|my_center|LOCUS_09750 3863 4537 gene locus_tag LOCUS_09760 3863 4537 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_09760 4534 4884 gene locus_tag LOCUS_09770 4534 4884 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707068.1 protein_id gnl|my_center|LOCUS_09770 4902 6053 gene locus_tag LOCUS_09780 4902 6053 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900904.1 protein_id gnl|my_center|LOCUS_09780 6044 7471 gene locus_tag LOCUS_09790 6044 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 8084 7536 gene locus_tag LOCUS_09800 8084 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 8612 8253 gene locus_tag LOCUS_09810 8612 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 9240 8854 gene locus_tag LOCUS_09820 9240 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 9244 10137 gene locus_tag LOCUS_09830 9244 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 10137 11633 gene locus_tag LOCUS_09840 10137 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 11650 14793 gene locus_tag LOCUS_09850 11650 14793 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_09850 15949 14972 gene locus_tag LOCUS_09860 15949 14972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 16014 16343 gene locus_tag LOCUS_09870 16014 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 <17528 16377 gene locus_tag LOCUS_09880 <17528 16377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003816030.1:catalase >Feature sequence049 436 2016 gene locus_tag LOCUS_09890 gene rny 436 2016 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_09890 2018 2908 gene locus_tag LOCUS_09900 gene folD 2018 2908 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_09900 2931 4205 gene locus_tag LOCUS_09910 gene xseA 2931 4205 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119437.1 protein_id gnl|my_center|LOCUS_09910 4202 4414 gene locus_tag LOCUS_09920 4202 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 4401 5300 gene locus_tag LOCUS_09930 4401 5300 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140419.1 protein_id gnl|my_center|LOCUS_09930 5355 7259 gene locus_tag LOCUS_09940 gene dxs 5355 7259 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_09940 7259 8122 gene locus_tag LOCUS_09950 7259 8122 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_09950 8362 10089 gene locus_tag LOCUS_09960 gene recN 8362 10089 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_09960 11710 10037 gene locus_tag LOCUS_09970 11710 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 11776 13554 gene locus_tag LOCUS_09980 11776 13554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 13568 14710 gene locus_tag LOCUS_09990 gene galK 13568 14710 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_09990 14843 14916 gene locus_tag LOCUS_t00100 14843 14916 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15077 15161 gene locus_tag LOCUS_t00110 15077 15161 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15811 15338 gene locus_tag LOCUS_10000 15811 15338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 16215 16027 gene locus_tag LOCUS_10010 16215 16027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 16453 17214 gene locus_tag LOCUS_10020 16453 17214 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence050 1086 478 gene locus_tag LOCUS_10030 1086 478 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660625.1 protein_id gnl|my_center|LOCUS_10030 1844 1182 gene locus_tag LOCUS_10040 1844 1182 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140612.1 protein_id gnl|my_center|LOCUS_10040 2003 2791 gene locus_tag LOCUS_10050 2003 2791 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_10050 2938 3669 gene locus_tag LOCUS_10060 2938 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3680 6754 gene locus_tag LOCUS_10070 3680 6754 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_10070 6768 8198 gene locus_tag LOCUS_10080 gene nrfD 6768 8198 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_10080 8198 8698 gene locus_tag LOCUS_10090 8198 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 8688 9410 gene locus_tag LOCUS_10100 8688 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 9407 10747 gene locus_tag LOCUS_10110 9407 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 11245 10871 gene locus_tag LOCUS_10120 11245 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 11449 11521 gene locus_tag LOCUS_t00120 11449 11521 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11811 12548 gene locus_tag LOCUS_10130 gene ccmA 11811 12548 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887051.1 protein_id gnl|my_center|LOCUS_10130 12548 13234 gene locus_tag LOCUS_10140 12548 13234 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887052.1 protein_id gnl|my_center|LOCUS_10140 13243 13956 gene locus_tag LOCUS_10150 gene ccsA 13243 13956 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_10150 13949 14107 gene locus_tag LOCUS_10160 13949 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 14104 14556 gene locus_tag LOCUS_10170 gene ccmE 14104 14556 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228655.1 protein_id gnl|my_center|LOCUS_10170 14553 16547 gene locus_tag LOCUS_10180 14553 16547 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_10180 15914 15988 gene locus_tag LOCUS_t00130 15914 15988 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence051 44 532 gene locus_tag LOCUS_10190 44 532 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_10190 545 1222 gene locus_tag LOCUS_10200 545 1222 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_10200 1239 1910 gene locus_tag LOCUS_10210 gene pgsA 1239 1910 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404053.1 protein_id gnl|my_center|LOCUS_10210 1988 3247 gene locus_tag LOCUS_10220 1988 3247 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_10220 3585 4214 gene locus_tag LOCUS_10230 3585 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 4222 5370 gene locus_tag LOCUS_10240 gene dnaJ 4222 5370 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230872.1 protein_id gnl|my_center|LOCUS_10240 6472 5414 gene locus_tag LOCUS_10250 gene mnmA 6472 5414 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389777.1 protein_id gnl|my_center|LOCUS_10250 7635 6472 gene locus_tag LOCUS_10260 gene nifS 7635 6472 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_10260 8077 7655 gene locus_tag LOCUS_10270 8077 7655 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870191.1 protein_id gnl|my_center|LOCUS_10270 8164 10032 gene locus_tag LOCUS_10280 8164 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 10652 10107 gene locus_tag LOCUS_10290 10652 10107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 11302 10655 gene locus_tag LOCUS_10300 11302 10655 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404252.1 protein_id gnl|my_center|LOCUS_10300 12079 11360 gene locus_tag LOCUS_10310 gene bshB1 12079 11360 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_10310 12292 12687 gene locus_tag LOCUS_10320 12292 12687 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262045.1 protein_id gnl|my_center|LOCUS_10320 12684 13487 gene locus_tag LOCUS_10330 12684 13487 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_10330 13971 13576 gene locus_tag LOCUS_10340 13971 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 14358 14146 gene locus_tag LOCUS_10350 14358 14146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 14246 15922 gene locus_tag LOCUS_10360 14246 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 16054 16443 gene locus_tag LOCUS_10370 16054 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence052 1743 16 gene locus_tag LOCUS_10380 1743 16 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_10380 1776 2309 gene locus_tag LOCUS_10390 1776 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2369 3415 gene locus_tag LOCUS_10400 2369 3415 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085973.1 protein_id gnl|my_center|LOCUS_10400 3582 4541 gene locus_tag LOCUS_10410 3582 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 4538 4888 gene locus_tag LOCUS_10420 4538 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4875 5810 gene locus_tag LOCUS_10430 4875 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10430 5813 6418 gene locus_tag LOCUS_10440 5813 6418 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088861.1 protein_id gnl|my_center|LOCUS_10440 6471 7001 gene locus_tag LOCUS_10450 6471 7001 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_10450 7003 7548 gene locus_tag LOCUS_10460 7003 7548 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938827.1 protein_id gnl|my_center|LOCUS_10460 8939 7617 gene locus_tag LOCUS_10470 8939 7617 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933883.1 protein_id gnl|my_center|LOCUS_10470 9987 9007 gene locus_tag LOCUS_10480 9987 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 10162 10467 gene locus_tag LOCUS_10490 10162 10467 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_10490 10604 12013 gene locus_tag LOCUS_10500 10604 12013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 12024 13052 gene locus_tag LOCUS_10510 12024 13052 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839428.1 protein_id gnl|my_center|LOCUS_10510 13055 16225 gene locus_tag LOCUS_10520 13055 16225 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_10520 16225 16515 gene locus_tag LOCUS_10530 16225 16515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence053 1102 188 gene locus_tag LOCUS_10540 gene pstA 1102 188 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_10540 2034 1102 gene locus_tag LOCUS_10550 gene pstC 2034 1102 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371940.1 protein_id gnl|my_center|LOCUS_10550 3218 2184 gene locus_tag LOCUS_10560 gene pstS 3218 2184 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809635.1 protein_id gnl|my_center|LOCUS_10560 5090 3363 gene locus_tag LOCUS_10570 gene phoR 5090 3363 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_10570 5794 5087 gene locus_tag LOCUS_10580 5794 5087 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_10580 6414 5791 gene locus_tag LOCUS_10590 gene udk 6414 5791 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986880.1 protein_id gnl|my_center|LOCUS_10590 6616 9840 gene locus_tag LOCUS_10600 6616 9840 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714156.1 protein_id gnl|my_center|LOCUS_10600 9837 10073 gene locus_tag LOCUS_10610 9837 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 10070 11116 gene locus_tag LOCUS_10620 gene add 10070 11116 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838307.1 protein_id gnl|my_center|LOCUS_10620 11113 11952 gene locus_tag LOCUS_10630 11113 11952 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_10630 12956 12144 gene locus_tag LOCUS_10640 12956 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 12972 13730 gene locus_tag LOCUS_10650 12972 13730 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808211.1 protein_id gnl|my_center|LOCUS_10650 13805 14641 gene locus_tag LOCUS_10660 13805 14641 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_10660 14680 15951 gene locus_tag LOCUS_10670 14680 15951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence054 229 1137 gene locus_tag LOCUS_10680 229 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1179 1442 gene locus_tag LOCUS_10690 1179 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1480 2358 gene locus_tag LOCUS_10700 1480 2358 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_10700 2355 3086 gene locus_tag LOCUS_10710 2355 3086 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_10710 3214 4194 gene locus_tag LOCUS_10720 gene trxB 3214 4194 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869571.1 protein_id gnl|my_center|LOCUS_10720 4194 4835 gene locus_tag LOCUS_10730 4194 4835 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228812.1 protein_id gnl|my_center|LOCUS_10730 4832 5314 gene locus_tag LOCUS_10740 4832 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 5311 6108 gene locus_tag LOCUS_10750 5311 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 6113 7504 gene locus_tag LOCUS_10760 6113 7504 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941147.1 protein_id gnl|my_center|LOCUS_10760 7537 7989 gene locus_tag LOCUS_10770 gene iscR 7537 7989 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039699.1 protein_id gnl|my_center|LOCUS_10770 7994 8566 gene locus_tag LOCUS_10780 7994 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 8767 8682 gene locus_tag LOCUS_t00140 8767 8682 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8929 9396 gene locus_tag LOCUS_10790 gene smpB 8929 9396 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723350.1 protein_id gnl|my_center|LOCUS_10790 9393 10619 gene locus_tag LOCUS_10800 9393 10619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 10616 12106 gene locus_tag LOCUS_10810 10616 12106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 12103 13035 gene locus_tag LOCUS_10820 12103 13035 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028173.1 protein_id gnl|my_center|LOCUS_10820 13095 13748 gene locus_tag LOCUS_10830 gene pyrF 13095 13748 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141657.1 protein_id gnl|my_center|LOCUS_10830 13768 14154 gene locus_tag LOCUS_10840 13768 14154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 14161 14538 gene locus_tag LOCUS_10850 gene rpsM 14161 14538 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633368.1 protein_id gnl|my_center|LOCUS_10850 14538 14915 gene locus_tag LOCUS_10860 gene rpsK 14538 14915 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_10860 14919 15551 gene locus_tag LOCUS_10870 gene rpsD 14919 15551 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence055 64 1380 gene locus_tag LOCUS_10880 64 1380 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_10880 2287 1427 gene locus_tag LOCUS_10890 2287 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3132 2305 gene locus_tag LOCUS_10900 3132 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3252 5087 gene locus_tag LOCUS_10910 gene typA 3252 5087 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_10910 5119 5499 gene locus_tag LOCUS_10920 5119 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 5658 5733 gene locus_tag LOCUS_t00150 5658 5733 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 6002 5847 gene locus_tag LOCUS_10930 6002 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 6047 6367 gene locus_tag LOCUS_10940 6047 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 7326 6484 gene locus_tag LOCUS_10950 gene fdhD 7326 6484 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 protein_id gnl|my_center|LOCUS_10950 8294 7323 gene locus_tag LOCUS_10960 8294 7323 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972421.1 protein_id gnl|my_center|LOCUS_10960 10171 8291 gene locus_tag LOCUS_10970 10171 8291 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_10970 11766 10171 gene locus_tag LOCUS_10980 11766 10171 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972418.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10980 12282 11836 gene locus_tag LOCUS_10990 12282 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10990 12876 13475 gene locus_tag LOCUS_11000 12876 13475 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774866.1 protein_id gnl|my_center|LOCUS_11000 13472 14005 gene locus_tag LOCUS_11010 13472 14005 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 protein_id gnl|my_center|LOCUS_11010 14018 14956 gene locus_tag LOCUS_11020 14018 14956 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_11020 15157 16524 gene locus_tag LOCUS_11030 15157 16524 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence056 1905 781 gene locus_tag LOCUS_11040 1905 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3271 1907 gene locus_tag LOCUS_11050 3271 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4104 3286 gene locus_tag LOCUS_11060 4104 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4612 4217 gene locus_tag LOCUS_11070 4612 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 4701 6263 gene locus_tag LOCUS_11080 4701 6263 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_11080 6263 8080 gene locus_tag LOCUS_11090 gene msbA 6263 8080 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_11090 8084 9169 gene locus_tag LOCUS_11100 8084 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 9169 10341 gene locus_tag LOCUS_11110 9169 10341 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_11110 10341 11255 gene locus_tag LOCUS_11120 10341 11255 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931905.1 protein_id gnl|my_center|LOCUS_11120 11275 12429 gene locus_tag LOCUS_11130 11275 12429 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_11130 12426 13256 gene locus_tag LOCUS_11140 12426 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 14512 13253 gene locus_tag LOCUS_11150 gene tyrS 14512 13253 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357324.1 protein_id gnl|my_center|LOCUS_11150 15792 14569 gene locus_tag LOCUS_11160 15792 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 <16511 15789 gene locus_tag LOCUS_11170 <16511 15789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121410.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence057 507 2648 gene locus_tag LOCUS_11180 507 2648 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_11180 2645 4000 gene locus_tag LOCUS_11190 2645 4000 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_11190 4222 5121 gene locus_tag LOCUS_11200 gene ilvE 4222 5121 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_11200 5166 5759 gene locus_tag LOCUS_11210 5166 5759 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_11210 6534 5863 gene locus_tag LOCUS_11220 6534 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 8243 6534 gene locus_tag LOCUS_11230 8243 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 9784 8411 gene locus_tag LOCUS_11240 9784 8411 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_11240 10139 9792 gene locus_tag LOCUS_11250 10139 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 10414 10136 gene locus_tag LOCUS_11260 10414 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 11621 10401 gene locus_tag LOCUS_11270 11621 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 12049 13791 gene locus_tag LOCUS_11280 12049 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 13802 14461 gene locus_tag LOCUS_11290 13802 14461 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356430.1 protein_id gnl|my_center|LOCUS_11290 15290 14628 gene locus_tag LOCUS_11300 15290 14628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 <16294 15411 gene locus_tag LOCUS_11310 <16294 15411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403160.1:glycine C-acetyltransferase >Feature sequence058 <1 2103 gene locus_tag LOCUS_11320 <1 2103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_121850300.1:SusC/RagA family TonB-linked outer membrane protein 2115 3422 gene locus_tag LOCUS_11330 2115 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 3563 3982 gene locus_tag LOCUS_11340 3563 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 6813 4465 gene locus_tag LOCUS_11350 6813 4465 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942659.1 protein_id gnl|my_center|LOCUS_11350 9068 7044 gene locus_tag LOCUS_11360 9068 7044 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 protein_id gnl|my_center|LOCUS_11360 10132 9068 gene locus_tag LOCUS_11370 10132 9068 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_11370 12075 10132 gene locus_tag LOCUS_11380 12075 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 13028 12084 gene locus_tag LOCUS_11390 13028 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 13758 13111 gene locus_tag LOCUS_11400 13758 13111 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_11400 14984 13860 gene locus_tag LOCUS_11410 14984 13860 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence059 185 880 gene locus_tag LOCUS_11420 185 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1052 6337 gene locus_tag LOCUS_11430 1052 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 7165 6356 gene locus_tag LOCUS_11440 7165 6356 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928572.1 protein_id gnl|my_center|LOCUS_11440 7377 7162 gene locus_tag LOCUS_11450 7377 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 7438 8292 gene locus_tag LOCUS_11460 7438 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 8446 8210 gene locus_tag LOCUS_11470 8446 8210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 8946 8443 gene locus_tag LOCUS_11480 8946 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 9063 9563 gene locus_tag LOCUS_11490 gene soxR 9063 9563 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706522.1 protein_id gnl|my_center|LOCUS_11490 10441 9569 gene locus_tag LOCUS_11500 10441 9569 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222877.1 protein_id gnl|my_center|LOCUS_11500 10553 11023 gene locus_tag LOCUS_11510 10553 11023 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090535.1 protein_id gnl|my_center|LOCUS_11510 12537 11113 gene locus_tag LOCUS_11520 12537 11113 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_11520 13123 13992 gene locus_tag LOCUS_11530 13123 13992 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_11530 14032 14316 gene locus_tag LOCUS_11540 14032 14316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 14319 14603 gene locus_tag LOCUS_11550 14319 14603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence060 613 1743 gene locus_tag LOCUS_11560 gene asnA 613 1743 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_11560 1825 2760 gene locus_tag LOCUS_11570 1825 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3025 6042 gene locus_tag LOCUS_11580 3025 6042 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_11580 6052 7404 gene locus_tag LOCUS_11590 6052 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 7416 8495 gene locus_tag LOCUS_11600 7416 8495 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038014.1 protein_id gnl|my_center|LOCUS_11600 8572 8886 gene locus_tag LOCUS_11610 8572 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 9252 10712 gene locus_tag LOCUS_11620 9252 10712 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_11620 12119 10866 gene locus_tag LOCUS_11630 12119 10866 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_11630 13525 12131 gene locus_tag LOCUS_11640 13525 12131 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 protein_id gnl|my_center|LOCUS_11640 13887 15437 gene locus_tag LOCUS_11650 13887 15437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence061 1904 93 gene locus_tag LOCUS_11660 1904 93 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870027.1 protein_id gnl|my_center|LOCUS_11660 2707 1901 gene locus_tag LOCUS_11670 2707 1901 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_11670 5788 2996 gene locus_tag LOCUS_11680 5788 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 6566 6006 gene locus_tag LOCUS_11690 6566 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 7038 6685 gene locus_tag LOCUS_11700 gene queD 7038 6685 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008576903.1 protein_id gnl|my_center|LOCUS_11700 7720 7082 gene locus_tag LOCUS_11710 gene queE 7720 7082 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_11710 8517 7792 gene locus_tag LOCUS_11720 gene queC 8517 7792 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_11720 9545 8514 gene locus_tag LOCUS_11730 9545 8514 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_11730 10493 9549 gene locus_tag LOCUS_11740 10493 9549 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_11740 12016 10676 gene locus_tag LOCUS_11750 12016 10676 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_11750 12586 12239 gene locus_tag LOCUS_11760 12586 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 12850 12590 gene locus_tag LOCUS_11770 12850 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 12931 13332 gene locus_tag LOCUS_11780 12931 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 13381 15309 gene locus_tag LOCUS_11790 13381 15309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence062 <1 1032 gene locus_tag LOCUS_11800 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615370.1:cytochrome-c oxidase, cbb3-type subunit I 1032 1214 gene locus_tag LOCUS_11810 1032 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1240 1839 gene locus_tag LOCUS_11820 1240 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1920 3344 gene locus_tag LOCUS_11830 gene ccoG 1920 3344 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_11830 3341 3817 gene locus_tag LOCUS_11840 3341 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 3817 4569 gene locus_tag LOCUS_11850 3817 4569 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615371.1 protein_id gnl|my_center|LOCUS_11850 4625 7054 gene locus_tag LOCUS_11860 4625 7054 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120873.1 protein_id gnl|my_center|LOCUS_11860 7051 7227 gene locus_tag LOCUS_11870 7051 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 7659 7267 gene locus_tag LOCUS_11880 7659 7267 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_11880 8300 8070 gene locus_tag LOCUS_11890 8300 8070 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_11890 8592 8302 gene locus_tag LOCUS_11900 8592 8302 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_11900 9137 8763 gene locus_tag LOCUS_11910 9137 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 9481 9134 gene locus_tag LOCUS_11920 9481 9134 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_11920 10517 9732 gene locus_tag LOCUS_11930 10517 9732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 11568 10612 gene locus_tag LOCUS_11940 11568 10612 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_11940 15103 11834 gene locus_tag LOCUS_11950 15103 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence063 2594 3517 gene locus_tag LOCUS_11960 2594 3517 CDS product TRAP transporter TatT component family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682338.1 protein_id gnl|my_center|LOCUS_11960 3530 4555 gene locus_tag LOCUS_11970 3530 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 4552 6375 gene locus_tag LOCUS_11980 4552 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 6945 6855 gene locus_tag LOCUS_t00160 6945 6855 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7974 7312 gene locus_tag LOCUS_11990 7974 7312 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029057.1 protein_id gnl|my_center|LOCUS_11990 8214 8552 gene locus_tag LOCUS_12000 8214 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 8667 9356 gene locus_tag LOCUS_12010 8667 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12010 10396 9353 gene locus_tag LOCUS_12020 10396 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 12407 10398 gene locus_tag LOCUS_12030 12407 10398 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403313.1 protein_id gnl|my_center|LOCUS_12030 12688 12518 gene locus_tag LOCUS_12040 12688 12518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 12863 13240 gene locus_tag LOCUS_12050 12863 13240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 14079 13237 gene locus_tag LOCUS_12060 14079 13237 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037362.1 protein_id gnl|my_center|LOCUS_12060 <15126 14076 gene locus_tag LOCUS_12070 <15126 14076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037363.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence064 947 546 gene locus_tag LOCUS_12080 947 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1576 1022 gene locus_tag LOCUS_12090 1576 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2590 1949 gene locus_tag LOCUS_12100 2590 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 3026 2691 gene locus_tag LOCUS_12110 3026 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4383 3214 gene locus_tag LOCUS_12120 4383 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 4950 4423 gene locus_tag LOCUS_12130 4950 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 6107 5604 gene locus_tag LOCUS_12140 gene paaJ 6107 5604 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039493.1 protein_id gnl|my_center|LOCUS_12140 6862 6101 gene locus_tag LOCUS_12150 gene paaC 6862 6101 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_12150 7161 6862 gene locus_tag LOCUS_12160 gene paaB 7161 6862 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069460051.1 protein_id gnl|my_center|LOCUS_12160 8150 7158 gene locus_tag LOCUS_12170 gene paaA 8150 7158 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523130.1 protein_id gnl|my_center|LOCUS_12170 8283 9059 gene locus_tag LOCUS_12180 8283 9059 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_12180 9601 9095 gene locus_tag LOCUS_12190 9601 9095 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977536.1 protein_id gnl|my_center|LOCUS_12190 9664 10881 gene locus_tag LOCUS_12200 9664 10881 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027702.1 protein_id gnl|my_center|LOCUS_12200 11091 12536 gene locus_tag LOCUS_12210 11091 12536 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258343.1 protein_id gnl|my_center|LOCUS_12210 12569 12964 gene locus_tag LOCUS_12220 12569 12964 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774559.1 protein_id gnl|my_center|LOCUS_12220 13388 14101 gene locus_tag LOCUS_12230 13388 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 <15047 14245 gene locus_tag LOCUS_12240 <15047 14245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338566.1:3-mercaptopyruvate sulfurtransferase note possible pseudo, frameshifted >Feature sequence065 <1 1397 gene locus_tag LOCUS_12250 <1 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941018.1:NADH-quinone oxidoreductase subunit M 1398 2912 gene locus_tag LOCUS_12260 1398 2912 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_12260 2996 4360 gene locus_tag LOCUS_12270 2996 4360 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869220.1 protein_id gnl|my_center|LOCUS_12270 4362 6806 gene locus_tag LOCUS_12280 4362 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 6968 8113 gene locus_tag LOCUS_12290 gene sucC 6968 8113 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_12290 8110 8982 gene locus_tag LOCUS_12300 gene sucD 8110 8982 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256597.1 protein_id gnl|my_center|LOCUS_12300 9127 9546 gene locus_tag LOCUS_12310 9127 9546 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933658.1 protein_id gnl|my_center|LOCUS_12310 9730 10254 gene locus_tag LOCUS_12320 9730 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 10278 10460 gene locus_tag LOCUS_12330 gene rpmF 10278 10460 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 protein_id gnl|my_center|LOCUS_12330 10463 11485 gene locus_tag LOCUS_12340 gene plsX 10463 11485 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402829.1 protein_id gnl|my_center|LOCUS_12340 11524 12471 gene locus_tag LOCUS_12350 11524 12471 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_12350 12478 13410 gene locus_tag LOCUS_12360 gene fabD 12478 13410 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_12360 13466 14197 gene locus_tag LOCUS_12370 gene fabG 13466 14197 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_12370 14260 14496 gene locus_tag LOCUS_12380 gene acpP 14260 14496 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence066 2795 1512 gene locus_tag LOCUS_12390 2795 1512 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932280.1 protein_id gnl|my_center|LOCUS_12390 3512 2808 gene locus_tag LOCUS_12400 3512 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 4717 3509 gene locus_tag LOCUS_12410 4717 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 6948 4714 gene locus_tag LOCUS_12420 6948 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 7466 10756 gene locus_tag LOCUS_12430 7466 10756 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222838248.1 protein_id gnl|my_center|LOCUS_12430 10823 12445 gene locus_tag LOCUS_12440 10823 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 12456 12953 gene locus_tag LOCUS_12450 12456 12953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 13006 13845 gene locus_tag LOCUS_12460 13006 13845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 13927 14688 gene locus_tag LOCUS_12470 13927 14688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence067 2276 1518 gene locus_tag LOCUS_12480 2276 1518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_12480 3949 2384 gene locus_tag LOCUS_12490 3949 2384 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943972.1 protein_id gnl|my_center|LOCUS_12490 5316 3946 gene locus_tag LOCUS_12500 5316 3946 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257983.1 protein_id gnl|my_center|LOCUS_12500 6257 5313 gene locus_tag LOCUS_12510 6257 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 6515 9343 gene locus_tag LOCUS_12520 gene uvrA 6515 9343 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_12520 9518 10192 gene locus_tag LOCUS_12530 gene sdaAB 9518 10192 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228158.1 protein_id gnl|my_center|LOCUS_12530 10261 11145 gene locus_tag LOCUS_12540 gene sdaAA 10261 11145 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_12540 11279 12646 gene locus_tag LOCUS_12550 11279 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 12643 13422 gene locus_tag LOCUS_12560 12643 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 13535 13939 gene locus_tag LOCUS_12570 13535 13939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence068 <1 1290 gene locus_tag LOCUS_12580 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976739.1:isoleucine--tRNA ligase 1293 1712 gene locus_tag LOCUS_12590 1293 1712 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403235.1 protein_id gnl|my_center|LOCUS_12590 1699 2307 gene locus_tag LOCUS_12600 1699 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 2315 3313 gene locus_tag LOCUS_12610 2315 3313 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_12610 3442 3801 gene locus_tag LOCUS_12620 gene cheY 3442 3801 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081049.1 protein_id gnl|my_center|LOCUS_12620 3818 5332 gene locus_tag LOCUS_12630 gene cheA 3818 5332 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 protein_id gnl|my_center|LOCUS_12630 5344 5964 gene locus_tag LOCUS_12640 5344 5964 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943818.1 protein_id gnl|my_center|LOCUS_12640 5961 8672 gene locus_tag LOCUS_12650 5961 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 8672 9637 gene locus_tag LOCUS_12660 8672 9637 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256562.1 protein_id gnl|my_center|LOCUS_12660 9627 10553 gene locus_tag LOCUS_12670 9627 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 10550 10897 gene locus_tag LOCUS_12680 10550 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 10894 11370 gene locus_tag LOCUS_12690 10894 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 11401 11997 gene locus_tag LOCUS_12700 11401 11997 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_12700 12002 13858 gene locus_tag LOCUS_12710 12002 13858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12710 >Feature sequence069 <1 3261 gene locus_tag LOCUS_12720 <1 3261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088423.1:PAS domain S-box protein 3879 3322 gene locus_tag LOCUS_12730 3879 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 5924 3897 gene locus_tag LOCUS_12740 gene ligA 5924 3897 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_12740 6057 5962 gene locus_tag LOCUS_t00170 6057 5962 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6533 6006 gene locus_tag LOCUS_12750 6533 6006 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681538.1 protein_id gnl|my_center|LOCUS_12750 7344 6553 gene locus_tag LOCUS_12760 7344 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 7474 8802 gene locus_tag LOCUS_12770 7474 8802 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_12770 9283 8825 gene locus_tag LOCUS_12780 9283 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 9441 10613 gene locus_tag LOCUS_12790 9441 10613 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_12790 11882 10692 gene locus_tag LOCUS_12800 11882 10692 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107704.1 protein_id gnl|my_center|LOCUS_12800 12673 11939 gene locus_tag LOCUS_12810 12673 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 14318 12864 gene locus_tag LOCUS_12820 14318 12864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence070 223 1146 gene locus_tag LOCUS_12830 223 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1286 2200 gene locus_tag LOCUS_12840 1286 2200 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257902.1 protein_id gnl|my_center|LOCUS_12840 2223 3404 gene locus_tag LOCUS_12850 2223 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3428 6037 gene locus_tag LOCUS_12860 3428 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 6810 6079 gene locus_tag LOCUS_12870 6810 6079 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902962.1 protein_id gnl|my_center|LOCUS_12870 8375 6807 gene locus_tag LOCUS_12880 8375 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8769 8416 gene locus_tag LOCUS_12890 8769 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 10205 8772 gene locus_tag LOCUS_12900 10205 8772 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_12900 10897 10433 gene locus_tag LOCUS_12910 10897 10433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 10994 11521 gene locus_tag LOCUS_12920 gene pgsA 10994 11521 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_12920 11523 11999 gene locus_tag LOCUS_12930 11523 11999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 12413 12093 gene locus_tag LOCUS_12940 12413 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 13360 12482 gene locus_tag LOCUS_12950 13360 12482 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728682.1 protein_id gnl|my_center|LOCUS_12950 13466 13371 gene locus_tag LOCUS_t00180 13466 13371 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence071 <1 727 gene locus_tag LOCUS_12960 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943702.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH 729 1016 gene locus_tag LOCUS_12970 729 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1000 2973 gene locus_tag LOCUS_12980 1000 2973 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_12980 2970 4442 gene locus_tag LOCUS_12990 2970 4442 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172762.1 protein_id gnl|my_center|LOCUS_12990 4446 5807 gene locus_tag LOCUS_13000 4446 5807 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142394.1 protein_id gnl|my_center|LOCUS_13000 5807 6940 gene locus_tag LOCUS_13010 gene mraY 5807 6940 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545877.1 protein_id gnl|my_center|LOCUS_13010 6937 8310 gene locus_tag LOCUS_13020 gene murD 6937 8310 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055928.1 protein_id gnl|my_center|LOCUS_13020 8307 9512 gene locus_tag LOCUS_13030 gene ftsW 8307 9512 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_13030 9584 10615 gene locus_tag LOCUS_13040 gene murG 9584 10615 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_13040 10619 11995 gene locus_tag LOCUS_13050 gene murC 10619 11995 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403337.1 protein_id gnl|my_center|LOCUS_13050 12174 12884 gene locus_tag LOCUS_13060 12174 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence072 2438 393 gene locus_tag LOCUS_13070 2438 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 3415 2435 gene locus_tag LOCUS_13080 3415 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 5618 3459 gene locus_tag LOCUS_13090 5618 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 5777 6082 gene locus_tag LOCUS_13100 5777 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 6176 7405 gene locus_tag LOCUS_13110 6176 7405 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975810.1 protein_id gnl|my_center|LOCUS_13110 8457 7756 gene locus_tag LOCUS_13120 8457 7756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_13120 9782 8505 gene locus_tag LOCUS_13130 9782 8505 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928727.1 protein_id gnl|my_center|LOCUS_13130 10179 9835 gene locus_tag LOCUS_13140 10179 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 12807 10189 gene locus_tag LOCUS_13150 12807 10189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_13150 <14105 13155 gene locus_tag LOCUS_13160 <14105 13155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942139.1:type II secretion system F family protein >Feature sequence073 448 104 gene locus_tag LOCUS_13170 448 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1889 786 gene locus_tag LOCUS_13180 1889 786 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120019338.1 protein_id gnl|my_center|LOCUS_13180 3383 2469 gene locus_tag LOCUS_13190 3383 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 4095 3463 gene locus_tag LOCUS_13200 4095 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 7192 4532 gene locus_tag LOCUS_13210 7192 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 8505 7189 gene locus_tag LOCUS_13220 8505 7189 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_13220 12170 8517 gene locus_tag LOCUS_13230 12170 8517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 13631 12174 gene locus_tag LOCUS_13240 gene glgA 13631 12174 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089199.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence074 1551 1150 gene locus_tag LOCUS_13250 1551 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1640 1873 gene locus_tag LOCUS_13260 1640 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 3703 1883 gene locus_tag LOCUS_13270 gene guaA 3703 1883 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234667.1 protein_id gnl|my_center|LOCUS_13270 4951 3707 gene locus_tag LOCUS_13280 4951 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6714 4948 gene locus_tag LOCUS_13290 6714 4948 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_13290 7163 9604 gene locus_tag LOCUS_13300 7163 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 9941 9588 gene locus_tag LOCUS_13310 9941 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 10552 10058 gene locus_tag LOCUS_13320 10552 10058 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 protein_id gnl|my_center|LOCUS_13320 10709 10545 gene locus_tag LOCUS_13330 10709 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 12889 10706 gene locus_tag LOCUS_13340 gene feoB 12889 10706 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_13340 13133 12873 gene locus_tag LOCUS_13350 13133 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 13681 13130 gene locus_tag LOCUS_13360 13681 13130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence075 610 323 gene locus_tag LOCUS_13370 610 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 710 3901 gene locus_tag LOCUS_13380 710 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_13380 4411 3986 gene locus_tag LOCUS_13390 4411 3986 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705497.1 protein_id gnl|my_center|LOCUS_13390 7588 4538 gene locus_tag LOCUS_13400 7588 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 10263 7597 gene locus_tag LOCUS_13410 gene ppdK 10263 7597 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_13410 11574 10300 gene locus_tag LOCUS_13420 gene purF 11574 10300 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_13420 <13732 11676 gene locus_tag LOCUS_13430 <13732 11676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768344.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence076 1421 69 gene locus_tag LOCUS_13440 gene accC 1421 69 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_13440 2731 1541 gene locus_tag LOCUS_13450 2731 1541 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_13450 3215 2724 gene locus_tag LOCUS_13460 gene accB 3215 2724 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_13460 4392 3301 gene locus_tag LOCUS_13470 4392 3301 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_13470 4849 4415 gene locus_tag LOCUS_13480 gene aroQ 4849 4415 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087065.1 protein_id gnl|my_center|LOCUS_13480 7305 4846 gene locus_tag LOCUS_13490 7305 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 7440 9362 gene locus_tag LOCUS_13500 7440 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 9771 9517 gene locus_tag LOCUS_13510 9771 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 10061 9780 gene locus_tag LOCUS_13520 10061 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 11068 10061 gene locus_tag LOCUS_13530 11068 10061 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_13530 13563 11065 gene locus_tag LOCUS_13540 13563 11065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence077 3297 1873 gene locus_tag LOCUS_13550 3297 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4033 3284 gene locus_tag LOCUS_13560 gene kdpE 4033 3284 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_13560 4632 8597 gene locus_tag LOCUS_13570 4632 8597 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225145.1 protein_id gnl|my_center|LOCUS_13570 8797 8564 gene locus_tag LOCUS_13580 8797 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 9921 9610 gene locus_tag LOCUS_13590 9921 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 10243 10028 gene locus_tag LOCUS_13600 10243 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13600 10893 10252 gene locus_tag LOCUS_13610 10893 10252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13610 11198 10890 gene locus_tag LOCUS_13620 11198 10890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13620 11612 11827 gene locus_tag LOCUS_13630 11612 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 12427 13407 gene locus_tag LOCUS_13640 12427 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence078 1475 180 gene locus_tag LOCUS_13650 gene tolB 1475 180 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932320.1 protein_id gnl|my_center|LOCUS_13650 2170 1475 gene locus_tag LOCUS_13660 2170 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 2583 2167 gene locus_tag LOCUS_13670 gene tolR 2583 2167 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932318.1 protein_id gnl|my_center|LOCUS_13670 3274 2585 gene locus_tag LOCUS_13680 3274 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 4340 3375 gene locus_tag LOCUS_13690 4340 3375 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_13690 5503 4379 gene locus_tag LOCUS_13700 5503 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 6048 5614 gene locus_tag LOCUS_13710 6048 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 6650 6165 gene locus_tag LOCUS_13720 gene ssb 6650 6165 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444870.1 protein_id gnl|my_center|LOCUS_13720 7193 6753 gene locus_tag LOCUS_13730 gene rimI 7193 6753 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_13730 7858 7193 gene locus_tag LOCUS_13740 7858 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 8301 7852 gene locus_tag LOCUS_13750 gene tsaE 8301 7852 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_13750 10378 8303 gene locus_tag LOCUS_13760 gene uvrB 10378 8303 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_13760 10948 10502 gene locus_tag LOCUS_13770 10948 10502 CDS product cytochrome B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119406804.1 protein_id gnl|my_center|LOCUS_13770 13284 11095 gene locus_tag LOCUS_13780 13284 11095 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence079 837 394 gene locus_tag LOCUS_13790 gene rplI 837 394 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_13790 1890 853 gene locus_tag LOCUS_13800 1890 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2112 1891 gene locus_tag LOCUS_13810 gene rpsR 2112 1891 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090661.1 protein_id gnl|my_center|LOCUS_13810 2474 2112 gene locus_tag LOCUS_13820 gene rpsF 2474 2112 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119610.1 protein_id gnl|my_center|LOCUS_13820 2703 3002 gene locus_tag LOCUS_13830 2703 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 2983 3495 gene locus_tag LOCUS_13840 2983 3495 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390771.1 protein_id gnl|my_center|LOCUS_13840 3492 4658 gene locus_tag LOCUS_13850 3492 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 5206 5215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6017 7798 gene locus_tag LOCUS_13860 6017 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 7791 8756 gene locus_tag LOCUS_13870 7791 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 8820 9944 gene locus_tag LOCUS_13880 8820 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 9941 11731 gene locus_tag LOCUS_13890 9941 11731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140176.1 protein_id gnl|my_center|LOCUS_13890 12821 11721 gene locus_tag LOCUS_13900 gene ychF 12821 11721 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687306.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence080 385 65 gene locus_tag LOCUS_13910 385 65 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074197.1 protein_id gnl|my_center|LOCUS_13910 1413 385 gene locus_tag LOCUS_13920 1413 385 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272343.1 protein_id gnl|my_center|LOCUS_13920 1799 1455 gene locus_tag LOCUS_13930 1799 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 2291 2950 gene locus_tag LOCUS_13940 2291 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3089 3421 gene locus_tag LOCUS_13950 3089 3421 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533331.1 protein_id gnl|my_center|LOCUS_13950 3418 4704 gene locus_tag LOCUS_13960 3418 4704 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533330.1 protein_id gnl|my_center|LOCUS_13960 6584 4713 gene locus_tag LOCUS_13970 6584 4713 CDS product DUF4209 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545693.1 protein_id gnl|my_center|LOCUS_13970 7440 6637 gene locus_tag LOCUS_13980 7440 6637 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074041.1 protein_id gnl|my_center|LOCUS_13980 7885 8733 gene locus_tag LOCUS_13990 7885 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 8645 10204 gene locus_tag LOCUS_14000 8645 10204 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537423.1 protein_id gnl|my_center|LOCUS_14000 11703 10288 gene locus_tag LOCUS_14010 11703 10288 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_14010 12773 11700 gene locus_tag LOCUS_14020 12773 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 <13338 12770 gene locus_tag LOCUS_14030 <13338 12770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041449647.1:response regulator transcription factor >Feature sequence081 2675 2331 gene locus_tag LOCUS_14040 2675 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 3616 2942 gene locus_tag LOCUS_14050 3616 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 4473 3772 gene locus_tag LOCUS_14060 4473 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 5326 4571 gene locus_tag LOCUS_14070 5326 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 6473 5346 gene locus_tag LOCUS_14080 6473 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 7669 6485 gene locus_tag LOCUS_14090 7669 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 8324 7662 gene locus_tag LOCUS_14100 8324 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 9226 8324 gene locus_tag LOCUS_14110 9226 8324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121967.1 protein_id gnl|my_center|LOCUS_14110 9603 9223 gene locus_tag LOCUS_14120 9603 9223 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782778.1 protein_id gnl|my_center|LOCUS_14120 11183 9891 gene locus_tag LOCUS_14130 11183 9891 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_14130 11327 11400 gene locus_tag LOCUS_t00190 11327 11400 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12953 11520 gene locus_tag LOCUS_14140 12953 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence082 52 687 gene locus_tag LOCUS_14150 52 687 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403456.1 protein_id gnl|my_center|LOCUS_14150 1364 684 gene locus_tag LOCUS_14160 1364 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2028 1495 gene locus_tag LOCUS_14170 2028 1495 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 protein_id gnl|my_center|LOCUS_14170 2244 2148 gene locus_tag LOCUS_t00200 2244 2148 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 3238 2267 gene locus_tag LOCUS_14180 gene selD 3238 2267 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_14180 3745 3365 gene locus_tag LOCUS_14190 3745 3365 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_14190 5620 3929 gene locus_tag LOCUS_14200 5620 3929 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_14200 6543 5761 gene locus_tag LOCUS_14210 6543 5761 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528321.1 protein_id gnl|my_center|LOCUS_14210 7677 6718 gene locus_tag LOCUS_14220 gene secF 7677 6718 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 protein_id gnl|my_center|LOCUS_14220 9326 7677 gene locus_tag LOCUS_14230 gene secD 9326 7677 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839265.1 protein_id gnl|my_center|LOCUS_14230 10364 9420 gene locus_tag LOCUS_14240 10364 9420 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404517.1 protein_id gnl|my_center|LOCUS_14240 11262 10357 gene locus_tag LOCUS_14250 gene truB 11262 10357 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296636.1 protein_id gnl|my_center|LOCUS_14250 11632 11240 gene locus_tag LOCUS_14260 gene rbfA 11632 11240 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_14260 <13299 11652 gene locus_tag LOCUS_14270 <13299 11652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942233.1:translation initiation factor IF-2 >Feature sequence083 784 182 gene locus_tag LOCUS_14280 784 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1337 837 gene locus_tag LOCUS_14290 gene frhD 1337 837 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869751.1 protein_id gnl|my_center|LOCUS_14290 2790 1348 gene locus_tag LOCUS_14300 2790 1348 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_14300 3717 2794 gene locus_tag LOCUS_14310 3717 2794 CDS product F420-nonreducing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496953.1 protein_id gnl|my_center|LOCUS_14310 3964 3761 gene locus_tag LOCUS_14320 3964 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 4386 3961 gene locus_tag LOCUS_14330 4386 3961 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_14330 8831 4383 gene locus_tag LOCUS_14340 8831 4383 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392708.1 protein_id gnl|my_center|LOCUS_14340 10102 8828 gene locus_tag LOCUS_14350 10102 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 11327 10281 gene locus_tag LOCUS_14360 gene hypE 11327 10281 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_14360 12457 11342 gene locus_tag LOCUS_14370 gene hypD 12457 11342 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_14370 12747 12454 gene locus_tag LOCUS_14380 12747 12454 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893644.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence084 1122 250 gene locus_tag LOCUS_14390 1122 250 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037942.1 protein_id gnl|my_center|LOCUS_14390 2631 1303 gene locus_tag LOCUS_14400 2631 1303 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840191.1 protein_id gnl|my_center|LOCUS_14400 2724 4412 gene locus_tag LOCUS_14410 2724 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 4480 4836 gene locus_tag LOCUS_14420 4480 4836 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927201.1 protein_id gnl|my_center|LOCUS_14420 5232 4843 gene locus_tag LOCUS_14430 5232 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 6917 5229 gene locus_tag LOCUS_14440 6917 5229 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_14440 8790 6943 gene locus_tag LOCUS_14450 8790 6943 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_14450 8934 11780 gene locus_tag LOCUS_14460 8934 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 12416 11784 gene locus_tag LOCUS_14470 12416 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence085 1133 105 gene locus_tag LOCUS_14480 1133 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 4639 1130 gene locus_tag LOCUS_14490 gene smc 4639 1130 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403652.1 protein_id gnl|my_center|LOCUS_14490 5926 4640 gene locus_tag LOCUS_14500 5926 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 7404 5923 gene locus_tag LOCUS_14510 7404 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 10951 7592 gene locus_tag LOCUS_14520 10951 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 11331 10966 gene locus_tag LOCUS_14530 gene rsfS 11331 10966 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 protein_id gnl|my_center|LOCUS_14530 13044 11875 gene locus_tag LOCUS_14540 13044 11875 CDS product IS701 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209648948.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence086 3062 1713 gene locus_tag LOCUS_14550 gene glmM 3062 1713 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839748.1 protein_id gnl|my_center|LOCUS_14550 3325 4455 gene locus_tag LOCUS_14560 3325 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4627 5796 gene locus_tag LOCUS_14570 4627 5796 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_14570 5866 6849 gene locus_tag LOCUS_14580 5866 6849 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899114.1 protein_id gnl|my_center|LOCUS_14580 6846 8132 gene locus_tag LOCUS_14590 gene purD 6846 8132 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388404.1 protein_id gnl|my_center|LOCUS_14590 8116 8991 gene locus_tag LOCUS_14600 gene mutM 8116 8991 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_14600 9016 10149 gene locus_tag LOCUS_14610 9016 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 11119 10280 gene locus_tag LOCUS_14620 11119 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 11355 11843 gene locus_tag LOCUS_14630 11355 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 11840 12463 gene locus_tag LOCUS_14640 11840 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 12911 12438 gene locus_tag LOCUS_14650 12911 12438 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993958.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence087 1091 18 gene locus_tag LOCUS_14660 1091 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 5411 1140 gene locus_tag LOCUS_14670 5411 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 8582 5469 gene locus_tag LOCUS_14680 8582 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 8839 9834 gene locus_tag LOCUS_14690 8839 9834 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339538.1 protein_id gnl|my_center|LOCUS_14690 9831 10898 gene locus_tag LOCUS_14700 gene asd 9831 10898 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_14700 10895 12250 gene locus_tag LOCUS_14710 gene lysC 10895 12250 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_14710 12247 12951 gene locus_tag LOCUS_14720 gene dapB 12247 12951 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence088 322 1020 gene locus_tag LOCUS_14730 322 1020 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529132.1 protein_id gnl|my_center|LOCUS_14730 1041 1346 gene locus_tag LOCUS_14740 1041 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 2706 1528 gene locus_tag LOCUS_14750 2706 1528 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228276.1 protein_id gnl|my_center|LOCUS_14750 5074 2759 gene locus_tag LOCUS_14760 5074 2759 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228275.1 protein_id gnl|my_center|LOCUS_14760 5219 5836 gene locus_tag LOCUS_14770 5219 5836 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_14770 5860 6744 gene locus_tag LOCUS_14780 5860 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 6741 7565 gene locus_tag LOCUS_14790 6741 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 7937 9721 gene locus_tag LOCUS_14800 7937 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 9718 11622 gene locus_tag LOCUS_14810 9718 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 12725 11721 gene locus_tag LOCUS_14820 12725 11721 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228908.1 protein_id gnl|my_center|LOCUS_14820 12642 12992 gene locus_tag LOCUS_14830 12642 12992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence089 <1 757 gene locus_tag LOCUS_14840 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544941.1:beta-ketoacyl-ACP synthase II 762 1931 gene locus_tag LOCUS_14850 gene mqnE 762 1931 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172898.1 protein_id gnl|my_center|LOCUS_14850 1931 2776 gene locus_tag LOCUS_14860 1931 2776 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393345.1 protein_id gnl|my_center|LOCUS_14860 2823 3857 gene locus_tag LOCUS_14870 gene mqnC 2823 3857 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_14870 3872 4822 gene locus_tag LOCUS_14880 3872 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 4819 5460 gene locus_tag LOCUS_14890 4819 5460 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_14890 5457 6371 gene locus_tag LOCUS_14900 gene xerD 5457 6371 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932289.1 protein_id gnl|my_center|LOCUS_14900 6417 7010 gene locus_tag LOCUS_14910 6417 7010 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_14910 7007 8191 gene locus_tag LOCUS_14920 7007 8191 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838120.1 protein_id gnl|my_center|LOCUS_14920 8565 8188 gene locus_tag LOCUS_14930 8565 8188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 8482 9111 gene locus_tag LOCUS_14940 gene kdsB 8482 9111 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690726.1 protein_id gnl|my_center|LOCUS_14940 9108 10778 gene locus_tag LOCUS_14950 9108 10778 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_14950 10781 11614 gene locus_tag LOCUS_14960 gene kdsA 10781 11614 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 protein_id gnl|my_center|LOCUS_14960 11611 12183 gene locus_tag LOCUS_14970 11611 12183 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence090 2598 1927 gene locus_tag LOCUS_14980 gene hypB 2598 1927 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728544.1 protein_id gnl|my_center|LOCUS_14980 2851 2579 gene locus_tag LOCUS_14990 2851 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 4225 3032 gene locus_tag LOCUS_15000 4225 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 4963 4268 gene locus_tag LOCUS_15010 4963 4268 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928746.1 protein_id gnl|my_center|LOCUS_15010 5516 5034 gene locus_tag LOCUS_15020 5516 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 6552 5605 gene locus_tag LOCUS_15030 6552 5605 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_15030 8096 6552 gene locus_tag LOCUS_15040 8096 6552 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_15040 10235 8214 gene locus_tag LOCUS_15050 10235 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 10726 10235 gene locus_tag LOCUS_15060 10726 10235 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_15060 10801 11865 gene locus_tag LOCUS_15070 10801 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15070 11897 12613 gene locus_tag LOCUS_15080 11897 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15080 >Feature sequence091 1 348 gene locus_tag LOCUS_15090 1 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 487 3126 gene locus_tag LOCUS_15100 487 3126 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_15100 3901 3191 gene locus_tag LOCUS_15110 3901 3191 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_15110 6394 3905 gene locus_tag LOCUS_15120 6394 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 6577 6726 gene locus_tag LOCUS_15130 6577 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6869 7420 gene locus_tag LOCUS_15140 gene pyrR 6869 7420 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938679.1 protein_id gnl|my_center|LOCUS_15140 7417 8376 gene locus_tag LOCUS_15150 7417 8376 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460660.1 protein_id gnl|my_center|LOCUS_15150 8376 9671 gene locus_tag LOCUS_15160 8376 9671 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_15160 9704 10327 gene locus_tag LOCUS_15170 9704 10327 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_15170 10336 11493 gene locus_tag LOCUS_15180 10336 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 11842 11639 gene locus_tag LOCUS_15190 11842 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence092 363 935 gene locus_tag LOCUS_15200 363 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 935 1240 gene locus_tag LOCUS_15210 935 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1243 2406 gene locus_tag LOCUS_15220 1243 2406 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_15220 2410 3126 gene locus_tag LOCUS_15230 gene ftsE 2410 3126 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768285.1 protein_id gnl|my_center|LOCUS_15230 3123 3971 gene locus_tag LOCUS_15240 3123 3971 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926835.1 protein_id gnl|my_center|LOCUS_15240 3968 5221 gene locus_tag LOCUS_15250 3968 5221 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404349.1 protein_id gnl|my_center|LOCUS_15250 5200 5424 gene locus_tag LOCUS_15260 5200 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 5504 6643 gene locus_tag LOCUS_15270 5504 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 6793 7101 gene locus_tag LOCUS_15280 6793 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 7178 8440 gene locus_tag LOCUS_15290 7178 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 8477 9382 gene locus_tag LOCUS_15300 8477 9382 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_15300 9379 10152 gene locus_tag LOCUS_15310 9379 10152 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_15310 10145 10972 gene locus_tag LOCUS_15320 10145 10972 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937415.1 protein_id gnl|my_center|LOCUS_15320 11075 11695 gene locus_tag LOCUS_15330 11075 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence093 174 749 gene locus_tag LOCUS_15340 gene atpF 174 749 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732516.1 protein_id gnl|my_center|LOCUS_15340 749 1282 gene locus_tag LOCUS_15350 gene atpH 749 1282 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403676.1 protein_id gnl|my_center|LOCUS_15350 1453 3636 gene locus_tag LOCUS_15360 1453 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 3841 4248 gene locus_tag LOCUS_15370 3841 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 4297 4869 gene locus_tag LOCUS_15380 4297 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 4991 5248 gene locus_tag LOCUS_15390 4991 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 5245 6234 gene locus_tag LOCUS_15400 5245 6234 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257630.1 protein_id gnl|my_center|LOCUS_15400 6340 7251 gene locus_tag LOCUS_15410 6340 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 7338 8090 gene locus_tag LOCUS_15420 7338 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 8101 9426 gene locus_tag LOCUS_15430 8101 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 9527 10927 gene locus_tag LOCUS_15440 9527 10927 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027183.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence094 <1 871 gene locus_tag LOCUS_15450 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704081.1:glycosyltransferase family 9 protein 1432 980 gene locus_tag LOCUS_15460 1432 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2251 1463 gene locus_tag LOCUS_15470 2251 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3033 2248 gene locus_tag LOCUS_15480 3033 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4265 3030 gene locus_tag LOCUS_15490 4265 3030 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_15490 4732 4265 gene locus_tag LOCUS_15500 4732 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 5360 4761 gene locus_tag LOCUS_15510 5360 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_15510 7472 5460 gene locus_tag LOCUS_15520 gene nosZ 7472 5460 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_15520 7725 8156 gene locus_tag LOCUS_15530 gene nsrR 7725 8156 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_15530 8757 8137 gene locus_tag LOCUS_15540 8757 8137 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_15540 9191 8754 gene locus_tag LOCUS_15550 gene dtd 9191 8754 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_15550 9266 9904 gene locus_tag LOCUS_15560 9266 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 9935 11161 gene locus_tag LOCUS_15570 9935 11161 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093151333.1 protein_id gnl|my_center|LOCUS_15570 11382 12206 gene locus_tag LOCUS_15580 11382 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 12391 12266 gene locus_tag LOCUS_15590 12391 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence095 65 1261 gene locus_tag LOCUS_15600 65 1261 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 protein_id gnl|my_center|LOCUS_15600 1251 1724 gene locus_tag LOCUS_15610 1251 1724 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258387.1 protein_id gnl|my_center|LOCUS_15610 3075 1777 gene locus_tag LOCUS_15620 3075 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3109 3807 gene locus_tag LOCUS_15630 3109 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 3809 5848 gene locus_tag LOCUS_15640 3809 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 5946 8735 gene locus_tag LOCUS_15650 5946 8735 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259558.1 protein_id gnl|my_center|LOCUS_15650 8760 11438 gene locus_tag LOCUS_15660 8760 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence096 22 819 gene locus_tag LOCUS_15670 22 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2923 836 gene locus_tag LOCUS_15680 2923 836 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928490.1 protein_id gnl|my_center|LOCUS_15680 4331 3162 gene locus_tag LOCUS_15690 4331 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 5178 4486 gene locus_tag LOCUS_15700 5178 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5728 5159 gene locus_tag LOCUS_15710 5728 5159 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_15710 5913 7400 gene locus_tag LOCUS_15720 5913 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 7465 7827 gene locus_tag LOCUS_15730 7465 7827 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390575.1 protein_id gnl|my_center|LOCUS_15730 9174 7978 gene locus_tag LOCUS_15740 9174 7978 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_15740 9251 10462 gene locus_tag LOCUS_15750 9251 10462 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_15750 10459 11253 gene locus_tag LOCUS_15760 10459 11253 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence097 94 312 gene locus_tag LOCUS_15770 94 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1304 630 gene locus_tag LOCUS_15780 1304 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15780 1850 2446 gene locus_tag LOCUS_15790 1850 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2603 3136 gene locus_tag LOCUS_15800 2603 3136 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258321.1 protein_id gnl|my_center|LOCUS_15800 3188 4513 gene locus_tag LOCUS_15810 3188 4513 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229317.1 protein_id gnl|my_center|LOCUS_15810 5182 4709 gene locus_tag LOCUS_15820 5182 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 5301 5786 gene locus_tag LOCUS_15830 5301 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 5783 6241 gene locus_tag LOCUS_15840 5783 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 6264 6509 gene locus_tag LOCUS_15850 6264 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 7047 6466 gene locus_tag LOCUS_15860 7047 6466 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336778.1 protein_id gnl|my_center|LOCUS_15860 7237 7848 gene locus_tag LOCUS_15870 7237 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 8302 10248 gene locus_tag LOCUS_15880 8302 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 10245 10661 gene locus_tag LOCUS_15890 gene arr 10245 10661 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 protein_id gnl|my_center|LOCUS_15890 10651 11139 gene locus_tag LOCUS_15900 10651 11139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 11211 11765 gene locus_tag LOCUS_15910 11211 11765 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530142.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence098 1435 3078 gene locus_tag LOCUS_15920 1435 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3700 3095 gene locus_tag LOCUS_15930 3700 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 3776 6283 gene locus_tag LOCUS_15940 3776 6283 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303164.1 protein_id gnl|my_center|LOCUS_15940 6366 7151 gene locus_tag LOCUS_15950 gene rfbA 6366 7151 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070079022.1 protein_id gnl|my_center|LOCUS_15950 7402 7968 gene locus_tag LOCUS_15960 gene rfbC 7402 7968 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_15960 7965 9065 gene locus_tag LOCUS_15970 gene rffG 7965 9065 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 protein_id gnl|my_center|LOCUS_15970 9313 10155 gene locus_tag LOCUS_15980 gene rfbD 9313 10155 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807150.1 protein_id gnl|my_center|LOCUS_15980 10263 11105 gene locus_tag LOCUS_15990 10263 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 11137 11727 gene locus_tag LOCUS_16000 11137 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence099 2313 1183 gene locus_tag LOCUS_16010 2313 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2501 2313 gene locus_tag LOCUS_16020 2501 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2625 2634 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3321 2710 gene locus_tag LOCUS_16030 3321 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3666 4811 gene locus_tag LOCUS_16040 3666 4811 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403516.1 protein_id gnl|my_center|LOCUS_16040 4811 5569 gene locus_tag LOCUS_16050 4811 5569 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_16050 5680 9192 gene locus_tag LOCUS_16060 5680 9192 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265500.1 protein_id gnl|my_center|LOCUS_16060 10412 9483 gene locus_tag LOCUS_16070 10412 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 11176 10409 gene locus_tag LOCUS_16080 11176 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 <11794 11173 gene locus_tag LOCUS_16090 <11794 11173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940210.1:glutamine--tRNA ligase/YqeY domain fusion protein >Feature sequence100 2154 736 gene locus_tag LOCUS_16100 gene amrB 2154 736 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052452.1 protein_id gnl|my_center|LOCUS_16100 2922 2320 gene locus_tag LOCUS_16110 2922 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 3269 2970 gene locus_tag LOCUS_16120 3269 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3320 4516 gene locus_tag LOCUS_16130 3320 4516 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_16130 6608 4557 gene locus_tag LOCUS_16140 6608 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 8402 7170 gene locus_tag LOCUS_16150 8402 7170 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_16150 9228 8434 gene locus_tag LOCUS_16160 9228 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 9845 9471 gene locus_tag LOCUS_16170 9845 9471 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876801.1 protein_id gnl|my_center|LOCUS_16170 10050 9820 gene locus_tag LOCUS_16180 10050 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 <11768 10304 gene locus_tag LOCUS_16190 <11768 10304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943603.1:bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase >Feature sequence101 270 2504 gene locus_tag LOCUS_16200 270 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3607 2678 gene locus_tag LOCUS_16210 gene fmt 3607 2678 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_16210 4164 3607 gene locus_tag LOCUS_16220 gene def 4164 3607 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974268.1 protein_id gnl|my_center|LOCUS_16220 4526 4161 gene locus_tag LOCUS_16230 gene yajC 4526 4161 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015446.1 protein_id gnl|my_center|LOCUS_16230 5662 4523 gene locus_tag LOCUS_16240 gene tgt 5662 4523 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_16240 6875 5841 gene locus_tag LOCUS_16250 gene queA 6875 5841 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_16250 9280 6890 gene locus_tag LOCUS_16260 9280 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 10289 9258 gene locus_tag LOCUS_16270 gene ruvB 10289 9258 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_16270 10902 10303 gene locus_tag LOCUS_16280 gene ruvA 10902 10303 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227122.1 protein_id gnl|my_center|LOCUS_16280 11408 10899 gene locus_tag LOCUS_16290 gene ruvC 11408 10899 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence102 500 835 gene locus_tag LOCUS_16300 500 835 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_16300 850 1653 gene locus_tag LOCUS_16310 850 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1962 2429 gene locus_tag LOCUS_16320 1962 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2707 3177 gene locus_tag LOCUS_16330 gene nrfH 2707 3177 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_16330 3322 4728 gene locus_tag LOCUS_16340 3322 4728 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123116.1 protein_id gnl|my_center|LOCUS_16340 5551 4811 gene locus_tag LOCUS_16350 5551 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 8103 5548 gene locus_tag LOCUS_16360 gene mprF 8103 5548 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022655.1 protein_id gnl|my_center|LOCUS_16360 11561 8175 gene locus_tag LOCUS_16370 11561 8175 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414323.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence103 <1 741 gene locus_tag LOCUS_16380 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940747.1:4Fe-4S dicluster domain-containing protein 742 1983 gene locus_tag LOCUS_16390 gene nrfD 742 1983 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_16390 2019 2783 gene locus_tag LOCUS_16400 2019 2783 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258918.1 protein_id gnl|my_center|LOCUS_16400 2907 3353 gene locus_tag LOCUS_16410 2907 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 3642 3424 gene locus_tag LOCUS_16420 3642 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 4873 4076 gene locus_tag LOCUS_16430 4873 4076 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 protein_id gnl|my_center|LOCUS_16430 6624 4933 gene locus_tag LOCUS_16440 6624 4933 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_16440 7712 6621 gene locus_tag LOCUS_16450 gene meaB 7712 6621 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_16450 8668 7709 gene locus_tag LOCUS_16460 8668 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 9897 8665 gene locus_tag LOCUS_16470 9897 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 10373 9894 gene locus_tag LOCUS_16480 10373 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 11356 10370 gene locus_tag LOCUS_16490 11356 10370 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228398.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence104 1678 671 gene locus_tag LOCUS_16500 1678 671 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_16500 2451 1675 gene locus_tag LOCUS_16510 2451 1675 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405213.1 protein_id gnl|my_center|LOCUS_16510 2940 2551 gene locus_tag LOCUS_16520 gene apaG 2940 2551 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257425.1 protein_id gnl|my_center|LOCUS_16520 3026 5104 gene locus_tag LOCUS_16530 3026 5104 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390968.1 protein_id gnl|my_center|LOCUS_16530 6255 5143 gene locus_tag LOCUS_16540 6255 5143 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966339.1 protein_id gnl|my_center|LOCUS_16540 7319 6393 gene locus_tag LOCUS_16550 gene yedA 7319 6393 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_16550 7521 9275 gene locus_tag LOCUS_16560 7521 9275 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_16560 9272 10186 gene locus_tag LOCUS_16570 9272 10186 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_16570 10226 11206 gene locus_tag LOCUS_16580 10226 11206 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222403.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence105 104 1396 gene locus_tag LOCUS_16590 104 1396 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_16590 1397 2074 gene locus_tag LOCUS_16600 1397 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2071 3078 gene locus_tag LOCUS_16610 2071 3078 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_16610 3075 4079 gene locus_tag LOCUS_16620 3075 4079 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_16620 6411 4246 gene locus_tag LOCUS_16630 6411 4246 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_16630 6905 6408 gene locus_tag LOCUS_16640 6905 6408 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_16640 7179 6988 gene locus_tag LOCUS_16650 7179 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 7753 7388 gene locus_tag LOCUS_16660 7753 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 7649 9631 gene locus_tag LOCUS_16670 7649 9631 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_16670 9882 10334 gene locus_tag LOCUS_16680 9882 10334 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_16680 <11407 10273 gene locus_tag LOCUS_16690 <11407 10273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392515.1:MFS transporter >Feature sequence106 81 6 gene locus_tag LOCUS_t00210 81 6 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 611 228 gene locus_tag LOCUS_16700 611 228 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_16700 2184 619 gene locus_tag LOCUS_16710 2184 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 2343 2270 gene locus_tag LOCUS_t00220 2343 2270 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2597 2525 gene locus_tag LOCUS_t00230 2597 2525 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2728 2655 gene locus_tag LOCUS_t00240 2728 2655 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2995 3885 gene locus_tag LOCUS_16720 2995 3885 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_16720 4160 4909 gene locus_tag LOCUS_16730 4160 4909 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_16730 4906 5355 gene locus_tag LOCUS_16740 4906 5355 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_16740 5352 6152 gene locus_tag LOCUS_16750 5352 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 6361 9510 gene locus_tag LOCUS_16760 6361 9510 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_16760 9507 11033 gene locus_tag LOCUS_16770 9507 11033 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence107 32 505 gene locus_tag LOCUS_16780 32 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 569 1003 gene locus_tag LOCUS_16790 569 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1661 1404 gene locus_tag LOCUS_16800 1661 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1774 3135 gene locus_tag LOCUS_16810 1774 3135 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_16810 3146 4684 gene locus_tag LOCUS_16820 3146 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4771 5631 gene locus_tag LOCUS_16830 4771 5631 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403318.1 protein_id gnl|my_center|LOCUS_16830 5635 6972 gene locus_tag LOCUS_16840 5635 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 6995 7276 gene locus_tag LOCUS_16850 6995 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 7273 8202 gene locus_tag LOCUS_16860 7273 8202 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338742.1 protein_id gnl|my_center|LOCUS_16860 8300 9346 gene locus_tag LOCUS_16870 gene corA 8300 9346 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233650.1 protein_id gnl|my_center|LOCUS_16870 9347 10387 gene locus_tag LOCUS_16880 9347 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence108 17 1528 gene locus_tag LOCUS_16890 17 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1528 3708 gene locus_tag LOCUS_16900 1528 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3739 5508 gene locus_tag LOCUS_16910 gene mutL 3739 5508 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974632.1 protein_id gnl|my_center|LOCUS_16910 5495 6406 gene locus_tag LOCUS_16920 gene miaA 5495 6406 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143238.1 protein_id gnl|my_center|LOCUS_16920 6403 7530 gene locus_tag LOCUS_16930 gene bshA 6403 7530 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926877.1 protein_id gnl|my_center|LOCUS_16930 7558 8367 gene locus_tag LOCUS_16940 gene uppP 7558 8367 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_16940 8372 9106 gene locus_tag LOCUS_16950 8372 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 9106 9876 gene locus_tag LOCUS_16960 9106 9876 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230456.1 protein_id gnl|my_center|LOCUS_16960 10133 10438 gene locus_tag LOCUS_16970 gene groES 10133 10438 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146552.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence109 <1 929 gene locus_tag LOCUS_16980 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869569.1:peptide chain release factor 1 926 1882 gene locus_tag LOCUS_16990 gene prmC 926 1882 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_16990 1882 2235 gene locus_tag LOCUS_17000 1882 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2241 2891 gene locus_tag LOCUS_17010 gene tmk 2241 2891 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_17010 2934 4514 gene locus_tag LOCUS_17020 2934 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 4850 6796 gene locus_tag LOCUS_17030 4850 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17030 9074 6918 gene locus_tag LOCUS_17040 9074 6918 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421589.1 protein_id gnl|my_center|LOCUS_17040 9910 9176 gene locus_tag LOCUS_17050 9910 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 10944 9910 gene locus_tag LOCUS_17060 gene aroF 10944 9910 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256593.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence110 5 736 gene locus_tag LOCUS_17070 gene pstB 5 736 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889420.1 protein_id gnl|my_center|LOCUS_17070 733 1500 gene locus_tag LOCUS_17080 gene pstB 733 1500 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500183.1 protein_id gnl|my_center|LOCUS_17080 1497 2243 gene locus_tag LOCUS_17090 gene phoU 1497 2243 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_17090 2339 5116 gene locus_tag LOCUS_17100 2339 5116 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_17100 5318 7057 gene locus_tag LOCUS_17110 5318 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002074543.1 protein_id gnl|my_center|LOCUS_17110 7132 7800 gene locus_tag LOCUS_17120 7132 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 7858 9486 gene locus_tag LOCUS_17130 7858 9486 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943196.1 protein_id gnl|my_center|LOCUS_17130 10644 9487 gene locus_tag LOCUS_17140 10644 9487 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460346.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence111 1189 35 gene locus_tag LOCUS_17150 1189 35 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887898.1 protein_id gnl|my_center|LOCUS_17150 2190 1312 gene locus_tag LOCUS_17160 2190 1312 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_17160 3038 2160 gene locus_tag LOCUS_17170 3038 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 4252 3047 gene locus_tag LOCUS_17180 4252 3047 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887715.1 protein_id gnl|my_center|LOCUS_17180 4519 4304 gene locus_tag LOCUS_17190 4519 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 5203 4643 gene locus_tag LOCUS_17200 5203 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 7140 5200 gene locus_tag LOCUS_17210 gene thrS 7140 5200 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213295.1 protein_id gnl|my_center|LOCUS_17210 7324 10077 gene locus_tag LOCUS_17220 7324 10077 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence112 32 1108 gene locus_tag LOCUS_17230 32 1108 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162675.1 protein_id gnl|my_center|LOCUS_17230 1105 1542 gene locus_tag LOCUS_17240 gene rpiB 1105 1542 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_17240 1552 2841 gene locus_tag LOCUS_17250 1552 2841 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_17250 3128 3484 gene locus_tag LOCUS_17260 3128 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3497 5038 gene locus_tag LOCUS_17270 3497 5038 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_17270 5041 6564 gene locus_tag LOCUS_17280 5041 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6580 7536 gene locus_tag LOCUS_17290 gene thiL 6580 7536 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752139.1 protein_id gnl|my_center|LOCUS_17290 7533 8300 gene locus_tag LOCUS_17300 7533 8300 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_17300 8405 9691 gene locus_tag LOCUS_17310 gene eno 8405 9691 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889260.1 protein_id gnl|my_center|LOCUS_17310 10020 10343 gene locus_tag LOCUS_17320 10020 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence113 1096 65 gene locus_tag LOCUS_17330 gene pdhA 1096 65 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_17330 2016 1108 gene locus_tag LOCUS_17340 gene lipA 2016 1108 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_17340 2274 2489 gene locus_tag LOCUS_17350 2274 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3580 2627 gene locus_tag LOCUS_17360 3580 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_17360 4389 3577 gene locus_tag LOCUS_17370 4389 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 5147 4386 gene locus_tag LOCUS_17380 5147 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 6286 5210 gene locus_tag LOCUS_17390 6286 5210 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_17390 7035 6304 gene locus_tag LOCUS_17400 7035 6304 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256367.1 protein_id gnl|my_center|LOCUS_17400 7092 7682 gene locus_tag LOCUS_17410 7092 7682 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_17410 7788 8366 gene locus_tag LOCUS_17420 7788 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 8504 10012 gene locus_tag LOCUS_17430 8504 10012 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 protein_id gnl|my_center|LOCUS_17430 10544 10173 gene locus_tag LOCUS_17440 10544 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence114 2568 226 gene locus_tag LOCUS_17450 2568 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 3602 2586 gene locus_tag LOCUS_17460 gene mtrA 3602 2586 CDS product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_17460 4004 4489 gene locus_tag LOCUS_17470 4004 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 4542 5486 gene locus_tag LOCUS_17480 4542 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 5974 5621 gene locus_tag LOCUS_17490 5974 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 5973 6551 gene locus_tag LOCUS_17500 5973 6551 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_17500 6544 8337 gene locus_tag LOCUS_17510 6544 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 8334 9494 gene locus_tag LOCUS_17520 gene porA 8334 9494 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_17520 9491 10399 gene locus_tag LOCUS_17530 9491 10399 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence115 1081 95 gene locus_tag LOCUS_17540 gene trpS 1081 95 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887203.1 protein_id gnl|my_center|LOCUS_17540 1105 1929 gene locus_tag LOCUS_17550 1105 1929 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403307.1 protein_id gnl|my_center|LOCUS_17550 2059 3582 gene locus_tag LOCUS_17560 2059 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3590 4354 gene locus_tag LOCUS_17570 3590 4354 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_17570 6303 4609 gene locus_tag LOCUS_17580 6303 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 7307 6555 gene locus_tag LOCUS_17590 gene map 7307 6555 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_17590 7951 7304 gene locus_tag LOCUS_17600 7951 7304 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021125.1 protein_id gnl|my_center|LOCUS_17600 9301 7958 gene locus_tag LOCUS_17610 gene secY 9301 7958 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_17610 9759 9301 gene locus_tag LOCUS_17620 gene rplO 9759 9301 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814543.1 protein_id gnl|my_center|LOCUS_17620 10010 9759 gene locus_tag LOCUS_17630 10010 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence116 493 1101 gene locus_tag LOCUS_17640 493 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1658 1146 gene locus_tag LOCUS_17650 1658 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3973 1658 gene locus_tag LOCUS_17660 3973 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 6167 4092 gene locus_tag LOCUS_17670 6167 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 6256 7782 gene locus_tag LOCUS_17680 gene trpE 6256 7782 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_17680 7815 9386 gene locus_tag LOCUS_17690 7815 9386 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_17690 9383 10156 gene locus_tag LOCUS_17700 9383 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence117 2546 1203 gene locus_tag LOCUS_17710 2546 1203 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201884.1 protein_id gnl|my_center|LOCUS_17710 3369 2722 gene locus_tag LOCUS_17720 3369 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 3862 3419 gene locus_tag LOCUS_17730 3862 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4010 4489 gene locus_tag LOCUS_17740 4010 4489 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_17740 5001 4522 gene locus_tag LOCUS_17750 5001 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 5099 5782 gene locus_tag LOCUS_17760 5099 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 6822 5698 gene locus_tag LOCUS_17770 6822 5698 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697738.1 protein_id gnl|my_center|LOCUS_17770 7821 6898 gene locus_tag LOCUS_17780 7821 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence118 827 48 gene locus_tag LOCUS_17790 827 48 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_17790 1780 824 gene locus_tag LOCUS_17800 1780 824 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_17800 2730 1807 gene locus_tag LOCUS_17810 2730 1807 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040581.1 protein_id gnl|my_center|LOCUS_17810 4238 2997 gene locus_tag LOCUS_17820 4238 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4740 4240 gene locus_tag LOCUS_17830 4740 4240 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895101.1 protein_id gnl|my_center|LOCUS_17830 5941 4763 gene locus_tag LOCUS_17840 gene metK 5941 4763 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289731.1 protein_id gnl|my_center|LOCUS_17840 7799 5991 gene locus_tag LOCUS_17850 gene ptsP 7799 5991 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660652.1 protein_id gnl|my_center|LOCUS_17850 8066 7800 gene locus_tag LOCUS_17860 8066 7800 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404610.1 protein_id gnl|my_center|LOCUS_17860 8824 8066 gene locus_tag LOCUS_17870 8824 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 9516 8821 gene locus_tag LOCUS_17880 9516 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 10001 9513 gene locus_tag LOCUS_17890 gene agaV 10001 9513 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098888.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence119 1373 99 gene locus_tag LOCUS_17900 1373 99 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_17900 2263 1370 gene locus_tag LOCUS_17910 2263 1370 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174107.1 protein_id gnl|my_center|LOCUS_17910 4199 2757 gene locus_tag LOCUS_17920 4199 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4400 5803 gene locus_tag LOCUS_17930 gene mgtE 4400 5803 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039061.1 protein_id gnl|my_center|LOCUS_17930 5808 6695 gene locus_tag LOCUS_17940 5808 6695 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541541.1 protein_id gnl|my_center|LOCUS_17940 6692 7597 gene locus_tag LOCUS_17950 6692 7597 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339199.1 protein_id gnl|my_center|LOCUS_17950 8261 7575 gene locus_tag LOCUS_17960 8261 7575 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256115.1 protein_id gnl|my_center|LOCUS_17960 8776 8414 gene locus_tag LOCUS_17970 8776 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 9279 8989 gene locus_tag LOCUS_17980 9279 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 10177 9164 gene locus_tag LOCUS_17990 10177 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence120 1920 2444 gene locus_tag LOCUS_18000 gene lspA 1920 2444 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769261.1 protein_id gnl|my_center|LOCUS_18000 2450 3178 gene locus_tag LOCUS_18010 2450 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3175 3774 gene locus_tag LOCUS_18020 3175 3774 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275402.1 protein_id gnl|my_center|LOCUS_18020 3916 4551 gene locus_tag LOCUS_18030 gene pdxH 3916 4551 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705310.1 protein_id gnl|my_center|LOCUS_18030 5694 4897 gene locus_tag LOCUS_18040 5694 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_18040 7419 5776 gene locus_tag LOCUS_18050 7419 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 9161 7554 gene locus_tag LOCUS_18060 9161 7554 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_18060 9437 9967 gene locus_tag LOCUS_18070 9437 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence121 238 933 gene locus_tag LOCUS_18080 238 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 945 1847 gene locus_tag LOCUS_18090 945 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2598 1972 gene locus_tag LOCUS_18100 2598 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 2788 3042 gene locus_tag LOCUS_18110 2788 3042 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409276.1 protein_id gnl|my_center|LOCUS_18110 3039 3434 gene locus_tag LOCUS_18120 3039 3434 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409273.1 protein_id gnl|my_center|LOCUS_18120 3434 3850 gene locus_tag LOCUS_18130 3434 3850 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_18130 3886 4986 gene locus_tag LOCUS_18140 3886 4986 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_18140 5116 6837 gene locus_tag LOCUS_18150 5116 6837 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 protein_id gnl|my_center|LOCUS_18150 7506 6907 gene locus_tag LOCUS_18160 7506 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 7685 8074 gene locus_tag LOCUS_18170 7685 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 9981 8164 gene locus_tag LOCUS_18180 9981 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence122 838 407 gene locus_tag LOCUS_18190 838 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 755 946 gene locus_tag LOCUS_18200 755 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1151 1612 gene locus_tag LOCUS_18210 1151 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1613 2392 gene locus_tag LOCUS_18220 1613 2392 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528736.1 protein_id gnl|my_center|LOCUS_18220 2389 3180 gene locus_tag LOCUS_18230 2389 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 3230 5062 gene locus_tag LOCUS_18240 3230 5062 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_18240 5762 5151 gene locus_tag LOCUS_18250 5762 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 6384 5773 gene locus_tag LOCUS_18260 6384 5773 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_18260 7181 6510 gene locus_tag LOCUS_18270 gene folE 7181 6510 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633832.1 protein_id gnl|my_center|LOCUS_18270 7584 7171 gene locus_tag LOCUS_18280 7584 7171 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_18280 8059 7715 gene locus_tag LOCUS_18290 8059 7715 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142954.1 protein_id gnl|my_center|LOCUS_18290 8874 8086 gene locus_tag LOCUS_18300 8874 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 9070 9642 gene locus_tag LOCUS_18310 9070 9642 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880755.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence123 1848 385 gene locus_tag LOCUS_18320 1848 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2048 1854 gene locus_tag LOCUS_18330 2048 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2294 2061 gene locus_tag LOCUS_18340 2294 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 2713 2453 gene locus_tag LOCUS_18350 2713 2453 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168081.1 protein_id gnl|my_center|LOCUS_18350 2822 3280 gene locus_tag LOCUS_18360 2822 3280 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118164.1 protein_id gnl|my_center|LOCUS_18360 3400 4962 gene locus_tag LOCUS_18370 3400 4962 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256420.1 protein_id gnl|my_center|LOCUS_18370 6423 5041 gene locus_tag LOCUS_18380 6423 5041 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839714.1 protein_id gnl|my_center|LOCUS_18380 8235 6535 gene locus_tag LOCUS_18390 gene ggt 8235 6535 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703698.1 protein_id gnl|my_center|LOCUS_18390 <10067 8292 gene locus_tag LOCUS_18400 <10067 8292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975278.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence124 140 1354 gene locus_tag LOCUS_18410 140 1354 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_18410 2932 1394 gene locus_tag LOCUS_18420 gene guaA 2932 1394 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942834.1 protein_id gnl|my_center|LOCUS_18420 3441 2932 gene locus_tag LOCUS_18430 3441 2932 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867756.1 protein_id gnl|my_center|LOCUS_18430 4721 3441 gene locus_tag LOCUS_18440 gene lysA 4721 3441 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401767.1 protein_id gnl|my_center|LOCUS_18440 6175 4703 gene locus_tag LOCUS_18450 gene proS 6175 4703 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_18450 7545 6187 gene locus_tag LOCUS_18460 gene hisS 7545 6187 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_18460 8928 7642 gene locus_tag LOCUS_18470 8928 7642 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227872.1 protein_id gnl|my_center|LOCUS_18470 9808 8945 gene locus_tag LOCUS_18480 gene accD 9808 8945 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence125 <1 1593 gene locus_tag LOCUS_18490 <1 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259365.1:carbohydrate-binding module family 20 domain-containing protein 1590 3635 gene locus_tag LOCUS_18500 1590 3635 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037605.1 protein_id gnl|my_center|LOCUS_18500 3806 6445 gene locus_tag LOCUS_18510 3806 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 6760 7155 gene locus_tag LOCUS_18520 6760 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 7801 7187 gene locus_tag LOCUS_18530 7801 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 8254 8547 gene locus_tag LOCUS_18540 8254 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18540 8731 8537 gene locus_tag LOCUS_18550 8731 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 9402 9082 gene locus_tag LOCUS_18560 9402 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 9784 9386 gene locus_tag LOCUS_18570 9784 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence126 729 142 gene locus_tag LOCUS_18580 gene recR 729 142 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886844.1 protein_id gnl|my_center|LOCUS_18580 1045 731 gene locus_tag LOCUS_18590 1045 731 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948445.1 protein_id gnl|my_center|LOCUS_18590 2830 1052 gene locus_tag LOCUS_18600 2830 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 3196 4248 gene locus_tag LOCUS_18610 gene aroF 3196 4248 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_18610 4248 4541 gene locus_tag LOCUS_18620 4248 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4538 5437 gene locus_tag LOCUS_18630 4538 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 7115 5970 gene locus_tag LOCUS_18640 gene hisC 7115 5970 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_18640 8327 7308 gene locus_tag LOCUS_18650 gene ltaE 8327 7308 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877119.1 protein_id gnl|my_center|LOCUS_18650 9241 8327 gene locus_tag LOCUS_18660 9241 8327 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506326.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence127 1128 226 gene locus_tag LOCUS_18670 1128 226 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_18670 3074 1128 gene locus_tag LOCUS_18680 3074 1128 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_18680 3781 3074 gene locus_tag LOCUS_18690 3781 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 5759 3804 gene locus_tag LOCUS_18700 5759 3804 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_18700 6067 6684 gene locus_tag LOCUS_18710 6067 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 7940 6681 gene locus_tag LOCUS_18720 7940 6681 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_18720 <9750 7943 gene locus_tag LOCUS_18730 <9750 7943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041914012.1:polyribonucleotide nucleotidyltransferase >Feature sequence128 1559 78 gene locus_tag LOCUS_18740 1559 78 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016415.1 protein_id gnl|my_center|LOCUS_18740 1900 2283 gene locus_tag LOCUS_18750 1900 2283 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331759.1 protein_id gnl|my_center|LOCUS_18750 2280 3911 gene locus_tag LOCUS_18760 2280 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 4584 4138 gene locus_tag LOCUS_18770 4584 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 5969 4581 gene locus_tag LOCUS_18780 5969 4581 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_18780 6639 5983 gene locus_tag LOCUS_18790 6639 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 7538 6639 gene locus_tag LOCUS_18800 gene larE 7538 6639 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_18800 8574 7723 gene locus_tag LOCUS_18810 8574 7723 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047314084.1 protein_id gnl|my_center|LOCUS_18810 <9627 8731 gene locus_tag LOCUS_18820 <9627 8731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193427763.1:serine hydrolase >Feature sequence129 60 752 gene locus_tag LOCUS_18830 60 752 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974978.1 protein_id gnl|my_center|LOCUS_18830 755 1573 gene locus_tag LOCUS_18840 755 1573 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525137.1 protein_id gnl|my_center|LOCUS_18840 1584 2486 gene locus_tag LOCUS_18850 1584 2486 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233579.1 protein_id gnl|my_center|LOCUS_18850 2483 3178 gene locus_tag LOCUS_18860 2483 3178 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143928.1 protein_id gnl|my_center|LOCUS_18860 3171 3764 gene locus_tag LOCUS_18870 3171 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 3769 6432 gene locus_tag LOCUS_18880 3769 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 6429 6812 gene locus_tag LOCUS_18890 6429 6812 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939195.1 protein_id gnl|my_center|LOCUS_18890 7691 6840 gene locus_tag LOCUS_18900 gene lgt 7691 6840 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_18900 8613 7732 gene locus_tag LOCUS_18910 8613 7732 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328804.1 protein_id gnl|my_center|LOCUS_18910 9236 8727 gene locus_tag LOCUS_18920 9236 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence130 104 553 gene locus_tag LOCUS_18930 gene rplM 104 553 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258261.1 protein_id gnl|my_center|LOCUS_18930 555 947 gene locus_tag LOCUS_18940 gene rpsI 555 947 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892945.1 protein_id gnl|my_center|LOCUS_18940 1150 2079 gene locus_tag LOCUS_18950 1150 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2190 3077 gene locus_tag LOCUS_18960 gene tsf 2190 3077 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_18960 3082 3798 gene locus_tag LOCUS_18970 gene pyrH 3082 3798 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933439.1 protein_id gnl|my_center|LOCUS_18970 3801 4355 gene locus_tag LOCUS_18980 gene frr 3801 4355 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_18980 4363 5109 gene locus_tag LOCUS_18990 4363 5109 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942562.1 protein_id gnl|my_center|LOCUS_18990 5122 5976 gene locus_tag LOCUS_19000 5122 5976 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927196.1 protein_id gnl|my_center|LOCUS_19000 5973 7112 gene locus_tag LOCUS_19010 gene dxr 5973 7112 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_19010 7103 8323 gene locus_tag LOCUS_19020 gene rseP 7103 8323 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087622.1 protein_id gnl|my_center|LOCUS_19020 8548 8808 gene locus_tag LOCUS_19030 gene rpsO 8548 8808 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence131 606 7 gene locus_tag LOCUS_19040 gene msrQ 606 7 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036769.1 protein_id gnl|my_center|LOCUS_19040 1659 712 gene locus_tag LOCUS_19050 gene msrP 1659 712 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920589.1 protein_id gnl|my_center|LOCUS_19050 1845 2948 gene locus_tag LOCUS_19060 1845 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2945 3772 gene locus_tag LOCUS_19070 2945 3772 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_19070 3762 4997 gene locus_tag LOCUS_19080 3762 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 5187 5624 gene locus_tag LOCUS_19090 5187 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 6126 5629 gene locus_tag LOCUS_19100 6126 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_19100 6300 7871 gene locus_tag LOCUS_19110 6300 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 8617 7850 gene locus_tag LOCUS_19120 8617 7850 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_19120 <9207 8614 gene locus_tag LOCUS_19130 <9207 8614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546142.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence132 <1 853 gene locus_tag LOCUS_19140 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141226.1:hydantoinase B/oxoprolinase family protein 975 2450 gene locus_tag LOCUS_19150 975 2450 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_19150 2917 2447 gene locus_tag LOCUS_19160 2917 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 3399 3001 gene locus_tag LOCUS_19170 3399 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 4759 3500 gene locus_tag LOCUS_19180 4759 3500 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026984.1 protein_id gnl|my_center|LOCUS_19180 7021 5345 gene locus_tag LOCUS_19190 7021 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence133 226 351 gene locus_tag LOCUS_19200 226 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1156 512 gene locus_tag LOCUS_19210 1156 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1420 2877 gene locus_tag LOCUS_19220 1420 2877 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066243.1 protein_id gnl|my_center|LOCUS_19220 2874 4013 gene locus_tag LOCUS_19230 2874 4013 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329265.1 protein_id gnl|my_center|LOCUS_19230 4494 3970 gene locus_tag LOCUS_19240 4494 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 5518 4538 gene locus_tag LOCUS_19250 5518 4538 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530704.1 protein_id gnl|my_center|LOCUS_19250 7827 5521 gene locus_tag LOCUS_19260 7827 5521 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_19260 8456 7824 gene locus_tag LOCUS_19270 8456 7824 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036293.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence134 354 1961 gene locus_tag LOCUS_19280 354 1961 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_19280 2054 2248 gene locus_tag LOCUS_19290 2054 2248 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_19290 2466 3731 gene locus_tag LOCUS_19300 2466 3731 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_19300 4645 3737 gene locus_tag LOCUS_19310 4645 3737 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_19310 5899 4805 gene locus_tag LOCUS_19320 5899 4805 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_19320 6540 5896 gene locus_tag LOCUS_19330 6540 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 7933 6569 gene locus_tag LOCUS_19340 7933 6569 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_19340 <9000 7930 gene locus_tag LOCUS_19350 <9000 7930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228321.1:phosphoglycerate dehydrogenase >Feature sequence135 1578 673 gene locus_tag LOCUS_19360 1578 673 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_19360 3400 1703 gene locus_tag LOCUS_19370 gene argS 3400 1703 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648220.1 protein_id gnl|my_center|LOCUS_19370 3741 3397 gene locus_tag LOCUS_19380 3741 3397 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667146.1 protein_id gnl|my_center|LOCUS_19380 4993 3902 gene locus_tag LOCUS_19390 4993 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 6778 5213 gene locus_tag LOCUS_19400 6778 5213 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173309.1 protein_id gnl|my_center|LOCUS_19400 7794 6778 gene locus_tag LOCUS_19410 gene fbp 7794 6778 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932050.1 protein_id gnl|my_center|LOCUS_19410 <8568 7855 gene locus_tag LOCUS_19420 <8568 7855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258143.1:MBL fold metallo-hydrolase >Feature sequence136 <1 619 gene locus_tag LOCUS_19430 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225356248.1:DNA helicase PcrA 1838 885 gene locus_tag LOCUS_19440 1838 885 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941786.1 protein_id gnl|my_center|LOCUS_19440 2586 1849 gene locus_tag LOCUS_19450 2586 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2858 4141 gene locus_tag LOCUS_19460 gene murA 2858 4141 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083644.1 protein_id gnl|my_center|LOCUS_19460 4138 4836 gene locus_tag LOCUS_19470 gene pgeF 4138 4836 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227882.1 protein_id gnl|my_center|LOCUS_19470 4993 5460 gene locus_tag LOCUS_19480 4993 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 5472 6809 gene locus_tag LOCUS_19490 gene nusA 5472 6809 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968444.1 protein_id gnl|my_center|LOCUS_19490 6823 7146 gene locus_tag LOCUS_19500 6823 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence137 252 2798 gene locus_tag LOCUS_19510 252 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 3561 2854 gene locus_tag LOCUS_19520 3561 2854 CDS product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403120.1 protein_id gnl|my_center|LOCUS_19520 4544 3558 gene locus_tag LOCUS_19530 4544 3558 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_19530 5317 4547 gene locus_tag LOCUS_19540 5317 4547 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_19540 6405 5314 gene locus_tag LOCUS_19550 6405 5314 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_19550 7965 6694 gene locus_tag LOCUS_19560 7965 6694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_19560 8465 7971 gene locus_tag LOCUS_19570 8465 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence138 36 245 gene locus_tag LOCUS_19580 36 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 484 645 gene locus_tag LOCUS_19590 484 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 929 756 gene locus_tag LOCUS_19600 929 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1181 996 gene locus_tag LOCUS_19610 1181 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1765 1181 gene locus_tag LOCUS_19620 1765 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 3641 2766 gene locus_tag LOCUS_19630 3641 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 4484 4245 gene locus_tag LOCUS_19640 4484 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 4643 5197 gene locus_tag LOCUS_19650 4643 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 5276 6592 gene locus_tag LOCUS_19660 5276 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 7212 6724 gene locus_tag LOCUS_19670 7212 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 7746 7345 gene locus_tag LOCUS_19680 7746 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence139 811 3897 gene locus_tag LOCUS_19690 811 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 5237 3894 gene locus_tag LOCUS_19700 5237 3894 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459114.1 protein_id gnl|my_center|LOCUS_19700 6169 5516 gene locus_tag LOCUS_19710 6169 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 7982 6426 gene locus_tag LOCUS_19720 7982 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 8372 8073 gene locus_tag LOCUS_19730 8372 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence140 257 1381 gene locus_tag LOCUS_19740 257 1381 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_19740 1872 1426 gene locus_tag LOCUS_19750 1872 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3023 1869 gene locus_tag LOCUS_19760 3023 1869 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040295.1 protein_id gnl|my_center|LOCUS_19760 3478 3020 gene locus_tag LOCUS_19770 gene purE 3478 3020 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839367.1 protein_id gnl|my_center|LOCUS_19770 3631 4233 gene locus_tag LOCUS_19780 3631 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 5338 4280 gene locus_tag LOCUS_19790 5338 4280 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140478.1 protein_id gnl|my_center|LOCUS_19790 7965 5407 gene locus_tag LOCUS_19800 7965 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 8198 8125 gene locus_tag LOCUS_t00250 8198 8125 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence141 <1 1242 gene locus_tag LOCUS_19810 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072045.1:dicarboxylate/amino acid:cation symporter 1423 2022 gene locus_tag LOCUS_19820 1423 2022 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393503.1 protein_id gnl|my_center|LOCUS_19820 2132 5407 gene locus_tag LOCUS_19830 2132 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 5392 7581 gene locus_tag LOCUS_19840 5392 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 8053 7517 gene locus_tag LOCUS_19850 8053 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence142 2050 2568 gene locus_tag LOCUS_19860 2050 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3561 2578 gene locus_tag LOCUS_19870 3561 2578 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_19870 4313 3561 gene locus_tag LOCUS_19880 4313 3561 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_19880 4497 5276 gene locus_tag LOCUS_19890 4497 5276 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_19890 7079 5409 gene locus_tag LOCUS_19900 7079 5409 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_19900 7517 7251 gene locus_tag LOCUS_19910 7517 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 7891 7472 gene locus_tag LOCUS_19920 7891 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence143 2632 509 gene locus_tag LOCUS_19930 gene fusA 2632 509 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_19930 5160 3199 gene locus_tag LOCUS_19940 5160 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 6154 5204 gene locus_tag LOCUS_19950 6154 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 7241 6093 gene locus_tag LOCUS_19960 7241 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 7448 7254 gene locus_tag LOCUS_19970 7448 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 7856 7482 gene locus_tag LOCUS_19980 7856 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence144 5 78 gene locus_tag LOCUS_t00260 5 78 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 819 169 gene locus_tag LOCUS_19990 819 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1352 816 gene locus_tag LOCUS_20000 1352 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 1480 1555 gene locus_tag LOCUS_t00270 1480 1555 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3196 2453 gene locus_tag LOCUS_20010 3196 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 3872 3219 gene locus_tag LOCUS_20020 3872 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 4467 3862 gene locus_tag LOCUS_20030 4467 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 5705 4758 gene locus_tag LOCUS_20040 5705 4758 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414409.1 protein_id gnl|my_center|LOCUS_20040 6547 5702 gene locus_tag LOCUS_20050 6547 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence145 <1 578 gene locus_tag LOCUS_20060 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921045.1:Mrp/NBP35 family ATP-binding protein 646 1395 gene locus_tag LOCUS_20070 646 1395 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_20070 2597 1458 gene locus_tag LOCUS_20080 2597 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 3190 2600 gene locus_tag LOCUS_20090 3190 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 3867 3265 gene locus_tag LOCUS_20100 gene rpoE 3867 3265 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_20100 4028 4795 gene locus_tag LOCUS_20110 gene ubiE 4028 4795 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_20110 4828 6306 gene locus_tag LOCUS_20120 4828 6306 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881045.1 protein_id gnl|my_center|LOCUS_20120 6303 7202 gene locus_tag LOCUS_20130 6303 7202 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_20130 7202 7801 gene locus_tag LOCUS_20140 7202 7801 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417280.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence146 1435 689 gene locus_tag LOCUS_20150 1435 689 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_20150 3356 1986 gene locus_tag LOCUS_20160 3356 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 3757 3377 gene locus_tag LOCUS_20170 3757 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 4370 3849 gene locus_tag LOCUS_20180 4370 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 4903 4367 gene locus_tag LOCUS_20190 4903 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 5045 5257 gene locus_tag LOCUS_20200 5045 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 5254 5874 gene locus_tag LOCUS_20210 5254 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 5871 6392 gene locus_tag LOCUS_20220 5871 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 6389 7348 gene locus_tag LOCUS_20230 6389 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence147 1120 632 gene locus_tag LOCUS_20240 1120 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 2322 1951 gene locus_tag LOCUS_20250 2322 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 4278 2827 gene locus_tag LOCUS_20260 gene merA 4278 2827 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136268.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20260 4568 4275 gene locus_tag LOCUS_20270 gene merP 4568 4275 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732275.1 protein_id gnl|my_center|LOCUS_20270 4955 4581 gene locus_tag LOCUS_20280 4955 4581 CDS product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294660.1 protein_id gnl|my_center|LOCUS_20280 4996 5439 gene locus_tag LOCUS_20290 gene merR 4996 5439 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_20290 6342 5794 gene locus_tag LOCUS_20300 6342 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 6494 6784 gene locus_tag LOCUS_20310 6494 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 <7790 6834 gene locus_tag LOCUS_20320 <7790 6834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041170156.1:TonB-dependent siderophore receptor >Feature sequence148 <1 1745 gene locus_tag LOCUS_20330 <1 1745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143441.1:Na+:solute symporter 1781 2434 gene locus_tag LOCUS_20340 1781 2434 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_20340 2431 4092 gene locus_tag LOCUS_20350 2431 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 4089 4370 gene locus_tag LOCUS_20360 4089 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4385 5560 gene locus_tag LOCUS_20370 4385 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 5572 6492 gene locus_tag LOCUS_20380 5572 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 6559 7227 gene locus_tag LOCUS_20390 6559 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence149 177 869 gene locus_tag LOCUS_20400 gene ispD 177 869 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_20400 853 1530 gene locus_tag LOCUS_20410 853 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1527 1988 gene locus_tag LOCUS_20420 gene prpB 1527 1988 CDS product protein arginine phosphatase PrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227664.1 protein_id gnl|my_center|LOCUS_20420 1999 2808 gene locus_tag LOCUS_20430 1999 2808 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_20430 2787 3617 gene locus_tag LOCUS_20440 2787 3617 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083041.1 protein_id gnl|my_center|LOCUS_20440 3638 4645 gene locus_tag LOCUS_20450 gene gap 3638 4645 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_20450 4656 5855 gene locus_tag LOCUS_20460 4656 5855 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_20460 5852 6601 gene locus_tag LOCUS_20470 gene tpiA 5852 6601 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_20470 6662 7042 gene locus_tag LOCUS_20480 6662 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence150 964 95 gene locus_tag LOCUS_20490 964 95 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_20490 2048 1005 gene locus_tag LOCUS_20500 2048 1005 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_20500 2449 2045 gene locus_tag LOCUS_20510 2449 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2816 2463 gene locus_tag LOCUS_20520 2816 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2980 3525 gene locus_tag LOCUS_20530 2980 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 3529 4803 gene locus_tag LOCUS_20540 gene serS 3529 4803 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_20540 4807 5973 gene locus_tag LOCUS_20550 4807 5973 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839261.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence151 393 929 gene locus_tag LOCUS_20560 393 929 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989581.1 protein_id gnl|my_center|LOCUS_20560 1052 2194 gene locus_tag LOCUS_20570 gene tal 1052 2194 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_20570 2205 3614 gene locus_tag LOCUS_20580 gene pyk 2205 3614 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_20580 3611 4384 gene locus_tag LOCUS_20590 3611 4384 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_20590 4384 5769 gene locus_tag LOCUS_20600 4384 5769 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_20600 5753 6232 gene locus_tag LOCUS_20610 5753 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence152 364 3189 gene locus_tag LOCUS_20620 gene alaS 364 3189 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_20620 3218 3538 gene locus_tag LOCUS_20630 3218 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 3543 4091 gene locus_tag LOCUS_20640 gene gmhA 3543 4091 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_20640 7310 4206 gene locus_tag LOCUS_20650 7310 4206 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence153 324 253 gene locus_tag LOCUS_t00280 324 253 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1051 692 gene locus_tag LOCUS_20660 1051 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 1408 1061 gene locus_tag LOCUS_20670 1408 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 1851 1405 gene locus_tag LOCUS_20680 1851 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 2791 2943 gene locus_tag LOCUS_20690 2791 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 3894 2977 gene locus_tag LOCUS_20700 gene ispE 3894 2977 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458917.1 protein_id gnl|my_center|LOCUS_20700 4937 3891 gene locus_tag LOCUS_20710 4937 3891 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_20710 6590 4941 gene locus_tag LOCUS_20720 6590 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 <7584 6861 gene locus_tag LOCUS_20730 <7584 6861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000818969.1:pyridoxine 5'-phosphate synthase >Feature sequence154 2641 1229 gene locus_tag LOCUS_20740 gene cysS 2641 1229 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570132.1 protein_id gnl|my_center|LOCUS_20740 3562 2663 gene locus_tag LOCUS_20750 3562 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 4669 4331 gene locus_tag LOCUS_20760 4669 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 6860 5658 gene locus_tag LOCUS_20770 6860 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence155 1377 124 gene locus_tag LOCUS_20780 1377 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 3152 1374 gene locus_tag LOCUS_20790 gene mrdA 3152 1374 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_20790 3637 3149 gene locus_tag LOCUS_20800 3637 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 4632 3634 gene locus_tag LOCUS_20810 4632 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 5724 4681 gene locus_tag LOCUS_20820 5724 4681 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_20820 7224 6112 gene locus_tag LOCUS_20830 gene ald 7224 6112 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence156 292 53 gene locus_tag LOCUS_20840 292 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 174 494 gene locus_tag LOCUS_20850 174 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 873 499 gene locus_tag LOCUS_20860 873 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 942 1499 gene locus_tag LOCUS_20870 942 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 1530 2351 gene locus_tag LOCUS_20880 1530 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2543 3550 gene locus_tag LOCUS_20890 2543 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3559 3849 gene locus_tag LOCUS_20900 3559 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3886 4671 gene locus_tag LOCUS_20910 3886 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 4725 5219 gene locus_tag LOCUS_20920 4725 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence157 1888 185 gene locus_tag LOCUS_20930 gene asnB 1888 185 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 protein_id gnl|my_center|LOCUS_20930 3087 2119 gene locus_tag LOCUS_20940 3087 2119 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838741.1 protein_id gnl|my_center|LOCUS_20940 5724 3379 gene locus_tag LOCUS_20950 5724 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 6704 5742 gene locus_tag LOCUS_20960 gene mtrA 6704 5742 CDS product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence158 3011 1137 gene locus_tag LOCUS_20970 3011 1137 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_20970 3172 5754 gene locus_tag LOCUS_20980 3172 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 6079 5729 gene locus_tag LOCUS_20990 6079 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 6740 6261 gene locus_tag LOCUS_21000 6740 6261 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 protein_id gnl|my_center|LOCUS_21000 6897 6733 gene locus_tag LOCUS_21010 6897 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 <7424 6894 gene locus_tag LOCUS_21020 <7424 6894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962270.1:ferrous iron transport protein B >Feature sequence159 398 952 gene locus_tag LOCUS_21030 398 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1078 2622 gene locus_tag LOCUS_21040 1078 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2679 4184 gene locus_tag LOCUS_21050 2679 4184 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_21050 5221 5967 gene locus_tag LOCUS_21060 5221 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 6086 6442 gene locus_tag LOCUS_21070 6086 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 7078 6776 gene locus_tag LOCUS_21080 7078 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence160 71 1318 gene locus_tag LOCUS_21090 gene lhgO 71 1318 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222145.1 protein_id gnl|my_center|LOCUS_21090 1635 1336 gene locus_tag LOCUS_21100 1635 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2144 1809 gene locus_tag LOCUS_21110 2144 1809 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_21110 2347 2135 gene locus_tag LOCUS_21120 2347 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2668 3990 gene locus_tag LOCUS_21130 2668 3990 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_21130 4814 3987 gene locus_tag LOCUS_21140 4814 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331406.1 protein_id gnl|my_center|LOCUS_21140 5068 4805 gene locus_tag LOCUS_21150 5068 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 5267 5620 gene locus_tag LOCUS_21160 5267 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 5607 6056 gene locus_tag LOCUS_21170 5607 6056 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_21170 6061 6588 gene locus_tag LOCUS_21180 6061 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 6622 7335 gene locus_tag LOCUS_21190 6622 7335 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057504658.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence161 2017 455 gene locus_tag LOCUS_21200 2017 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3288 2014 gene locus_tag LOCUS_21210 3288 2014 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975930.1 protein_id gnl|my_center|LOCUS_21210 4339 3290 gene locus_tag LOCUS_21220 4339 3290 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894495.1 protein_id gnl|my_center|LOCUS_21220 6549 4342 gene locus_tag LOCUS_21230 6549 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 7168 6641 gene locus_tag LOCUS_21240 7168 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 7413 7165 gene locus_tag LOCUS_21250 7413 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence162 83 2014 gene locus_tag LOCUS_21260 gene btuB 83 2014 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275301.1 protein_id gnl|my_center|LOCUS_21260 2146 2907 gene locus_tag LOCUS_21270 gene recO 2146 2907 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927151.1 protein_id gnl|my_center|LOCUS_21270 2880 4805 gene locus_tag LOCUS_21280 gene selB 2880 4805 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_21280 4889 5329 gene locus_tag LOCUS_21290 4889 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence163 316 110 gene locus_tag LOCUS_21300 316 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1885 338 gene locus_tag LOCUS_21310 1885 338 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_21310 2478 1903 gene locus_tag LOCUS_21320 2478 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 3443 2475 gene locus_tag LOCUS_21330 3443 2475 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268938.1 protein_id gnl|my_center|LOCUS_21330 3585 4673 gene locus_tag LOCUS_21340 3585 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 6821 4728 gene locus_tag LOCUS_21350 6821 4728 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence164 673 95 gene locus_tag LOCUS_21360 673 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21360 1040 663 gene locus_tag LOCUS_21370 1040 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21370 1372 2643 gene locus_tag LOCUS_21380 1372 2643 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_21380 2657 2971 gene locus_tag LOCUS_21390 gene tusE 2657 2971 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301417.1 protein_id gnl|my_center|LOCUS_21390 2991 3509 gene locus_tag LOCUS_21400 2991 3509 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_21400 4153 3563 gene locus_tag LOCUS_21410 4153 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 4231 6903 gene locus_tag LOCUS_21420 4231 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 7298 7053 gene locus_tag LOCUS_21430 7298 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence165 <1 1483 gene locus_tag LOCUS_21440 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404818.1:DUF2723 domain-containing protein 1820 1473 gene locus_tag LOCUS_21450 1820 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1929 4409 gene locus_tag LOCUS_21460 1929 4409 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403097.1 protein_id gnl|my_center|LOCUS_21460 4387 6600 gene locus_tag LOCUS_21470 gene glgB 4387 6600 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066955.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence166 2792 18 gene locus_tag LOCUS_21480 gene acnA 2792 18 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_21480 4065 2950 gene locus_tag LOCUS_21490 4065 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 4420 4097 gene locus_tag LOCUS_21500 4420 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 4520 5842 gene locus_tag LOCUS_21510 4520 5842 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861814.1 protein_id gnl|my_center|LOCUS_21510 5842 7029 gene locus_tag LOCUS_21520 5842 7029 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404168.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence167 <1 1415 gene locus_tag LOCUS_21530 <1 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839967.1:MATE family efflux transporter 1875 1423 gene locus_tag LOCUS_21540 1875 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1990 3075 gene locus_tag LOCUS_21550 gene dusB 1990 3075 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_21550 3075 3827 gene locus_tag LOCUS_21560 gene larB 3075 3827 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_21560 3831 5450 gene locus_tag LOCUS_21570 3831 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 5609 5970 gene locus_tag LOCUS_tm00010 5609 5970 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6227 6658 gene locus_tag LOCUS_21580 6227 6658 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721810.1 protein_id gnl|my_center|LOCUS_21580 <7175 6669 gene locus_tag LOCUS_21590 <7175 6669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706283.1:lytic transglycosylase F >Feature sequence168 1329 580 gene locus_tag LOCUS_21600 1329 580 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_21600 1679 1326 gene locus_tag LOCUS_21610 1679 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_21610 3040 1679 gene locus_tag LOCUS_21620 3040 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 4653 3037 gene locus_tag LOCUS_21630 4653 3037 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826328.1 protein_id gnl|my_center|LOCUS_21630 5063 4650 gene locus_tag LOCUS_21640 5063 4650 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_21640 5224 5523 gene locus_tag LOCUS_21650 5224 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 5776 6090 gene locus_tag LOCUS_21660 5776 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 6275 6799 gene locus_tag LOCUS_21670 6275 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 6796 7005 gene locus_tag LOCUS_21680 6796 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence169 <1 2204 gene locus_tag LOCUS_21690 <1 2204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940947.1:cytochrome c3 family protein 2679 2383 gene locus_tag LOCUS_21700 2679 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 3490 2717 gene locus_tag LOCUS_21710 3490 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3626 4507 gene locus_tag LOCUS_21720 3626 4507 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_21720 4558 5613 gene locus_tag LOCUS_21730 4558 5613 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530933.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence170 444 554 gene locus_tag LOCUS_r00010 444 554 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1069 2568 gene locus_tag LOCUS_21740 1069 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2752 3636 gene locus_tag LOCUS_21750 2752 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 3633 3800 gene locus_tag LOCUS_21760 3633 3800 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_21760 3802 4779 gene locus_tag LOCUS_21770 3802 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 4776 5699 gene locus_tag LOCUS_21780 4776 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 5920 6798 gene locus_tag LOCUS_21790 5920 6798 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545261.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence171 1407 148 gene locus_tag LOCUS_21800 1407 148 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259113.1 protein_id gnl|my_center|LOCUS_21800 1954 1421 gene locus_tag LOCUS_21810 1954 1421 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815991.1 protein_id gnl|my_center|LOCUS_21810 4490 2019 gene locus_tag LOCUS_21820 gene lon 4490 2019 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_21820 4801 6120 gene locus_tag LOCUS_21830 gene ffh 4801 6120 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_21830 6824 6192 gene locus_tag LOCUS_21840 6824 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence172 <1 2432 gene locus_tag LOCUS_21850 <1 2432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226719.1:oxidoreductase 2429 4090 gene locus_tag LOCUS_21860 2429 4090 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257261.1 protein_id gnl|my_center|LOCUS_21860 4271 4690 gene locus_tag LOCUS_21870 4271 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 4730 5479 gene locus_tag LOCUS_21880 4730 5479 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855402.1 protein_id gnl|my_center|LOCUS_21880 5493 6659 gene locus_tag LOCUS_21890 gene argJ 5493 6659 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123874.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence173 <1 2306 gene locus_tag LOCUS_21900 <1 2306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403151.1:glycoside hydrolase family 3 N-terminal domain-containing protein 2395 2751 gene locus_tag LOCUS_21910 2395 2751 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565964.1 protein_id gnl|my_center|LOCUS_21910 2846 4747 gene locus_tag LOCUS_21920 gene nagB 2846 4747 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074422.1 protein_id gnl|my_center|LOCUS_21920 4772 6280 gene locus_tag LOCUS_21930 4772 6280 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060927.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence174 1548 52 gene locus_tag LOCUS_21940 1548 52 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143249.1 protein_id gnl|my_center|LOCUS_21940 1732 2553 gene locus_tag LOCUS_21950 1732 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2553 3758 gene locus_tag LOCUS_21960 2553 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 4156 4755 gene locus_tag LOCUS_21970 4156 4755 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070530.1 protein_id gnl|my_center|LOCUS_21970 4890 5780 gene locus_tag LOCUS_21980 4890 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 6557 5751 gene locus_tag LOCUS_21990 6557 5751 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence175 <1 1209 gene locus_tag LOCUS_22000 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057223.1:ABC transporter permease 1276 2541 gene locus_tag LOCUS_22010 1276 2541 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_22010 2715 3905 gene locus_tag LOCUS_22020 2715 3905 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_22020 3909 5159 gene locus_tag LOCUS_22030 3909 5159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339253.1 protein_id gnl|my_center|LOCUS_22030 5163 6422 gene locus_tag LOCUS_22040 5163 6422 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405554.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence176 <1 575 gene locus_tag LOCUS_22050 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037397112.1:aldo/keto reductase 1757 579 gene locus_tag LOCUS_22060 1757 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2129 3253 gene locus_tag LOCUS_22070 gene hppD 2129 3253 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_22070 3253 4434 gene locus_tag LOCUS_22080 3253 4434 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258372.1 protein_id gnl|my_center|LOCUS_22080 4437 5615 gene locus_tag LOCUS_22090 4437 5615 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence177 <1 2447 gene locus_tag LOCUS_22100 <1 2447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein 4188 2674 gene locus_tag LOCUS_22110 4188 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 4395 4467 gene locus_tag LOCUS_t00290 4395 4467 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4806 5789 gene locus_tag LOCUS_22120 4806 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 5786 6451 gene locus_tag LOCUS_22130 5786 6451 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_22130 >Feature sequence178 922 2142 gene locus_tag LOCUS_22140 922 2142 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933564.1 protein_id gnl|my_center|LOCUS_22140 2980 2099 gene locus_tag LOCUS_22150 2980 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3156 2977 gene locus_tag LOCUS_22160 3156 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 3888 3169 gene locus_tag LOCUS_22170 3888 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 5439 3928 gene locus_tag LOCUS_22180 5439 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 <6588 5452 gene locus_tag LOCUS_22190 <6588 5452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118827098.1:ABC transporter ATP-binding protein >Feature sequence179 456 82 gene locus_tag LOCUS_22200 456 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2508 745 gene locus_tag LOCUS_22210 2508 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 3263 2505 gene locus_tag LOCUS_22220 3263 2505 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_22220 4833 3298 gene locus_tag LOCUS_22230 4833 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 6410 4830 gene locus_tag LOCUS_22240 6410 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence180 1297 302 gene locus_tag LOCUS_22250 1297 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2220 1294 gene locus_tag LOCUS_22260 2220 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 3182 2229 gene locus_tag LOCUS_22270 3182 2229 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22270 4129 3179 gene locus_tag LOCUS_22280 4129 3179 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_22280 4961 4221 gene locus_tag LOCUS_22290 4961 4221 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227785.1 protein_id gnl|my_center|LOCUS_22290 5533 4958 gene locus_tag LOCUS_22300 gene scpB 5533 4958 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_22300 6293 5508 gene locus_tag LOCUS_22310 6293 5508 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225073.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence181 542 1153 gene locus_tag LOCUS_22320 542 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22320 2393 1326 gene locus_tag LOCUS_22330 gene lpxD 2393 1326 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141862.1 protein_id gnl|my_center|LOCUS_22330 2547 3572 gene locus_tag LOCUS_22340 gene pheS 2547 3572 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_22340 3569 6073 gene locus_tag LOCUS_22350 gene pheT 3569 6073 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405510.1 protein_id gnl|my_center|LOCUS_22350 6051 6353 gene locus_tag LOCUS_22360 6051 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence182 1277 171 gene locus_tag LOCUS_22370 1277 171 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_22370 1527 3119 gene locus_tag LOCUS_22380 1527 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 4024 3842 gene locus_tag LOCUS_22390 4024 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 4091 5026 gene locus_tag LOCUS_22400 4091 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 5076 5627 gene locus_tag LOCUS_22410 gene hpt 5076 5627 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence183 <1 695 gene locus_tag LOCUS_22420 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888962.1:potassium channel protein 818 3316 gene locus_tag LOCUS_22430 gene leuS 818 3316 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_22430 4291 3473 gene locus_tag LOCUS_22440 4291 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 5006 4284 gene locus_tag LOCUS_22450 5006 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 5156 5734 gene locus_tag LOCUS_22460 5156 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 5739 6449 gene locus_tag LOCUS_22470 5739 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence184 64 843 gene locus_tag LOCUS_22480 gene lepB 64 843 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_22480 913 1788 gene locus_tag LOCUS_22490 913 1788 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_22490 1963 2466 gene locus_tag LOCUS_22500 1963 2466 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_22500 2463 3848 gene locus_tag LOCUS_22510 gene rimO 2463 3848 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_22510 3845 5218 gene locus_tag LOCUS_22520 3845 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence185 1972 329 gene locus_tag LOCUS_22530 gene glgA 1972 329 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_22530 2084 2281 gene locus_tag LOCUS_22540 2084 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 4380 2227 gene locus_tag LOCUS_22550 gene glgP 4380 2227 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_22550 4597 5025 gene locus_tag LOCUS_22560 4597 5025 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396390.1 protein_id gnl|my_center|LOCUS_22560 5140 5811 gene locus_tag LOCUS_22570 5140 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22570 5708 6022 gene locus_tag LOCUS_22580 5708 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22580 >Feature sequence186 125 817 gene locus_tag LOCUS_22590 125 817 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530528.1 protein_id gnl|my_center|LOCUS_22590 819 1853 gene locus_tag LOCUS_22600 819 1853 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_22600 1861 3027 gene locus_tag LOCUS_22610 1861 3027 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228908.1 protein_id gnl|my_center|LOCUS_22610 3204 4061 gene locus_tag LOCUS_22620 3204 4061 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_22620 4196 5476 gene locus_tag LOCUS_22630 4196 5476 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545033.1 protein_id gnl|my_center|LOCUS_22630 6451 5570 gene locus_tag LOCUS_22640 6451 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 >Feature sequence187 424 972 gene locus_tag LOCUS_22650 424 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1138 1836 gene locus_tag LOCUS_22660 1138 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 1883 2203 gene locus_tag LOCUS_22670 1883 2203 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_22670 2264 3052 gene locus_tag LOCUS_22680 2264 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 3126 3515 gene locus_tag LOCUS_22690 gene glxB 3126 3515 CDS product methylglyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243237.1 protein_id gnl|my_center|LOCUS_22690 3538 4467 gene locus_tag LOCUS_22700 gene cysK 3538 4467 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_22700 4514 5587 gene locus_tag LOCUS_22710 4514 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22710 >Feature sequence188 2536 1277 gene locus_tag LOCUS_22720 2536 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 5567 2544 gene locus_tag LOCUS_22730 5567 2544 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176521608.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence189 226 3231 gene locus_tag LOCUS_22740 226 3231 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176521608.1 protein_id gnl|my_center|LOCUS_22740 3231 4526 gene locus_tag LOCUS_22750 3231 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 4685 5686 gene locus_tag LOCUS_22760 4685 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 <6318 5761 gene locus_tag LOCUS_22770 <6318 5761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001788197.1:DNA-directed RNA polymerase subunit beta' >Feature sequence190 1721 327 gene locus_tag LOCUS_22780 1721 327 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_22780 2389 1724 gene locus_tag LOCUS_22790 gene fsa 2389 1724 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403055.1 protein_id gnl|my_center|LOCUS_22790 3162 2389 gene locus_tag LOCUS_22800 gene truA 3162 2389 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403435.1 protein_id gnl|my_center|LOCUS_22800 3325 4623 gene locus_tag LOCUS_22810 3325 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 4616 5653 gene locus_tag LOCUS_22820 gene trpD 4616 5653 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_22820 <6305 5687 gene locus_tag LOCUS_22830 <6305 5687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000413738.1:transcriptional repressor LexA >Feature sequence191 261 1625 gene locus_tag LOCUS_22840 261 1625 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_22840 1625 2065 gene locus_tag LOCUS_22850 1625 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2062 2745 gene locus_tag LOCUS_22860 gene mntR 2062 2745 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728504.1 protein_id gnl|my_center|LOCUS_22860 3033 3578 gene locus_tag LOCUS_22870 3033 3578 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_22870 3734 4576 gene locus_tag LOCUS_22880 3734 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 5261 4770 gene locus_tag LOCUS_22890 5261 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 <6186 5404 gene locus_tag LOCUS_22900 <6186 5404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022878.1:alpha/beta fold hydrolase >Feature sequence192 309 1499 gene locus_tag LOCUS_22910 gene ftsZ 309 1499 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305686.1 protein_id gnl|my_center|LOCUS_22910 1529 2761 gene locus_tag LOCUS_22920 1529 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2823 4619 gene locus_tag LOCUS_22930 2823 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence193 1986 1126 gene locus_tag LOCUS_22940 1986 1126 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035563.1 protein_id gnl|my_center|LOCUS_22940 2455 2009 gene locus_tag LOCUS_22950 2455 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2578 3999 gene locus_tag LOCUS_22960 2578 3999 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_22960 4095 4370 gene locus_tag LOCUS_22970 4095 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 4367 4756 gene locus_tag LOCUS_22980 4367 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 4798 5115 gene locus_tag LOCUS_22990 4798 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 5112 5522 gene locus_tag LOCUS_23000 5112 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence194 425 150 gene locus_tag LOCUS_23010 425 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 691 1347 gene locus_tag LOCUS_23020 691 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 1344 2681 gene locus_tag LOCUS_23030 1344 2681 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_23030 2746 3789 gene locus_tag LOCUS_23040 2746 3789 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387917.1 protein_id gnl|my_center|LOCUS_23040 3947 5509 gene locus_tag LOCUS_23050 3947 5509 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence195 2752 629 gene locus_tag LOCUS_23060 gene dcp 2752 629 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275152.1 protein_id gnl|my_center|LOCUS_23060 2816 3229 gene locus_tag LOCUS_23070 2816 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 4146 3496 gene locus_tag LOCUS_23080 4146 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 5506 4163 gene locus_tag LOCUS_23090 5506 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5739 6044 gene locus_tag LOCUS_23100 5739 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence196 1718 171 gene locus_tag LOCUS_23110 gene bshC 1718 171 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933222.1 protein_id gnl|my_center|LOCUS_23110 2339 1875 gene locus_tag LOCUS_23120 gene rlmH 2339 1875 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_23120 3663 2353 gene locus_tag LOCUS_23130 3663 2353 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403282.1 protein_id gnl|my_center|LOCUS_23130 4713 3703 gene locus_tag LOCUS_23140 gene lpxK 4713 3703 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_23140 5383 4706 gene locus_tag LOCUS_23150 5383 4706 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367246.1 protein_id gnl|my_center|LOCUS_23150 <6087 5380 gene locus_tag LOCUS_23160 <6087 5380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942901.1:lipid-A-disaccharide synthase >Feature sequence197 1555 1190 gene locus_tag LOCUS_23170 1555 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2007 1552 gene locus_tag LOCUS_23180 2007 1552 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963556.1 protein_id gnl|my_center|LOCUS_23180 2114 3010 gene locus_tag LOCUS_23190 2114 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 3007 4089 gene locus_tag LOCUS_23200 gene rlmN 3007 4089 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392423.1 protein_id gnl|my_center|LOCUS_23200 4419 4018 gene locus_tag LOCUS_23210 4419 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 5036 4500 gene locus_tag LOCUS_23220 5036 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 5806 5033 gene locus_tag LOCUS_23230 gene trpA 5806 5033 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence198 43 2565 gene locus_tag LOCUS_23240 43 2565 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_23240 2567 2914 gene locus_tag LOCUS_23250 2567 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 3028 3528 gene locus_tag LOCUS_23260 3028 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 <6053 3579 gene locus_tag LOCUS_23270 <6053 3579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167355190.1:PAS domain-containing protein >Feature sequence199 1063 71 gene locus_tag LOCUS_23280 1063 71 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_23280 1221 1826 gene locus_tag LOCUS_23290 1221 1826 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_23290 1817 3400 gene locus_tag LOCUS_23300 1817 3400 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066658.1 protein_id gnl|my_center|LOCUS_23300 4723 3473 gene locus_tag LOCUS_23310 4723 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 <6048 4737 gene locus_tag LOCUS_23320 <6048 4737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176521608.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence200 1732 272 gene locus_tag LOCUS_23330 1732 272 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537445.1 protein_id gnl|my_center|LOCUS_23330 3850 1736 gene locus_tag LOCUS_23340 3850 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 5305 3881 gene locus_tag LOCUS_23350 5305 3881 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943876.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence201 <1 768 gene locus_tag LOCUS_23360 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881196.1:diaminopimelate epimerase 1742 1089 gene locus_tag LOCUS_23370 1742 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 1935 2528 gene locus_tag LOCUS_23380 1935 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2543 3871 gene locus_tag LOCUS_23390 gene tolC 2543 3871 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735329.1 protein_id gnl|my_center|LOCUS_23390 3868 4851 gene locus_tag LOCUS_23400 3868 4851 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_23400 4890 5861 gene locus_tag LOCUS_23410 4890 5861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence202 <1 1896 gene locus_tag LOCUS_23420 <1 1896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928446.1:S9 family peptidase 1896 2843 gene locus_tag LOCUS_23430 1896 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 3246 2815 gene locus_tag LOCUS_23440 3246 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 4609 3338 gene locus_tag LOCUS_23450 gene gltT 4609 3338 CDS product glutamate/proton symporter GltT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245579.1 protein_id gnl|my_center|LOCUS_23450 <5842 4682 gene locus_tag LOCUS_23460 <5842 4682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000838734.1:amino acid permease >Feature sequence203 2344 812 gene locus_tag LOCUS_23470 gene purH 2344 812 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_23470 3128 2457 gene locus_tag LOCUS_23480 gene purN 3128 2457 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404384.1 protein_id gnl|my_center|LOCUS_23480 3768 3130 gene locus_tag LOCUS_23490 3768 3130 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870429.1 protein_id gnl|my_center|LOCUS_23490 5123 3765 gene locus_tag LOCUS_23500 gene selA 5123 3765 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393981.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence204 2973 2482 gene locus_tag LOCUS_23510 2973 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2882 3493 gene locus_tag LOCUS_23520 2882 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 3518 4642 gene locus_tag LOCUS_23530 3518 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 5114 4647 gene locus_tag LOCUS_23540 5114 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence205 149 1126 gene locus_tag LOCUS_23550 149 1126 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942059.1 protein_id gnl|my_center|LOCUS_23550 1123 2340 gene locus_tag LOCUS_23560 1123 2340 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272563.1 protein_id gnl|my_center|LOCUS_23560 2366 2818 gene locus_tag LOCUS_23570 2366 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2822 3475 gene locus_tag LOCUS_23580 2822 3475 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024137.1 protein_id gnl|my_center|LOCUS_23580 3741 3953 gene locus_tag LOCUS_23590 gene cspE 3741 3953 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439184.1 protein_id gnl|my_center|LOCUS_23590 4178 4891 gene locus_tag LOCUS_23600 4178 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 4958 5431 gene locus_tag LOCUS_23610 4958 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 5332 5751 gene locus_tag LOCUS_23620 5332 5751 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772547.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence206 536 2551 gene locus_tag LOCUS_23630 536 2551 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942207.1 protein_id gnl|my_center|LOCUS_23630 2566 3756 gene locus_tag LOCUS_23640 2566 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 3767 5404 gene locus_tag LOCUS_23650 3767 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 5401 5709 gene locus_tag LOCUS_23660 5401 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence207 393 1544 gene locus_tag LOCUS_23670 393 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 3430 1541 gene locus_tag LOCUS_23680 3430 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 4395 3427 gene locus_tag LOCUS_23690 4395 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 5382 4468 gene locus_tag LOCUS_23700 5382 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence208 1326 526 gene locus_tag LOCUS_23710 1326 526 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967054.1 protein_id gnl|my_center|LOCUS_23710 2168 1323 gene locus_tag LOCUS_23720 2168 1323 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_23720 3142 2168 gene locus_tag LOCUS_23730 3142 2168 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_23730 4798 3146 gene locus_tag LOCUS_23740 4798 3146 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986790.1 protein_id gnl|my_center|LOCUS_23740 5624 4839 gene locus_tag LOCUS_23750 5624 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence209 1074 766 gene locus_tag LOCUS_23760 1074 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2198 1071 gene locus_tag LOCUS_23770 gene recF 2198 1071 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_23770 2979 2200 gene locus_tag LOCUS_23780 2979 2200 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_23780 3151 4224 gene locus_tag LOCUS_23790 gene mtnA 3151 4224 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_23790 4232 4552 gene locus_tag LOCUS_23800 4232 4552 CDS product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103307.1 protein_id gnl|my_center|LOCUS_23800 4629 4841 gene locus_tag LOCUS_23810 4629 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence210 1050 187 gene locus_tag LOCUS_23820 1050 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2028 1066 gene locus_tag LOCUS_23830 2028 1066 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_23830 4310 2025 gene locus_tag LOCUS_23840 4310 2025 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119132.1 protein_id gnl|my_center|LOCUS_23840 <5639 4669 gene locus_tag LOCUS_23850 <5639 4669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545192.1:chaperonin GroEL >Feature sequence211 <1 1174 gene locus_tag LOCUS_23860 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256562.1:DUF4388 domain-containing protein 1171 2055 gene locus_tag LOCUS_23870 1171 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 2052 3068 gene locus_tag LOCUS_23880 2052 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 3145 3318 gene locus_tag LOCUS_23890 3145 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 3343 3417 gene locus_tag LOCUS_t00300 3343 3417 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3523 5256 gene locus_tag LOCUS_23900 3523 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence212 <1 1240 gene locus_tag LOCUS_23910 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389262.1:FAD-dependent oxidoreductase 1309 2496 gene locus_tag LOCUS_23920 1309 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_23920 2976 2509 gene locus_tag LOCUS_23930 gene greA 2976 2509 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_23930 3199 4050 gene locus_tag LOCUS_23940 3199 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 4267 5528 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcgccccgcgcggggcgcgac >Feature sequence213 1914 1531 gene locus_tag LOCUS_23950 1914 1531 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403946.1 protein_id gnl|my_center|LOCUS_23950 2331 2723 gene locus_tag LOCUS_23960 2331 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence214 1670 33 gene locus_tag LOCUS_23970 1670 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2123 1758 gene locus_tag LOCUS_23980 2123 1758 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392702.1 protein_id gnl|my_center|LOCUS_23980 4449 2158 gene locus_tag LOCUS_23990 4449 2158 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225572.1 protein_id gnl|my_center|LOCUS_23990 4910 4446 gene locus_tag LOCUS_24000 4910 4446 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171505.1 protein_id gnl|my_center|LOCUS_24000 5127 5390 gene locus_tag LOCUS_24010 5127 5390 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence215 135 329 gene locus_tag LOCUS_24020 135 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 313 888 gene locus_tag LOCUS_24030 313 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 1313 3721 gene locus_tag LOCUS_24040 1313 3721 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_24040 3891 5453 gene locus_tag LOCUS_24050 3891 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence216 20 2872 gene locus_tag LOCUS_24060 20 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 3100 5025 gene locus_tag LOCUS_24070 3100 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 5454 5032 gene locus_tag LOCUS_24080 5454 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence217 839 1876 gene locus_tag LOCUS_24090 839 1876 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615469.1 protein_id gnl|my_center|LOCUS_24090 2028 2723 gene locus_tag LOCUS_24100 2028 2723 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_24100 2749 4065 gene locus_tag LOCUS_24110 2749 4065 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_24110 4062 4520 gene locus_tag LOCUS_24120 4062 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 4553 4840 gene locus_tag LOCUS_24130 4553 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 4890 5168 gene locus_tag LOCUS_24140 4890 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 5202 5420 gene locus_tag LOCUS_24150 5202 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence218 1472 36 gene locus_tag LOCUS_24160 gene hslU 1472 36 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932863.1 protein_id gnl|my_center|LOCUS_24160 1555 2361 gene locus_tag LOCUS_24170 1555 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2906 2364 gene locus_tag LOCUS_24180 gene hslV 2906 2364 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_24180 3489 2950 gene locus_tag LOCUS_24190 3489 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 3587 4558 gene locus_tag LOCUS_24200 3587 4558 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813999.1 protein_id gnl|my_center|LOCUS_24200 <5373 4650 gene locus_tag LOCUS_24210 <5373 4650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002121221.1:DNA adenine methylase >Feature sequence219 1200 154 gene locus_tag LOCUS_24220 1200 154 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_24220 4159 1310 gene locus_tag LOCUS_24230 4159 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 5307 4156 gene locus_tag LOCUS_24240 5307 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence220 418 1182 gene locus_tag LOCUS_24250 418 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1209 1739 gene locus_tag LOCUS_24260 1209 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 1898 2356 gene locus_tag LOCUS_24270 1898 2356 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223931.1 protein_id gnl|my_center|LOCUS_24270 2391 2552 gene locus_tag LOCUS_24280 2391 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2561 4435 gene locus_tag LOCUS_24290 2561 4435 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445450.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence221 78 347 gene locus_tag LOCUS_24300 78 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 939 490 gene locus_tag LOCUS_24310 939 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 1199 2746 gene locus_tag LOCUS_24320 1199 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2746 2967 gene locus_tag LOCUS_24330 2746 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2964 3632 gene locus_tag LOCUS_24340 2964 3632 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_24340 3640 5133 gene locus_tag LOCUS_24350 3640 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence222 93 20 gene locus_tag LOCUS_t00310 93 20 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1537 173 gene locus_tag LOCUS_24360 1537 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2760 1612 gene locus_tag LOCUS_24370 2760 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2846 3883 gene locus_tag LOCUS_24380 2846 3883 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038014.1 protein_id gnl|my_center|LOCUS_24380 4374 3901 gene locus_tag LOCUS_24390 4374 3901 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence223 <1 1081 gene locus_tag LOCUS_24400 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937797.1:HD-GYP domain-containing protein 1088 1861 gene locus_tag LOCUS_24410 gene trpA 1088 1861 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_24410 1858 2394 gene locus_tag LOCUS_24420 gene yqeK 1858 2394 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640291.1 protein_id gnl|my_center|LOCUS_24420 2376 2876 gene locus_tag LOCUS_24430 2376 2876 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405259.1 protein_id gnl|my_center|LOCUS_24430 3896 2805 gene locus_tag LOCUS_24440 gene rlmN 3896 2805 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392423.1 protein_id gnl|my_center|LOCUS_24440 4789 3893 gene locus_tag LOCUS_24450 4789 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 4108 4035 gene locus_tag LOCUS_t00320 4108 4035 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence224 522 683 gene locus_tag LOCUS_24460 522 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1150 848 gene locus_tag LOCUS_24470 1150 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1271 3748 gene locus_tag LOCUS_24480 1271 3748 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020587.1 protein_id gnl|my_center|LOCUS_24480 3875 5092 gene locus_tag LOCUS_24490 gene acdA 3875 5092 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence225 2986 1691 gene locus_tag LOCUS_24500 gene fadI 2986 1691 CDS product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531977.1 protein_id gnl|my_center|LOCUS_24500 3193 4824 gene locus_tag LOCUS_24510 gene glpD 3193 4824 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence226 1839 1069 gene locus_tag LOCUS_24520 1839 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 3416 1971 gene locus_tag LOCUS_24530 3416 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 <5108 3474 gene locus_tag LOCUS_24540 <5108 3474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103036562.1:TonB-dependent receptor >Feature sequence227 286 1311 gene locus_tag LOCUS_24550 286 1311 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_24550 1367 1831 gene locus_tag LOCUS_24560 1367 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1828 2232 gene locus_tag LOCUS_24570 1828 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 2229 3068 gene locus_tag LOCUS_24580 2229 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3070 4233 gene locus_tag LOCUS_24590 3070 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence228 332 949 gene locus_tag LOCUS_24600 332 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 1002 1994 gene locus_tag LOCUS_24610 1002 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2043 2567 gene locus_tag LOCUS_24620 2043 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 4841 2685 gene locus_tag LOCUS_24630 4841 2685 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence229 1135 338 gene locus_tag LOCUS_24640 gene rsmA 1135 338 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036027.1 protein_id gnl|my_center|LOCUS_24640 2916 1318 gene locus_tag LOCUS_24650 2916 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 3400 2927 gene locus_tag LOCUS_24660 3400 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 3733 3401 gene locus_tag LOCUS_24670 3733 3401 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_24670 4813 3764 gene locus_tag LOCUS_24680 gene pta 4813 3764 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence230 1716 586 gene locus_tag LOCUS_24690 1716 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 2138 1716 gene locus_tag LOCUS_24700 2138 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 2629 2102 gene locus_tag LOCUS_24710 2629 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 3134 4213 gene locus_tag LOCUS_24720 3134 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence231 763 143 gene locus_tag LOCUS_24730 763 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 1461 889 gene locus_tag LOCUS_24740 1461 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 2057 1458 gene locus_tag LOCUS_24750 2057 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2267 2431 gene locus_tag LOCUS_24760 2267 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 3571 2678 gene locus_tag LOCUS_24770 3571 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 4358 3558 gene locus_tag LOCUS_24780 4358 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence232 422 2026 gene locus_tag LOCUS_24790 422 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2759 2064 gene locus_tag LOCUS_24800 2759 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 3978 2788 gene locus_tag LOCUS_24810 3978 2788 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_24810 <4897 4197 gene locus_tag LOCUS_24820 <4897 4197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089483.1:2-oxoacid:ferredoxin oxidoreductase subunit beta >Feature sequence233 2501 24 gene locus_tag LOCUS_24830 gene cas3 2501 24 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_24830 2761 3294 gene locus_tag LOCUS_24840 2761 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 4588 3308 gene locus_tag LOCUS_24850 4588 3308 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence234 737 1660 gene locus_tag LOCUS_24860 737 1660 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920982.1 protein_id gnl|my_center|LOCUS_24860 3298 1676 gene locus_tag LOCUS_24870 3298 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 3489 4454 gene locus_tag LOCUS_24880 3489 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence235 1831 26 gene locus_tag LOCUS_24890 1831 26 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105272.1 protein_id gnl|my_center|LOCUS_24890 2101 1862 gene locus_tag LOCUS_24900 2101 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_24900 2361 2143 gene locus_tag LOCUS_24910 2361 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 2961 2482 gene locus_tag LOCUS_24920 2961 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 3327 3004 gene locus_tag LOCUS_24930 3327 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 3754 3461 gene locus_tag LOCUS_24940 3754 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 4126 3794 gene locus_tag LOCUS_24950 4126 3794 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 protein_id gnl|my_center|LOCUS_24950 4494 4126 gene locus_tag LOCUS_24960 4494 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 >Feature sequence236 374 760 gene locus_tag LOCUS_24970 gene rplU 374 760 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216394.1 protein_id gnl|my_center|LOCUS_24970 782 1054 gene locus_tag LOCUS_24980 gene rpmA 782 1054 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545975.1 protein_id gnl|my_center|LOCUS_24980 2065 1154 gene locus_tag LOCUS_24990 2065 1154 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023294.1 protein_id gnl|my_center|LOCUS_24990 2187 2573 gene locus_tag LOCUS_25000 2187 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 3961 2654 gene locus_tag LOCUS_25010 3961 2654 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 protein_id gnl|my_center|LOCUS_25010 <4770 3961 gene locus_tag LOCUS_25020 <4770 3961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265753.1:amidohydrolase >Feature sequence237 853 1233 gene locus_tag LOCUS_25030 853 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 1320 1544 gene locus_tag LOCUS_25040 1320 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1652 2818 gene locus_tag LOCUS_25050 gene nifS 1652 2818 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_25050 2815 3876 gene locus_tag LOCUS_25060 gene mnmA 2815 3876 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_25060 3694 3787 gene locus_tag LOCUS_t00330 3694 3787 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4495 4061 gene locus_tag LOCUS_25070 4495 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence238 <1 532 gene locus_tag LOCUS_25080 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028830.1:indole-3-glycerol phosphate synthase TrpC 525 1181 gene locus_tag LOCUS_25090 525 1181 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_25090 1183 2373 gene locus_tag LOCUS_25100 gene trpB 1183 2373 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124343.1 protein_id gnl|my_center|LOCUS_25100 2411 4183 gene locus_tag LOCUS_25110 2411 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence239 1 678 gene locus_tag LOCUS_25120 1 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 675 2444 gene locus_tag LOCUS_25130 675 2444 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036596.1 protein_id gnl|my_center|LOCUS_25130 2453 3385 gene locus_tag LOCUS_25140 2453 3385 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_25140 3382 3777 gene locus_tag LOCUS_25150 3382 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 3774 4706 gene locus_tag LOCUS_25160 gene rsgA 3774 4706 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence240 36 317 gene locus_tag LOCUS_25170 36 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 390 578 gene locus_tag LOCUS_25180 390 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 866 1240 gene locus_tag LOCUS_25190 866 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1299 2000 gene locus_tag LOCUS_25200 1299 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 2271 3008 gene locus_tag LOCUS_25210 2271 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 3005 3871 gene locus_tag LOCUS_25220 3005 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence241 1288 59 gene locus_tag LOCUS_25230 1288 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2067 1285 gene locus_tag LOCUS_25240 gene paaG 2067 1285 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969781.1 protein_id gnl|my_center|LOCUS_25240 2292 4388 gene locus_tag LOCUS_25250 2292 4388 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396305.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence242 <1 755 gene locus_tag LOCUS_25260 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942781.1:efflux RND transporter periplasmic adaptor subunit 766 3957 gene locus_tag LOCUS_25270 766 3957 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524131.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence243 427 1716 gene locus_tag LOCUS_25280 427 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 1716 2843 gene locus_tag LOCUS_25290 1716 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2848 4008 gene locus_tag LOCUS_25300 2848 4008 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence244 774 52 gene locus_tag LOCUS_25310 774 52 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_25310 1862 771 gene locus_tag LOCUS_25320 1862 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3133 1859 gene locus_tag LOCUS_25330 gene hemL 3133 1859 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_25330 4161 3160 gene locus_tag LOCUS_25340 gene hemB 4161 3160 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence245 349 900 gene locus_tag LOCUS_25350 gene nuoE 349 900 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_25350 999 2306 gene locus_tag LOCUS_25360 gene nuoF 999 2306 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_25360 2306 3835 gene locus_tag LOCUS_25370 2306 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence246 261 533 gene locus_tag LOCUS_25380 261 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 647 958 gene locus_tag LOCUS_25390 647 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 962 1186 gene locus_tag LOCUS_25400 962 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 1190 1414 gene locus_tag LOCUS_25410 1190 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1418 1687 gene locus_tag LOCUS_25420 1418 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 1894 2070 gene locus_tag LOCUS_25430 1894 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2067 3062 gene locus_tag LOCUS_25440 2067 3062 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_25440 3089 3997 gene locus_tag LOCUS_25450 3089 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 4008 4181 gene locus_tag LOCUS_25460 4008 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence247 307 59 gene locus_tag LOCUS_25470 307 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1023 592 gene locus_tag LOCUS_25480 1023 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2242 1406 gene locus_tag LOCUS_25490 gene dapF 2242 1406 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_25490 2961 2239 gene locus_tag LOCUS_25500 2961 2239 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_25500 <4539 2954 gene locus_tag LOCUS_25510 <4539 2954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797373.1:YfhO family protein >Feature sequence248 559 2202 gene locus_tag LOCUS_25520 559 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence249 <1 1099 gene locus_tag LOCUS_25530 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942261.1:DNA polymerase IV 1140 1628 gene locus_tag LOCUS_25540 1140 1628 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039582.1 protein_id gnl|my_center|LOCUS_25540 1780 4263 gene locus_tag LOCUS_25550 1780 4263 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence250 292 1338 gene locus_tag LOCUS_25560 292 1338 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_25560 1348 2496 gene locus_tag LOCUS_25570 1348 2496 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_25570 2499 2894 gene locus_tag LOCUS_25580 2499 2894 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_25580 2894 3070 gene locus_tag LOCUS_25590 2894 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3216 3956 gene locus_tag LOCUS_25600 3216 3956 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_25600 4338 3985 gene locus_tag LOCUS_25610 4338 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence251 1077 235 gene locus_tag LOCUS_25620 1077 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2436 1348 gene locus_tag LOCUS_25630 2436 1348 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_25630 4101 2485 gene locus_tag LOCUS_25640 4101 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence252 <1 2643 gene locus_tag LOCUS_25650 <1 2643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070862.1:efflux RND transporter permease subunit 2672 3076 gene locus_tag LOCUS_25660 2672 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence253 43 426 gene locus_tag LOCUS_25670 43 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 435 632 gene locus_tag LOCUS_25680 435 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 729 1685 gene locus_tag LOCUS_25690 729 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence254 1248 943 gene locus_tag LOCUS_25700 1248 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2359 1253 gene locus_tag LOCUS_25710 2359 1253 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_25710 2772 2359 gene locus_tag LOCUS_25720 gene nusB 2772 2359 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326965.1 protein_id gnl|my_center|LOCUS_25720 3263 2772 gene locus_tag LOCUS_25730 gene ribE 3263 2772 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869754.1 protein_id gnl|my_center|LOCUS_25730 <4319 3263 gene locus_tag LOCUS_25740 <4319 3263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920923.1:bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II >Feature sequence255 2371 407 gene locus_tag LOCUS_25750 2371 407 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968769.1 protein_id gnl|my_center|LOCUS_25750 2583 3647 gene locus_tag LOCUS_25760 2583 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence256 954 52 gene locus_tag LOCUS_25770 954 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 1101 3059 gene locus_tag LOCUS_25780 gene speA 1101 3059 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence257 718 2025 gene locus_tag LOCUS_25790 718 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2183 3136 gene locus_tag LOCUS_25800 2183 3136 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence258 2 1450 gene locus_tag LOCUS_25810 2 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 2329 1478 gene locus_tag LOCUS_25820 2329 1478 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931188.1 protein_id gnl|my_center|LOCUS_25820 3109 2432 gene locus_tag LOCUS_25830 3109 2432 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 protein_id gnl|my_center|LOCUS_25830 3500 3042 gene locus_tag LOCUS_25840 3500 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25840 <4193 3587 gene locus_tag LOCUS_25850 <4193 3587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202608288.1:YfcC family protein >Feature sequence259 1168 350 gene locus_tag LOCUS_25860 1168 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 2553 1225 gene locus_tag LOCUS_25870 2553 1225 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_25870 4038 2554 gene locus_tag LOCUS_25880 4038 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence260 1234 3252 gene locus_tag LOCUS_25890 1234 3252 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_25890 3256 3789 gene locus_tag LOCUS_25900 3256 3789 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence261 910 269 gene locus_tag LOCUS_25910 910 269 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016415.1 protein_id gnl|my_center|LOCUS_25910 2576 915 gene locus_tag LOCUS_25920 2576 915 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405524.1 protein_id gnl|my_center|LOCUS_25920 <4099 2795 gene locus_tag LOCUS_25930 <4099 2795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763947.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence262 470 916 gene locus_tag LOCUS_25940 470 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1896 943 gene locus_tag LOCUS_25950 1896 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 3570 1951 gene locus_tag LOCUS_25960 3570 1951 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_25960 3900 3580 gene locus_tag LOCUS_25970 3900 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence263 3700 125 gene locus_tag LOCUS_25980 3700 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence264 <1 1030 gene locus_tag LOCUS_25990 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:response regulator note possible pseudo, internal stop codon 1034 2386 gene locus_tag LOCUS_26000 1034 2386 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_26000 2358 2588 gene locus_tag LOCUS_26010 2358 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2585 3550 gene locus_tag LOCUS_26020 2585 3550 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_26020 3975 3547 gene locus_tag LOCUS_26030 3975 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence265 <1 3195 gene locus_tag LOCUS_26040 <1 3195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase 3192 3617 gene locus_tag LOCUS_26050 3192 3617 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_26050 >Feature sequence266 691 2091 gene locus_tag LOCUS_26060 gene gdhA 691 2091 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence267 1670 297 gene locus_tag LOCUS_26070 gene hemG 1670 297 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_26070 3085 1667 gene locus_tag LOCUS_26080 gene hemN 3085 1667 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881391.1 protein_id gnl|my_center|LOCUS_26080 <3970 3082 gene locus_tag LOCUS_26090 <3970 3082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957475.1:uroporphyrinogen decarboxylase >Feature sequence268 1225 602 gene locus_tag LOCUS_26100 1225 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1620 1216 gene locus_tag LOCUS_26110 1620 1216 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_26110 1841 3682 gene locus_tag LOCUS_26120 1841 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence269 613 32 gene locus_tag LOCUS_26130 613 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 667 1800 gene locus_tag LOCUS_26140 667 1800 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268294.1 protein_id gnl|my_center|LOCUS_26140 2131 3075 gene locus_tag LOCUS_26150 2131 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 <3941 3299 gene locus_tag LOCUS_26160 <3941 3299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393996.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE >Feature sequence270 404 1762 gene locus_tag LOCUS_26170 404 1762 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941279.1 protein_id gnl|my_center|LOCUS_26170 1813 2499 gene locus_tag LOCUS_26180 1813 2499 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_26180 2531 3496 gene locus_tag LOCUS_26190 2531 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence271 1664 507 gene locus_tag LOCUS_26200 1664 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1887 2504 gene locus_tag LOCUS_26210 1887 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 3418 2981 gene locus_tag LOCUS_26220 3418 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence272 492 1046 gene locus_tag LOCUS_26230 492 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1106 2404 gene locus_tag LOCUS_26240 1106 2404 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218080540.1 protein_id gnl|my_center|LOCUS_26240 <3897 2560 gene locus_tag LOCUS_26250 <3897 2560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393420.1:amino acid permease >Feature sequence273 93 908 gene locus_tag LOCUS_26260 93 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 905 1984 gene locus_tag LOCUS_26270 gene wtpC 905 1984 CDS product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_26270 3727 2009 gene locus_tag LOCUS_26280 3727 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 >Feature sequence274 1209 223 gene locus_tag LOCUS_26290 1209 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 1478 2356 gene locus_tag LOCUS_26300 1478 2356 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_26300 2629 2826 gene locus_tag LOCUS_26310 2629 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2837 3817 gene locus_tag LOCUS_26320 2837 3817 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391327.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence275 383 652 gene locus_tag LOCUS_26330 383 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 851 1402 gene locus_tag LOCUS_26340 851 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1773 1495 gene locus_tag LOCUS_26350 1773 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 1849 2130 gene locus_tag LOCUS_26360 1849 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2678 2899 gene locus_tag LOCUS_26370 2678 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2974 3417 gene locus_tag LOCUS_26380 2974 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 3414 3656 gene locus_tag LOCUS_26390 3414 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence276 381 2477 gene locus_tag LOCUS_26400 381 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2474 2953 gene locus_tag LOCUS_26410 2474 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 3512 3012 gene locus_tag LOCUS_26420 3512 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence277 45 608 gene locus_tag LOCUS_26430 45 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 1584 724 gene locus_tag LOCUS_26440 1584 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207842.1 protein_id gnl|my_center|LOCUS_26440 3345 1588 gene locus_tag LOCUS_26450 3345 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence278 1109 3589 gene locus_tag LOCUS_26460 1109 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence279 1476 226 gene locus_tag LOCUS_26470 1476 226 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_26470 1691 3280 gene locus_tag LOCUS_26480 1691 3280 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615699.1 protein_id gnl|my_center|LOCUS_26480 <3789 3289 gene locus_tag LOCUS_26490 <3789 3289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731052.1:sulfite exporter TauE/SafE family protein >Feature sequence280 268 456 gene locus_tag LOCUS_26500 gene rpsU 268 456 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357777.1 protein_id gnl|my_center|LOCUS_26500 456 899 gene locus_tag LOCUS_26510 456 899 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_26510 1001 3385 gene locus_tag LOCUS_26520 1001 3385 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence281 1712 291 gene locus_tag LOCUS_26530 gene dnaB 1712 291 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_26530 2667 1666 gene locus_tag LOCUS_26540 2667 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 <3787 2657 gene locus_tag LOCUS_26550 <3787 2657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941785.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC >Feature sequence282 62 328 gene locus_tag LOCUS_26560 62 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26560 349 1179 gene locus_tag LOCUS_26570 349 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26570 1240 1416 gene locus_tag LOCUS_26580 1240 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 1413 2024 gene locus_tag LOCUS_26590 1413 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2009 2854 gene locus_tag LOCUS_26600 2009 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 3041 3637 gene locus_tag LOCUS_26610 3041 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence283 1 3237 gene locus_tag LOCUS_26620 gene narZ 1 3237 CDS product nitrate reductase Z subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040458.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence284 <1 1571 gene locus_tag LOCUS_26630 <1 1571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001006287.1:ATP-dependent protease ATP-binding subunit ClpX 2935 1628 gene locus_tag LOCUS_26640 2935 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence285 217 1854 gene locus_tag LOCUS_26650 217 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1851 2819 gene locus_tag LOCUS_26660 1851 2819 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_26660 3027 3308 gene locus_tag LOCUS_26670 3027 3308 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_26670 3323 3604 gene locus_tag LOCUS_26680 3323 3604 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence286 <1 632 gene locus_tag LOCUS_26690 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144015.1:efflux RND transporter periplasmic adaptor subunit 1221 751 gene locus_tag LOCUS_26700 1221 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 1980 3707 gene locus_tag LOCUS_26710 1980 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26710 >Feature sequence287 692 18 gene locus_tag LOCUS_26720 gene cmk 692 18 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408441.1 protein_id gnl|my_center|LOCUS_26720 1944 679 gene locus_tag LOCUS_26730 gene aroA 1944 679 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255967.1 protein_id gnl|my_center|LOCUS_26730 2830 1955 gene locus_tag LOCUS_26740 2830 1955 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403729.1 protein_id gnl|my_center|LOCUS_26740 3720 2827 gene locus_tag LOCUS_26750 gene dapA 3720 2827 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence288 652 816 gene locus_tag LOCUS_26760 652 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 1946 804 gene locus_tag LOCUS_26770 1946 804 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_26770 <3717 2069 gene locus_tag LOCUS_26780 <3717 2069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391800.1:excinuclease ABC subunit UvrC >Feature sequence289 1823 135 gene locus_tag LOCUS_26790 1823 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 2051 1842 gene locus_tag LOCUS_26800 gene yidD 2051 1842 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256304.1 protein_id gnl|my_center|LOCUS_26800 2279 2067 gene locus_tag LOCUS_26810 2279 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 2583 2419 gene locus_tag LOCUS_26820 gene rpmH 2583 2419 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888783.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence290 <1 1009 gene locus_tag LOCUS_26830 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096956.1:glutamate/aspartate:proton symporter GltP 1034 1999 gene locus_tag LOCUS_26840 1034 1999 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454499.1 protein_id gnl|my_center|LOCUS_26840 2003 2254 gene locus_tag LOCUS_26850 2003 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 3432 2794 gene locus_tag LOCUS_26860 3432 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence291 183 1769 gene locus_tag LOCUS_26870 183 1769 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243139.1 protein_id gnl|my_center|LOCUS_26870 2794 1766 gene locus_tag LOCUS_26880 2794 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 3483 2794 gene locus_tag LOCUS_26890 3483 2794 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence292 <1 1252 gene locus_tag LOCUS_26900 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121816.1:adenylosuccinate lyase 1249 2181 gene locus_tag LOCUS_26910 1249 2181 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083634.1 protein_id gnl|my_center|LOCUS_26910 2178 2825 gene locus_tag LOCUS_26920 2178 2825 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence293 722 1978 gene locus_tag LOCUS_26930 722 1978 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_26930 2242 2469 gene locus_tag LOCUS_26940 2242 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 2806 2597 gene locus_tag LOCUS_26950 2806 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 3318 2803 gene locus_tag LOCUS_26960 3318 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence294 887 159 gene locus_tag LOCUS_26970 887 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 1429 905 gene locus_tag LOCUS_26980 gene lspA 1429 905 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112823.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence295 <1 2626 gene locus_tag LOCUS_26990 <1 2626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085105.1:formate dehydrogenase subunit alpha 2629 3420 gene locus_tag LOCUS_27000 2629 3420 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence296 83 1567 gene locus_tag LOCUS_27010 gene glpK 83 1567 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_27010 1966 1577 gene locus_tag LOCUS_27020 1966 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 3574 2084 gene locus_tag LOCUS_27030 3574 2084 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence297 720 316 gene locus_tag LOCUS_27040 720 316 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_27040 <3547 907 gene locus_tag LOCUS_27050 <3547 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117740.1:prolyl oligopeptidase family serine peptidase >Feature sequence298 3230 1311 gene locus_tag LOCUS_27060 3230 1311 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530170.1 protein_id gnl|my_center|LOCUS_27060 3526 3227 gene locus_tag LOCUS_27070 3526 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence299 1477 944 gene locus_tag LOCUS_27080 1477 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 2935 1898 gene locus_tag LOCUS_27090 2935 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27090 3462 2932 gene locus_tag LOCUS_27100 3462 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence300 947 174 gene locus_tag LOCUS_27110 947 174 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_27110 2884 971 gene locus_tag LOCUS_27120 2884 971 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_27120 <3509 2898 gene locus_tag LOCUS_27130 <3509 2898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016325539.1:succinate dehydrogenase cytochrome b subunit >Feature sequence301 1733 870 gene locus_tag LOCUS_27140 gene atpG 1733 870 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948667.1 protein_id gnl|my_center|LOCUS_27140 3341 1779 gene locus_tag LOCUS_27150 gene atpA 3341 1779 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence302 <1 598 gene locus_tag LOCUS_27160 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005082850.1:YdeI/OmpD-associated family protein 1795 695 gene locus_tag LOCUS_27170 1795 695 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_27170 1836 1845 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1957 2505 gene locus_tag LOCUS_27180 1957 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 2598 3080 gene locus_tag LOCUS_27190 2598 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence303 <1 1243 gene locus_tag LOCUS_27200 <1 1243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_095517487.1:winged helix-turn-helix domain-containing tetratricopeptide repeat protein 2725 1307 gene locus_tag LOCUS_27210 2725 1307 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_27210 2848 3129 gene locus_tag LOCUS_27220 2848 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence304 1869 424 gene locus_tag LOCUS_27230 1869 424 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940922.1 protein_id gnl|my_center|LOCUS_27230 2173 2424 gene locus_tag LOCUS_27240 2173 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence305 1537 50 gene locus_tag LOCUS_27250 1537 50 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_27250 2976 1534 gene locus_tag LOCUS_27260 2976 1534 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence306 1969 2148 gene locus_tag LOCUS_27270 1969 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence307 >Feature sequence308 580 987 gene locus_tag LOCUS_27280 580 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 1995 1198 gene locus_tag LOCUS_27290 1995 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331406.1 protein_id gnl|my_center|LOCUS_27290 2249 1986 gene locus_tag LOCUS_27300 2249 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 2789 2514 gene locus_tag LOCUS_27310 2789 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 3181 2786 gene locus_tag LOCUS_27320 3181 2786 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402858.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence309 768 2864 gene locus_tag LOCUS_27330 768 2864 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396305.1 protein_id gnl|my_center|LOCUS_27330 3368 2892 gene locus_tag LOCUS_27340 gene paaJ 3368 2892 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931075.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence310 <1 544 gene locus_tag LOCUS_27350 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228028.1:DivIVA domain-containing protein 553 1404 gene locus_tag LOCUS_27360 553 1404 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence311 >Feature sequence312 265 969 gene locus_tag LOCUS_27370 265 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927023.1 protein_id gnl|my_center|LOCUS_27370 1009 2796 gene locus_tag LOCUS_27380 gene recJ 1009 2796 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence313 736 119 gene locus_tag LOCUS_27390 736 119 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_27390 1947 850 gene locus_tag LOCUS_27400 gene ribD 1947 850 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_27400 2942 1947 gene locus_tag LOCUS_27410 2942 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence314 1219 257 gene locus_tag LOCUS_27420 1219 257 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_27420 1983 1282 gene locus_tag LOCUS_27430 1983 1282 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839853.1 protein_id gnl|my_center|LOCUS_27430 <3299 1980 gene locus_tag LOCUS_27440 <3299 1980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405241.1:GMC family oxidoreductase >Feature sequence315 1009 554 gene locus_tag LOCUS_27450 1009 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 1972 1439 gene locus_tag LOCUS_27460 1972 1439 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017341.1 protein_id gnl|my_center|LOCUS_27460 2550 1972 gene locus_tag LOCUS_27470 2550 1972 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931713.1 protein_id gnl|my_center|LOCUS_27470 2891 2622 gene locus_tag LOCUS_27480 2891 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 >Feature sequence316 2767 1715 gene locus_tag LOCUS_27490 2767 1715 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078027.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence317 841 1860 gene locus_tag LOCUS_27500 841 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 >Feature sequence318 99 1112 gene locus_tag LOCUS_27510 99 1112 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816295.1 protein_id gnl|my_center|LOCUS_27510 1130 2227 gene locus_tag LOCUS_27520 1130 2227 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138390504.1 protein_id gnl|my_center|LOCUS_27520 3099 2758 gene locus_tag LOCUS_27530 3099 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence319 <1 1515 gene locus_tag LOCUS_27540 <1 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962811.1:M28 family metallopeptidase 1956 1567 gene locus_tag LOCUS_27550 1956 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 2104 2706 gene locus_tag LOCUS_27560 2104 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 <3206 2699 gene locus_tag LOCUS_27570 <3206 2699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000405420.1:amidase family protein >Feature sequence320 <1 979 gene locus_tag LOCUS_27580 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965143.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB 1113 2417 gene locus_tag LOCUS_27590 1113 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence321 <3150 2440 gene locus_tag LOCUS_27600 <3150 2440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707237.1:ABC transporter ATP-binding protein >Feature sequence322 1633 554 gene locus_tag LOCUS_27610 gene prfB 1633 554 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_27610 2248 1859 gene locus_tag LOCUS_27620 2248 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence323 1061 216 gene locus_tag LOCUS_27630 1061 216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_27630 2035 1061 gene locus_tag LOCUS_27640 2035 1061 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_27640 2773 2039 gene locus_tag LOCUS_27650 2773 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 2784 2793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence324 >Feature sequence325 1288 62 gene locus_tag LOCUS_27660 1288 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 2135 1455 gene locus_tag LOCUS_27670 gene trmD 2135 1455 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_27670 2677 2132 gene locus_tag LOCUS_27680 gene rimM 2677 2132 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_27680 2994 2674 gene locus_tag LOCUS_27690 gene rpsP 2994 2674 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence326 575 375 gene locus_tag LOCUS_27700 575 375 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670205.1 protein_id gnl|my_center|LOCUS_27700 818 3043 gene locus_tag LOCUS_27710 818 3043 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence327 608 258 gene locus_tag LOCUS_27720 608 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 1278 622 gene locus_tag LOCUS_27730 1278 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 1638 1282 gene locus_tag LOCUS_27740 gene groES 1638 1282 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141030.1 protein_id gnl|my_center|LOCUS_27740 2234 1638 gene locus_tag LOCUS_27750 2234 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 2811 2248 gene locus_tag LOCUS_27760 2811 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence328 46 405 gene locus_tag LOCUS_27770 46 405 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705627.1 protein_id gnl|my_center|LOCUS_27770 467 913 gene locus_tag LOCUS_27780 467 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 936 1238 gene locus_tag LOCUS_27790 936 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 1259 2164 gene locus_tag LOCUS_27800 1259 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 <3083 2169 gene locus_tag LOCUS_27810 <3083 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405451.1:ATP-dependent helicase HrpB >Feature sequence329 594 758 gene locus_tag LOCUS_27820 594 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 1473 814 gene locus_tag LOCUS_27830 1473 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 2474 1470 gene locus_tag LOCUS_27840 2474 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence330 >Feature sequence331 1026 2204 gene locus_tag LOCUS_27850 1026 2204 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_27850 2792 2226 gene locus_tag LOCUS_27860 2792 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence332 488 1720 gene locus_tag LOCUS_27870 488 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 1999 1739 gene locus_tag LOCUS_27880 1999 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 2216 1986 gene locus_tag LOCUS_27890 2216 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 2477 2758 gene locus_tag LOCUS_27900 2477 2758 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_27900 >Feature sequence333 447 1460 gene locus_tag LOCUS_27910 447 1460 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584015.1 protein_id gnl|my_center|LOCUS_27910 1461 2948 gene locus_tag LOCUS_27920 1461 2948 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence334 157 966 gene locus_tag LOCUS_27930 157 966 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_27930 963 2402 gene locus_tag LOCUS_27940 963 2402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902634.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence335 1167 2426 gene locus_tag LOCUS_27950 gene tyrS 1167 2426 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_27950 2953 2480 gene locus_tag LOCUS_27960 2953 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence336 1125 274 gene locus_tag LOCUS_27970 1125 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27970 1475 1122 gene locus_tag LOCUS_27980 1475 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27980 1787 1503 gene locus_tag LOCUS_27990 1787 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence337 170 1336 gene locus_tag LOCUS_28000 170 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 1336 2259 gene locus_tag LOCUS_28010 1336 2259 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence338 133 495 gene locus_tag LOCUS_28020 133 495 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813644.1 protein_id gnl|my_center|LOCUS_28020 778 1821 gene locus_tag LOCUS_28030 gene recA 778 1821 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_28030 2082 2819 gene locus_tag LOCUS_28040 2082 2819 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_28040 >Feature sequence339 78 2444 gene locus_tag LOCUS_28050 78 2444 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838717.1 protein_id gnl|my_center|LOCUS_28050 2441 2644 gene locus_tag LOCUS_28060 2441 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence340 1033 410 gene locus_tag LOCUS_28070 gene udk 1033 410 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986880.1 protein_id gnl|my_center|LOCUS_28070 >Feature sequence341 174 659 gene locus_tag LOCUS_28080 174 659 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_28080 656 1312 gene locus_tag LOCUS_28090 656 1312 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921714.1 protein_id gnl|my_center|LOCUS_28090 >Feature sequence342 2242 2688 gene locus_tag LOCUS_28100 2242 2688 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396390.1 protein_id gnl|my_center|LOCUS_28100 >Feature sequence343 2362 347 gene locus_tag LOCUS_28110 2362 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence344 2850 28 gene locus_tag LOCUS_28120 2850 28 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_28120 >Feature sequence345 696 484 gene locus_tag LOCUS_28130 696 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 1349 711 gene locus_tag LOCUS_28140 gene gmk 1349 711 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531657.1 protein_id gnl|my_center|LOCUS_28140 2212 1346 gene locus_tag LOCUS_28150 2212 1346 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_28150 >Feature sequence346 2409 355 gene locus_tag LOCUS_28160 2409 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence347 >Feature sequence348 244 501 gene locus_tag LOCUS_28170 244 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 992 570 gene locus_tag LOCUS_28180 992 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 2388 1009 gene locus_tag LOCUS_28190 2388 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 2557 2405 gene locus_tag LOCUS_28200 2557 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence349 1423 2454 gene locus_tag LOCUS_28210 1423 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence350 232 945 gene locus_tag LOCUS_28220 232 945 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522307.1 protein_id gnl|my_center|LOCUS_28220 1671 949 gene locus_tag LOCUS_28230 1671 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 1785 2744 gene locus_tag LOCUS_28240 1785 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence351 365 1771 gene locus_tag LOCUS_28250 365 1771 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928471.1 protein_id gnl|my_center|LOCUS_28250 1776 2132 gene locus_tag LOCUS_28260 1776 2132 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545317.1 protein_id gnl|my_center|LOCUS_28260 2248 2682 gene locus_tag LOCUS_28270 2248 2682 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923583.1 protein_id gnl|my_center|LOCUS_28270 >Feature sequence352 1053 325 gene locus_tag LOCUS_28280 gene radC 1053 325 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_28280 2487 1126 gene locus_tag LOCUS_28290 2487 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 2797 2618 gene locus_tag LOCUS_28300 2797 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence353 323 1561 gene locus_tag LOCUS_28310 gene nrfD 323 1561 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272193.1 protein_id gnl|my_center|LOCUS_28310 >Feature sequence354 6 182 gene locus_tag LOCUS_28320 6 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 179 2098 gene locus_tag LOCUS_28330 179 2098 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530170.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence355 268 1221 gene locus_tag LOCUS_28340 268 1221 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_28340 1394 2068 gene locus_tag LOCUS_28350 1394 2068 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_28350 2083 2772 gene locus_tag LOCUS_28360 2083 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence356 <1 1222 gene locus_tag LOCUS_28370 <1 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941319.1:ATP-dependent chaperone ClpB 1293 2231 gene locus_tag LOCUS_28380 1293 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 2262 2747 gene locus_tag LOCUS_28390 gene tadA 2262 2747 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706618.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence357 1954 596 gene locus_tag LOCUS_28400 gene selA 1954 596 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967004.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence358 1090 65 gene locus_tag LOCUS_28410 1090 65 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_28410 1198 1398 gene locus_tag LOCUS_28420 1198 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 <2737 1388 gene locus_tag LOCUS_28430 <2737 1388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761136.1:PEP/pyruvate-binding domain-containing protein >Feature sequence359 400 1881 gene locus_tag LOCUS_28440 400 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence360 2116 20 gene locus_tag LOCUS_28450 gene paaZ 2116 20 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399720.1 protein_id gnl|my_center|LOCUS_28450 <2735 2149 gene locus_tag LOCUS_28460 <2735 2149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001123453.1:phenylacetic acid degradation protein PaaY >Feature sequence361 2401 851 gene locus_tag LOCUS_28470 2401 851 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence362 776 498 gene locus_tag LOCUS_28480 776 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1137 826 gene locus_tag LOCUS_28490 1137 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1603 1145 gene locus_tag LOCUS_28500 1603 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 <2696 1600 gene locus_tag LOCUS_28510 <2696 1600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762240.1:inositol-3-phosphate synthase >Feature sequence363 1947 511 gene locus_tag LOCUS_28520 1947 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 2558 1947 gene locus_tag LOCUS_28530 2558 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 >Feature sequence364 <2695 1763 gene locus_tag LOCUS_28540 <2695 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918824.1:CocE/NonD family hydrolase >Feature sequence365 1700 51 gene locus_tag LOCUS_28550 1700 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 1803 2357 gene locus_tag LOCUS_28560 1803 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence366 1480 254 gene locus_tag LOCUS_28570 1480 254 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_28570 2204 1512 gene locus_tag LOCUS_28580 2204 1512 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence367 2142 163 gene locus_tag LOCUS_28590 gene malZ 2142 163 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818979.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence368 <1 1537 gene locus_tag LOCUS_28600 <1 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188253.1:PAS domain-containing protein 1534 2178 gene locus_tag LOCUS_28610 1534 2178 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence369 2530 425 gene locus_tag LOCUS_28620 2530 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence370 226 1428 gene locus_tag LOCUS_28630 226 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence371 >Feature sequence372 <1 577 gene locus_tag LOCUS_28640 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886565.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence373 1465 713 gene locus_tag LOCUS_28650 1465 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence374 <1 613 gene locus_tag LOCUS_28660 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013231063.1:ParB/RepB/Spo0J family partition protein 610 1248 gene locus_tag LOCUS_28670 610 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 1236 1670 gene locus_tag LOCUS_28680 1236 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 >Feature sequence375 82 534 gene locus_tag LOCUS_28690 82 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 694 909 gene locus_tag LOCUS_28700 694 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 1276 1097 gene locus_tag LOCUS_28710 1276 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence376 1429 182 gene locus_tag LOCUS_28720 1429 182 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228096.1 protein_id gnl|my_center|LOCUS_28720 1677 1510 gene locus_tag LOCUS_28730 1677 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 2201 1674 gene locus_tag LOCUS_28740 2201 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740