>Feature sequence001 130 447 gene locus_tag LOCUS_00010 130 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1076 450 gene locus_tag LOCUS_00020 1076 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1500 1183 gene locus_tag LOCUS_00030 1500 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1756 2154 gene locus_tag LOCUS_00040 1756 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2235 2244 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2630 3955 gene locus_tag LOCUS_00050 2630 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4461 3997 gene locus_tag LOCUS_00060 4461 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5657 6259 gene locus_tag LOCUS_00070 5657 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7704 6508 gene locus_tag LOCUS_00080 7704 6508 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_00080 8819 7701 gene locus_tag LOCUS_00090 8819 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10342 8816 gene locus_tag LOCUS_00100 10342 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10614 11393 gene locus_tag LOCUS_00110 10614 11393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393834.1 protein_id gnl|my_center|LOCUS_00110 11380 13035 gene locus_tag LOCUS_00120 11380 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13068 14522 gene locus_tag LOCUS_00130 13068 14522 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_00130 14935 15546 gene locus_tag LOCUS_00140 14935 15546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15543 16289 gene locus_tag LOCUS_00150 15543 16289 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807742.1 protein_id gnl|my_center|LOCUS_00150 16293 17792 gene locus_tag LOCUS_00160 16293 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19506 18118 gene locus_tag LOCUS_00170 19506 18118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21377 20271 gene locus_tag LOCUS_00180 21377 20271 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_00180 21539 21805 gene locus_tag LOCUS_00190 21539 21805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22715 21786 gene locus_tag LOCUS_00200 22715 21786 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337437.1 protein_id gnl|my_center|LOCUS_00200 23899 22745 gene locus_tag LOCUS_00210 23899 22745 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_00210 24937 24158 gene locus_tag LOCUS_00220 24937 24158 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_00220 25543 26376 gene locus_tag LOCUS_00230 25543 26376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26488 26754 gene locus_tag LOCUS_00240 26488 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27834 29306 gene locus_tag LOCUS_00250 27834 29306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29715 30215 gene locus_tag LOCUS_00260 29715 30215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30354 31271 gene locus_tag LOCUS_00270 30354 31271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31935 31432 gene locus_tag LOCUS_00280 31935 31432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32332 32907 gene locus_tag LOCUS_00290 32332 32907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 33817 34704 gene locus_tag LOCUS_00300 33817 34704 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226710.1 protein_id gnl|my_center|LOCUS_00300 35107 35601 gene locus_tag LOCUS_00310 35107 35601 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547452.1 protein_id gnl|my_center|LOCUS_00310 35706 37685 gene locus_tag LOCUS_00320 35706 37685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 37721 38329 gene locus_tag LOCUS_00330 gene mobA 37721 38329 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969527.1 protein_id gnl|my_center|LOCUS_00330 39261 38344 gene locus_tag LOCUS_00340 39261 38344 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_00340 39400 40941 gene locus_tag LOCUS_00350 gene nrfD 39400 40941 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_00350 41084 44176 gene locus_tag LOCUS_00360 41084 44176 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_00360 45739 44273 gene locus_tag LOCUS_00370 45739 44273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 47608 46178 gene locus_tag LOCUS_00380 47608 46178 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_00380 48594 49643 gene locus_tag LOCUS_00390 48594 49643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 49769 50752 gene locus_tag LOCUS_00400 49769 50752 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173824.1 protein_id gnl|my_center|LOCUS_00400 52009 51185 gene locus_tag LOCUS_00410 52009 51185 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_00410 53869 52127 gene locus_tag LOCUS_00420 53869 52127 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228431.1 protein_id gnl|my_center|LOCUS_00420 54548 53958 gene locus_tag LOCUS_00430 gene cysC 54548 53958 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140515.1 protein_id gnl|my_center|LOCUS_00430 55951 54929 gene locus_tag LOCUS_00440 55951 54929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 56280 55945 gene locus_tag LOCUS_00450 56280 55945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 56582 57016 gene locus_tag LOCUS_00460 56582 57016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 57013 57417 gene locus_tag LOCUS_00470 57013 57417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 58137 57541 gene locus_tag LOCUS_00480 gene pyrE 58137 57541 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583288.1 protein_id gnl|my_center|LOCUS_00480 59495 58152 gene locus_tag LOCUS_00490 59495 58152 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243112.1 protein_id gnl|my_center|LOCUS_00490 61124 59694 gene locus_tag LOCUS_00500 61124 59694 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957528.1 protein_id gnl|my_center|LOCUS_00500 61816 61394 gene locus_tag LOCUS_00510 61816 61394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 61990 62322 gene locus_tag LOCUS_00520 61990 62322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63873 62395 gene locus_tag LOCUS_00530 63873 62395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 64286 65224 gene locus_tag LOCUS_00540 gene purU 64286 65224 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228594.1 protein_id gnl|my_center|LOCUS_00540 65455 66225 gene locus_tag LOCUS_00550 65455 66225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 66728 69787 gene locus_tag LOCUS_00560 66728 69787 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068258.1 protein_id gnl|my_center|LOCUS_00560 70218 70739 gene locus_tag LOCUS_00570 70218 70739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 71022 72290 gene locus_tag LOCUS_00580 71022 72290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 72287 73834 gene locus_tag LOCUS_00590 72287 73834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 74515 74057 gene locus_tag LOCUS_00600 74515 74057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 74525 74534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 75031 74549 gene locus_tag LOCUS_00610 75031 74549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 76580 75198 gene locus_tag LOCUS_00620 76580 75198 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714165.1 protein_id gnl|my_center|LOCUS_00620 76844 78199 gene locus_tag LOCUS_00630 76844 78199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 78411 79709 gene locus_tag LOCUS_00640 78411 79709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 79702 81159 gene locus_tag LOCUS_00650 79702 81159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 81225 81422 gene locus_tag LOCUS_00660 81225 81422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 81872 81465 gene locus_tag LOCUS_00670 81872 81465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 82644 81988 gene locus_tag LOCUS_00680 gene qoxC 82644 81988 CDS product cytochrome aa3 quinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729317.1 protein_id gnl|my_center|LOCUS_00680 84647 82641 gene locus_tag LOCUS_00690 gene qoxB 84647 82641 CDS product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762372.1 protein_id gnl|my_center|LOCUS_00690 85692 84706 gene locus_tag LOCUS_00700 85692 84706 CDS product cytochrome aa3 quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176165.1 protein_id gnl|my_center|LOCUS_00700 87018 89393 gene locus_tag LOCUS_00710 87018 89393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_00710 89577 90224 gene locus_tag LOCUS_00720 89577 90224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 90692 91936 gene locus_tag LOCUS_00730 90692 91936 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_00730 93662 92064 gene locus_tag LOCUS_00740 gene gndA 93662 92064 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141117.1 protein_id gnl|my_center|LOCUS_00740 94297 94848 gene locus_tag LOCUS_00750 94297 94848 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962904.1 protein_id gnl|my_center|LOCUS_00750 95576 94908 gene locus_tag LOCUS_00760 95576 94908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 95991 95806 gene locus_tag LOCUS_00770 95991 95806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 96021 97556 gene locus_tag LOCUS_00780 96021 97556 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768265.1 protein_id gnl|my_center|LOCUS_00780 97673 98608 gene locus_tag LOCUS_00790 97673 98608 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_00790 99491 98790 gene locus_tag LOCUS_00800 99491 98790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 102102 99967 gene locus_tag LOCUS_00810 102102 99967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 102461 103582 gene locus_tag LOCUS_00820 102461 103582 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459731.1 protein_id gnl|my_center|LOCUS_00820 103615 104469 gene locus_tag LOCUS_00830 103615 104469 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_00830 104586 105587 gene locus_tag LOCUS_00840 104586 105587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 105648 106889 gene locus_tag LOCUS_00850 105648 106889 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704717.1 protein_id gnl|my_center|LOCUS_00850 108442 107081 gene locus_tag LOCUS_00860 108442 107081 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 protein_id gnl|my_center|LOCUS_00860 110471 109083 gene locus_tag LOCUS_00870 110471 109083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 112001 111117 gene locus_tag LOCUS_00880 112001 111117 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_00880 113554 112070 gene locus_tag LOCUS_00890 113554 112070 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_00890 113553 113843 gene locus_tag LOCUS_00900 113553 113843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 115358 114147 gene locus_tag LOCUS_00910 115358 114147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 115806 117212 gene locus_tag LOCUS_00920 115806 117212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 118342 117455 gene locus_tag LOCUS_00930 118342 117455 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_00930 118998 121358 gene locus_tag LOCUS_00940 118998 121358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 123009 121642 gene locus_tag LOCUS_00950 123009 121642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 123427 123110 gene locus_tag LOCUS_00960 123427 123110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 124170 125135 gene locus_tag LOCUS_00970 124170 125135 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902253.1 protein_id gnl|my_center|LOCUS_00970 127001 125493 gene locus_tag LOCUS_00980 127001 125493 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941147.1 protein_id gnl|my_center|LOCUS_00980 128154 127387 gene locus_tag LOCUS_00990 128154 127387 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_00990 128770 128159 gene locus_tag LOCUS_01000 128770 128159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 130569 129523 gene locus_tag LOCUS_01010 130569 129523 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_01010 131869 130958 gene locus_tag LOCUS_01020 131869 130958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01020 131924 132208 gene locus_tag LOCUS_01030 131924 132208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 132641 133306 gene locus_tag LOCUS_01040 132641 133306 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393330.1 protein_id gnl|my_center|LOCUS_01040 133603 134667 gene locus_tag LOCUS_01050 133603 134667 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_01050 134923 135477 gene locus_tag LOCUS_01060 134923 135477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 135450 136100 gene locus_tag LOCUS_01070 135450 136100 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_01070 136177 137298 gene locus_tag LOCUS_01080 136177 137298 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812102.1 protein_id gnl|my_center|LOCUS_01080 138651 137473 gene locus_tag LOCUS_01090 138651 137473 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_01090 139687 138743 gene locus_tag LOCUS_01100 139687 138743 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079944.1 protein_id gnl|my_center|LOCUS_01100 140590 140198 gene locus_tag LOCUS_01110 140590 140198 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804105.1 protein_id gnl|my_center|LOCUS_01110 141703 140639 gene locus_tag LOCUS_01120 141703 140639 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537580.1 protein_id gnl|my_center|LOCUS_01120 141770 142198 gene locus_tag LOCUS_01130 141770 142198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 144303 142705 gene locus_tag LOCUS_01140 144303 142705 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729326.1 protein_id gnl|my_center|LOCUS_01140 145551 144553 gene locus_tag LOCUS_01150 145551 144553 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_01150 146829 145882 gene locus_tag LOCUS_01160 146829 145882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 147598 146879 gene locus_tag LOCUS_01170 147598 146879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 149755 147917 gene locus_tag LOCUS_01180 149755 147917 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228612.1 protein_id gnl|my_center|LOCUS_01180 151557 149752 gene locus_tag LOCUS_01190 151557 149752 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_01190 153413 152139 gene locus_tag LOCUS_01200 153413 152139 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_01200 153864 154604 gene locus_tag LOCUS_01210 153864 154604 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246488.1 protein_id gnl|my_center|LOCUS_01210 155922 154690 gene locus_tag LOCUS_01220 155922 154690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 156725 157129 gene locus_tag LOCUS_01230 156725 157129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 157129 157290 gene locus_tag LOCUS_01240 157129 157290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 157480 159351 gene locus_tag LOCUS_01250 157480 159351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 161372 159396 gene locus_tag LOCUS_01260 gene kimA 161372 159396 CDS product potassium transporter KimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246693.1 protein_id gnl|my_center|LOCUS_01260 162018 163874 gene locus_tag LOCUS_01270 162018 163874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 164163 164852 gene locus_tag LOCUS_01280 164163 164852 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265853.1 protein_id gnl|my_center|LOCUS_01280 165302 165021 gene locus_tag LOCUS_01290 165302 165021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 165502 165660 gene locus_tag LOCUS_01300 165502 165660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 165869 166747 gene locus_tag LOCUS_01310 165869 166747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 167079 168632 gene locus_tag LOCUS_01320 167079 168632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 >Feature sequence002 977 6 gene locus_tag LOCUS_01330 977 6 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_01330 1936 914 gene locus_tag LOCUS_01340 1936 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 3352 2084 gene locus_tag LOCUS_01350 3352 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 5711 3549 gene locus_tag LOCUS_01360 gene pknB 5711 3549 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_01360 6465 5746 gene locus_tag LOCUS_01370 6465 5746 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_01370 6686 7126 gene locus_tag LOCUS_01380 6686 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 8445 7150 gene locus_tag LOCUS_01390 gene rlmN 8445 7150 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_01390 8663 8567 gene locus_tag LOCUS_t00010 8663 8567 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10347 9004 gene locus_tag LOCUS_01400 gene rsmB 10347 9004 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_01400 11795 10344 gene locus_tag LOCUS_01410 11795 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 12000 15041 gene locus_tag LOCUS_01420 12000 15041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 15070 15573 gene locus_tag LOCUS_01430 15070 15573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 15588 16481 gene locus_tag LOCUS_01440 15588 16481 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_01440 16530 17465 gene locus_tag LOCUS_01450 16530 17465 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812010.1 protein_id gnl|my_center|LOCUS_01450 19461 17752 gene locus_tag LOCUS_01460 19461 17752 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886809.1 protein_id gnl|my_center|LOCUS_01460 20373 19756 gene locus_tag LOCUS_01470 20373 19756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 21000 21371 gene locus_tag LOCUS_01480 21000 21371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 23301 21796 gene locus_tag LOCUS_01490 23301 21796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 24138 23329 gene locus_tag LOCUS_01500 24138 23329 CDS product GPMC system family 4 glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643499.1 protein_id gnl|my_center|LOCUS_01500 25001 25390 gene locus_tag LOCUS_01510 25001 25390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01510 25415 26074 gene locus_tag LOCUS_01520 25415 26074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01520 26282 27250 gene locus_tag LOCUS_01530 gene selD 26282 27250 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301201.1 protein_id gnl|my_center|LOCUS_01530 29421 27331 gene locus_tag LOCUS_01540 gene selB 29421 27331 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_01540 30795 29434 gene locus_tag LOCUS_01550 gene selA 30795 29434 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393981.1 protein_id gnl|my_center|LOCUS_01550 31482 31576 gene locus_tag LOCUS_t00020 31482 31576 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 31757 32959 gene locus_tag LOCUS_01560 31757 32959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 33744 32992 gene locus_tag LOCUS_01570 33744 32992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 35670 33772 gene locus_tag LOCUS_01580 gene pepF 35670 33772 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944353.1 protein_id gnl|my_center|LOCUS_01580 36925 36101 gene locus_tag LOCUS_01590 36925 36101 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_01590 38351 37026 gene locus_tag LOCUS_01600 38351 37026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 39046 38348 gene locus_tag LOCUS_01610 39046 38348 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_01610 39705 39046 gene locus_tag LOCUS_01620 gene phoU 39705 39046 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_01620 40720 39788 gene locus_tag LOCUS_01630 gene pstB 40720 39788 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918181.1 protein_id gnl|my_center|LOCUS_01630 41570 40737 gene locus_tag LOCUS_01640 gene pstA 41570 40737 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404794.1 protein_id gnl|my_center|LOCUS_01640 43834 41567 gene locus_tag LOCUS_01650 43834 41567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 44262 44675 gene locus_tag LOCUS_01660 44262 44675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 45197 44652 gene locus_tag LOCUS_01670 45197 44652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 46526 45408 gene locus_tag LOCUS_01680 46526 45408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 47110 48150 gene locus_tag LOCUS_01690 47110 48150 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185221.1 protein_id gnl|my_center|LOCUS_01690 48646 49833 gene locus_tag LOCUS_01700 48646 49833 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_01700 49851 50990 gene locus_tag LOCUS_01710 49851 50990 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_01710 50987 53089 gene locus_tag LOCUS_01720 50987 53089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 55329 53425 gene locus_tag LOCUS_01730 gene glmS 55329 53425 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_01730 57120 55771 gene locus_tag LOCUS_01740 gene glmM 57120 55771 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393729.1 protein_id gnl|my_center|LOCUS_01740 58125 57184 gene locus_tag LOCUS_01750 58125 57184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 58954 58112 gene locus_tag LOCUS_01760 gene cdaA 58954 58112 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_01760 60163 59528 gene locus_tag LOCUS_01770 60163 59528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 61595 60648 gene locus_tag LOCUS_01780 61595 60648 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460185.1 protein_id gnl|my_center|LOCUS_01780 62841 61858 gene locus_tag LOCUS_01790 62841 61858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 64325 62970 gene locus_tag LOCUS_01800 64325 62970 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391803.1 protein_id gnl|my_center|LOCUS_01800 65494 64505 gene locus_tag LOCUS_01810 gene rapZ 65494 64505 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_01810 65784 66860 gene locus_tag LOCUS_01820 65784 66860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 66965 67411 gene locus_tag LOCUS_01830 66965 67411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 68185 67508 gene locus_tag LOCUS_01840 68185 67508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 69262 70452 gene locus_tag LOCUS_01850 69262 70452 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391568.1 protein_id gnl|my_center|LOCUS_01850 70683 72293 gene locus_tag LOCUS_01860 gene serA 70683 72293 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142136.1 protein_id gnl|my_center|LOCUS_01860 73859 72438 gene locus_tag LOCUS_01870 73859 72438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 74266 75249 gene locus_tag LOCUS_01880 74266 75249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 75382 76329 gene locus_tag LOCUS_01890 75382 76329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 77820 76441 gene locus_tag LOCUS_01900 77820 76441 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_01900 79044 78235 gene locus_tag LOCUS_01910 79044 78235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 79425 79592 gene locus_tag LOCUS_01920 79425 79592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 79583 79903 gene locus_tag LOCUS_01930 79583 79903 CDS product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000407043.1 protein_id gnl|my_center|LOCUS_01930 80459 81145 gene locus_tag LOCUS_01940 80459 81145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 81175 81564 gene locus_tag LOCUS_01950 81175 81564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043386.1 protein_id gnl|my_center|LOCUS_01950 81952 82653 gene locus_tag LOCUS_01960 81952 82653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 82686 83612 gene locus_tag LOCUS_01970 82686 83612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 83603 84619 gene locus_tag LOCUS_01980 83603 84619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 85924 84737 gene locus_tag LOCUS_01990 85924 84737 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_01990 87422 86319 gene locus_tag LOCUS_02000 87422 86319 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_02000 90019 87905 gene locus_tag LOCUS_02010 90019 87905 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480306.1 protein_id gnl|my_center|LOCUS_02010 90302 90895 gene locus_tag LOCUS_02020 90302 90895 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656771.1 protein_id gnl|my_center|LOCUS_02020 91408 93393 gene locus_tag LOCUS_02030 91408 93393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 93729 93959 gene locus_tag LOCUS_02040 93729 93959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 93956 94882 gene locus_tag LOCUS_02050 93956 94882 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222982.1 protein_id gnl|my_center|LOCUS_02050 94893 95093 gene locus_tag LOCUS_02060 94893 95093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 95205 95891 gene locus_tag LOCUS_02070 95205 95891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02070 96205 96017 gene locus_tag LOCUS_02080 96205 96017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 96508 96756 gene locus_tag LOCUS_02090 96508 96756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 96753 96932 gene locus_tag LOCUS_02100 96753 96932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 98684 97368 gene locus_tag LOCUS_02110 98684 97368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 98748 99383 gene locus_tag LOCUS_02120 98748 99383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 99272 99490 gene locus_tag LOCUS_02130 99272 99490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 99555 100052 gene locus_tag LOCUS_02140 99555 100052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 100890 100507 gene locus_tag LOCUS_02150 100890 100507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 103389 100936 gene locus_tag LOCUS_02160 103389 100936 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786535.1 protein_id gnl|my_center|LOCUS_02160 103636 103947 gene locus_tag LOCUS_02170 103636 103947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 105380 103860 gene locus_tag LOCUS_02180 105380 103860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 106182 105367 gene locus_tag LOCUS_02190 106182 105367 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_02190 106606 106277 gene locus_tag LOCUS_02200 106606 106277 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141555.1 protein_id gnl|my_center|LOCUS_02200 106853 107089 gene locus_tag LOCUS_02210 106853 107089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 108453 107179 gene locus_tag LOCUS_02220 108453 107179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 108994 108506 gene locus_tag LOCUS_02230 108994 108506 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583104.1 protein_id gnl|my_center|LOCUS_02230 111080 109059 gene locus_tag LOCUS_02240 gene uvrC 111080 109059 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_02240 112587 111781 gene locus_tag LOCUS_02250 112587 111781 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226134.1 protein_id gnl|my_center|LOCUS_02250 114128 113256 gene locus_tag LOCUS_02260 114128 113256 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_02260 114546 114238 gene locus_tag LOCUS_02270 114546 114238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 117452 114627 gene locus_tag LOCUS_02280 gene uvrA 117452 114627 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_02280 119815 118622 gene locus_tag LOCUS_02290 119815 118622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 121002 120106 gene locus_tag LOCUS_02300 gene flgL 121002 120106 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460796.1 protein_id gnl|my_center|LOCUS_02300 123116 121683 gene locus_tag LOCUS_02310 gene flgK 123116 121683 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_02310 123709 123131 gene locus_tag LOCUS_02320 123709 123131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 124017 123712 gene locus_tag LOCUS_02330 124017 123712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 124518 124099 gene locus_tag LOCUS_02340 124518 124099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 124972 124556 gene locus_tag LOCUS_02350 124972 124556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 126451 125246 gene locus_tag LOCUS_02360 gene metK 126451 125246 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355656.1 protein_id gnl|my_center|LOCUS_02360 127383 126571 gene locus_tag LOCUS_02370 127383 126571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 128986 127763 gene locus_tag LOCUS_02380 128986 127763 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_02380 129746 129183 gene locus_tag LOCUS_02390 129746 129183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 130732 129941 gene locus_tag LOCUS_02400 gene flgG 130732 129941 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946438.1 protein_id gnl|my_center|LOCUS_02400 131883 131095 gene locus_tag LOCUS_02410 gene flgF 131883 131095 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_02410 132917 132657 gene locus_tag LOCUS_02420 gene spoIIID 132917 132657 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014795808.1 protein_id gnl|my_center|LOCUS_02420 133259 132939 gene locus_tag LOCUS_02430 133259 132939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 134767 133325 gene locus_tag LOCUS_02440 gene spoIVCA 134767 133325 CDS product site-specific DNA recombinase SpoIVCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886573.1 protein_id gnl|my_center|LOCUS_02440 135072 134890 gene locus_tag LOCUS_02450 135072 134890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 137142 135967 gene locus_tag LOCUS_02460 137142 135967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_02460 137988 137254 gene locus_tag LOCUS_02470 137988 137254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173093.1 protein_id gnl|my_center|LOCUS_02470 139978 138059 gene locus_tag LOCUS_02480 139978 138059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 140841 140485 gene locus_tag LOCUS_02490 140841 140485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 140954 141208 gene locus_tag LOCUS_02500 140954 141208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 143436 142078 gene locus_tag LOCUS_02510 143436 142078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 143684 144427 gene locus_tag LOCUS_02520 143684 144427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 144446 145168 gene locus_tag LOCUS_02530 144446 145168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 145165 145500 gene locus_tag LOCUS_02540 145165 145500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 145591 146127 gene locus_tag LOCUS_02550 145591 146127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 146501 146133 gene locus_tag LOCUS_02560 146501 146133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 146946 147869 gene locus_tag LOCUS_02570 146946 147869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 147883 148938 gene locus_tag LOCUS_02580 147883 148938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 148976 149338 gene locus_tag LOCUS_02590 148976 149338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 150237 149929 gene locus_tag LOCUS_02600 150237 149929 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_02600 150610 150619 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 151237 150932 gene locus_tag LOCUS_02610 151237 150932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 152738 151326 gene locus_tag LOCUS_02620 gene atpD 152738 151326 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_02620 153693 152830 gene locus_tag LOCUS_02630 gene atpG 153693 152830 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_02630 155313 153805 gene locus_tag LOCUS_02640 gene atpA 155313 153805 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_02640 155941 155405 gene locus_tag LOCUS_02650 155941 155405 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_02650 156456 155938 gene locus_tag LOCUS_02660 gene atpF 156456 155938 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906128.1 protein_id gnl|my_center|LOCUS_02660 156938 156711 gene locus_tag LOCUS_02670 156938 156711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 157728 157003 gene locus_tag LOCUS_02680 gene atpB 157728 157003 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462234.1 protein_id gnl|my_center|LOCUS_02680 158080 157733 gene locus_tag LOCUS_02690 158080 157733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 158298 158080 gene locus_tag LOCUS_02700 158298 158080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 159591 158458 gene locus_tag LOCUS_02710 gene wecB 159591 158458 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_02710 160742 159609 gene locus_tag LOCUS_02720 160742 159609 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_02720 161777 160917 gene locus_tag LOCUS_02730 161777 160917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 162620 161835 gene locus_tag LOCUS_02740 162620 161835 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392045.1 protein_id gnl|my_center|LOCUS_02740 163699 162719 gene locus_tag LOCUS_02750 163699 162719 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869937.1 protein_id gnl|my_center|LOCUS_02750 164532 163696 gene locus_tag LOCUS_02760 gene prmC 164532 163696 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_02760 165614 164532 gene locus_tag LOCUS_02770 gene prfA 165614 164532 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_02770 166094 165867 gene locus_tag LOCUS_02780 gene rpmE 166094 165867 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144403.1 protein_id gnl|my_center|LOCUS_02780 <167028 166317 gene locus_tag LOCUS_02790 <167028 166317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393879.1:transcription termination factor Rho >Feature sequence003 1300 296 gene locus_tag LOCUS_02800 1300 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02800 1928 1701 gene locus_tag LOCUS_02810 1928 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 2670 3146 gene locus_tag LOCUS_02820 gene nrdR 2670 3146 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203687.1 protein_id gnl|my_center|LOCUS_02820 3220 3939 gene locus_tag LOCUS_02830 3220 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 4008 7643 gene locus_tag LOCUS_02840 4008 7643 CDS product ribonucleotide reductase N-terminal alpha domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459011.1 protein_id gnl|my_center|LOCUS_02840 8935 7919 gene locus_tag LOCUS_02850 8935 7919 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433135.1 protein_id gnl|my_center|LOCUS_02850 8816 9103 gene locus_tag LOCUS_02860 8816 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 10800 10087 gene locus_tag LOCUS_02870 10800 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 12573 10903 gene locus_tag LOCUS_02880 12573 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 13653 12949 gene locus_tag LOCUS_02890 13653 12949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_02890 14690 13650 gene locus_tag LOCUS_02900 14690 13650 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_02900 15087 16643 gene locus_tag LOCUS_02910 15087 16643 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227888.1 protein_id gnl|my_center|LOCUS_02910 17022 16816 gene locus_tag LOCUS_02920 17022 16816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 17392 18330 gene locus_tag LOCUS_02930 gene ubiA 17392 18330 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_02930 18339 19178 gene locus_tag LOCUS_02940 18339 19178 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398978.1 protein_id gnl|my_center|LOCUS_02940 19182 19847 gene locus_tag LOCUS_02950 19182 19847 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941109.1 protein_id gnl|my_center|LOCUS_02950 21607 19889 gene locus_tag LOCUS_02960 21607 19889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 22126 23298 gene locus_tag LOCUS_02970 22126 23298 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083520.1 protein_id gnl|my_center|LOCUS_02970 24069 23500 gene locus_tag LOCUS_02980 24069 23500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 24970 24341 gene locus_tag LOCUS_02990 24970 24341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 24999 25208 gene locus_tag LOCUS_03000 24999 25208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 25213 26553 gene locus_tag LOCUS_03010 25213 26553 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_03010 27010 26660 gene locus_tag LOCUS_03020 gene mgsR 27010 26660 CDS product transcriptional regulator MgsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230147.1 protein_id gnl|my_center|LOCUS_03020 27215 28600 gene locus_tag LOCUS_03030 gene lpdA 27215 28600 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_03030 28661 29119 gene locus_tag LOCUS_03040 28661 29119 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_03040 29284 29817 gene locus_tag LOCUS_03050 29284 29817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 30195 30587 gene locus_tag LOCUS_03060 gene acpS 30195 30587 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635063.1 protein_id gnl|my_center|LOCUS_03060 30589 32136 gene locus_tag LOCUS_03070 30589 32136 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_03070 33103 33921 gene locus_tag LOCUS_03080 33103 33921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 33918 34340 gene locus_tag LOCUS_03090 33918 34340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 34718 35758 gene locus_tag LOCUS_03100 gene alr 34718 35758 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_03100 35832 36143 gene locus_tag LOCUS_03110 35832 36143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 36140 37888 gene locus_tag LOCUS_03120 36140 37888 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_03120 37879 38916 gene locus_tag LOCUS_03130 37879 38916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 39253 39897 gene locus_tag LOCUS_03140 39253 39897 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393648.1 protein_id gnl|my_center|LOCUS_03140 39916 40005 gene locus_tag LOCUS_t00030 39916 40005 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 40316 40059 gene locus_tag LOCUS_03150 40316 40059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 41410 40751 gene locus_tag LOCUS_03160 41410 40751 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775976.1 protein_id gnl|my_center|LOCUS_03160 41610 42263 gene locus_tag LOCUS_03170 41610 42263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 42517 42260 gene locus_tag LOCUS_03180 42517 42260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 42574 43074 gene locus_tag LOCUS_03190 gene tsaE 42574 43074 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_03190 43078 43794 gene locus_tag LOCUS_03200 43078 43794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 43870 44376 gene locus_tag LOCUS_03210 gene rimI 43870 44376 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_03210 45905 44487 gene locus_tag LOCUS_03220 45905 44487 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_03220 46657 45902 gene locus_tag LOCUS_03230 46657 45902 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_03230 48430 46898 gene locus_tag LOCUS_03240 48430 46898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 49217 49504 gene locus_tag LOCUS_03250 49217 49504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 50868 50119 gene locus_tag LOCUS_03260 50868 50119 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229160.1 protein_id gnl|my_center|LOCUS_03260 52354 50882 gene locus_tag LOCUS_03270 52354 50882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 54083 52575 gene locus_tag LOCUS_03280 54083 52575 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 protein_id gnl|my_center|LOCUS_03280 54838 55908 gene locus_tag LOCUS_03290 gene tsaD 54838 55908 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_03290 55954 56712 gene locus_tag LOCUS_03300 gene recO 55954 56712 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_03300 56835 57218 gene locus_tag LOCUS_03310 56835 57218 CDS product DUF4342 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392139.1 protein_id gnl|my_center|LOCUS_03310 57419 58429 gene locus_tag LOCUS_03320 gene glyQ 57419 58429 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 protein_id gnl|my_center|LOCUS_03320 58422 60485 gene locus_tag LOCUS_03330 gene glyS 58422 60485 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_03330 61411 62307 gene locus_tag LOCUS_03340 61411 62307 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_03340 62498 62701 gene locus_tag LOCUS_03350 62498 62701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 62788 62988 gene locus_tag LOCUS_03360 62788 62988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 63801 63151 gene locus_tag LOCUS_03370 63801 63151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 64499 66439 gene locus_tag LOCUS_03380 64499 66439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 66615 67889 gene locus_tag LOCUS_03390 gene rpoD 66615 67889 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_03390 68128 68877 gene locus_tag LOCUS_03400 68128 68877 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 protein_id gnl|my_center|LOCUS_03400 69501 69274 gene locus_tag LOCUS_03410 69501 69274 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812750.1 protein_id gnl|my_center|LOCUS_03410 69929 70570 gene locus_tag LOCUS_03420 69929 70570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 71656 70700 gene locus_tag LOCUS_03430 gene rpoD 71656 70700 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280530.1 protein_id gnl|my_center|LOCUS_03430 73883 72246 gene locus_tag LOCUS_03440 73883 72246 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389262.1 protein_id gnl|my_center|LOCUS_03440 74332 74868 gene locus_tag LOCUS_03450 74332 74868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 76806 74950 gene locus_tag LOCUS_03460 76806 74950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 80872 77903 gene locus_tag LOCUS_03470 80872 77903 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257471.1 protein_id gnl|my_center|LOCUS_03470 81643 81044 gene locus_tag LOCUS_03480 81643 81044 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108450.1 protein_id gnl|my_center|LOCUS_03480 82576 81710 gene locus_tag LOCUS_03490 gene folD 82576 81710 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448683.1 protein_id gnl|my_center|LOCUS_03490 83322 82909 gene locus_tag LOCUS_03500 83322 82909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 84267 83512 gene locus_tag LOCUS_03510 84267 83512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 84373 84570 gene locus_tag LOCUS_03520 84373 84570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 84690 85175 gene locus_tag LOCUS_03530 84690 85175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 85382 86056 gene locus_tag LOCUS_03540 85382 86056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 86247 90170 gene locus_tag LOCUS_03550 86247 90170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 90732 93737 gene locus_tag LOCUS_03560 90732 93737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 94460 93753 gene locus_tag LOCUS_03570 94460 93753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 94559 95140 gene locus_tag LOCUS_03580 94559 95140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 95218 96174 gene locus_tag LOCUS_03590 95218 96174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 96513 96782 gene locus_tag LOCUS_03600 96513 96782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 97430 97828 gene locus_tag LOCUS_03610 97430 97828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 97880 100930 gene locus_tag LOCUS_03620 97880 100930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 100975 103029 gene locus_tag LOCUS_03630 100975 103029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 103103 103645 gene locus_tag LOCUS_03640 103103 103645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 103648 103917 gene locus_tag LOCUS_03650 103648 103917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 103968 104813 gene locus_tag LOCUS_03660 103968 104813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 104829 105146 gene locus_tag LOCUS_03670 104829 105146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 105164 105838 gene locus_tag LOCUS_03680 105164 105838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 105825 107609 gene locus_tag LOCUS_03690 105825 107609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 108311 107664 gene locus_tag LOCUS_03700 108311 107664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 108414 109376 gene locus_tag LOCUS_03710 108414 109376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 109575 110600 gene locus_tag LOCUS_03720 109575 110600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 110608 111060 gene locus_tag LOCUS_03730 110608 111060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 111057 111281 gene locus_tag LOCUS_03740 111057 111281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 112019 112552 gene locus_tag LOCUS_03750 112019 112552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 112549 113973 gene locus_tag LOCUS_03760 112549 113973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 114333 114860 gene locus_tag LOCUS_03770 114333 114860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 114923 115399 gene locus_tag LOCUS_03780 114923 115399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 115452 116177 gene locus_tag LOCUS_03790 115452 116177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 116234 116809 gene locus_tag LOCUS_03800 116234 116809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 117307 116822 gene locus_tag LOCUS_03810 117307 116822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 117890 117384 gene locus_tag LOCUS_03820 117890 117384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 118827 117937 gene locus_tag LOCUS_03830 118827 117937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 119386 119081 gene locus_tag LOCUS_03840 119386 119081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 119537 119806 gene locus_tag LOCUS_03850 119537 119806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 120026 121405 gene locus_tag LOCUS_03860 120026 121405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 121437 122048 gene locus_tag LOCUS_03870 121437 122048 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_03870 123078 122164 gene locus_tag LOCUS_03880 123078 122164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 123383 125347 gene locus_tag LOCUS_03890 123383 125347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 127422 125944 gene locus_tag LOCUS_03900 127422 125944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 127447 127456 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence004 1155 169 gene locus_tag LOCUS_03910 gene lipA 1155 169 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166375.1 protein_id gnl|my_center|LOCUS_03910 2604 1258 gene locus_tag LOCUS_03920 2604 1258 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674509.1 protein_id gnl|my_center|LOCUS_03920 4095 2896 gene locus_tag LOCUS_03930 4095 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 5151 4171 gene locus_tag LOCUS_03940 gene bfmBAB 5151 4171 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290076.1 protein_id gnl|my_center|LOCUS_03940 6320 5139 gene locus_tag LOCUS_03950 6320 5139 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257564.1 protein_id gnl|my_center|LOCUS_03950 7576 6560 gene locus_tag LOCUS_03960 7576 6560 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169507384.1 protein_id gnl|my_center|LOCUS_03960 8420 7809 gene locus_tag LOCUS_03970 8420 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 8754 10400 gene locus_tag LOCUS_03980 8754 10400 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_03980 12090 10414 gene locus_tag LOCUS_03990 12090 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 12905 13363 gene locus_tag LOCUS_04000 12905 13363 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 protein_id gnl|my_center|LOCUS_04000 13699 14223 gene locus_tag LOCUS_04010 13699 14223 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120696.1 protein_id gnl|my_center|LOCUS_04010 14946 14428 gene locus_tag LOCUS_04020 14946 14428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 15856 14981 gene locus_tag LOCUS_04030 15856 14981 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460066.1 protein_id gnl|my_center|LOCUS_04030 16020 17708 gene locus_tag LOCUS_04040 16020 17708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 17959 18693 gene locus_tag LOCUS_04050 17959 18693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 18926 19825 gene locus_tag LOCUS_04060 18926 19825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 19977 20915 gene locus_tag LOCUS_04070 gene mdh 19977 20915 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_04070 21009 22121 gene locus_tag LOCUS_04080 gene sucC 21009 22121 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_04080 22550 23437 gene locus_tag LOCUS_04090 gene sucD 22550 23437 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750467.1 protein_id gnl|my_center|LOCUS_04090 23566 24051 gene locus_tag LOCUS_04100 23566 24051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 24036 25736 gene locus_tag LOCUS_04110 24036 25736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 25729 26523 gene locus_tag LOCUS_04120 gene ccsA 25729 26523 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_04120 26614 26829 gene locus_tag LOCUS_04130 26614 26829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 26826 28445 gene locus_tag LOCUS_04140 gene murJ 26826 28445 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454106.1 protein_id gnl|my_center|LOCUS_04140 28695 30113 gene locus_tag LOCUS_04150 28695 30113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 30384 31034 gene locus_tag LOCUS_04160 30384 31034 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_04160 31617 34388 gene locus_tag LOCUS_04170 31617 34388 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_04170 34391 34987 gene locus_tag LOCUS_04180 34391 34987 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105015.1 protein_id gnl|my_center|LOCUS_04180 35069 35893 gene locus_tag LOCUS_04190 gene radC 35069 35893 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392073.1 protein_id gnl|my_center|LOCUS_04190 36118 37137 gene locus_tag LOCUS_04200 36118 37137 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_04200 37329 38183 gene locus_tag LOCUS_04210 gene mreC 37329 38183 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_04210 38180 38698 gene locus_tag LOCUS_04220 38180 38698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 39500 39847 gene locus_tag LOCUS_04230 39500 39847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 40088 41197 gene locus_tag LOCUS_04240 gene citZ 40088 41197 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903548.1 protein_id gnl|my_center|LOCUS_04240 41461 42318 gene locus_tag LOCUS_04250 41461 42318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 42394 43191 gene locus_tag LOCUS_04260 gene minD 42394 43191 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_04260 43659 43958 gene locus_tag LOCUS_04270 gene minE 43659 43958 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816777.1 protein_id gnl|my_center|LOCUS_04270 43961 45058 gene locus_tag LOCUS_04280 43961 45058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 45395 46729 gene locus_tag LOCUS_04290 45395 46729 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_04290 46726 48063 gene locus_tag LOCUS_04300 46726 48063 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_04300 48073 49008 gene locus_tag LOCUS_04310 48073 49008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 49083 50129 gene locus_tag LOCUS_04320 49083 50129 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 protein_id gnl|my_center|LOCUS_04320 50153 50584 gene locus_tag LOCUS_04330 50153 50584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 50964 52400 gene locus_tag LOCUS_04340 gene argH 50964 52400 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388156.1 protein_id gnl|my_center|LOCUS_04340 52463 53746 gene locus_tag LOCUS_04350 gene hemL 52463 53746 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_04350 53761 54792 gene locus_tag LOCUS_04360 53761 54792 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392700.1 protein_id gnl|my_center|LOCUS_04360 55750 54830 gene locus_tag LOCUS_04370 gene proI 55750 54830 CDS product pyrroline-5-carboxylate reductase ProI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027273.1 protein_id gnl|my_center|LOCUS_04370 56238 57161 gene locus_tag LOCUS_04380 56238 57161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 57235 58263 gene locus_tag LOCUS_04390 57235 58263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 58631 59827 gene locus_tag LOCUS_04400 58631 59827 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_04400 59828 60646 gene locus_tag LOCUS_04410 gene tpiA 59828 60646 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_04410 60643 62190 gene locus_tag LOCUS_04420 gene gpmI 60643 62190 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257028.1 protein_id gnl|my_center|LOCUS_04420 62174 63457 gene locus_tag LOCUS_04430 gene eno 62174 63457 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_04430 63551 63793 gene locus_tag LOCUS_04440 gene secG 63551 63793 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556760.1 protein_id gnl|my_center|LOCUS_04440 64397 63831 gene locus_tag LOCUS_04450 64397 63831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 64540 66558 gene locus_tag LOCUS_04460 64540 66558 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_04460 66826 67044 gene locus_tag LOCUS_04470 66826 67044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 68435 67140 gene locus_tag LOCUS_04480 gene hflX 68435 67140 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804682.1 protein_id gnl|my_center|LOCUS_04480 70561 68555 gene locus_tag LOCUS_04490 70561 68555 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_04490 71019 70777 gene locus_tag LOCUS_04500 71019 70777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 71581 72558 gene locus_tag LOCUS_04510 71581 72558 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_04510 72617 73744 gene locus_tag LOCUS_04520 gene rodA 72617 73744 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_04520 74043 73735 gene locus_tag LOCUS_04530 74043 73735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 74320 74952 gene locus_tag LOCUS_04540 gene folE 74320 74952 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_04540 75168 76148 gene locus_tag LOCUS_04550 gene folP 75168 76148 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_04550 76392 77285 gene locus_tag LOCUS_04560 76392 77285 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816555.1 protein_id gnl|my_center|LOCUS_04560 77372 79222 gene locus_tag LOCUS_04570 77372 79222 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_04570 79989 83603 gene locus_tag LOCUS_04580 gene rpoB 79989 83603 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 protein_id gnl|my_center|LOCUS_04580 83789 87454 gene locus_tag LOCUS_04590 gene rpoC 83789 87454 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773568.1 protein_id gnl|my_center|LOCUS_04590 87369 87596 gene locus_tag LOCUS_04600 87369 87596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 87731 88042 gene locus_tag LOCUS_04610 87731 88042 CDS product 50S ribosomal protein L7Ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393943.1 protein_id gnl|my_center|LOCUS_04610 88246 88623 gene locus_tag LOCUS_04620 gene rpsL 88246 88623 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869933.1 protein_id gnl|my_center|LOCUS_04620 88708 89178 gene locus_tag LOCUS_04630 gene rpsG 88708 89178 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137493.1 protein_id gnl|my_center|LOCUS_04630 89235 91328 gene locus_tag LOCUS_04640 gene fusA 89235 91328 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence005 1802 276 gene locus_tag LOCUS_04650 gene xylB 1802 276 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_04650 1939 3330 gene locus_tag LOCUS_04660 1939 3330 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_04660 3594 3349 gene locus_tag LOCUS_04670 3594 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 3502 4155 gene locus_tag LOCUS_04680 3502 4155 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777044.1 protein_id gnl|my_center|LOCUS_04680 4314 5174 gene locus_tag LOCUS_04690 gene panB 4314 5174 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763099.1 protein_id gnl|my_center|LOCUS_04690 5171 6049 gene locus_tag LOCUS_04700 gene panC 5171 6049 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_04700 6198 8384 gene locus_tag LOCUS_04710 6198 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 8903 8541 gene locus_tag LOCUS_04720 8903 8541 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887363.1 protein_id gnl|my_center|LOCUS_04720 9258 9839 gene locus_tag LOCUS_04730 9258 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 9881 10063 gene locus_tag LOCUS_04740 gene rpmF 9881 10063 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_04740 10343 14098 gene locus_tag LOCUS_04750 10343 14098 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_04750 14370 15320 gene locus_tag LOCUS_04760 14370 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391696.1 protein_id gnl|my_center|LOCUS_04760 15393 15752 gene locus_tag LOCUS_04770 15393 15752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 16527 15922 gene locus_tag LOCUS_04780 16527 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 16910 16527 gene locus_tag LOCUS_04790 16910 16527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 17288 18136 gene locus_tag LOCUS_04800 17288 18136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 18838 18467 gene locus_tag LOCUS_04810 18838 18467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 19481 18921 gene locus_tag LOCUS_04820 19481 18921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 20069 19629 gene locus_tag LOCUS_04830 20069 19629 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_04830 21865 20453 gene locus_tag LOCUS_04840 21865 20453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 22968 22081 gene locus_tag LOCUS_04850 22968 22081 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972767.1 protein_id gnl|my_center|LOCUS_04850 23955 23023 gene locus_tag LOCUS_04860 23955 23023 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972768.1 protein_id gnl|my_center|LOCUS_04860 24944 24645 gene locus_tag LOCUS_04870 24944 24645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 24876 26945 gene locus_tag LOCUS_04880 24876 26945 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_04880 28234 27095 gene locus_tag LOCUS_04890 gene yhbH 28234 27095 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392048.1 protein_id gnl|my_center|LOCUS_04890 28660 29808 gene locus_tag LOCUS_04900 28660 29808 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 protein_id gnl|my_center|LOCUS_04900 31088 29973 gene locus_tag LOCUS_04910 31088 29973 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262874.1 protein_id gnl|my_center|LOCUS_04910 31356 32774 gene locus_tag LOCUS_04920 31356 32774 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812025.1 protein_id gnl|my_center|LOCUS_04920 33808 32828 gene locus_tag LOCUS_04930 33808 32828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 37207 34013 gene locus_tag LOCUS_04940 37207 34013 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284781.1 protein_id gnl|my_center|LOCUS_04940 35393 35470 gene locus_tag LOCUS_t00040 35393 35470 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 37892 37587 gene locus_tag LOCUS_04950 37892 37587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 39150 38311 gene locus_tag LOCUS_04960 39150 38311 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080707694.1 protein_id gnl|my_center|LOCUS_04960 39805 39533 gene locus_tag LOCUS_04970 39805 39533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 41103 39802 gene locus_tag LOCUS_04980 41103 39802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 41675 42232 gene locus_tag LOCUS_04990 41675 42232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 42325 43674 gene locus_tag LOCUS_05000 gene rifK 42325 43674 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_05000 44272 45477 gene locus_tag LOCUS_05010 44272 45477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 45607 47091 gene locus_tag LOCUS_05020 45607 47091 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_05020 47994 47185 gene locus_tag LOCUS_05030 47994 47185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 49535 48012 gene locus_tag LOCUS_05040 49535 48012 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921498.1 protein_id gnl|my_center|LOCUS_05040 51031 49649 gene locus_tag LOCUS_05050 51031 49649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 52245 51718 gene locus_tag LOCUS_05060 52245 51718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 52843 54975 gene locus_tag LOCUS_05070 52843 54975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 55257 55934 gene locus_tag LOCUS_05080 55257 55934 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313743.1 protein_id gnl|my_center|LOCUS_05080 56103 56795 gene locus_tag LOCUS_05090 56103 56795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 59029 57173 gene locus_tag LOCUS_05100 gene efbA 59029 57173 CDS product fibronectin-binding protein EfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379361.1 protein_id gnl|my_center|LOCUS_05100 59365 60525 gene locus_tag LOCUS_05110 59365 60525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 60522 65147 gene locus_tag LOCUS_05120 60522 65147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 66268 65321 gene locus_tag LOCUS_05130 66268 65321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 66929 68077 gene locus_tag LOCUS_05140 66929 68077 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_05140 68103 69272 gene locus_tag LOCUS_05150 68103 69272 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_05150 69274 69825 gene locus_tag LOCUS_05160 69274 69825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 69834 71048 gene locus_tag LOCUS_05170 gene ltaE 69834 71048 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_05170 71131 71439 gene locus_tag LOCUS_05180 71131 71439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 71678 72718 gene locus_tag LOCUS_05190 gene aroF 71678 72718 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_05190 72944 74062 gene locus_tag LOCUS_05200 72944 74062 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_05200 74223 74978 gene locus_tag LOCUS_05210 74223 74978 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865221.1 protein_id gnl|my_center|LOCUS_05210 75698 75309 gene locus_tag LOCUS_05220 75698 75309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 77024 75978 gene locus_tag LOCUS_05230 gene gpr 77024 75978 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_05230 77163 77744 gene locus_tag LOCUS_05240 gene rsmD 77163 77744 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_05240 77756 78232 gene locus_tag LOCUS_05250 gene coaD 77756 78232 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_05250 78273 78821 gene locus_tag LOCUS_05260 78273 78821 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460509.1 protein_id gnl|my_center|LOCUS_05260 80429 79137 gene locus_tag LOCUS_05270 80429 79137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 81069 81509 gene locus_tag LOCUS_05280 81069 81509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 83229 81493 gene locus_tag LOCUS_05290 83229 81493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 83174 83614 gene locus_tag LOCUS_05300 83174 83614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence006 633 2033 gene locus_tag LOCUS_05310 gene leuC 633 2033 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_05310 2260 3024 gene locus_tag LOCUS_05320 2260 3024 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246488.1 protein_id gnl|my_center|LOCUS_05320 3093 3707 gene locus_tag LOCUS_05330 gene leuD 3093 3707 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330456.1 protein_id gnl|my_center|LOCUS_05330 4356 5357 gene locus_tag LOCUS_05340 4356 5357 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244721.1 protein_id gnl|my_center|LOCUS_05340 5575 5372 gene locus_tag LOCUS_05350 5575 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 6707 5757 gene locus_tag LOCUS_05360 6707 5757 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989564.1 protein_id gnl|my_center|LOCUS_05360 7649 6714 gene locus_tag LOCUS_05370 7649 6714 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_05370 10461 7738 gene locus_tag LOCUS_05380 10461 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 10904 11329 gene locus_tag LOCUS_05390 10904 11329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 12871 11363 gene locus_tag LOCUS_05400 12871 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 13471 15027 gene locus_tag LOCUS_05410 13471 15027 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975683.1 protein_id gnl|my_center|LOCUS_05410 15373 16179 gene locus_tag LOCUS_05420 15373 16179 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_05420 16190 17575 gene locus_tag LOCUS_05430 16190 17575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 18138 18368 gene locus_tag LOCUS_05440 18138 18368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 19539 18454 gene locus_tag LOCUS_05450 19539 18454 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776452.1 protein_id gnl|my_center|LOCUS_05450 19995 19723 gene locus_tag LOCUS_05460 19995 19723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 20663 19992 gene locus_tag LOCUS_05470 20663 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 20990 20700 gene locus_tag LOCUS_05480 20990 20700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 21304 20987 gene locus_tag LOCUS_05490 21304 20987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 21745 21431 gene locus_tag LOCUS_05500 gene csoR 21745 21431 CDS product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228404.1 protein_id gnl|my_center|LOCUS_05500 23679 21982 gene locus_tag LOCUS_05510 23679 21982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 23973 23734 gene locus_tag LOCUS_05520 23973 23734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 24873 24481 gene locus_tag LOCUS_05530 24873 24481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 26824 24941 gene locus_tag LOCUS_05540 26824 24941 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_05540 27057 28313 gene locus_tag LOCUS_05550 27057 28313 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973685.1 protein_id gnl|my_center|LOCUS_05550 28904 28497 gene locus_tag LOCUS_05560 28904 28497 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_05560 29944 28943 gene locus_tag LOCUS_05570 29944 28943 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804290.1 protein_id gnl|my_center|LOCUS_05570 30424 31485 gene locus_tag LOCUS_05580 gene pheS 30424 31485 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_05580 31642 34062 gene locus_tag LOCUS_05590 gene pheT 31642 34062 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_05590 36571 34190 gene locus_tag LOCUS_05600 36571 34190 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974204.1 protein_id gnl|my_center|LOCUS_05600 37986 37150 gene locus_tag LOCUS_05610 37986 37150 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_05610 38511 38155 gene locus_tag LOCUS_05620 gene rplT 38511 38155 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 protein_id gnl|my_center|LOCUS_05620 38785 38585 gene locus_tag LOCUS_05630 gene rpmI 38785 38585 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830767.1 protein_id gnl|my_center|LOCUS_05630 39424 38876 gene locus_tag LOCUS_05640 gene infC 39424 38876 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_05640 40224 39994 gene locus_tag LOCUS_05650 40224 39994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 40189 40737 gene locus_tag LOCUS_05660 40189 40737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 41108 40734 gene locus_tag LOCUS_05670 41108 40734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 42641 41523 gene locus_tag LOCUS_05680 42641 41523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 43413 43336 gene locus_tag LOCUS_t00050 43413 43336 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44560 43769 gene locus_tag LOCUS_05690 44560 43769 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_05690 44980 44669 gene locus_tag LOCUS_05700 44980 44669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 45104 45394 gene locus_tag LOCUS_05710 45104 45394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 46851 45565 gene locus_tag LOCUS_05720 46851 45565 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294056.1 protein_id gnl|my_center|LOCUS_05720 48072 48800 gene locus_tag LOCUS_05730 gene sodA 48072 48800 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052031.1 protein_id gnl|my_center|LOCUS_05730 48884 49747 gene locus_tag LOCUS_05740 48884 49747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 49962 49971 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50066 51136 gene locus_tag LOCUS_05750 50066 51136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 51251 52372 gene locus_tag LOCUS_05760 51251 52372 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582708.1 protein_id gnl|my_center|LOCUS_05760 52853 54214 gene locus_tag LOCUS_05770 52853 54214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 54664 55593 gene locus_tag LOCUS_05780 54664 55593 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_05780 56909 55701 gene locus_tag LOCUS_05790 56909 55701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 57271 58320 gene locus_tag LOCUS_05800 57271 58320 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284007.1 protein_id gnl|my_center|LOCUS_05800 59122 58265 gene locus_tag LOCUS_05810 59122 58265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 60060 59119 gene locus_tag LOCUS_05820 60060 59119 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837553.1 protein_id gnl|my_center|LOCUS_05820 61805 60432 gene locus_tag LOCUS_05830 61805 60432 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_05830 62412 63824 gene locus_tag LOCUS_05840 62412 63824 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108982.1 protein_id gnl|my_center|LOCUS_05840 65238 63946 gene locus_tag LOCUS_05850 65238 63946 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401544.1 protein_id gnl|my_center|LOCUS_05850 67186 65747 gene locus_tag LOCUS_05860 67186 65747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 68572 67460 gene locus_tag LOCUS_05870 68572 67460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 69132 70355 gene locus_tag LOCUS_05880 gene nuoD 69132 70355 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_05880 71520 70909 gene locus_tag LOCUS_05890 71520 70909 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259303.1 protein_id gnl|my_center|LOCUS_05890 72184 71630 gene locus_tag LOCUS_05900 72184 71630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 72717 72223 gene locus_tag LOCUS_05910 72717 72223 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091672.1 protein_id gnl|my_center|LOCUS_05910 73400 73005 gene locus_tag LOCUS_05920 73400 73005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 74277 73450 gene locus_tag LOCUS_05930 gene trpA 74277 73450 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_05930 75059 74274 gene locus_tag LOCUS_05940 75059 74274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 75551 76501 gene locus_tag LOCUS_05950 gene rbsK 75551 76501 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_05950 78335 76827 gene locus_tag LOCUS_05960 78335 76827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 78664 79857 gene locus_tag LOCUS_05970 78664 79857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 80524 80042 gene locus_tag LOCUS_05980 80524 80042 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812063.1 protein_id gnl|my_center|LOCUS_05980 81384 80521 gene locus_tag LOCUS_05990 81384 80521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847040.1 protein_id gnl|my_center|LOCUS_05990 81766 81446 gene locus_tag LOCUS_06000 81766 81446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 82790 81948 gene locus_tag LOCUS_06010 82790 81948 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027042.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence007 791 1042 gene locus_tag LOCUS_06020 791 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 2452 1049 gene locus_tag LOCUS_06030 2452 1049 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 protein_id gnl|my_center|LOCUS_06030 4187 2598 gene locus_tag LOCUS_06040 4187 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 4658 4467 gene locus_tag LOCUS_06050 4658 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 4719 4728 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5033 7177 gene locus_tag LOCUS_06060 5033 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7382 8152 gene locus_tag LOCUS_06070 7382 8152 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_06070 8532 9992 gene locus_tag LOCUS_06080 8532 9992 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_06080 10090 11376 gene locus_tag LOCUS_06090 10090 11376 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108982.1 protein_id gnl|my_center|LOCUS_06090 11458 13131 gene locus_tag LOCUS_06100 11458 13131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 13852 15315 gene locus_tag LOCUS_06110 13852 15315 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582767.1 protein_id gnl|my_center|LOCUS_06110 15369 16343 gene locus_tag LOCUS_06120 15369 16343 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434865.1 protein_id gnl|my_center|LOCUS_06120 16555 17439 gene locus_tag LOCUS_06130 16555 17439 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_06130 17517 18917 gene locus_tag LOCUS_06140 17517 18917 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108982.1 protein_id gnl|my_center|LOCUS_06140 19135 20613 gene locus_tag LOCUS_06150 19135 20613 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 protein_id gnl|my_center|LOCUS_06150 20775 22148 gene locus_tag LOCUS_06160 20775 22148 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_06160 22237 23520 gene locus_tag LOCUS_06170 22237 23520 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615503.1 protein_id gnl|my_center|LOCUS_06170 23812 25242 gene locus_tag LOCUS_06180 23812 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 25296 26660 gene locus_tag LOCUS_06190 25296 26660 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_06190 28429 27020 gene locus_tag LOCUS_06200 28429 27020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 30007 28589 gene locus_tag LOCUS_06210 30007 28589 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_06210 30688 32181 gene locus_tag LOCUS_06220 30688 32181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 32330 33625 gene locus_tag LOCUS_06230 32330 33625 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_06230 35395 33854 gene locus_tag LOCUS_06240 35395 33854 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_06240 35991 35611 gene locus_tag LOCUS_06250 35991 35611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 36348 37754 gene locus_tag LOCUS_06260 36348 37754 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886161.1 protein_id gnl|my_center|LOCUS_06260 38374 39051 gene locus_tag LOCUS_06270 38374 39051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 39123 39401 gene locus_tag LOCUS_06280 39123 39401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 41164 39392 gene locus_tag LOCUS_06290 gene thiC 41164 39392 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 protein_id gnl|my_center|LOCUS_06290 41710 43020 gene locus_tag LOCUS_06300 41710 43020 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811039.1 protein_id gnl|my_center|LOCUS_06300 43213 43668 gene locus_tag LOCUS_06310 43213 43668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 43661 44176 gene locus_tag LOCUS_06320 gene spoIIAB 43661 44176 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393006.1 protein_id gnl|my_center|LOCUS_06320 44173 45024 gene locus_tag LOCUS_06330 gene sigF 44173 45024 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393005.1 protein_id gnl|my_center|LOCUS_06330 45417 45611 gene locus_tag LOCUS_06340 45417 45611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 45608 46246 gene locus_tag LOCUS_06350 gene spoVAA 45608 46246 CDS product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438361.1 protein_id gnl|my_center|LOCUS_06350 46243 46671 gene locus_tag LOCUS_06360 46243 46671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 47033 47248 gene locus_tag LOCUS_06370 47033 47248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 47420 47881 gene locus_tag LOCUS_06380 gene spoVAC 47420 47881 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106004728.1 protein_id gnl|my_center|LOCUS_06380 47960 49042 gene locus_tag LOCUS_06390 gene spoVAD 47960 49042 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_06390 49154 49504 gene locus_tag LOCUS_06400 gene spoVAE 49154 49504 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 protein_id gnl|my_center|LOCUS_06400 49757 50266 gene locus_tag LOCUS_06410 49757 50266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 51375 50377 gene locus_tag LOCUS_06420 gene corA 51375 50377 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_06420 52591 51539 gene locus_tag LOCUS_06430 52591 51539 CDS product YIEGIA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141596.1 protein_id gnl|my_center|LOCUS_06430 54173 52605 gene locus_tag LOCUS_06440 gene spoVAF 54173 52605 CDS product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 protein_id gnl|my_center|LOCUS_06440 55108 54311 gene locus_tag LOCUS_06450 55108 54311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 56022 55201 gene locus_tag LOCUS_06460 56022 55201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 56992 57894 gene locus_tag LOCUS_06470 56992 57894 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193211.1 protein_id gnl|my_center|LOCUS_06470 59205 58429 gene locus_tag LOCUS_06480 59205 58429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 60001 59747 gene locus_tag LOCUS_06490 60001 59747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 60556 60828 gene locus_tag LOCUS_06500 gene rpsO 60556 60828 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_06500 61059 63242 gene locus_tag LOCUS_06510 gene pnp 61059 63242 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_06510 63935 63618 gene locus_tag LOCUS_06520 63935 63618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 63828 65057 gene locus_tag LOCUS_06530 63828 65057 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_06530 65054 65509 gene locus_tag LOCUS_06540 65054 65509 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905176.1 protein_id gnl|my_center|LOCUS_06540 65587 66111 gene locus_tag LOCUS_06550 65587 66111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 66467 67207 gene locus_tag LOCUS_06560 gene dapB 66467 67207 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_06560 67587 67258 gene locus_tag LOCUS_06570 67587 67258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 67621 68505 gene locus_tag LOCUS_06580 gene dpsA 67621 68505 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460385.1 protein_id gnl|my_center|LOCUS_06580 68492 69106 gene locus_tag LOCUS_06590 68492 69106 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_06590 69273 70277 gene locus_tag LOCUS_06600 69273 70277 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392580.1 protein_id gnl|my_center|LOCUS_06600 70379 71599 gene locus_tag LOCUS_06610 gene dapG 70379 71599 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392581.1 protein_id gnl|my_center|LOCUS_06610 71745 72656 gene locus_tag LOCUS_06620 gene dapA 71745 72656 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057061.1 protein_id gnl|my_center|LOCUS_06620 72783 74519 gene locus_tag LOCUS_06630 72783 74519 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_06630 75469 74750 gene locus_tag LOCUS_06640 75469 74750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 76060 75800 gene locus_tag LOCUS_06650 76060 75800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 76911 76093 gene locus_tag LOCUS_06660 76911 76093 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_06660 77126 77896 gene locus_tag LOCUS_06670 gene uppP 77126 77896 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_06670 77893 80208 gene locus_tag LOCUS_06680 77893 80208 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272342.1 protein_id gnl|my_center|LOCUS_06680 80361 81638 gene locus_tag LOCUS_06690 80361 81638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence008 <1 515 gene locus_tag LOCUS_06700 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013382870.1:sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein 758 1708 gene locus_tag LOCUS_06710 758 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 1940 2899 gene locus_tag LOCUS_06720 1940 2899 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_06720 3702 3127 gene locus_tag LOCUS_06730 3702 3127 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214821.1 protein_id gnl|my_center|LOCUS_06730 4763 4059 gene locus_tag LOCUS_06740 4763 4059 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_06740 6383 5529 gene locus_tag LOCUS_06750 6383 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 8536 7103 gene locus_tag LOCUS_06760 8536 7103 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_06760 10306 9791 gene locus_tag LOCUS_06770 gene smpB 10306 9791 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_06770 10877 10590 gene locus_tag LOCUS_06780 10877 10590 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_06780 12173 10938 gene locus_tag LOCUS_06790 gene thrC 12173 10938 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880362.1 protein_id gnl|my_center|LOCUS_06790 14263 12764 gene locus_tag LOCUS_06800 14263 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 15963 14269 gene locus_tag LOCUS_06810 15963 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 16822 15953 gene locus_tag LOCUS_06820 16822 15953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_06820 18254 17148 gene locus_tag LOCUS_06830 gene ugpC 18254 17148 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_06830 19522 18470 gene locus_tag LOCUS_06840 19522 18470 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_06840 20090 19572 gene locus_tag LOCUS_06850 20090 19572 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393497.1 protein_id gnl|my_center|LOCUS_06850 20673 20209 gene locus_tag LOCUS_06860 gene sufU 20673 20209 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222809.1 protein_id gnl|my_center|LOCUS_06860 21934 20666 gene locus_tag LOCUS_06870 21934 20666 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057903.1 protein_id gnl|my_center|LOCUS_06870 23223 22000 gene locus_tag LOCUS_06880 gene sufD 23223 22000 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259319.1 protein_id gnl|my_center|LOCUS_06880 23995 23228 gene locus_tag LOCUS_06890 gene sufC 23995 23228 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 protein_id gnl|my_center|LOCUS_06890 25187 24537 gene locus_tag LOCUS_06900 25187 24537 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027667.1 protein_id gnl|my_center|LOCUS_06900 25463 25385 gene locus_tag LOCUS_t00060 25463 25385 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26552 25785 gene locus_tag LOCUS_06910 26552 25785 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256274.1 protein_id gnl|my_center|LOCUS_06910 27399 26629 gene locus_tag LOCUS_06920 27399 26629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 27823 27542 gene locus_tag LOCUS_06930 27823 27542 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140124.1 protein_id gnl|my_center|LOCUS_06930 28033 29160 gene locus_tag LOCUS_06940 28033 29160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 29488 29862 gene locus_tag LOCUS_06950 29488 29862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 31778 30249 gene locus_tag LOCUS_06960 gene glpK 31778 30249 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229157.1 protein_id gnl|my_center|LOCUS_06960 33620 31983 gene locus_tag LOCUS_06970 33620 31983 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_06970 34941 34102 gene locus_tag LOCUS_06980 34941 34102 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_06980 36132 35083 gene locus_tag LOCUS_06990 36132 35083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 37419 36493 gene locus_tag LOCUS_07000 37419 36493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 37779 37552 gene locus_tag LOCUS_07010 37779 37552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 37705 38526 gene locus_tag LOCUS_07020 37705 38526 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_07020 39550 38567 gene locus_tag LOCUS_07030 39550 38567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 39963 40187 gene locus_tag LOCUS_07040 39963 40187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 40202 40441 gene locus_tag LOCUS_07050 40202 40441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 40755 40324 gene locus_tag LOCUS_07060 40755 40324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 43559 40752 gene locus_tag LOCUS_07070 gene ileS 43559 40752 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_07070 45192 43717 gene locus_tag LOCUS_07080 45192 43717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 45832 45266 gene locus_tag LOCUS_07090 45832 45266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 46300 45959 gene locus_tag LOCUS_07100 46300 45959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 47352 46405 gene locus_tag LOCUS_07110 47352 46405 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228360.1 protein_id gnl|my_center|LOCUS_07110 47758 47324 gene locus_tag LOCUS_07120 47758 47324 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_07120 50537 47721 gene locus_tag LOCUS_07130 50537 47721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 50994 53147 gene locus_tag LOCUS_07140 50994 53147 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_07140 53411 56020 gene locus_tag LOCUS_07150 53411 56020 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393212.1 protein_id gnl|my_center|LOCUS_07150 56162 58627 gene locus_tag LOCUS_07160 gene mrdA 56162 58627 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_07160 60193 58742 gene locus_tag LOCUS_07170 60193 58742 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838231.1 protein_id gnl|my_center|LOCUS_07170 60167 60484 gene locus_tag LOCUS_07180 60167 60484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 61893 60517 gene locus_tag LOCUS_07190 61893 60517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 62665 61904 gene locus_tag LOCUS_07200 62665 61904 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272297.1 protein_id gnl|my_center|LOCUS_07200 63310 62744 gene locus_tag LOCUS_07210 gene efp 63310 62744 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_07210 64423 63344 gene locus_tag LOCUS_07220 64423 63344 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_07220 64875 64420 gene locus_tag LOCUS_07230 gene aroQ 64875 64420 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_07230 65645 64899 gene locus_tag LOCUS_07240 65645 64899 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_07240 68356 65909 gene locus_tag LOCUS_07250 68356 65909 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542519.1 protein_id gnl|my_center|LOCUS_07250 69795 68770 gene locus_tag LOCUS_07260 gene nadA 69795 68770 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257284.1 protein_id gnl|my_center|LOCUS_07260 70910 69996 gene locus_tag LOCUS_07270 gene nadC 70910 69996 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_07270 72484 70907 gene locus_tag LOCUS_07280 gene nadB 72484 70907 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257285.1 protein_id gnl|my_center|LOCUS_07280 73826 72738 gene locus_tag LOCUS_07290 73826 72738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 75157 74498 gene locus_tag LOCUS_07300 gene nth 75157 74498 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886934.1 protein_id gnl|my_center|LOCUS_07300 76600 75239 gene locus_tag LOCUS_07310 76600 75239 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_07310 77698 76772 gene locus_tag LOCUS_07320 77698 76772 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928937.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence009 855 436 gene locus_tag LOCUS_07330 855 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1893 1189 gene locus_tag LOCUS_07340 1893 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 4309 2078 gene locus_tag LOCUS_07350 4309 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 5318 4389 gene locus_tag LOCUS_07360 5318 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 6019 5579 gene locus_tag LOCUS_07370 6019 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 6600 6037 gene locus_tag LOCUS_07380 6600 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 7248 6697 gene locus_tag LOCUS_07390 7248 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 7614 7381 gene locus_tag LOCUS_07400 7614 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 8642 7734 gene locus_tag LOCUS_07410 8642 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 9577 8642 gene locus_tag LOCUS_07420 9577 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 11213 9747 gene locus_tag LOCUS_07430 11213 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 11441 11250 gene locus_tag LOCUS_07440 11441 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 12495 11359 gene locus_tag LOCUS_07450 12495 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 13392 12499 gene locus_tag LOCUS_07460 13392 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 14782 13472 gene locus_tag LOCUS_07470 14782 13472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 15496 14783 gene locus_tag LOCUS_07480 15496 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 16145 17041 gene locus_tag LOCUS_07490 16145 17041 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_07490 17102 17932 gene locus_tag LOCUS_07500 gene thiM 17102 17932 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393513.1 protein_id gnl|my_center|LOCUS_07500 18019 18990 gene locus_tag LOCUS_07510 18019 18990 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_07510 19303 20406 gene locus_tag LOCUS_07520 19303 20406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 20589 21128 gene locus_tag LOCUS_07530 20589 21128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 22326 21973 gene locus_tag LOCUS_07540 22326 21973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 22474 24153 gene locus_tag LOCUS_07550 22474 24153 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257261.1 protein_id gnl|my_center|LOCUS_07550 24380 25243 gene locus_tag LOCUS_07560 24380 25243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 25467 26879 gene locus_tag LOCUS_07570 25467 26879 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_07570 28400 26934 gene locus_tag LOCUS_07580 28400 26934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 29496 28450 gene locus_tag LOCUS_07590 29496 28450 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100168880.1 protein_id gnl|my_center|LOCUS_07590 31246 29666 gene locus_tag LOCUS_07600 31246 29666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 31803 31252 gene locus_tag LOCUS_07610 31803 31252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 31930 32580 gene locus_tag LOCUS_07620 31930 32580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 32731 33378 gene locus_tag LOCUS_07630 32731 33378 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 protein_id gnl|my_center|LOCUS_07630 33375 34688 gene locus_tag LOCUS_07640 33375 34688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 34892 35515 gene locus_tag LOCUS_07650 34892 35515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 35619 36293 gene locus_tag LOCUS_07660 35619 36293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 36361 36684 gene locus_tag LOCUS_07670 36361 36684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 38957 36981 gene locus_tag LOCUS_07680 gene acs 38957 36981 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_07680 40013 38994 gene locus_tag LOCUS_07690 gene mutY 40013 38994 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522857.1 protein_id gnl|my_center|LOCUS_07690 40600 40001 gene locus_tag LOCUS_07700 40600 40001 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_07700 40652 41014 gene locus_tag LOCUS_07710 gene erpA 40652 41014 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228822.1 protein_id gnl|my_center|LOCUS_07710 41282 42070 gene locus_tag LOCUS_07720 41282 42070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 42067 42774 gene locus_tag LOCUS_07730 gene tmk 42067 42774 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_07730 42767 43453 gene locus_tag LOCUS_07740 42767 43453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 43500 45071 gene locus_tag LOCUS_07750 43500 45071 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259263.1 protein_id gnl|my_center|LOCUS_07750 46945 45116 gene locus_tag LOCUS_07760 gene pyk 46945 45116 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 protein_id gnl|my_center|LOCUS_07760 47210 47010 gene locus_tag LOCUS_07770 47210 47010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 47667 47410 gene locus_tag LOCUS_07780 47667 47410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 49179 47956 gene locus_tag LOCUS_07790 49179 47956 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_07790 49368 49847 gene locus_tag LOCUS_07800 49368 49847 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978601.1 protein_id gnl|my_center|LOCUS_07800 51185 50118 gene locus_tag LOCUS_07810 51185 50118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 51816 52052 gene locus_tag LOCUS_07820 51816 52052 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_07820 52912 52163 gene locus_tag LOCUS_07830 gene pgl 52912 52163 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_07830 54492 52909 gene locus_tag LOCUS_07840 gene zwf 54492 52909 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_07840 55769 54639 gene locus_tag LOCUS_07850 gene tal 55769 54639 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_07850 57873 55855 gene locus_tag LOCUS_07860 gene tkt 57873 55855 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_07860 59432 57954 gene locus_tag LOCUS_07870 gene gntK 59432 57954 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450003.1 protein_id gnl|my_center|LOCUS_07870 59452 59763 gene locus_tag LOCUS_07880 59452 59763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 59918 59700 gene locus_tag LOCUS_07890 59918 59700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 60339 59965 gene locus_tag LOCUS_07900 60339 59965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 60469 62097 gene locus_tag LOCUS_07910 gene zwf 60469 62097 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_07910 62856 62392 gene locus_tag LOCUS_07920 62856 62392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 63472 63236 gene locus_tag LOCUS_07930 63472 63236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 65205 63487 gene locus_tag LOCUS_07940 65205 63487 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_07940 65386 66315 gene locus_tag LOCUS_07950 gene htpX 65386 66315 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392235.1 protein_id gnl|my_center|LOCUS_07950 66428 67015 gene locus_tag LOCUS_07960 66428 67015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392236.1 protein_id gnl|my_center|LOCUS_07960 67328 67059 gene locus_tag LOCUS_07970 67328 67059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392238.1 protein_id gnl|my_center|LOCUS_07970 68087 67380 gene locus_tag LOCUS_07980 68087 67380 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392237.1 protein_id gnl|my_center|LOCUS_07980 69693 68692 gene locus_tag LOCUS_07990 gene ctaA 69693 68692 CDS product heme A synthase CtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245869.1 protein_id gnl|my_center|LOCUS_07990 70838 69927 gene locus_tag LOCUS_08000 70838 69927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 71363 72370 gene locus_tag LOCUS_08010 71363 72370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 72573 73997 gene locus_tag LOCUS_08020 72573 73997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 74129 74401 gene locus_tag LOCUS_08030 74129 74401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 74407 74589 gene locus_tag LOCUS_08040 74407 74589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 74810 75691 gene locus_tag LOCUS_08050 74810 75691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08050 75672 76598 gene locus_tag LOCUS_08060 75672 76598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08060 77489 76863 gene locus_tag LOCUS_08070 77489 76863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence010 1287 328 gene locus_tag LOCUS_08080 1287 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3642 1444 gene locus_tag LOCUS_08090 3642 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 4385 5170 gene locus_tag LOCUS_08100 4385 5170 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403200.1 protein_id gnl|my_center|LOCUS_08100 5167 6519 gene locus_tag LOCUS_08110 gene sat 5167 6519 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141086.1 protein_id gnl|my_center|LOCUS_08110 7765 8310 gene locus_tag LOCUS_08120 gene pyrR 7765 8310 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869840.1 protein_id gnl|my_center|LOCUS_08120 8353 9285 gene locus_tag LOCUS_08130 8353 9285 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_08130 9282 10514 gene locus_tag LOCUS_08140 9282 10514 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_08140 10537 11652 gene locus_tag LOCUS_08150 gene carA 10537 11652 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_08150 12322 15657 gene locus_tag LOCUS_08160 gene carB 12322 15657 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_08160 15821 16558 gene locus_tag LOCUS_08170 gene pyrF 15821 16558 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_08170 16718 21298 gene locus_tag LOCUS_08180 gene gltB 16718 21298 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393514.1 protein_id gnl|my_center|LOCUS_08180 21471 21704 gene locus_tag LOCUS_08190 21471 21704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 21814 22152 gene locus_tag LOCUS_08200 21814 22152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 22327 23067 gene locus_tag LOCUS_08210 22327 23067 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719585.1 protein_id gnl|my_center|LOCUS_08210 23950 25863 gene locus_tag LOCUS_08220 gene asnB 23950 25863 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392813.1 protein_id gnl|my_center|LOCUS_08220 27098 26169 gene locus_tag LOCUS_08230 27098 26169 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_08230 27219 28256 gene locus_tag LOCUS_08240 gene selD 27219 28256 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_08240 28413 29561 gene locus_tag LOCUS_08250 28413 29561 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_08250 30028 29663 gene locus_tag LOCUS_08260 30028 29663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 30168 29992 gene locus_tag LOCUS_08270 30168 29992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 30249 30539 gene locus_tag LOCUS_08280 30249 30539 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140052.1 protein_id gnl|my_center|LOCUS_08280 30646 31398 gene locus_tag LOCUS_08290 30646 31398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 31509 31664 gene locus_tag LOCUS_08300 31509 31664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 32781 31741 gene locus_tag LOCUS_08310 32781 31741 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887745.1 protein_id gnl|my_center|LOCUS_08310 33386 32997 gene locus_tag LOCUS_08320 33386 32997 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272733.1 protein_id gnl|my_center|LOCUS_08320 33728 34228 gene locus_tag LOCUS_08330 33728 34228 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_08330 34527 35372 gene locus_tag LOCUS_08340 34527 35372 CDS product cytochrome aa3 quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176165.1 protein_id gnl|my_center|LOCUS_08340 35431 37395 gene locus_tag LOCUS_08350 gene qoxB 35431 37395 CDS product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762372.1 protein_id gnl|my_center|LOCUS_08350 37392 38009 gene locus_tag LOCUS_08360 gene qoxC 37392 38009 CDS product cytochrome aa3 quinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729317.1 protein_id gnl|my_center|LOCUS_08360 38055 38459 gene locus_tag LOCUS_08370 38055 38459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 39719 40651 gene locus_tag LOCUS_08380 39719 40651 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706198.1 protein_id gnl|my_center|LOCUS_08380 40918 41271 gene locus_tag LOCUS_08390 40918 41271 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545882.1 protein_id gnl|my_center|LOCUS_08390 41293 41871 gene locus_tag LOCUS_08400 41293 41871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 41918 43072 gene locus_tag LOCUS_08410 41918 43072 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900904.1 protein_id gnl|my_center|LOCUS_08410 44026 43211 gene locus_tag LOCUS_08420 44026 43211 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_08420 44414 44893 gene locus_tag LOCUS_08430 44414 44893 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897586.1 protein_id gnl|my_center|LOCUS_08430 46173 45232 gene locus_tag LOCUS_08440 46173 45232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 46710 47117 gene locus_tag LOCUS_08450 46710 47117 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_08450 47473 49152 gene locus_tag LOCUS_08460 gene gltA 47473 49152 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_08460 50811 49456 gene locus_tag LOCUS_08470 50811 49456 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968789.1 protein_id gnl|my_center|LOCUS_08470 50973 52229 gene locus_tag LOCUS_08480 50973 52229 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618783.1 protein_id gnl|my_center|LOCUS_08480 52791 53075 gene locus_tag LOCUS_08490 52791 53075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 53348 53680 gene locus_tag LOCUS_08500 53348 53680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 54277 54891 gene locus_tag LOCUS_08510 54277 54891 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880118.1 protein_id gnl|my_center|LOCUS_08510 54842 55183 gene locus_tag LOCUS_08520 54842 55183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 55254 57044 gene locus_tag LOCUS_08530 55254 57044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967136.1 protein_id gnl|my_center|LOCUS_08530 57034 58953 gene locus_tag LOCUS_08540 57034 58953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 protein_id gnl|my_center|LOCUS_08540 59750 59133 gene locus_tag LOCUS_08550 59750 59133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 60349 60975 gene locus_tag LOCUS_08560 60349 60975 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229706.1 protein_id gnl|my_center|LOCUS_08560 61137 61670 gene locus_tag LOCUS_08570 61137 61670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 62027 62773 gene locus_tag LOCUS_08580 62027 62773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 63078 66128 gene locus_tag LOCUS_08590 63078 66128 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_08590 66301 66786 gene locus_tag LOCUS_08600 66301 66786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 66792 67379 gene locus_tag LOCUS_08610 66792 67379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 67798 69315 gene locus_tag LOCUS_08620 67798 69315 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_08620 69527 69940 gene locus_tag LOCUS_08630 69527 69940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 69977 70771 gene locus_tag LOCUS_08640 gene rph 69977 70771 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392056.1 protein_id gnl|my_center|LOCUS_08640 70789 71424 gene locus_tag LOCUS_08650 gene rdgB 70789 71424 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776021.1 protein_id gnl|my_center|LOCUS_08650 72506 71553 gene locus_tag LOCUS_08660 72506 71553 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966497.1 protein_id gnl|my_center|LOCUS_08660 74003 72774 gene locus_tag LOCUS_08670 74003 72774 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393460.1 protein_id gnl|my_center|LOCUS_08670 74264 75277 gene locus_tag LOCUS_08680 74264 75277 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973550.1 protein_id gnl|my_center|LOCUS_08680 75319 75648 gene locus_tag LOCUS_08690 75319 75648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence011 84 1307 gene locus_tag LOCUS_08700 84 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2117 1863 gene locus_tag LOCUS_08710 2117 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 4136 2166 gene locus_tag LOCUS_08720 4136 2166 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093091.1 protein_id gnl|my_center|LOCUS_08720 4758 4195 gene locus_tag LOCUS_08730 gene yjjX 4758 4195 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071197.1 protein_id gnl|my_center|LOCUS_08730 5167 6150 gene locus_tag LOCUS_08740 5167 6150 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_08740 7686 6463 gene locus_tag LOCUS_08750 7686 6463 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244027.1 protein_id gnl|my_center|LOCUS_08750 7916 9367 gene locus_tag LOCUS_08760 gene gabP 7916 9367 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360123.1 protein_id gnl|my_center|LOCUS_08760 9583 9386 gene locus_tag LOCUS_08770 9583 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 9856 11520 gene locus_tag LOCUS_08780 9856 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 13007 11790 gene locus_tag LOCUS_08790 13007 11790 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 protein_id gnl|my_center|LOCUS_08790 13262 15424 gene locus_tag LOCUS_08800 13262 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 17957 15606 gene locus_tag LOCUS_08810 17957 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 19063 18248 gene locus_tag LOCUS_08820 19063 18248 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_08820 20098 19334 gene locus_tag LOCUS_08830 20098 19334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 23403 20239 gene locus_tag LOCUS_08840 23403 20239 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020247.1 protein_id gnl|my_center|LOCUS_08840 24458 23940 gene locus_tag LOCUS_08850 24458 23940 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280188.1 protein_id gnl|my_center|LOCUS_08850 24815 25069 gene locus_tag LOCUS_08860 24815 25069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 26052 25030 gene locus_tag LOCUS_08870 26052 25030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 27651 26422 gene locus_tag LOCUS_08880 27651 26422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 27949 28500 gene locus_tag LOCUS_08890 27949 28500 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927009.1 protein_id gnl|my_center|LOCUS_08890 28916 29479 gene locus_tag LOCUS_08900 28916 29479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 29666 30241 gene locus_tag LOCUS_08910 gene lepB 29666 30241 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_08910 30604 30323 gene locus_tag LOCUS_08920 30604 30323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 32064 31378 gene locus_tag LOCUS_08930 32064 31378 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_08930 32794 32402 gene locus_tag LOCUS_08940 32794 32402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 34252 33131 gene locus_tag LOCUS_08950 34252 33131 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965740.1 protein_id gnl|my_center|LOCUS_08950 35294 34683 gene locus_tag LOCUS_08960 35294 34683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 35498 36490 gene locus_tag LOCUS_08970 35498 36490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 36812 36522 gene locus_tag LOCUS_08980 36812 36522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 38320 37100 gene locus_tag LOCUS_08990 38320 37100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 40734 38317 gene locus_tag LOCUS_09000 gene mrfA 40734 38317 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_09000 40902 41711 gene locus_tag LOCUS_09010 40902 41711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 42788 42114 gene locus_tag LOCUS_09020 42788 42114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 43157 44218 gene locus_tag LOCUS_09030 43157 44218 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029113.1 protein_id gnl|my_center|LOCUS_09030 44215 44475 gene locus_tag LOCUS_09040 44215 44475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 45495 44674 gene locus_tag LOCUS_09050 gene iolB 45495 44674 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 protein_id gnl|my_center|LOCUS_09050 45406 45675 gene locus_tag LOCUS_09060 45406 45675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 46321 45647 gene locus_tag LOCUS_09070 46321 45647 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876859.1 protein_id gnl|my_center|LOCUS_09070 47131 46685 gene locus_tag LOCUS_09080 47131 46685 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172943.1 protein_id gnl|my_center|LOCUS_09080 47737 47408 gene locus_tag LOCUS_09090 gene trxA 47737 47408 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_09090 47883 48218 gene locus_tag LOCUS_09100 47883 48218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 49880 48186 gene locus_tag LOCUS_09110 49880 48186 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398544.1 protein_id gnl|my_center|LOCUS_09110 50205 49858 gene locus_tag LOCUS_09120 50205 49858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 51045 50476 gene locus_tag LOCUS_09130 51045 50476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 51138 52658 gene locus_tag LOCUS_09140 51138 52658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 53364 52621 gene locus_tag LOCUS_09150 53364 52621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 54244 53399 gene locus_tag LOCUS_09160 54244 53399 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392874.1 protein_id gnl|my_center|LOCUS_09160 54941 54276 gene locus_tag LOCUS_09170 54941 54276 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_09170 56438 54978 gene locus_tag LOCUS_09180 gene lysA 56438 54978 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_09180 57246 56809 gene locus_tag LOCUS_09190 57246 56809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 57568 58233 gene locus_tag LOCUS_09200 57568 58233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 59310 58315 gene locus_tag LOCUS_09210 59310 58315 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909515.1 protein_id gnl|my_center|LOCUS_09210 60229 59312 gene locus_tag LOCUS_09220 60229 59312 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_09220 62677 60233 gene locus_tag LOCUS_09230 62677 60233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 65043 62803 gene locus_tag LOCUS_09240 65043 62803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 66330 65365 gene locus_tag LOCUS_09250 66330 65365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_09250 69438 66334 gene locus_tag LOCUS_09260 69438 66334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 70736 69567 gene locus_tag LOCUS_09270 70736 69567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 71448 70729 gene locus_tag LOCUS_09280 71448 70729 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_09280 72663 71518 gene locus_tag LOCUS_09290 72663 71518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence012 1560 1213 gene locus_tag LOCUS_09300 1560 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1621 2523 gene locus_tag LOCUS_09310 1621 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2558 4363 gene locus_tag LOCUS_09320 2558 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 5908 4685 gene locus_tag LOCUS_09330 gene trpB 5908 4685 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392850.1 protein_id gnl|my_center|LOCUS_09330 6570 5938 gene locus_tag LOCUS_09340 6570 5938 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258566.1 protein_id gnl|my_center|LOCUS_09340 7697 6792 gene locus_tag LOCUS_09350 gene trpC 7697 6792 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_09350 8725 7694 gene locus_tag LOCUS_09360 gene trpD 8725 7694 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_09360 9980 9273 gene locus_tag LOCUS_09370 9980 9273 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_09370 11584 9977 gene locus_tag LOCUS_09380 gene trpE 11584 9977 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_09380 11755 12024 gene locus_tag LOCUS_09390 11755 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 13612 12344 gene locus_tag LOCUS_09400 13612 12344 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405103.1 protein_id gnl|my_center|LOCUS_09400 16266 13990 gene locus_tag LOCUS_09410 gene recG 16266 13990 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_09410 16766 16266 gene locus_tag LOCUS_09420 16766 16266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 17258 16932 gene locus_tag LOCUS_09430 17258 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 18249 17299 gene locus_tag LOCUS_09440 gene hslO 18249 17299 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656366.1 protein_id gnl|my_center|LOCUS_09440 18887 20644 gene locus_tag LOCUS_09450 18887 20644 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058229.1 protein_id gnl|my_center|LOCUS_09450 20672 22081 gene locus_tag LOCUS_09460 20672 22081 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259552.1 protein_id gnl|my_center|LOCUS_09460 22385 23173 gene locus_tag LOCUS_09470 22385 23173 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088380.1 protein_id gnl|my_center|LOCUS_09470 23646 23407 gene locus_tag LOCUS_09480 23646 23407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 25129 24086 gene locus_tag LOCUS_09490 25129 24086 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257437.1 protein_id gnl|my_center|LOCUS_09490 27041 25401 gene locus_tag LOCUS_09500 27041 25401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 28224 27043 gene locus_tag LOCUS_09510 28224 27043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 29413 28553 gene locus_tag LOCUS_09520 29413 28553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 30814 29585 gene locus_tag LOCUS_09530 gene thiI 30814 29585 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_09530 29895 29806 gene locus_tag LOCUS_t00070 29895 29806 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 32193 30811 gene locus_tag LOCUS_09540 32193 30811 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_09540 32210 34918 gene locus_tag LOCUS_09550 32210 34918 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258812.1 protein_id gnl|my_center|LOCUS_09550 35641 37656 gene locus_tag LOCUS_09560 35641 37656 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_09560 38024 39040 gene locus_tag LOCUS_09570 gene ribD 38024 39040 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_09570 39040 39651 gene locus_tag LOCUS_09580 39040 39651 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_09580 39644 40897 gene locus_tag LOCUS_09590 39644 40897 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_09590 40968 41171 gene locus_tag LOCUS_09600 40968 41171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 41940 41428 gene locus_tag LOCUS_09610 41940 41428 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269072.1 protein_id gnl|my_center|LOCUS_09610 42791 41937 gene locus_tag LOCUS_09620 42791 41937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 44343 42976 gene locus_tag LOCUS_09630 44343 42976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 44249 44620 gene locus_tag LOCUS_09640 44249 44620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 44815 45846 gene locus_tag LOCUS_09650 gene coxB 44815 45846 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745268.1 protein_id gnl|my_center|LOCUS_09650 45935 47863 gene locus_tag LOCUS_09660 gene ctaD 45935 47863 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232245.1 protein_id gnl|my_center|LOCUS_09660 47860 48492 gene locus_tag LOCUS_09670 47860 48492 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179824.1 protein_id gnl|my_center|LOCUS_09670 48495 48800 gene locus_tag LOCUS_09680 48495 48800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 48921 49889 gene locus_tag LOCUS_09690 gene ctaG 48921 49889 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069023.1 protein_id gnl|my_center|LOCUS_09690 50002 50895 gene locus_tag LOCUS_09700 50002 50895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 50952 51416 gene locus_tag LOCUS_09710 50952 51416 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538766.1 protein_id gnl|my_center|LOCUS_09710 51450 52076 gene locus_tag LOCUS_09720 51450 52076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 52312 52872 gene locus_tag LOCUS_09730 52312 52872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 53793 53017 gene locus_tag LOCUS_09740 53793 53017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 55435 54242 gene locus_tag LOCUS_09750 55435 54242 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_09750 56208 55528 gene locus_tag LOCUS_09760 56208 55528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 56486 56983 gene locus_tag LOCUS_09770 gene ribE 56486 56983 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_09770 57323 58489 gene locus_tag LOCUS_09780 57323 58489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 61440 58585 gene locus_tag LOCUS_09790 gene ppc 61440 58585 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_09790 62594 61437 gene locus_tag LOCUS_09800 gene galK 62594 61437 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_09800 63601 62591 gene locus_tag LOCUS_09810 gene galT 63601 62591 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015287872.1 protein_id gnl|my_center|LOCUS_09810 64713 63598 gene locus_tag LOCUS_09820 gene galE 64713 63598 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643943.1 protein_id gnl|my_center|LOCUS_09820 65631 64732 gene locus_tag LOCUS_09830 65631 64732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 66197 65802 gene locus_tag LOCUS_09840 66197 65802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 67917 67027 gene locus_tag LOCUS_09850 67917 67027 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461587.1 protein_id gnl|my_center|LOCUS_09850 68195 67914 gene locus_tag LOCUS_09860 68195 67914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 68535 68996 gene locus_tag LOCUS_09870 68535 68996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 70656 69757 gene locus_tag LOCUS_09880 70656 69757 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257620.1 protein_id gnl|my_center|LOCUS_09880 70994 71395 gene locus_tag LOCUS_09890 70994 71395 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence013 807 7 gene locus_tag LOCUS_09900 807 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1153 2079 gene locus_tag LOCUS_09910 gene tmpR 1153 2079 CDS product bifunctional dihydropteridine reductase/dihydrofolate reductase TmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172549.1 protein_id gnl|my_center|LOCUS_09910 2502 2155 gene locus_tag LOCUS_09920 2502 2155 CDS product DUF1805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248463.1 protein_id gnl|my_center|LOCUS_09920 2684 3376 gene locus_tag LOCUS_09930 2684 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3514 3882 gene locus_tag LOCUS_09940 3514 3882 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393953.1 protein_id gnl|my_center|LOCUS_09940 5041 4151 gene locus_tag LOCUS_09950 5041 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 5317 5126 gene locus_tag LOCUS_09960 5317 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 6097 5444 gene locus_tag LOCUS_09970 gene phoU 6097 5444 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_09970 6829 6239 gene locus_tag LOCUS_09980 6829 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 7827 6826 gene locus_tag LOCUS_09990 7827 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7991 8425 gene locus_tag LOCUS_10000 7991 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 8984 10138 gene locus_tag LOCUS_10010 gene dgoD 8984 10138 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 protein_id gnl|my_center|LOCUS_10010 10290 11429 gene locus_tag LOCUS_10020 10290 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 11486 12379 gene locus_tag LOCUS_10030 11486 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 12784 13827 gene locus_tag LOCUS_10040 12784 13827 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_10040 14161 15978 gene locus_tag LOCUS_10050 14161 15978 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259019.1 protein_id gnl|my_center|LOCUS_10050 16005 16781 gene locus_tag LOCUS_10060 16005 16781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 16939 17022 gene locus_tag LOCUS_t00080 16939 17022 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17361 17648 gene locus_tag LOCUS_10070 17361 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 17661 19115 gene locus_tag LOCUS_10080 17661 19115 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083258.1 protein_id gnl|my_center|LOCUS_10080 19991 19437 gene locus_tag LOCUS_10090 19991 19437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 22057 20075 gene locus_tag LOCUS_10100 22057 20075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 22995 22063 gene locus_tag LOCUS_10110 22995 22063 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389167.1 protein_id gnl|my_center|LOCUS_10110 23793 23188 gene locus_tag LOCUS_10120 23793 23188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 25568 23820 gene locus_tag LOCUS_10130 25568 23820 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275246.1 protein_id gnl|my_center|LOCUS_10130 25769 27907 gene locus_tag LOCUS_10140 25769 27907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 29180 28044 gene locus_tag LOCUS_10150 gene rhaI 29180 28044 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027369.1 protein_id gnl|my_center|LOCUS_10150 31481 29442 gene locus_tag LOCUS_10160 31481 29442 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_10160 33130 31499 gene locus_tag LOCUS_10170 gene xylB 33130 31499 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_10170 33972 33127 gene locus_tag LOCUS_10180 gene rhaR 33972 33127 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_10180 34482 36944 gene locus_tag LOCUS_10190 34482 36944 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729203.1 protein_id gnl|my_center|LOCUS_10190 36955 38052 gene locus_tag LOCUS_10200 36955 38052 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141002.1 protein_id gnl|my_center|LOCUS_10200 38287 39051 gene locus_tag LOCUS_10210 38287 39051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 39203 40309 gene locus_tag LOCUS_10220 39203 40309 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230995.1 protein_id gnl|my_center|LOCUS_10220 40578 41858 gene locus_tag LOCUS_10230 gene pepT 40578 41858 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401270.1 protein_id gnl|my_center|LOCUS_10230 41975 42802 gene locus_tag LOCUS_10240 41975 42802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 43081 44178 gene locus_tag LOCUS_10250 43081 44178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 46922 44406 gene locus_tag LOCUS_10260 46922 44406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 47351 48208 gene locus_tag LOCUS_10270 47351 48208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 48208 49260 gene locus_tag LOCUS_10280 48208 49260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 49344 52025 gene locus_tag LOCUS_10290 gene polA 49344 52025 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_10290 52207 53049 gene locus_tag LOCUS_10300 gene mutM 52207 53049 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_10300 53259 53468 gene locus_tag LOCUS_10310 53259 53468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 53630 54871 gene locus_tag LOCUS_10320 53630 54871 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_10320 54952 55134 gene locus_tag LOCUS_10330 54952 55134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 55116 55748 gene locus_tag LOCUS_10340 gene coaE 55116 55748 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_10340 55738 56343 gene locus_tag LOCUS_10350 55738 56343 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393337.1 protein_id gnl|my_center|LOCUS_10350 58724 57360 gene locus_tag LOCUS_10360 58724 57360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 59074 59463 gene locus_tag LOCUS_10370 59074 59463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 59984 59900 gene locus_tag LOCUS_t00090 59984 59900 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 60141 60055 gene locus_tag LOCUS_t00100 60141 60055 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 61080 60325 gene locus_tag LOCUS_10380 61080 60325 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_10380 61926 61396 gene locus_tag LOCUS_10390 61926 61396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 62061 62987 gene locus_tag LOCUS_10400 62061 62987 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_10400 63065 66082 gene locus_tag LOCUS_10410 63065 66082 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392668.1 protein_id gnl|my_center|LOCUS_10410 66384 67463 gene locus_tag LOCUS_10420 66384 67463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 67739 67551 gene locus_tag LOCUS_10430 67739 67551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 67959 68354 gene locus_tag LOCUS_10440 67959 68354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 68423 68722 gene locus_tag LOCUS_10450 68423 68722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 69077 70036 gene locus_tag LOCUS_10460 69077 70036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence014 2314 677 gene locus_tag LOCUS_10470 gene groL 2314 677 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_10470 2846 2520 gene locus_tag LOCUS_10480 gene groES 2846 2520 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_10480 3656 3153 gene locus_tag LOCUS_10490 3656 3153 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227870.1 protein_id gnl|my_center|LOCUS_10490 4168 3632 gene locus_tag LOCUS_10500 gene moaC 4168 3632 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_10500 5138 4161 gene locus_tag LOCUS_10510 gene moaA 5138 4161 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_10510 6349 5165 gene locus_tag LOCUS_10520 6349 5165 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_10520 6398 7633 gene locus_tag LOCUS_10530 6398 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 11040 8194 gene locus_tag LOCUS_10540 11040 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 12690 11236 gene locus_tag LOCUS_10550 gene murC 12690 11236 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_10550 13850 12834 gene locus_tag LOCUS_10560 13850 12834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 14422 13847 gene locus_tag LOCUS_10570 14422 13847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 14902 14456 gene locus_tag LOCUS_10580 14902 14456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 17487 15187 gene locus_tag LOCUS_10590 17487 15187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 18953 17922 gene locus_tag LOCUS_10600 18953 17922 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392130.1 protein_id gnl|my_center|LOCUS_10600 19957 18977 gene locus_tag LOCUS_10610 19957 18977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 19850 20203 gene locus_tag LOCUS_10620 19850 20203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 20645 20283 gene locus_tag LOCUS_10630 20645 20283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 20887 21141 gene locus_tag LOCUS_10640 20887 21141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 21900 21559 gene locus_tag LOCUS_10650 21900 21559 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_10650 23107 21989 gene locus_tag LOCUS_10660 23107 21989 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056373.1 protein_id gnl|my_center|LOCUS_10660 23962 23195 gene locus_tag LOCUS_10670 23962 23195 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930130.1 protein_id gnl|my_center|LOCUS_10670 24831 23959 gene locus_tag LOCUS_10680 gene prmA 24831 23959 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872105.1 protein_id gnl|my_center|LOCUS_10680 26152 25016 gene locus_tag LOCUS_10690 gene dnaJ 26152 25016 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_10690 28449 26557 gene locus_tag LOCUS_10700 gene dnaK 28449 26557 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_10700 29039 28449 gene locus_tag LOCUS_10710 29039 28449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 30377 29148 gene locus_tag LOCUS_10720 gene hrcA 30377 29148 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_10720 30750 31292 gene locus_tag LOCUS_10730 30750 31292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 31717 31262 gene locus_tag LOCUS_10740 31717 31262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 33198 32038 gene locus_tag LOCUS_10750 gene hemW 33198 32038 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_10750 33720 33376 gene locus_tag LOCUS_10760 33720 33376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 34250 34020 gene locus_tag LOCUS_10770 34250 34020 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069660.1 protein_id gnl|my_center|LOCUS_10770 36452 34623 gene locus_tag LOCUS_10780 gene lepA 36452 34623 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_10780 37419 37069 gene locus_tag LOCUS_10790 37419 37069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 37828 37502 gene locus_tag LOCUS_10800 37828 37502 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392117.1 protein_id gnl|my_center|LOCUS_10800 38270 40030 gene locus_tag LOCUS_10810 38270 40030 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625424.1 protein_id gnl|my_center|LOCUS_10810 40014 40901 gene locus_tag LOCUS_10820 40014 40901 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190138.1 protein_id gnl|my_center|LOCUS_10820 41328 40978 gene locus_tag LOCUS_10830 41328 40978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 41307 41555 gene locus_tag LOCUS_10840 41307 41555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 41913 41695 gene locus_tag LOCUS_10850 41913 41695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 42232 43494 gene locus_tag LOCUS_10860 42232 43494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 43555 44328 gene locus_tag LOCUS_10870 43555 44328 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 protein_id gnl|my_center|LOCUS_10870 44439 45737 gene locus_tag LOCUS_10880 44439 45737 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_10880 45763 46575 gene locus_tag LOCUS_10890 45763 46575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 46774 48582 gene locus_tag LOCUS_10900 46774 48582 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_10900 48579 50642 gene locus_tag LOCUS_10910 48579 50642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 51252 50689 gene locus_tag LOCUS_10920 gene spoVT 51252 50689 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_10920 51858 51499 gene locus_tag LOCUS_10930 51858 51499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 52243 52010 gene locus_tag LOCUS_10940 52243 52010 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416009.1 protein_id gnl|my_center|LOCUS_10940 52653 52300 gene locus_tag LOCUS_10950 52653 52300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 54800 52728 gene locus_tag LOCUS_10960 54800 52728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 56156 55116 gene locus_tag LOCUS_10970 gene argC 56156 55116 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_10970 56660 56250 gene locus_tag LOCUS_10980 gene speD 56660 56250 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223584.1 protein_id gnl|my_center|LOCUS_10980 57598 57026 gene locus_tag LOCUS_10990 57598 57026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 59296 57722 gene locus_tag LOCUS_11000 59296 57722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 60048 59293 gene locus_tag LOCUS_11010 60048 59293 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461981.1 protein_id gnl|my_center|LOCUS_11010 60333 61172 gene locus_tag LOCUS_11020 gene pheA 60333 61172 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_11020 62287 61448 gene locus_tag LOCUS_11030 62287 61448 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081357594.1 protein_id gnl|my_center|LOCUS_11030 63646 62675 gene locus_tag LOCUS_11040 gene thrB 63646 62675 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_11040 64995 63910 gene locus_tag LOCUS_11050 gene thrC 64995 63910 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406172.1 protein_id gnl|my_center|LOCUS_11050 65532 65014 gene locus_tag LOCUS_11060 65532 65014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 66038 65718 gene locus_tag LOCUS_11070 66038 65718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 66554 67963 gene locus_tag LOCUS_11080 66554 67963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 69321 68470 gene locus_tag LOCUS_11090 69321 68470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence015 1492 257 gene locus_tag LOCUS_11100 1492 257 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020294.1 protein_id gnl|my_center|LOCUS_11100 2112 2594 gene locus_tag LOCUS_11110 2112 2594 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730654.1 protein_id gnl|my_center|LOCUS_11110 2960 5650 gene locus_tag LOCUS_11120 gene clpB 2960 5650 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_11120 6824 6135 gene locus_tag LOCUS_11130 6824 6135 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391602.1 protein_id gnl|my_center|LOCUS_11130 7576 9051 gene locus_tag LOCUS_11140 7576 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 9147 9875 gene locus_tag LOCUS_11150 9147 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 10630 9989 gene locus_tag LOCUS_11160 10630 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 10569 10916 gene locus_tag LOCUS_11170 10569 10916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 11815 11264 gene locus_tag LOCUS_11180 11815 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 12005 12937 gene locus_tag LOCUS_11190 12005 12937 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224974.1 protein_id gnl|my_center|LOCUS_11190 13099 14307 gene locus_tag LOCUS_11200 13099 14307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 14700 14311 gene locus_tag LOCUS_11210 14700 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 15859 14678 gene locus_tag LOCUS_11220 15859 14678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 15938 16132 gene locus_tag LOCUS_11230 15938 16132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 16416 16763 gene locus_tag LOCUS_11240 16416 16763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 17751 17176 gene locus_tag LOCUS_11250 17751 17176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 17922 18158 gene locus_tag LOCUS_11260 17922 18158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11260 18293 18520 gene locus_tag LOCUS_11270 18293 18520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 18757 18969 gene locus_tag LOCUS_11280 18757 18969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 19223 20518 gene locus_tag LOCUS_11290 19223 20518 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 protein_id gnl|my_center|LOCUS_11290 20561 21070 gene locus_tag LOCUS_11300 gene arsC 20561 21070 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641672.1 protein_id gnl|my_center|LOCUS_11300 21375 22655 gene locus_tag LOCUS_11310 21375 22655 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007344.1 protein_id gnl|my_center|LOCUS_11310 23020 24312 gene locus_tag LOCUS_11320 23020 24312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 25489 24680 gene locus_tag LOCUS_11330 25489 24680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 25855 25619 gene locus_tag LOCUS_11340 25855 25619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 26943 28619 gene locus_tag LOCUS_11350 gene sdhA 26943 28619 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930843.1 protein_id gnl|my_center|LOCUS_11350 28683 29663 gene locus_tag LOCUS_11360 28683 29663 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057591.1 protein_id gnl|my_center|LOCUS_11360 29928 30812 gene locus_tag LOCUS_11370 29928 30812 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_11370 31509 31584 gene locus_tag LOCUS_t00110 31509 31584 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 32873 31680 gene locus_tag LOCUS_11380 32873 31680 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_11380 33252 33557 gene locus_tag LOCUS_11390 33252 33557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 33632 34075 gene locus_tag LOCUS_11400 33632 34075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 34053 35597 gene locus_tag LOCUS_11410 34053 35597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 35729 36091 gene locus_tag LOCUS_11420 35729 36091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 36088 36525 gene locus_tag LOCUS_11430 36088 36525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 36655 37827 gene locus_tag LOCUS_11440 36655 37827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 37920 40133 gene locus_tag LOCUS_11450 37920 40133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 40130 40816 gene locus_tag LOCUS_11460 40130 40816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 40822 41586 gene locus_tag LOCUS_11470 40822 41586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 41675 42607 gene locus_tag LOCUS_11480 41675 42607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 42607 43929 gene locus_tag LOCUS_11490 42607 43929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 43930 45420 gene locus_tag LOCUS_11500 43930 45420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 45417 46349 gene locus_tag LOCUS_11510 45417 46349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 46369 47280 gene locus_tag LOCUS_11520 46369 47280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 47504 48175 gene locus_tag LOCUS_11530 47504 48175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 49781 48588 gene locus_tag LOCUS_11540 49781 48588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 50469 49771 gene locus_tag LOCUS_11550 50469 49771 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284338.1 protein_id gnl|my_center|LOCUS_11550 50359 50637 gene locus_tag LOCUS_11560 50359 50637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 51071 50622 gene locus_tag LOCUS_11570 51071 50622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 51456 51701 gene locus_tag LOCUS_11580 51456 51701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 51797 51967 gene locus_tag LOCUS_11590 51797 51967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 51961 52500 gene locus_tag LOCUS_11600 51961 52500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 52504 52974 gene locus_tag LOCUS_11610 52504 52974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 52989 53453 gene locus_tag LOCUS_11620 52989 53453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 53586 53957 gene locus_tag LOCUS_11630 53586 53957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 53973 56273 gene locus_tag LOCUS_11640 53973 56273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 56346 58052 gene locus_tag LOCUS_11650 56346 58052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 59763 58213 gene locus_tag LOCUS_11660 59763 58213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 59945 61357 gene locus_tag LOCUS_11670 59945 61357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 61618 61860 gene locus_tag LOCUS_11680 61618 61860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 62115 62852 gene locus_tag LOCUS_11690 62115 62852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 62855 63193 gene locus_tag LOCUS_11700 62855 63193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 63264 64724 gene locus_tag LOCUS_11710 63264 64724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 64833 66080 gene locus_tag LOCUS_11720 64833 66080 CDS product IS701 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151614010.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence016 962 2809 gene locus_tag LOCUS_11730 962 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2949 4259 gene locus_tag LOCUS_11740 gene aroA 2949 4259 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332883.1 protein_id gnl|my_center|LOCUS_11740 4332 5687 gene locus_tag LOCUS_11750 gene ygjG 4332 5687 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309772.1 protein_id gnl|my_center|LOCUS_11750 6859 5702 gene locus_tag LOCUS_11760 6859 5702 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931414.1 protein_id gnl|my_center|LOCUS_11760 7418 8404 gene locus_tag LOCUS_11770 7418 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 8429 9616 gene locus_tag LOCUS_11780 8429 9616 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_11780 10339 9605 gene locus_tag LOCUS_11790 10339 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 11067 12983 gene locus_tag LOCUS_11800 gene typA 11067 12983 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393394.1 protein_id gnl|my_center|LOCUS_11800 13707 13015 gene locus_tag LOCUS_11810 gene queC 13707 13015 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272362.1 protein_id gnl|my_center|LOCUS_11810 14386 13697 gene locus_tag LOCUS_11820 gene queE 14386 13697 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090918384.1 protein_id gnl|my_center|LOCUS_11820 14754 14383 gene locus_tag LOCUS_11830 14754 14383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 15603 14758 gene locus_tag LOCUS_11840 15603 14758 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392638.1 protein_id gnl|my_center|LOCUS_11840 15756 16355 gene locus_tag LOCUS_11850 15756 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 16797 16357 gene locus_tag LOCUS_11860 16797 16357 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172363.1 protein_id gnl|my_center|LOCUS_11860 17066 17953 gene locus_tag LOCUS_11870 17066 17953 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391666.1 protein_id gnl|my_center|LOCUS_11870 19085 18114 gene locus_tag LOCUS_11880 19085 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 19636 21081 gene locus_tag LOCUS_11890 19636 21081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 22741 21152 gene locus_tag LOCUS_11900 22741 21152 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_11900 23029 24153 gene locus_tag LOCUS_11910 23029 24153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 24357 25970 gene locus_tag LOCUS_11920 gene cimA 24357 25970 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_11920 26334 26134 gene locus_tag LOCUS_11930 26334 26134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 27035 26331 gene locus_tag LOCUS_11940 27035 26331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 27257 27718 gene locus_tag LOCUS_11950 27257 27718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 27873 28751 gene locus_tag LOCUS_11960 gene folP 27873 28751 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_11960 28748 30082 gene locus_tag LOCUS_11970 28748 30082 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_11970 31243 30107 gene locus_tag LOCUS_11980 31243 30107 CDS product tetraprenyl-beta-curcumene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391704.1 protein_id gnl|my_center|LOCUS_11980 31469 32365 gene locus_tag LOCUS_11990 31469 32365 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_11990 32481 32993 gene locus_tag LOCUS_12000 gene argR 32481 32993 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_12000 33102 34817 gene locus_tag LOCUS_12010 gene recN 33102 34817 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_12010 35052 35462 gene locus_tag LOCUS_12020 35052 35462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 35843 37165 gene locus_tag LOCUS_12030 gene spoIVB 35843 37165 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393015.1 protein_id gnl|my_center|LOCUS_12030 37401 38177 gene locus_tag LOCUS_12040 gene spo0A 37401 38177 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_12040 38478 39578 gene locus_tag LOCUS_12050 38478 39578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 40310 40963 gene locus_tag LOCUS_12060 40310 40963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 41224 42333 gene locus_tag LOCUS_12070 gene ald 41224 42333 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905011.1 protein_id gnl|my_center|LOCUS_12070 42427 43461 gene locus_tag LOCUS_12080 gene xerD 42427 43461 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_12080 43458 44321 gene locus_tag LOCUS_12090 43458 44321 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498639.1 protein_id gnl|my_center|LOCUS_12090 44657 45970 gene locus_tag LOCUS_12100 44657 45970 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921564.1 protein_id gnl|my_center|LOCUS_12100 47620 46172 gene locus_tag LOCUS_12110 47620 46172 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_12110 48413 50068 gene locus_tag LOCUS_12120 48413 50068 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_12120 50324 51310 gene locus_tag LOCUS_12130 50324 51310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776034.1 protein_id gnl|my_center|LOCUS_12130 51338 52231 gene locus_tag LOCUS_12140 51338 52231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12140 52261 54285 gene locus_tag LOCUS_12150 52261 54285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532883.1 protein_id gnl|my_center|LOCUS_12150 54312 56003 gene locus_tag LOCUS_12160 54312 56003 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803788.1 protein_id gnl|my_center|LOCUS_12160 57161 56193 gene locus_tag LOCUS_12170 57161 56193 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869311.1 protein_id gnl|my_center|LOCUS_12170 58023 57652 gene locus_tag LOCUS_12180 58023 57652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 58227 59633 gene locus_tag LOCUS_12190 58227 59633 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_12190 60002 60739 gene locus_tag LOCUS_12200 60002 60739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 61774 60932 gene locus_tag LOCUS_12210 61774 60932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 62794 62471 gene locus_tag LOCUS_12220 62794 62471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 63381 63881 gene locus_tag LOCUS_12230 63381 63881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 63878 65089 gene locus_tag LOCUS_12240 63878 65089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence017 741 1373 gene locus_tag LOCUS_12250 741 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1348 1896 gene locus_tag LOCUS_12260 1348 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 2286 3086 gene locus_tag LOCUS_12270 2286 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3149 3871 gene locus_tag LOCUS_12280 3149 3871 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921962.1 protein_id gnl|my_center|LOCUS_12280 3996 4346 gene locus_tag LOCUS_12290 3996 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 5204 4470 gene locus_tag LOCUS_12300 5204 4470 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258401.1 protein_id gnl|my_center|LOCUS_12300 6207 5458 gene locus_tag LOCUS_12310 6207 5458 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223384.1 protein_id gnl|my_center|LOCUS_12310 6704 6195 gene locus_tag LOCUS_12320 6704 6195 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223383.1 protein_id gnl|my_center|LOCUS_12320 6940 6698 gene locus_tag LOCUS_12330 6940 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 7190 6903 gene locus_tag LOCUS_12340 7190 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 8310 7309 gene locus_tag LOCUS_12350 gene lgoD 8310 7309 CDS product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106036.1 protein_id gnl|my_center|LOCUS_12350 10429 8771 gene locus_tag LOCUS_12360 10429 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 12394 10991 gene locus_tag LOCUS_12370 12394 10991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 14025 12391 gene locus_tag LOCUS_12380 14025 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 14845 14015 gene locus_tag LOCUS_12390 14845 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 16946 14916 gene locus_tag LOCUS_12400 16946 14916 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 protein_id gnl|my_center|LOCUS_12400 18300 16993 gene locus_tag LOCUS_12410 18300 16993 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_12410 19033 18293 gene locus_tag LOCUS_12420 19033 18293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 19463 20137 gene locus_tag LOCUS_12430 19463 20137 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531349.1 protein_id gnl|my_center|LOCUS_12430 20154 20396 gene locus_tag LOCUS_12440 20154 20396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 21421 20450 gene locus_tag LOCUS_12450 21421 20450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 22539 21805 gene locus_tag LOCUS_12460 22539 21805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 23218 23913 gene locus_tag LOCUS_12470 23218 23913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 23807 25192 gene locus_tag LOCUS_12480 23807 25192 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250139.1 protein_id gnl|my_center|LOCUS_12480 25269 25940 gene locus_tag LOCUS_12490 25269 25940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 26184 26705 gene locus_tag LOCUS_12500 26184 26705 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226161.1 protein_id gnl|my_center|LOCUS_12500 27992 26784 gene locus_tag LOCUS_12510 27992 26784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 29315 28302 gene locus_tag LOCUS_12520 29315 28302 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_12520 30165 29338 gene locus_tag LOCUS_12530 30165 29338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 31825 30695 gene locus_tag LOCUS_12540 31825 30695 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066535.1 protein_id gnl|my_center|LOCUS_12540 31975 32334 gene locus_tag LOCUS_12550 31975 32334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 33096 32425 gene locus_tag LOCUS_12560 33096 32425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392783.1 protein_id gnl|my_center|LOCUS_12560 33278 33565 gene locus_tag LOCUS_12570 33278 33565 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847047.1 protein_id gnl|my_center|LOCUS_12570 34030 34764 gene locus_tag LOCUS_12580 34030 34764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 36123 34897 gene locus_tag LOCUS_12590 36123 34897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 36517 36921 gene locus_tag LOCUS_12600 36517 36921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 36918 38417 gene locus_tag LOCUS_12610 36918 38417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 38578 38997 gene locus_tag LOCUS_12620 38578 38997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 39212 40138 gene locus_tag LOCUS_12630 39212 40138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 40652 41323 gene locus_tag LOCUS_12640 gene tenA 40652 41323 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877712.1 protein_id gnl|my_center|LOCUS_12640 41342 41635 gene locus_tag LOCUS_12650 41342 41635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 42411 43118 gene locus_tag LOCUS_12660 42411 43118 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313094.1 protein_id gnl|my_center|LOCUS_12660 43157 44302 gene locus_tag LOCUS_12670 43157 44302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 44515 44826 gene locus_tag LOCUS_12680 44515 44826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 44865 46448 gene locus_tag LOCUS_12690 gene murJ 44865 46448 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_12690 47185 46571 gene locus_tag LOCUS_12700 47185 46571 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255933.1 protein_id gnl|my_center|LOCUS_12700 48333 47182 gene locus_tag LOCUS_12710 48333 47182 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973239.1 protein_id gnl|my_center|LOCUS_12710 49958 48768 gene locus_tag LOCUS_12720 49958 48768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 50548 51186 gene locus_tag LOCUS_12730 50548 51186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 52385 51441 gene locus_tag LOCUS_12740 52385 51441 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407571.1 protein_id gnl|my_center|LOCUS_12740 52842 52423 gene locus_tag LOCUS_12750 52842 52423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 53141 54019 gene locus_tag LOCUS_12760 53141 54019 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903458.1 protein_id gnl|my_center|LOCUS_12760 54196 54597 gene locus_tag LOCUS_12770 54196 54597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 54929 54666 gene locus_tag LOCUS_12780 54929 54666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 54849 55952 gene locus_tag LOCUS_12790 54849 55952 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705009.1 protein_id gnl|my_center|LOCUS_12790 56023 56307 gene locus_tag LOCUS_12800 56023 56307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence018 2964 1024 gene locus_tag LOCUS_12810 gene thrS 2964 1024 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393260.1 protein_id gnl|my_center|LOCUS_12810 4497 3436 gene locus_tag LOCUS_12820 gene thiO 4497 3436 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921239.1 protein_id gnl|my_center|LOCUS_12820 5503 4490 gene locus_tag LOCUS_12830 gene thiS 5503 4490 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390185.1 protein_id gnl|my_center|LOCUS_12830 6174 5473 gene locus_tag LOCUS_12840 6174 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 6546 6337 gene locus_tag LOCUS_12850 6546 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 8006 6702 gene locus_tag LOCUS_12860 8006 6702 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_12860 9249 11042 gene locus_tag LOCUS_12870 9249 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 11107 12276 gene locus_tag LOCUS_12880 11107 12276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_12880 14351 12639 gene locus_tag LOCUS_12890 14351 12639 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392591.1 protein_id gnl|my_center|LOCUS_12890 14886 14338 gene locus_tag LOCUS_12900 14886 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 15348 15614 gene locus_tag LOCUS_12910 15348 15614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 15933 17993 gene locus_tag LOCUS_12920 gene yagF 15933 17993 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_12920 18333 19346 gene locus_tag LOCUS_12930 18333 19346 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195337.1 protein_id gnl|my_center|LOCUS_12930 19528 20025 gene locus_tag LOCUS_12940 19528 20025 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_12940 21220 20057 gene locus_tag LOCUS_12950 21220 20057 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_12950 22039 21296 gene locus_tag LOCUS_12960 gene pdaB 22039 21296 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945995.1 protein_id gnl|my_center|LOCUS_12960 23598 22075 gene locus_tag LOCUS_12970 23598 22075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 23933 25618 gene locus_tag LOCUS_12980 23933 25618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 26586 25636 gene locus_tag LOCUS_12990 26586 25636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 26922 28418 gene locus_tag LOCUS_13000 26922 28418 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_13000 30692 28446 gene locus_tag LOCUS_13010 30692 28446 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944365.1 protein_id gnl|my_center|LOCUS_13010 30863 31981 gene locus_tag LOCUS_13020 30863 31981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 33106 32090 gene locus_tag LOCUS_13030 33106 32090 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_13030 33741 34565 gene locus_tag LOCUS_13040 33741 34565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 34698 35090 gene locus_tag LOCUS_13050 34698 35090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 35177 35935 gene locus_tag LOCUS_13060 35177 35935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 35932 36945 gene locus_tag LOCUS_13070 35932 36945 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_13070 37150 37413 gene locus_tag LOCUS_13080 37150 37413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 37406 39685 gene locus_tag LOCUS_13090 37406 39685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 40484 40023 gene locus_tag LOCUS_13100 40484 40023 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546098.1 protein_id gnl|my_center|LOCUS_13100 41778 40486 gene locus_tag LOCUS_13110 41778 40486 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_13110 43238 41970 gene locus_tag LOCUS_13120 43238 41970 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_13120 44097 43315 gene locus_tag LOCUS_13130 gene mtnP 44097 43315 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583293.1 protein_id gnl|my_center|LOCUS_13130 44631 44134 gene locus_tag LOCUS_13140 44631 44134 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229573.1 protein_id gnl|my_center|LOCUS_13140 45089 44634 gene locus_tag LOCUS_13150 gene ndk 45089 44634 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_13150 46504 45689 gene locus_tag LOCUS_13160 46504 45689 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929384.1 protein_id gnl|my_center|LOCUS_13160 47520 47113 gene locus_tag LOCUS_13170 gene mec 47520 47113 CDS product CysO-cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898830.1 protein_id gnl|my_center|LOCUS_13170 49043 47964 gene locus_tag LOCUS_13180 gene cysK 49043 47964 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_13180 50548 49043 gene locus_tag LOCUS_13190 gene moeB 50548 49043 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_13190 50753 50829 gene locus_tag LOCUS_t00120 50753 50829 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 51274 50915 gene locus_tag LOCUS_13200 51274 50915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 51422 52252 gene locus_tag LOCUS_13210 51422 52252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 52267 52467 gene locus_tag LOCUS_13220 52267 52467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence019 432 710 gene locus_tag LOCUS_13230 432 710 CDS product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393333.1 protein_id gnl|my_center|LOCUS_13230 1162 2415 gene locus_tag LOCUS_13240 1162 2415 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_13240 2572 3897 gene locus_tag LOCUS_13250 2572 3897 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 protein_id gnl|my_center|LOCUS_13250 4270 5001 gene locus_tag LOCUS_13260 4270 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 5700 6866 gene locus_tag LOCUS_13270 5700 6866 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392163.1 protein_id gnl|my_center|LOCUS_13270 6944 7663 gene locus_tag LOCUS_13280 6944 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 7757 8545 gene locus_tag LOCUS_13290 7757 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 9237 8929 gene locus_tag LOCUS_13300 9237 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 9268 10065 gene locus_tag LOCUS_13310 9268 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 10337 11176 gene locus_tag LOCUS_13320 10337 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 11569 12576 gene locus_tag LOCUS_13330 11569 12576 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030497.1 protein_id gnl|my_center|LOCUS_13330 13843 13007 gene locus_tag LOCUS_13340 13843 13007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 14417 14629 gene locus_tag LOCUS_13350 14417 14629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 14872 16290 gene locus_tag LOCUS_13360 14872 16290 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_13360 16356 17357 gene locus_tag LOCUS_13370 16356 17357 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555973.1 protein_id gnl|my_center|LOCUS_13370 17758 18303 gene locus_tag LOCUS_13380 17758 18303 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_13380 19677 18436 gene locus_tag LOCUS_13390 19677 18436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 20582 19803 gene locus_tag LOCUS_13400 20582 19803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 21298 20972 gene locus_tag LOCUS_13410 21298 20972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 23492 21621 gene locus_tag LOCUS_13420 gene ctaD 23492 21621 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232245.1 protein_id gnl|my_center|LOCUS_13420 24705 23641 gene locus_tag LOCUS_13430 gene coxB 24705 23641 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745268.1 protein_id gnl|my_center|LOCUS_13430 25231 25055 gene locus_tag LOCUS_13440 25231 25055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 25891 25670 gene locus_tag LOCUS_13450 25891 25670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 25905 26237 gene locus_tag LOCUS_13460 25905 26237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 26393 27379 gene locus_tag LOCUS_13470 gene trpS 26393 27379 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111973.1 protein_id gnl|my_center|LOCUS_13470 28372 27827 gene locus_tag LOCUS_13480 28372 27827 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583077.1 protein_id gnl|my_center|LOCUS_13480 28731 28432 gene locus_tag LOCUS_13490 28731 28432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 29403 29149 gene locus_tag LOCUS_13500 29403 29149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 29521 30624 gene locus_tag LOCUS_13510 29521 30624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 30805 33201 gene locus_tag LOCUS_13520 gene pcrA 30805 33201 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_13520 33305 35329 gene locus_tag LOCUS_13530 gene ligA 33305 35329 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_13530 35492 35851 gene locus_tag LOCUS_13540 35492 35851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 35870 36169 gene locus_tag LOCUS_13550 35870 36169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 36294 37898 gene locus_tag LOCUS_13560 gene gatA 36294 37898 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_13560 38128 39678 gene locus_tag LOCUS_13570 gene gatB 38128 39678 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_13570 39870 40808 gene locus_tag LOCUS_13580 39870 40808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_13580 40801 41532 gene locus_tag LOCUS_13590 40801 41532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 41723 41541 gene locus_tag LOCUS_13600 41723 41541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 42096 42539 gene locus_tag LOCUS_13610 42096 42539 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_13610 43501 42623 gene locus_tag LOCUS_13620 gene thyX 43501 42623 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390602.1 protein_id gnl|my_center|LOCUS_13620 44045 43638 gene locus_tag LOCUS_13630 44045 43638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 44633 44157 gene locus_tag LOCUS_13640 44633 44157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 45088 44795 gene locus_tag LOCUS_13650 45088 44795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 45236 45700 gene locus_tag LOCUS_13660 gene trmL 45236 45700 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_13660 45974 45771 gene locus_tag LOCUS_13670 45974 45771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 45927 47270 gene locus_tag LOCUS_13680 gene rlmD 45927 47270 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722228.1 protein_id gnl|my_center|LOCUS_13680 47657 47433 gene locus_tag LOCUS_13690 47657 47433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 47772 48881 gene locus_tag LOCUS_13700 47772 48881 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461739.1 protein_id gnl|my_center|LOCUS_13700 49573 49031 gene locus_tag LOCUS_13710 49573 49031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 50123 49842 gene locus_tag LOCUS_13720 50123 49842 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_13720 51558 50548 gene locus_tag LOCUS_13730 51558 50548 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence020 179 625 gene locus_tag LOCUS_13740 gene queF 179 625 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_13740 1895 912 gene locus_tag LOCUS_13750 1895 912 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_13750 2843 1929 gene locus_tag LOCUS_13760 gene truB 2843 1929 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392567.1 protein_id gnl|my_center|LOCUS_13760 3922 2840 gene locus_tag LOCUS_13770 3922 2840 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_13770 4405 3974 gene locus_tag LOCUS_13780 4405 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 7778 4716 gene locus_tag LOCUS_13790 7778 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 9223 8822 gene locus_tag LOCUS_13800 9223 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 10529 9279 gene locus_tag LOCUS_13810 10529 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 11111 10593 gene locus_tag LOCUS_13820 11111 10593 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_13820 12758 11301 gene locus_tag LOCUS_13830 12758 11301 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_13830 14101 13127 gene locus_tag LOCUS_13840 14101 13127 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550371.1 protein_id gnl|my_center|LOCUS_13840 14261 15133 gene locus_tag LOCUS_13850 gene larE 14261 15133 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_13850 16564 15146 gene locus_tag LOCUS_13860 16564 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 17435 16671 gene locus_tag LOCUS_13870 gene larB 17435 16671 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392116.1 protein_id gnl|my_center|LOCUS_13870 18879 17770 gene locus_tag LOCUS_13880 18879 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 20640 18991 gene locus_tag LOCUS_13890 20640 18991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 20955 20656 gene locus_tag LOCUS_13900 20955 20656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 21351 21133 gene locus_tag LOCUS_13910 21351 21133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 21305 22300 gene locus_tag LOCUS_13920 21305 22300 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_13920 22436 23845 gene locus_tag LOCUS_13930 22436 23845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 23955 24374 gene locus_tag LOCUS_13940 gene gloA 23955 24374 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_13940 24576 25937 gene locus_tag LOCUS_13950 24576 25937 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_13950 27403 26036 gene locus_tag LOCUS_13960 27403 26036 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804122.1 protein_id gnl|my_center|LOCUS_13960 29605 27584 gene locus_tag LOCUS_13970 29605 27584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 29604 31184 gene locus_tag LOCUS_13980 29604 31184 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_13980 31181 32383 gene locus_tag LOCUS_13990 31181 32383 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393536.1 protein_id gnl|my_center|LOCUS_13990 32380 33564 gene locus_tag LOCUS_14000 32380 33564 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392970.1 protein_id gnl|my_center|LOCUS_14000 33540 33794 gene locus_tag LOCUS_14010 33540 33794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 34144 35691 gene locus_tag LOCUS_14020 34144 35691 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726950.1 protein_id gnl|my_center|LOCUS_14020 35832 36641 gene locus_tag LOCUS_14030 35832 36641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 36799 37764 gene locus_tag LOCUS_14040 36799 37764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 37826 38668 gene locus_tag LOCUS_14050 37826 38668 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082680.1 protein_id gnl|my_center|LOCUS_14050 39332 38883 gene locus_tag LOCUS_14060 39332 38883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 40906 39362 gene locus_tag LOCUS_14070 40906 39362 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272520.1 protein_id gnl|my_center|LOCUS_14070 42384 40903 gene locus_tag LOCUS_14080 42384 40903 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460862.1 protein_id gnl|my_center|LOCUS_14080 43029 42388 gene locus_tag LOCUS_14090 43029 42388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 43952 43026 gene locus_tag LOCUS_14100 43952 43026 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_14100 45973 43973 gene locus_tag LOCUS_14110 gene hyfB 45973 43973 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816729.1 protein_id gnl|my_center|LOCUS_14110 46401 45970 gene locus_tag LOCUS_14120 46401 45970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 46982 48187 gene locus_tag LOCUS_14130 46982 48187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 48687 50144 gene locus_tag LOCUS_14140 48687 50144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 50233 51231 gene locus_tag LOCUS_14150 50233 51231 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence021 8684 8343 gene locus_tag LOCUS_14160 8684 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 11818 8963 gene locus_tag LOCUS_14170 11818 8963 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031478.1 protein_id gnl|my_center|LOCUS_14170 14260 12515 gene locus_tag LOCUS_14180 14260 12515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 14672 14232 gene locus_tag LOCUS_14190 14672 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 14987 14694 gene locus_tag LOCUS_14200 14987 14694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 15871 16710 gene locus_tag LOCUS_14210 15871 16710 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_14210 17146 17922 gene locus_tag LOCUS_14220 17146 17922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 17979 19178 gene locus_tag LOCUS_14230 17979 19178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 19883 19527 gene locus_tag LOCUS_14240 19883 19527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 20412 19966 gene locus_tag LOCUS_14250 20412 19966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 20783 21421 gene locus_tag LOCUS_14260 20783 21421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 21418 22875 gene locus_tag LOCUS_14270 21418 22875 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081159250.1 protein_id gnl|my_center|LOCUS_14270 23287 24981 gene locus_tag LOCUS_14280 23287 24981 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803788.1 protein_id gnl|my_center|LOCUS_14280 25061 26863 gene locus_tag LOCUS_14290 25061 26863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 27978 27091 gene locus_tag LOCUS_14300 gene cysL 27978 27091 CDS product cysJI operon transcriptional regulator CysL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243173.1 protein_id gnl|my_center|LOCUS_14300 28428 29822 gene locus_tag LOCUS_14310 28428 29822 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081159250.1 protein_id gnl|my_center|LOCUS_14310 30575 30372 gene locus_tag LOCUS_14320 30575 30372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 30574 32022 gene locus_tag LOCUS_14330 gene betC 30574 32022 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_14330 32026 33387 gene locus_tag LOCUS_14340 32026 33387 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_14340 33441 33908 gene locus_tag LOCUS_14350 33441 33908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 33923 35323 gene locus_tag LOCUS_14360 33923 35323 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 protein_id gnl|my_center|LOCUS_14360 35780 37162 gene locus_tag LOCUS_14370 35780 37162 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_14370 37917 39380 gene locus_tag LOCUS_14380 37917 39380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 40723 40088 gene locus_tag LOCUS_14390 40723 40088 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970960.1 protein_id gnl|my_center|LOCUS_14390 41298 40750 gene locus_tag LOCUS_14400 41298 40750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 41486 41827 gene locus_tag LOCUS_14410 41486 41827 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_14410 42755 45079 gene locus_tag LOCUS_14420 42755 45079 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_14420 45295 46809 gene locus_tag LOCUS_14430 45295 46809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 46820 47146 gene locus_tag LOCUS_14440 46820 47146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 47624 47253 gene locus_tag LOCUS_14450 47624 47253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 48041 47640 gene locus_tag LOCUS_14460 48041 47640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence022 494 1852 gene locus_tag LOCUS_14470 gene accC 494 1852 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_14470 2121 2894 gene locus_tag LOCUS_14480 2121 2894 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922035.1 protein_id gnl|my_center|LOCUS_14480 3594 2848 gene locus_tag LOCUS_14490 3594 2848 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591230.1 protein_id gnl|my_center|LOCUS_14490 4600 4136 gene locus_tag LOCUS_14500 gene rpsI 4600 4136 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_14500 5045 4590 gene locus_tag LOCUS_14510 gene rplM 5045 4590 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_14510 6167 5340 gene locus_tag LOCUS_14520 gene truA 6167 5340 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_14520 7015 6209 gene locus_tag LOCUS_14530 7015 6209 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_14530 8913 7000 gene locus_tag LOCUS_14540 8913 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 9335 8997 gene locus_tag LOCUS_14550 gene rplQ 9335 8997 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393907.1 protein_id gnl|my_center|LOCUS_14550 10429 9482 gene locus_tag LOCUS_14560 10429 9482 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_14560 11343 10714 gene locus_tag LOCUS_14570 gene rpsD 11343 10714 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459108.1 protein_id gnl|my_center|LOCUS_14570 11820 11422 gene locus_tag LOCUS_14580 gene rpsK 11820 11422 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393910.1 protein_id gnl|my_center|LOCUS_14580 12329 11958 gene locus_tag LOCUS_14590 gene rpsM 12329 11958 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_14590 12811 12539 gene locus_tag LOCUS_14600 gene infA 12811 12539 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258253.1 protein_id gnl|my_center|LOCUS_14600 13161 12808 gene locus_tag LOCUS_14610 13161 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 14338 13529 gene locus_tag LOCUS_14620 gene map 14338 13529 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_14620 15002 14325 gene locus_tag LOCUS_14630 15002 14325 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393916.1 protein_id gnl|my_center|LOCUS_14630 16331 15057 gene locus_tag LOCUS_14640 gene secY 16331 15057 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_14640 16949 16458 gene locus_tag LOCUS_14650 16949 16458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 17571 17062 gene locus_tag LOCUS_14660 gene rpsE 17571 17062 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_14660 17972 17613 gene locus_tag LOCUS_14670 gene rplR 17972 17613 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_14670 18590 18051 gene locus_tag LOCUS_14680 gene rplF 18590 18051 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_14680 19148 18756 gene locus_tag LOCUS_14690 gene rpsH 19148 18756 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_14690 20065 19520 gene locus_tag LOCUS_14700 gene rplE 20065 19520 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_14700 20506 20150 gene locus_tag LOCUS_14710 gene rplX 20506 20150 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_14710 20941 20573 gene locus_tag LOCUS_14720 gene rplN 20941 20573 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814521.1 protein_id gnl|my_center|LOCUS_14720 21214 20948 gene locus_tag LOCUS_14730 gene rpsQ 21214 20948 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_14730 21428 21240 gene locus_tag LOCUS_14740 gene rpmC 21428 21240 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357691.1 protein_id gnl|my_center|LOCUS_14740 21850 21425 gene locus_tag LOCUS_14750 gene rplP 21850 21425 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_14750 22753 21962 gene locus_tag LOCUS_14760 gene rpsC 22753 21962 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810152.1 protein_id gnl|my_center|LOCUS_14760 23132 22728 gene locus_tag LOCUS_14770 23132 22728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 23504 23220 gene locus_tag LOCUS_14780 gene rpsS 23504 23220 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_14780 24380 23553 gene locus_tag LOCUS_14790 gene rplB 24380 23553 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_14790 24995 24708 gene locus_tag LOCUS_14800 gene rplW 24995 24708 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393935.1 protein_id gnl|my_center|LOCUS_14800 25621 24992 gene locus_tag LOCUS_14810 gene rplD 25621 24992 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_14810 26356 25679 gene locus_tag LOCUS_14820 gene rplC 26356 25679 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393937.1 protein_id gnl|my_center|LOCUS_14820 26771 26463 gene locus_tag LOCUS_14830 gene rpsJ 26771 26463 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_14830 27983 26784 gene locus_tag LOCUS_14840 gene tuf 27983 26784 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_14840 28488 29717 gene locus_tag LOCUS_14850 28488 29717 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459993.1 protein_id gnl|my_center|LOCUS_14850 29714 31102 gene locus_tag LOCUS_14860 29714 31102 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494345.1 protein_id gnl|my_center|LOCUS_14860 31392 31213 gene locus_tag LOCUS_14870 31392 31213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 31363 31809 gene locus_tag LOCUS_14880 31363 31809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 32068 32571 gene locus_tag LOCUS_14890 32068 32571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 32568 34202 gene locus_tag LOCUS_14900 32568 34202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 34465 35166 gene locus_tag LOCUS_14910 34465 35166 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_14910 36828 35566 gene locus_tag LOCUS_14920 gene purD 36828 35566 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388404.1 protein_id gnl|my_center|LOCUS_14920 37554 36955 gene locus_tag LOCUS_14930 gene purN 37554 36955 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 protein_id gnl|my_center|LOCUS_14930 38585 37551 gene locus_tag LOCUS_14940 gene purM 38585 37551 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057648.1 protein_id gnl|my_center|LOCUS_14940 40203 38578 gene locus_tag LOCUS_14950 gene purF 40203 38578 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989807.1 protein_id gnl|my_center|LOCUS_14950 42479 40191 gene locus_tag LOCUS_14960 gene purL 42479 40191 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_14960 43203 42493 gene locus_tag LOCUS_14970 gene purQ 43203 42493 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_14970 43624 43367 gene locus_tag LOCUS_14980 gene purS 43624 43367 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393546.1 protein_id gnl|my_center|LOCUS_14980 45143 43833 gene locus_tag LOCUS_14990 gene purB 45143 43833 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140047.1 protein_id gnl|my_center|LOCUS_14990 45331 45543 gene locus_tag LOCUS_15000 45331 45543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 47071 45506 gene locus_tag LOCUS_15010 gene guaA 47071 45506 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_15010 47781 47266 gene locus_tag LOCUS_15020 gene hpt 47781 47266 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869595.1 protein_id gnl|my_center|LOCUS_15020 47686 47880 gene locus_tag LOCUS_15030 47686 47880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence023 1435 1686 gene locus_tag LOCUS_15040 1435 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1683 3752 gene locus_tag LOCUS_15050 1683 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 4645 4100 gene locus_tag LOCUS_15060 gene mug 4645 4100 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228937.1 protein_id gnl|my_center|LOCUS_15060 5628 4642 gene locus_tag LOCUS_15070 gene hemB 5628 4642 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_15070 7465 5621 gene locus_tag LOCUS_15080 gene cobA 7465 5621 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_15080 8433 7465 gene locus_tag LOCUS_15090 gene hemC 8433 7465 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 protein_id gnl|my_center|LOCUS_15090 9116 8430 gene locus_tag LOCUS_15100 9116 8430 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256584.1 protein_id gnl|my_center|LOCUS_15100 10572 9238 gene locus_tag LOCUS_15110 gene hemA 10572 9238 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 protein_id gnl|my_center|LOCUS_15110 11590 10748 gene locus_tag LOCUS_15120 gene ubiE 11590 10748 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392794.1 protein_id gnl|my_center|LOCUS_15120 11989 12609 gene locus_tag LOCUS_15130 11989 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 12696 13526 gene locus_tag LOCUS_15140 12696 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 13826 16285 gene locus_tag LOCUS_15150 13826 16285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 17455 16448 gene locus_tag LOCUS_15160 gene murB 17455 16448 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_15160 18696 17452 gene locus_tag LOCUS_15170 gene murG 18696 17452 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_15170 20063 18960 gene locus_tag LOCUS_15180 gene spoVE 20063 18960 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_15180 21261 20290 gene locus_tag LOCUS_15190 gene mraY 21261 20290 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392359.1 protein_id gnl|my_center|LOCUS_15190 22771 21311 gene locus_tag LOCUS_15200 22771 21311 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_15200 24297 22768 gene locus_tag LOCUS_15210 24297 22768 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_15210 26538 24418 gene locus_tag LOCUS_15220 26538 24418 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_15220 27385 26822 gene locus_tag LOCUS_15230 27385 26822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 28823 27396 gene locus_tag LOCUS_15240 28823 27396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 29308 28871 gene locus_tag LOCUS_15250 gene mraZ 29308 28871 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_15250 30042 30117 gene locus_tag LOCUS_t00130 30042 30117 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 30287 31369 gene locus_tag LOCUS_15260 30287 31369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 33929 32199 gene locus_tag LOCUS_15270 gene ilvB 33929 32199 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393741.1 protein_id gnl|my_center|LOCUS_15270 35031 34159 gene locus_tag LOCUS_15280 gene ilvE 35031 34159 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_15280 36307 35123 gene locus_tag LOCUS_15290 gene leuB 36307 35123 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143540.1 protein_id gnl|my_center|LOCUS_15290 37363 36800 gene locus_tag LOCUS_15300 37363 36800 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037855.1 protein_id gnl|my_center|LOCUS_15300 37498 37926 gene locus_tag LOCUS_15310 37498 37926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 38355 39044 gene locus_tag LOCUS_15320 38355 39044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 40110 39325 gene locus_tag LOCUS_15330 gene fabL 40110 39325 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723876.1 protein_id gnl|my_center|LOCUS_15330 40240 40731 gene locus_tag LOCUS_15340 40240 40731 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_15340 43068 41008 gene locus_tag LOCUS_15350 43068 41008 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036147.1 protein_id gnl|my_center|LOCUS_15350 43656 43300 gene locus_tag LOCUS_15360 43656 43300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 43655 46711 gene locus_tag LOCUS_15370 gene aroA 43655 46711 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152273703.1 protein_id gnl|my_center|LOCUS_15370 46821 47960 gene locus_tag LOCUS_15380 46821 47960 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727137.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence024 1139 180 gene locus_tag LOCUS_15390 1139 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1730 1329 gene locus_tag LOCUS_15400 1730 1329 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014828146.1 protein_id gnl|my_center|LOCUS_15400 2484 2218 gene locus_tag LOCUS_15410 2484 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2656 3336 gene locus_tag LOCUS_15420 gene rpiA 2656 3336 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140034.1 protein_id gnl|my_center|LOCUS_15420 3485 3306 gene locus_tag LOCUS_15430 3485 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 4424 3633 gene locus_tag LOCUS_15440 gene hpaI 4424 3633 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_15440 5529 4531 gene locus_tag LOCUS_15450 5529 4531 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_15450 6206 7234 gene locus_tag LOCUS_15460 6206 7234 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_15460 7238 8008 gene locus_tag LOCUS_15470 7238 8008 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137082021.1 protein_id gnl|my_center|LOCUS_15470 8121 10814 gene locus_tag LOCUS_15480 8121 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 11496 13190 gene locus_tag LOCUS_15490 11496 13190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 13920 13435 gene locus_tag LOCUS_15500 13920 13435 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_15500 15209 14292 gene locus_tag LOCUS_15510 15209 14292 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039795.1 protein_id gnl|my_center|LOCUS_15510 17399 15576 gene locus_tag LOCUS_15520 17399 15576 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_15520 17825 19924 gene locus_tag LOCUS_15530 17825 19924 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391758.1 protein_id gnl|my_center|LOCUS_15530 19960 21129 gene locus_tag LOCUS_15540 gene csaB 19960 21129 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886807.1 protein_id gnl|my_center|LOCUS_15540 21260 22069 gene locus_tag LOCUS_15550 gene ftsE 21260 22069 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985455.1 protein_id gnl|my_center|LOCUS_15550 22653 23699 gene locus_tag LOCUS_15560 22653 23699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 23842 25167 gene locus_tag LOCUS_15570 23842 25167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 25505 25759 gene locus_tag LOCUS_15580 25505 25759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 25774 25986 gene locus_tag LOCUS_15590 25774 25986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 26076 26231 gene locus_tag LOCUS_15600 26076 26231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 26388 27809 gene locus_tag LOCUS_15610 26388 27809 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_15610 28269 28066 gene locus_tag LOCUS_15620 28269 28066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 28484 28272 gene locus_tag LOCUS_15630 28484 28272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 28383 29234 gene locus_tag LOCUS_15640 28383 29234 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349500.1 protein_id gnl|my_center|LOCUS_15640 29650 30723 gene locus_tag LOCUS_15650 29650 30723 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_15650 30972 30778 gene locus_tag LOCUS_15660 30972 30778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 31363 33141 gene locus_tag LOCUS_15670 31363 33141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 33350 33955 gene locus_tag LOCUS_15680 33350 33955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 34568 33897 gene locus_tag LOCUS_15690 34568 33897 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_15690 34635 34904 gene locus_tag LOCUS_15700 34635 34904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 35002 37110 gene locus_tag LOCUS_15710 gene uvrB 35002 37110 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_15710 37912 37484 gene locus_tag LOCUS_15720 37912 37484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 38405 39193 gene locus_tag LOCUS_15730 38405 39193 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979881.1 protein_id gnl|my_center|LOCUS_15730 39894 39367 gene locus_tag LOCUS_15740 39894 39367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 40431 42314 gene locus_tag LOCUS_15750 40431 42314 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272653.1 protein_id gnl|my_center|LOCUS_15750 42489 43883 gene locus_tag LOCUS_15760 42489 43883 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108982.1 protein_id gnl|my_center|LOCUS_15760 43939 45333 gene locus_tag LOCUS_15770 43939 45333 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_15770 46791 45424 gene locus_tag LOCUS_15780 46791 45424 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542382.1 protein_id gnl|my_center|LOCUS_15780 47494 47210 gene locus_tag LOCUS_15790 47494 47210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15790 >Feature sequence025 482 243 gene locus_tag LOCUS_15800 482 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1523 531 gene locus_tag LOCUS_15810 1523 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1966 2265 gene locus_tag LOCUS_15820 1966 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2343 3779 gene locus_tag LOCUS_15830 2343 3779 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092177.1 protein_id gnl|my_center|LOCUS_15830 4022 7708 gene locus_tag LOCUS_15840 4022 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 8342 9544 gene locus_tag LOCUS_15850 gene wlbA 8342 9544 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_15850 10880 12223 gene locus_tag LOCUS_15860 10880 12223 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 protein_id gnl|my_center|LOCUS_15860 13826 12756 gene locus_tag LOCUS_15870 gene eltD 13826 12756 CDS product erythritol/L-threitol dehyrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728938.1 protein_id gnl|my_center|LOCUS_15870 15543 14128 gene locus_tag LOCUS_15880 15543 14128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 17406 15952 gene locus_tag LOCUS_15890 gene betC 17406 15952 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768150.1 protein_id gnl|my_center|LOCUS_15890 19019 17577 gene locus_tag LOCUS_15900 19019 17577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 20596 19370 gene locus_tag LOCUS_15910 20596 19370 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_15910 22215 20773 gene locus_tag LOCUS_15920 22215 20773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 23348 22374 gene locus_tag LOCUS_15930 23348 22374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 23860 23345 gene locus_tag LOCUS_15940 23860 23345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 24533 23949 gene locus_tag LOCUS_15950 24533 23949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15950 25166 24660 gene locus_tag LOCUS_15960 25166 24660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15960 25326 25736 gene locus_tag LOCUS_15970 25326 25736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 25848 26198 gene locus_tag LOCUS_15980 25848 26198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 34201 26093 gene locus_tag LOCUS_15990 34201 26093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 36451 35762 gene locus_tag LOCUS_16000 36451 35762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 36902 38353 gene locus_tag LOCUS_16010 36902 38353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 38408 39448 gene locus_tag LOCUS_16020 38408 39448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 39586 40368 gene locus_tag LOCUS_16030 39586 40368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 41597 40707 gene locus_tag LOCUS_16040 41597 40707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 43282 41879 gene locus_tag LOCUS_16050 43282 41879 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_16050 44329 43322 gene locus_tag LOCUS_16060 44329 43322 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence026 <1 1687 gene locus_tag LOCUS_16070 <1 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259000.1:aconitate hydratase AcnA 2199 3677 gene locus_tag LOCUS_16080 2199 3677 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_16080 3807 4598 gene locus_tag LOCUS_16090 3807 4598 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_16090 5950 4694 gene locus_tag LOCUS_16100 5950 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 6296 6748 gene locus_tag LOCUS_16110 6296 6748 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_16110 6873 7964 gene locus_tag LOCUS_16120 gene nifS 6873 7964 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_16120 8033 9151 gene locus_tag LOCUS_16130 gene mnmA 8033 9151 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256566.1 protein_id gnl|my_center|LOCUS_16130 10031 9177 gene locus_tag LOCUS_16140 10031 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 10387 11205 gene locus_tag LOCUS_16150 10387 11205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 11517 12605 gene locus_tag LOCUS_16160 gene spoIIIAA 11517 12605 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393045.1 protein_id gnl|my_center|LOCUS_16160 12590 13117 gene locus_tag LOCUS_16170 12590 13117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 13171 13371 gene locus_tag LOCUS_16180 gene spoIIIAC 13171 13371 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153142.1 protein_id gnl|my_center|LOCUS_16180 13406 13792 gene locus_tag LOCUS_16190 gene spoIIIAD 13406 13792 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810912.1 protein_id gnl|my_center|LOCUS_16190 13840 15177 gene locus_tag LOCUS_16200 gene spoIIIAE 13840 15177 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393041.1 protein_id gnl|my_center|LOCUS_16200 15348 15794 gene locus_tag LOCUS_16210 15348 15794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 15822 16523 gene locus_tag LOCUS_16220 15822 16523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 16549 17178 gene locus_tag LOCUS_16230 16549 17178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 17555 17959 gene locus_tag LOCUS_16240 17555 17959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 18077 18607 gene locus_tag LOCUS_16250 18077 18607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 18686 18913 gene locus_tag LOCUS_16260 18686 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 18981 19358 gene locus_tag LOCUS_16270 gene nusB 18981 19358 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393030.1 protein_id gnl|my_center|LOCUS_16270 19493 20743 gene locus_tag LOCUS_16280 gene xseA 19493 20743 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_16280 20796 21131 gene locus_tag LOCUS_16290 20796 21131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 21128 22015 gene locus_tag LOCUS_16300 21128 22015 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529224.1 protein_id gnl|my_center|LOCUS_16300 23074 23652 gene locus_tag LOCUS_16310 23074 23652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 23798 25717 gene locus_tag LOCUS_16320 gene dxs 23798 25717 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_16320 25719 26543 gene locus_tag LOCUS_16330 25719 26543 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_16330 26643 27536 gene locus_tag LOCUS_16340 26643 27536 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_16340 27723 30122 gene locus_tag LOCUS_16350 27723 30122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 30475 32073 gene locus_tag LOCUS_16360 30475 32073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 32070 33056 gene locus_tag LOCUS_16370 gene secF 32070 33056 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_16370 33339 34034 gene locus_tag LOCUS_16380 33339 34034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 34187 34753 gene locus_tag LOCUS_16390 gene fapR 34187 34753 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774378.1 protein_id gnl|my_center|LOCUS_16390 34897 35916 gene locus_tag LOCUS_16400 gene plsX 34897 35916 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_16400 35906 37030 gene locus_tag LOCUS_16410 35906 37030 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_16410 37083 38045 gene locus_tag LOCUS_16420 gene fabD 37083 38045 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_16420 38150 38896 gene locus_tag LOCUS_16430 gene fabG 38150 38896 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_16430 39031 39270 gene locus_tag LOCUS_16440 gene acpP 39031 39270 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_16440 39462 40700 gene locus_tag LOCUS_16450 gene fabF 39462 40700 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence027 523 1731 gene locus_tag LOCUS_16460 523 1731 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 protein_id gnl|my_center|LOCUS_16460 1728 1925 gene locus_tag LOCUS_16470 1728 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2095 3381 gene locus_tag LOCUS_16480 2095 3381 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_16480 3439 4155 gene locus_tag LOCUS_16490 3439 4155 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_16490 4155 5144 gene locus_tag LOCUS_16500 4155 5144 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764768.1 protein_id gnl|my_center|LOCUS_16500 6281 5145 gene locus_tag LOCUS_16510 6281 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 6908 8482 gene locus_tag LOCUS_16520 6908 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 8673 8759 gene locus_tag LOCUS_t00140 8673 8759 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8774 8848 gene locus_tag LOCUS_t00150 8774 8848 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9320 9673 gene locus_tag LOCUS_16530 9320 9673 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_16530 9670 10179 gene locus_tag LOCUS_16540 9670 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 10172 10771 gene locus_tag LOCUS_16550 10172 10771 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337546.1 protein_id gnl|my_center|LOCUS_16550 10960 12126 gene locus_tag LOCUS_16560 gene nuoD 10960 12126 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_16560 12126 12596 gene locus_tag LOCUS_16570 12126 12596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 12593 13882 gene locus_tag LOCUS_16580 gene nuoF 12593 13882 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969255.1 protein_id gnl|my_center|LOCUS_16580 13879 16239 gene locus_tag LOCUS_16590 13879 16239 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222458.1 protein_id gnl|my_center|LOCUS_16590 16236 17228 gene locus_tag LOCUS_16600 gene nuoH 16236 17228 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_16600 17228 17740 gene locus_tag LOCUS_16610 gene nuoI 17228 17740 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888136.1 protein_id gnl|my_center|LOCUS_16610 17737 18357 gene locus_tag LOCUS_16620 17737 18357 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_16620 18357 18662 gene locus_tag LOCUS_16630 gene nuoK 18357 18662 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_16630 18780 20621 gene locus_tag LOCUS_16640 gene nuoL 18780 20621 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110664.1 protein_id gnl|my_center|LOCUS_16640 20808 22277 gene locus_tag LOCUS_16650 20808 22277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 22278 23675 gene locus_tag LOCUS_16660 22278 23675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 23961 25313 gene locus_tag LOCUS_16670 gene tig 23961 25313 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_16670 25310 25966 gene locus_tag LOCUS_16680 gene clpP 25310 25966 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_16680 25963 27417 gene locus_tag LOCUS_16690 gene clpX 25963 27417 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_16690 28071 29846 gene locus_tag LOCUS_16700 gene lonB 28071 29846 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392067.1 protein_id gnl|my_center|LOCUS_16700 30181 32916 gene locus_tag LOCUS_16710 gene lon 30181 32916 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_16710 33057 33806 gene locus_tag LOCUS_16720 33057 33806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 33936 35165 gene locus_tag LOCUS_16730 33936 35165 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886605.1 protein_id gnl|my_center|LOCUS_16730 35461 35542 gene locus_tag LOCUS_t00160 35461 35542 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 35765 36766 gene locus_tag LOCUS_16740 35765 36766 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207603918.1 protein_id gnl|my_center|LOCUS_16740 36957 37568 gene locus_tag LOCUS_16750 36957 37568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 38051 37923 gene locus_tag LOCUS_16760 38051 37923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 38162 38605 gene locus_tag LOCUS_16770 38162 38605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence028 1628 183 gene locus_tag LOCUS_16780 1628 183 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108631.1 protein_id gnl|my_center|LOCUS_16780 3574 1727 gene locus_tag LOCUS_16790 3574 1727 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971639.1 protein_id gnl|my_center|LOCUS_16790 5742 4309 gene locus_tag LOCUS_16800 5742 4309 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_16800 7612 6122 gene locus_tag LOCUS_16810 7612 6122 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108631.1 protein_id gnl|my_center|LOCUS_16810 8399 9823 gene locus_tag LOCUS_16820 8399 9823 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_16820 11514 10009 gene locus_tag LOCUS_16830 11514 10009 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083258.1 protein_id gnl|my_center|LOCUS_16830 12980 11556 gene locus_tag LOCUS_16840 gene betC 12980 11556 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768150.1 protein_id gnl|my_center|LOCUS_16840 13342 14223 gene locus_tag LOCUS_16850 13342 14223 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529656.1 protein_id gnl|my_center|LOCUS_16850 15800 14343 gene locus_tag LOCUS_16860 15800 14343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 17614 15932 gene locus_tag LOCUS_16870 17614 15932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 20322 18727 gene locus_tag LOCUS_16880 20322 18727 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 protein_id gnl|my_center|LOCUS_16880 20726 20508 gene locus_tag LOCUS_16890 20726 20508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 21974 21276 gene locus_tag LOCUS_16900 21974 21276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 23824 22661 gene locus_tag LOCUS_16910 23824 22661 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_16910 24172 23999 gene locus_tag LOCUS_16920 24172 23999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 26026 24671 gene locus_tag LOCUS_16930 26026 24671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 29367 26164 gene locus_tag LOCUS_16940 29367 26164 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537777.1 protein_id gnl|my_center|LOCUS_16940 31489 29453 gene locus_tag LOCUS_16950 31489 29453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 31947 32360 gene locus_tag LOCUS_16960 31947 32360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 32899 34107 gene locus_tag LOCUS_16970 32899 34107 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529507.1 protein_id gnl|my_center|LOCUS_16970 35616 34171 gene locus_tag LOCUS_16980 35616 34171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 36035 37096 gene locus_tag LOCUS_16990 36035 37096 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_16990 37359 37054 gene locus_tag LOCUS_17000 37359 37054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 38782 37343 gene locus_tag LOCUS_17010 38782 37343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 39198 38935 gene locus_tag LOCUS_17020 39198 38935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence029 763 533 gene locus_tag LOCUS_17030 763 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2102 969 gene locus_tag LOCUS_17040 2102 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2481 2065 gene locus_tag LOCUS_17050 2481 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2946 3509 gene locus_tag LOCUS_17060 2946 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 4694 3750 gene locus_tag LOCUS_17070 4694 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 4883 5398 gene locus_tag LOCUS_17080 4883 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 6084 7910 gene locus_tag LOCUS_17090 6084 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 8320 8853 gene locus_tag LOCUS_17100 8320 8853 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_17100 9123 10007 gene locus_tag LOCUS_17110 9123 10007 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_17110 10467 11516 gene locus_tag LOCUS_17120 10467 11516 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_17120 11838 12995 gene locus_tag LOCUS_17130 gene aroC 11838 12995 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768335.1 protein_id gnl|my_center|LOCUS_17130 13034 13648 gene locus_tag LOCUS_17140 13034 13648 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175815.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17140 13611 14777 gene locus_tag LOCUS_17150 gene aroB 13611 14777 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_17150 16086 14854 gene locus_tag LOCUS_17160 gene dltB 16086 14854 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127959.1 protein_id gnl|my_center|LOCUS_17160 17726 16083 gene locus_tag LOCUS_17170 gene dltA 17726 16083 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770505.1 protein_id gnl|my_center|LOCUS_17170 18013 17834 gene locus_tag LOCUS_17180 18013 17834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 18311 18054 gene locus_tag LOCUS_17190 gene dltC 18311 18054 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356389.1 protein_id gnl|my_center|LOCUS_17190 18545 19675 gene locus_tag LOCUS_17200 gene gcvT 18545 19675 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393443.1 protein_id gnl|my_center|LOCUS_17200 19672 20052 gene locus_tag LOCUS_17210 gene gcvH 19672 20052 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223709.1 protein_id gnl|my_center|LOCUS_17210 20055 21389 gene locus_tag LOCUS_17220 gene gcvPA 20055 21389 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_17220 21382 22860 gene locus_tag LOCUS_17230 gene gcvPB 21382 22860 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_17230 23005 24204 gene locus_tag LOCUS_17240 gene tyrS 23005 24204 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_17240 25348 24398 gene locus_tag LOCUS_17250 25348 24398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 25804 26724 gene locus_tag LOCUS_17260 25804 26724 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061072.1 protein_id gnl|my_center|LOCUS_17260 26897 27655 gene locus_tag LOCUS_17270 26897 27655 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460362.1 protein_id gnl|my_center|LOCUS_17270 27923 28546 gene locus_tag LOCUS_17280 27923 28546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 28743 29561 gene locus_tag LOCUS_17290 28743 29561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 29558 30160 gene locus_tag LOCUS_17300 gene ruvA 29558 30160 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227122.1 protein_id gnl|my_center|LOCUS_17300 30257 31312 gene locus_tag LOCUS_17310 gene ruvB 30257 31312 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_17310 31532 32278 gene locus_tag LOCUS_17320 gene sigI 31532 32278 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498572.1 protein_id gnl|my_center|LOCUS_17320 32371 33975 gene locus_tag LOCUS_17330 32371 33975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 34026 34337 gene locus_tag LOCUS_17340 34026 34337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 34324 35412 gene locus_tag LOCUS_17350 gene queA 34324 35412 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_17350 35527 36885 gene locus_tag LOCUS_17360 35527 36885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 36939 37472 gene locus_tag LOCUS_17370 36939 37472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence030 97 21 gene locus_tag LOCUS_t00170 97 21 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 620 261 gene locus_tag LOCUS_17380 620 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 977 901 gene locus_tag LOCUS_t00180 977 901 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3035 1788 gene locus_tag LOCUS_17390 gene bshA 3035 1788 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_17390 3814 3032 gene locus_tag LOCUS_17400 gene bshB1 3814 3032 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888991.1 protein_id gnl|my_center|LOCUS_17400 6083 4413 gene locus_tag LOCUS_17410 gene bshC 6083 4413 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_17410 7310 6288 gene locus_tag LOCUS_17420 gene thiL 7310 6288 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392671.1 protein_id gnl|my_center|LOCUS_17420 7990 7307 gene locus_tag LOCUS_17430 7990 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 8523 8011 gene locus_tag LOCUS_17440 8523 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 9344 8520 gene locus_tag LOCUS_17450 gene thiD 9344 8520 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_17450 9613 10416 gene locus_tag LOCUS_17460 9613 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 10505 11257 gene locus_tag LOCUS_17470 10505 11257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 11672 11244 gene locus_tag LOCUS_17480 11672 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 12043 11669 gene locus_tag LOCUS_17490 12043 11669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 13890 12097 gene locus_tag LOCUS_17500 13890 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 14719 13883 gene locus_tag LOCUS_17510 14719 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 15671 14739 gene locus_tag LOCUS_17520 15671 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 16221 15928 gene locus_tag LOCUS_17530 16221 15928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 18137 16653 gene locus_tag LOCUS_17540 gene glnA 18137 16653 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257332.1 protein_id gnl|my_center|LOCUS_17540 18288 18713 gene locus_tag LOCUS_17550 18288 18713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 19173 18871 gene locus_tag LOCUS_17560 19173 18871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 20276 19374 gene locus_tag LOCUS_17570 20276 19374 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 protein_id gnl|my_center|LOCUS_17570 21427 20696 gene locus_tag LOCUS_17580 21427 20696 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_17580 23112 21736 gene locus_tag LOCUS_17590 23112 21736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 23800 23051 gene locus_tag LOCUS_17600 23800 23051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 25569 24598 gene locus_tag LOCUS_17610 25569 24598 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583661.1 protein_id gnl|my_center|LOCUS_17610 25737 26111 gene locus_tag LOCUS_17620 25737 26111 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391689.1 protein_id gnl|my_center|LOCUS_17620 27301 26276 gene locus_tag LOCUS_17630 27301 26276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 27756 28550 gene locus_tag LOCUS_17640 27756 28550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 29421 28645 gene locus_tag LOCUS_17650 gene fabI 29421 28645 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057530.1 protein_id gnl|my_center|LOCUS_17650 29683 30381 gene locus_tag LOCUS_17660 29683 30381 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_17660 30829 30422 gene locus_tag LOCUS_17670 30829 30422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 32466 31210 gene locus_tag LOCUS_17680 gene alr 32466 31210 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393884.1 protein_id gnl|my_center|LOCUS_17680 34218 32596 gene locus_tag LOCUS_17690 34218 32596 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_17690 35905 34415 gene locus_tag LOCUS_17700 35905 34415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence031 <1 552 gene locus_tag LOCUS_17710 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902978.1:MaoC family dehydratase 1057 1827 gene locus_tag LOCUS_17720 1057 1827 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361569.1 protein_id gnl|my_center|LOCUS_17720 3881 2250 gene locus_tag LOCUS_17730 3881 2250 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_17730 5097 4099 gene locus_tag LOCUS_17740 gene ilvC 5097 4099 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_17740 5715 5149 gene locus_tag LOCUS_17750 gene ilvN 5715 5149 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_17750 7882 6788 gene locus_tag LOCUS_17760 7882 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 8886 7897 gene locus_tag LOCUS_17770 8886 7897 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_17770 10464 9031 gene locus_tag LOCUS_17780 10464 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 12007 10658 gene locus_tag LOCUS_17790 12007 10658 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803772.1 protein_id gnl|my_center|LOCUS_17790 12460 14070 gene locus_tag LOCUS_17800 12460 14070 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 protein_id gnl|my_center|LOCUS_17800 14113 15429 gene locus_tag LOCUS_17810 14113 15429 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_17810 16700 15477 gene locus_tag LOCUS_17820 16700 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 18205 16820 gene locus_tag LOCUS_17830 18205 16820 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_17830 18089 18313 gene locus_tag LOCUS_17840 18089 18313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 18339 18722 gene locus_tag LOCUS_17850 18339 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 18981 19679 gene locus_tag LOCUS_17860 18981 19679 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230121.1 protein_id gnl|my_center|LOCUS_17860 19744 21147 gene locus_tag LOCUS_17870 19744 21147 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550958.1 protein_id gnl|my_center|LOCUS_17870 21190 21492 gene locus_tag LOCUS_17880 21190 21492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 21769 23151 gene locus_tag LOCUS_17890 21769 23151 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_17890 23518 24897 gene locus_tag LOCUS_17900 23518 24897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 25280 25011 gene locus_tag LOCUS_17910 25280 25011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 26138 25302 gene locus_tag LOCUS_17920 26138 25302 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_17920 26737 26405 gene locus_tag LOCUS_17930 gene tnpA 26737 26405 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435056.1 protein_id gnl|my_center|LOCUS_17930 28258 26906 gene locus_tag LOCUS_17940 28258 26906 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807138.1 protein_id gnl|my_center|LOCUS_17940 28702 29958 gene locus_tag LOCUS_17950 28702 29958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 30930 30061 gene locus_tag LOCUS_17960 gene speE 30930 30061 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393316.1 protein_id gnl|my_center|LOCUS_17960 32375 31287 gene locus_tag LOCUS_17970 32375 31287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 32650 32913 gene locus_tag LOCUS_17980 32650 32913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 34011 33310 gene locus_tag LOCUS_17990 34011 33310 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037241.1 protein_id gnl|my_center|LOCUS_17990 35652 34081 gene locus_tag LOCUS_18000 35652 34081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence032 4390 710 gene locus_tag LOCUS_18010 gene addA 4390 710 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018662405.1 protein_id gnl|my_center|LOCUS_18010 7772 4383 gene locus_tag LOCUS_18020 gene addB 7772 4383 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816091.1 protein_id gnl|my_center|LOCUS_18020 8284 9621 gene locus_tag LOCUS_18030 8284 9621 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_18030 9884 10378 gene locus_tag LOCUS_18040 9884 10378 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723894.1 protein_id gnl|my_center|LOCUS_18040 10375 10920 gene locus_tag LOCUS_18050 gene mcsA 10375 10920 CDS product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 protein_id gnl|my_center|LOCUS_18050 10956 12101 gene locus_tag LOCUS_18060 10956 12101 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_18060 12169 14694 gene locus_tag LOCUS_18070 gene clpC 12169 14694 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_18070 15106 14741 gene locus_tag LOCUS_18080 15106 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 15017 15385 gene locus_tag LOCUS_18090 15017 15385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 15640 16992 gene locus_tag LOCUS_18100 gene radA 15640 16992 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_18100 17966 17460 gene locus_tag LOCUS_18110 17966 17460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048365.1 protein_id gnl|my_center|LOCUS_18110 18259 18738 gene locus_tag LOCUS_18120 18259 18738 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_18120 18797 19912 gene locus_tag LOCUS_18130 18797 19912 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_18130 19975 21081 gene locus_tag LOCUS_18140 19975 21081 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975262.1 protein_id gnl|my_center|LOCUS_18140 21849 22523 gene locus_tag LOCUS_18150 gene cysE 21849 22523 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_18150 22594 24075 gene locus_tag LOCUS_18160 gene cysS 22594 24075 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869759.1 protein_id gnl|my_center|LOCUS_18160 24294 25031 gene locus_tag LOCUS_18170 gene rlmB 24294 25031 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_18170 25304 25966 gene locus_tag LOCUS_18180 gene sigH 25304 25966 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_18180 26064 26139 gene locus_tag LOCUS_t00190 26064 26139 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 26156 26241 gene locus_tag LOCUS_t00200 26156 26241 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 26256 26332 gene locus_tag LOCUS_t00210 26256 26332 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26339 26414 gene locus_tag LOCUS_t00220 26339 26414 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27093 29405 gene locus_tag LOCUS_18190 27093 29405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 30462 29443 gene locus_tag LOCUS_18200 30462 29443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 30418 30783 gene locus_tag LOCUS_18210 30418 30783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 30840 32663 gene locus_tag LOCUS_18220 gene ftsH 30840 32663 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_18220 32826 33929 gene locus_tag LOCUS_18230 32826 33929 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259193.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence033 609 2492 gene locus_tag LOCUS_18240 609 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3802 2687 gene locus_tag LOCUS_18250 3802 2687 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250672.1 protein_id gnl|my_center|LOCUS_18250 4663 3809 gene locus_tag LOCUS_18260 4663 3809 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_18260 5575 4685 gene locus_tag LOCUS_18270 5575 4685 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836183.1 protein_id gnl|my_center|LOCUS_18270 6916 5594 gene locus_tag LOCUS_18280 6916 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 8340 6913 gene locus_tag LOCUS_18290 8340 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 9149 9421 gene locus_tag LOCUS_18300 9149 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 9787 9443 gene locus_tag LOCUS_18310 9787 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 10413 9784 gene locus_tag LOCUS_18320 10413 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 11863 10403 gene locus_tag LOCUS_18330 11863 10403 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727196.1 protein_id gnl|my_center|LOCUS_18330 12282 11860 gene locus_tag LOCUS_18340 12282 11860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 14396 12621 gene locus_tag LOCUS_18350 14396 12621 CDS product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079698.1 protein_id gnl|my_center|LOCUS_18350 16455 14926 gene locus_tag LOCUS_18360 16455 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 18512 17013 gene locus_tag LOCUS_18370 18512 17013 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460222.1 protein_id gnl|my_center|LOCUS_18370 19831 18509 gene locus_tag LOCUS_18380 19831 18509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 20727 20587 gene locus_tag LOCUS_18390 20727 20587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 20774 21553 gene locus_tag LOCUS_18400 20774 21553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 21833 23302 gene locus_tag LOCUS_18410 21833 23302 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_18410 23746 23390 gene locus_tag LOCUS_18420 23746 23390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 24011 25003 gene locus_tag LOCUS_18430 24011 25003 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 protein_id gnl|my_center|LOCUS_18430 25000 25662 gene locus_tag LOCUS_18440 gene hisG 25000 25662 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_18440 25692 28121 gene locus_tag LOCUS_18450 25692 28121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 28404 29000 gene locus_tag LOCUS_18460 gene hisB 28404 29000 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774805.1 protein_id gnl|my_center|LOCUS_18460 29027 29647 gene locus_tag LOCUS_18470 gene hisH 29027 29647 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_18470 30111 30205 gene locus_tag LOCUS_t00230 30111 30205 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 30450 31250 gene locus_tag LOCUS_18480 gene hisF 30450 31250 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 protein_id gnl|my_center|LOCUS_18480 31247 32035 gene locus_tag LOCUS_18490 gene hisIE 31247 32035 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228687.1 protein_id gnl|my_center|LOCUS_18490 32709 33623 gene locus_tag LOCUS_18500 32709 33623 CDS product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808149.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence034 461 2026 gene locus_tag LOCUS_18510 461 2026 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064158.1 protein_id gnl|my_center|LOCUS_18510 2656 5271 gene locus_tag LOCUS_18520 2656 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 5402 6844 gene locus_tag LOCUS_18530 5402 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 9018 7447 gene locus_tag LOCUS_18540 9018 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 9005 9397 gene locus_tag LOCUS_18550 9005 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 9463 11028 gene locus_tag LOCUS_18560 9463 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 11043 13475 gene locus_tag LOCUS_18570 11043 13475 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257648.1 protein_id gnl|my_center|LOCUS_18570 13457 13843 gene locus_tag LOCUS_18580 13457 13843 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404784.1 protein_id gnl|my_center|LOCUS_18580 13836 14063 gene locus_tag LOCUS_18590 13836 14063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 14357 15055 gene locus_tag LOCUS_18600 14357 15055 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392237.1 protein_id gnl|my_center|LOCUS_18600 15574 15774 gene locus_tag LOCUS_18610 15574 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 16023 17048 gene locus_tag LOCUS_18620 16023 17048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 17052 17813 gene locus_tag LOCUS_18630 17052 17813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 18715 19734 gene locus_tag LOCUS_18640 18715 19734 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_18640 20475 19891 gene locus_tag LOCUS_18650 20475 19891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 21100 21501 gene locus_tag LOCUS_18660 21100 21501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 22378 21644 gene locus_tag LOCUS_18670 22378 21644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_18670 22846 23388 gene locus_tag LOCUS_18680 22846 23388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 23507 24562 gene locus_tag LOCUS_18690 23507 24562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 24523 24532 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25120 25380 gene locus_tag LOCUS_18700 25120 25380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 25371 26924 gene locus_tag LOCUS_18710 25371 26924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 27035 28489 gene locus_tag LOCUS_18720 27035 28489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 28398 28316 gene locus_tag LOCUS_t00240 28398 28316 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 28486 28755 gene locus_tag LOCUS_18730 28486 28755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 29000 30454 gene locus_tag LOCUS_18740 29000 30454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 31043 32239 gene locus_tag LOCUS_18750 31043 32239 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_18750 32844 33389 gene locus_tag LOCUS_18760 32844 33389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence035 1648 188 gene locus_tag LOCUS_18770 1648 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4144 2012 gene locus_tag LOCUS_18780 4144 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 5226 4525 gene locus_tag LOCUS_18790 5226 4525 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221295.1 protein_id gnl|my_center|LOCUS_18790 5705 5854 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccccatcacacgcgcgcagagagcggcg 6088 5918 gene locus_tag LOCUS_18800 6088 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 7456 6116 gene locus_tag LOCUS_18810 7456 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 9465 8209 gene locus_tag LOCUS_18820 9465 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 9740 9462 gene locus_tag LOCUS_18830 9740 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 10959 9769 gene locus_tag LOCUS_18840 10959 9769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 12823 11573 gene locus_tag LOCUS_18850 12823 11573 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974647.1 protein_id gnl|my_center|LOCUS_18850 13253 12879 gene locus_tag LOCUS_18860 13253 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 14523 13693 gene locus_tag LOCUS_18870 14523 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 15736 14654 gene locus_tag LOCUS_18880 15736 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 16123 15743 gene locus_tag LOCUS_18890 16123 15743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 17879 16143 gene locus_tag LOCUS_18900 17879 16143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 18217 17912 gene locus_tag LOCUS_18910 18217 17912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 19085 18933 gene locus_tag LOCUS_18920 19085 18933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 19027 20400 gene locus_tag LOCUS_18930 19027 20400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 20705 22183 gene locus_tag LOCUS_18940 20705 22183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 24335 22590 gene locus_tag LOCUS_18950 gene betC 24335 22590 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_18950 26757 25366 gene locus_tag LOCUS_18960 26757 25366 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_18960 29485 27341 gene locus_tag LOCUS_18970 29485 27341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 30016 31344 gene locus_tag LOCUS_18980 30016 31344 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_18980 32150 32827 gene locus_tag LOCUS_18990 32150 32827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence036 250 726 gene locus_tag LOCUS_19000 250 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 880 2622 gene locus_tag LOCUS_19010 880 2622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_19010 2619 4526 gene locus_tag LOCUS_19020 2619 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 6933 4771 gene locus_tag LOCUS_19030 6933 4771 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_19030 10263 7663 gene locus_tag LOCUS_19040 10263 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 12901 10622 gene locus_tag LOCUS_19050 12901 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 14856 12898 gene locus_tag LOCUS_19060 14856 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 14928 15320 gene locus_tag LOCUS_19070 14928 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 15407 17740 gene locus_tag LOCUS_19080 15407 17740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_19080 17759 18376 gene locus_tag LOCUS_19090 17759 18376 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 protein_id gnl|my_center|LOCUS_19090 18801 20156 gene locus_tag LOCUS_19100 18801 20156 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_19100 21198 20740 gene locus_tag LOCUS_19110 21198 20740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 21457 23778 gene locus_tag LOCUS_19120 21457 23778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 25913 24159 gene locus_tag LOCUS_19130 25913 24159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 25474 25550 gene locus_tag LOCUS_t00250 25474 25550 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26459 27373 gene locus_tag LOCUS_19140 26459 27373 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_19140 27394 28047 gene locus_tag LOCUS_19150 27394 28047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 28206 29621 gene locus_tag LOCUS_19160 28206 29621 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582770.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence037 1465 212 gene locus_tag LOCUS_19170 1465 212 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584133.1 protein_id gnl|my_center|LOCUS_19170 1644 3251 gene locus_tag LOCUS_19180 1644 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 3248 4948 gene locus_tag LOCUS_19190 3248 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 5073 6014 gene locus_tag LOCUS_19200 5073 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 6014 6805 gene locus_tag LOCUS_19210 gene sigE 6014 6805 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774280.1 protein_id gnl|my_center|LOCUS_19210 7062 8396 gene locus_tag LOCUS_19220 7062 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 9212 9625 gene locus_tag LOCUS_19230 9212 9625 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845472.1 protein_id gnl|my_center|LOCUS_19230 9764 10378 gene locus_tag LOCUS_19240 gene wrbA 9764 10378 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889473.1 protein_id gnl|my_center|LOCUS_19240 11223 10543 gene locus_tag LOCUS_19250 11223 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 12521 11739 gene locus_tag LOCUS_19260 gene sigG 12521 11739 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774282.1 protein_id gnl|my_center|LOCUS_19260 12760 13410 gene locus_tag LOCUS_19270 12760 13410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 13971 14228 gene locus_tag LOCUS_19280 13971 14228 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236745.1 protein_id gnl|my_center|LOCUS_19280 14233 15042 gene locus_tag LOCUS_19290 gene pgeF 14233 15042 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_19290 15256 16464 gene locus_tag LOCUS_19300 15256 16464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 16952 17608 gene locus_tag LOCUS_19310 16952 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 18055 18792 gene locus_tag LOCUS_19320 18055 18792 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_19320 18984 19523 gene locus_tag LOCUS_19330 18984 19523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 19554 19823 gene locus_tag LOCUS_19340 19554 19823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 19869 20411 gene locus_tag LOCUS_19350 gene divIVA 19869 20411 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131611.1 protein_id gnl|my_center|LOCUS_19350 20755 21135 gene locus_tag LOCUS_19360 20755 21135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 21150 21365 gene locus_tag LOCUS_19370 21150 21365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 21507 22670 gene locus_tag LOCUS_19380 21507 22670 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393149.1 protein_id gnl|my_center|LOCUS_19380 22902 25616 gene locus_tag LOCUS_19390 gene alaS 22902 25616 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_19390 25651 26955 gene locus_tag LOCUS_19400 gene mdtG 25651 26955 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027946.1 protein_id gnl|my_center|LOCUS_19400 26948 27415 gene locus_tag LOCUS_19410 gene ruvX 26948 27415 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 protein_id gnl|my_center|LOCUS_19410 28038 28439 gene locus_tag LOCUS_19420 28038 28439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence038 433 239 gene locus_tag LOCUS_19430 433 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 1786 767 gene locus_tag LOCUS_19440 1786 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2258 1896 gene locus_tag LOCUS_19450 2258 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 3932 2502 gene locus_tag LOCUS_19460 3932 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4963 3929 gene locus_tag LOCUS_19470 4963 3929 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014888.1 protein_id gnl|my_center|LOCUS_19470 6827 5658 gene locus_tag LOCUS_19480 6827 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 8552 7329 gene locus_tag LOCUS_19490 8552 7329 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805158.1 protein_id gnl|my_center|LOCUS_19490 9010 8801 gene locus_tag LOCUS_19500 9010 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 9171 9007 gene locus_tag LOCUS_19510 9171 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 9576 9265 gene locus_tag LOCUS_19520 9576 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 11867 10497 gene locus_tag LOCUS_19530 11867 10497 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_19530 12137 12322 gene locus_tag LOCUS_19540 12137 12322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 12844 13947 gene locus_tag LOCUS_19550 12844 13947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 15132 14215 gene locus_tag LOCUS_19560 15132 14215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 15356 15129 gene locus_tag LOCUS_19570 15356 15129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 16496 15582 gene locus_tag LOCUS_19580 16496 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 17600 16596 gene locus_tag LOCUS_19590 17600 16596 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_19590 18848 17814 gene locus_tag LOCUS_19600 18848 17814 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399796.1 protein_id gnl|my_center|LOCUS_19600 19852 19103 gene locus_tag LOCUS_19610 19852 19103 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703673.1 protein_id gnl|my_center|LOCUS_19610 20649 19858 gene locus_tag LOCUS_19620 20649 19858 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804151.1 protein_id gnl|my_center|LOCUS_19620 21508 20660 gene locus_tag LOCUS_19630 21508 20660 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066690.1 protein_id gnl|my_center|LOCUS_19630 22539 21505 gene locus_tag LOCUS_19640 22539 21505 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868029.1 protein_id gnl|my_center|LOCUS_19640 23338 24858 gene locus_tag LOCUS_19650 23338 24858 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_19650 26436 24895 gene locus_tag LOCUS_19660 26436 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 28322 26862 gene locus_tag LOCUS_19670 28322 26862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 29588 28761 gene locus_tag LOCUS_19680 29588 28761 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846813.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence039 1813 2046 gene locus_tag LOCUS_19690 1813 2046 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416009.1 protein_id gnl|my_center|LOCUS_19690 3385 5928 gene locus_tag LOCUS_19700 3385 5928 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_19700 6146 5820 gene locus_tag LOCUS_19710 6146 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 6339 8774 gene locus_tag LOCUS_19720 6339 8774 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_19720 9243 10265 gene locus_tag LOCUS_19730 9243 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 11866 10652 gene locus_tag LOCUS_19740 11866 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 13407 12604 gene locus_tag LOCUS_19750 13407 12604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 14386 13535 gene locus_tag LOCUS_19760 14386 13535 CDS product glucosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921804.1 protein_id gnl|my_center|LOCUS_19760 15058 14585 gene locus_tag LOCUS_19770 15058 14585 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_19770 16417 15062 gene locus_tag LOCUS_19780 16417 15062 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921544.1 protein_id gnl|my_center|LOCUS_19780 16848 16504 gene locus_tag LOCUS_19790 16848 16504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 18309 17116 gene locus_tag LOCUS_19800 18309 17116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 19451 18306 gene locus_tag LOCUS_19810 19451 18306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 20929 19448 gene locus_tag LOCUS_19820 20929 19448 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_19820 21010 21222 gene locus_tag LOCUS_19830 21010 21222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 22708 21263 gene locus_tag LOCUS_19840 22708 21263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 23009 23206 gene locus_tag LOCUS_19850 23009 23206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 23615 25555 gene locus_tag LOCUS_19860 23615 25555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 27966 26092 gene locus_tag LOCUS_19870 27966 26092 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_19870 29216 28572 gene locus_tag LOCUS_19880 gene msrA 29216 28572 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083656.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence040 614 892 gene locus_tag LOCUS_19890 614 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1630 1163 gene locus_tag LOCUS_19900 1630 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 1739 2218 gene locus_tag LOCUS_19910 1739 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2163 2813 gene locus_tag LOCUS_19920 2163 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2806 4662 gene locus_tag LOCUS_19930 2806 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 4646 7498 gene locus_tag LOCUS_19940 4646 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 7495 8511 gene locus_tag LOCUS_19950 7495 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 9891 9019 gene locus_tag LOCUS_19960 9891 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 9853 10134 gene locus_tag LOCUS_19970 9853 10134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 10529 10840 gene locus_tag LOCUS_19980 10529 10840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 10843 11796 gene locus_tag LOCUS_19990 10843 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 12110 12775 gene locus_tag LOCUS_20000 12110 12775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 12781 13734 gene locus_tag LOCUS_20010 12781 13734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 13761 14072 gene locus_tag LOCUS_20020 13761 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 14065 15156 gene locus_tag LOCUS_20030 14065 15156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 15209 15499 gene locus_tag LOCUS_20040 15209 15499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 16536 16868 gene locus_tag LOCUS_20050 16536 16868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_20050 16853 17215 gene locus_tag LOCUS_20060 16853 17215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 17289 20312 gene locus_tag LOCUS_20070 17289 20312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 20380 20952 gene locus_tag LOCUS_20080 20380 20952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 20873 21811 gene locus_tag LOCUS_20090 20873 21811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 21857 22834 gene locus_tag LOCUS_20100 21857 22834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 22837 23322 gene locus_tag LOCUS_20110 22837 23322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 23496 23332 gene locus_tag LOCUS_20120 23496 23332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 23441 24106 gene locus_tag LOCUS_20130 23441 24106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 24221 24481 gene locus_tag LOCUS_20140 24221 24481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 24789 25337 gene locus_tag LOCUS_20150 gene radC 24789 25337 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942813.1 protein_id gnl|my_center|LOCUS_20150 25532 25969 gene locus_tag LOCUS_20160 25532 25969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 26394 27128 gene locus_tag LOCUS_20170 26394 27128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 27125 28327 gene locus_tag LOCUS_20180 27125 28327 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189955127.1 protein_id gnl|my_center|LOCUS_20180 28410 28988 gene locus_tag LOCUS_20190 28410 28988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence041 <1 2413 gene locus_tag LOCUS_20200 <1 2413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398544.1:SNF2-related protein 2430 3125 gene locus_tag LOCUS_20210 2430 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 3146 4333 gene locus_tag LOCUS_20220 3146 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 4236 4454 gene locus_tag LOCUS_20230 4236 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 4814 5194 gene locus_tag LOCUS_20240 4814 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 5230 5430 gene locus_tag LOCUS_20250 5230 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 5469 5618 gene locus_tag LOCUS_20260 5469 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 5755 6270 gene locus_tag LOCUS_20270 5755 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 6320 7432 gene locus_tag LOCUS_20280 6320 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 7433 9253 gene locus_tag LOCUS_20290 7433 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 9282 9596 gene locus_tag LOCUS_20300 9282 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 9623 10039 gene locus_tag LOCUS_20310 9623 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 10045 10311 gene locus_tag LOCUS_20320 10045 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 10327 11010 gene locus_tag LOCUS_20330 10327 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 11010 11705 gene locus_tag LOCUS_20340 11010 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 11718 12350 gene locus_tag LOCUS_20350 11718 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 12337 12537 gene locus_tag LOCUS_20360 12337 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 12563 14299 gene locus_tag LOCUS_20370 12563 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 14315 14755 gene locus_tag LOCUS_20380 14315 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 14771 15100 gene locus_tag LOCUS_20390 14771 15100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 15078 15419 gene locus_tag LOCUS_20400 15078 15419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 15412 18099 gene locus_tag LOCUS_20410 15412 18099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 18930 18103 gene locus_tag LOCUS_20420 18930 18103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 18929 19111 gene locus_tag LOCUS_20430 18929 19111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 19406 19245 gene locus_tag LOCUS_20440 19406 19245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 19545 20828 gene locus_tag LOCUS_20450 19545 20828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 20825 21622 gene locus_tag LOCUS_20460 20825 21622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 22391 23233 gene locus_tag LOCUS_20470 22391 23233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 23240 23692 gene locus_tag LOCUS_20480 23240 23692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 23689 24564 gene locus_tag LOCUS_20490 23689 24564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 24580 26034 gene locus_tag LOCUS_20500 24580 26034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 26031 26861 gene locus_tag LOCUS_20510 26031 26861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 26876 27379 gene locus_tag LOCUS_20520 26876 27379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence042 2486 1032 gene locus_tag LOCUS_20530 2486 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 6423 2560 gene locus_tag LOCUS_20540 6423 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 7172 8335 gene locus_tag LOCUS_20550 7172 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 8387 10726 gene locus_tag LOCUS_20560 8387 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 10723 13890 gene locus_tag LOCUS_20570 10723 13890 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_20570 13993 14151 gene locus_tag LOCUS_20580 13993 14151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 14904 14266 gene locus_tag LOCUS_20590 14904 14266 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530499.1 protein_id gnl|my_center|LOCUS_20590 15356 15012 gene locus_tag LOCUS_20600 15356 15012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 16388 15399 gene locus_tag LOCUS_20610 16388 15399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 17578 16517 gene locus_tag LOCUS_20620 17578 16517 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803848.1 protein_id gnl|my_center|LOCUS_20620 19068 17986 gene locus_tag LOCUS_20630 19068 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 20126 19344 gene locus_tag LOCUS_20640 20126 19344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 21700 20231 gene locus_tag LOCUS_20650 21700 20231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 23534 22077 gene locus_tag LOCUS_20660 23534 22077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 25414 24092 gene locus_tag LOCUS_20670 25414 24092 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_20670 26340 25546 gene locus_tag LOCUS_20680 26340 25546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 27063 26671 gene locus_tag LOCUS_20690 27063 26671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 27418 27014 gene locus_tag LOCUS_20700 27418 27014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 27683 27408 gene locus_tag LOCUS_20710 27683 27408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 27705 27914 gene locus_tag LOCUS_20720 27705 27914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence043 411 487 gene locus_tag LOCUS_t00260 411 487 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 695 886 gene locus_tag LOCUS_20730 695 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 891 1604 gene locus_tag LOCUS_20740 891 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 1762 2193 gene locus_tag LOCUS_20750 gene rplK 1762 2193 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085809.1 protein_id gnl|my_center|LOCUS_20750 2231 2932 gene locus_tag LOCUS_20760 gene rplA 2231 2932 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_20760 3175 3777 gene locus_tag LOCUS_20770 gene rplJ 3175 3777 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_20770 3862 4239 gene locus_tag LOCUS_20780 gene rplL 3862 4239 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459089.1 protein_id gnl|my_center|LOCUS_20780 4544 4921 gene locus_tag LOCUS_20790 gene rplU 4544 4921 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_20790 4986 5354 gene locus_tag LOCUS_20800 4986 5354 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392095.1 protein_id gnl|my_center|LOCUS_20800 5398 5718 gene locus_tag LOCUS_20810 gene rpmA 5398 5718 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289452.1 protein_id gnl|my_center|LOCUS_20810 5831 7267 gene locus_tag LOCUS_20820 gene obgE 5831 7267 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257169.1 protein_id gnl|my_center|LOCUS_20820 7314 7913 gene locus_tag LOCUS_20830 gene nadD 7314 7913 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_20830 8303 8941 gene locus_tag LOCUS_20840 gene yqeK 8303 8941 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_20840 8966 9379 gene locus_tag LOCUS_20850 gene rsfS 8966 9379 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392104.1 protein_id gnl|my_center|LOCUS_20850 9829 9904 gene locus_tag LOCUS_t00270 9829 9904 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10246 12891 gene locus_tag LOCUS_20860 gene leuS 10246 12891 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583912.1 protein_id gnl|my_center|LOCUS_20860 12948 13619 gene locus_tag LOCUS_20870 12948 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 13612 14700 gene locus_tag LOCUS_20880 13612 14700 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_20880 14684 15754 gene locus_tag LOCUS_20890 gene holA 14684 15754 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_20890 15758 16318 gene locus_tag LOCUS_20900 15758 16318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 16341 16724 gene locus_tag LOCUS_20910 16341 16724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 17246 16959 gene locus_tag LOCUS_20920 gene rpsT 17246 16959 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274011.1 protein_id gnl|my_center|LOCUS_20920 17946 19364 gene locus_tag LOCUS_20930 gene sufB 17946 19364 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_20930 19436 19768 gene locus_tag LOCUS_20940 19436 19768 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817039.1 protein_id gnl|my_center|LOCUS_20940 19894 20313 gene locus_tag LOCUS_20950 19894 20313 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_20950 20605 21888 gene locus_tag LOCUS_20960 20605 21888 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245710.1 protein_id gnl|my_center|LOCUS_20960 22148 22459 gene locus_tag LOCUS_20970 22148 22459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20970 23004 24026 gene locus_tag LOCUS_20980 23004 24026 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256717.1 protein_id gnl|my_center|LOCUS_20980 25550 24372 gene locus_tag LOCUS_20990 25550 24372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 25813 26697 gene locus_tag LOCUS_21000 25813 26697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence044 334 1644 gene locus_tag LOCUS_21010 334 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 1681 5202 gene locus_tag LOCUS_21020 1681 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 5521 6465 gene locus_tag LOCUS_21030 gene ftsY 5521 6465 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_21030 7052 7432 gene locus_tag LOCUS_21040 7052 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 7492 8847 gene locus_tag LOCUS_21050 gene ffh 7492 8847 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_21050 8915 9301 gene locus_tag LOCUS_21060 8915 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 9971 9420 gene locus_tag LOCUS_21070 9971 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 9867 10097 gene locus_tag LOCUS_21080 9867 10097 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_21080 10120 10647 gene locus_tag LOCUS_21090 gene rimM 10120 10647 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_21090 10766 11521 gene locus_tag LOCUS_21100 gene trmD 10766 11521 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_21100 11836 12183 gene locus_tag LOCUS_21110 gene rplS 11836 12183 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_21110 12277 13185 gene locus_tag LOCUS_21120 gene ylqF 12277 13185 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392488.1 protein_id gnl|my_center|LOCUS_21120 13202 13813 gene locus_tag LOCUS_21130 13202 13813 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392491.1 protein_id gnl|my_center|LOCUS_21130 14172 15071 gene locus_tag LOCUS_21140 14172 15071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 15521 16846 gene locus_tag LOCUS_21150 gene hmgA 15521 16846 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762566.1 protein_id gnl|my_center|LOCUS_21150 17084 18220 gene locus_tag LOCUS_21160 17084 18220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 18262 19140 gene locus_tag LOCUS_21170 18262 19140 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015468.1 protein_id gnl|my_center|LOCUS_21170 19493 21907 gene locus_tag LOCUS_21180 gene topA 19493 21907 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_21180 21936 23258 gene locus_tag LOCUS_21190 gene trmFO 21936 23258 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_21190 23283 24167 gene locus_tag LOCUS_21200 23283 24167 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088347.1 protein_id gnl|my_center|LOCUS_21200 24247 24789 gene locus_tag LOCUS_21210 gene hslV 24247 24789 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_21210 24791 26242 gene locus_tag LOCUS_21220 gene hslU 24791 26242 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081401.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence045 1 1254 gene locus_tag LOCUS_21230 1 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1311 1733 gene locus_tag LOCUS_21240 1311 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1699 2052 gene locus_tag LOCUS_21250 1699 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 1957 1966 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1997 2653 gene locus_tag LOCUS_21260 1997 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2635 4479 gene locus_tag LOCUS_21270 2635 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 4483 7386 gene locus_tag LOCUS_21280 4483 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 7379 8329 gene locus_tag LOCUS_21290 7379 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 8694 9482 gene locus_tag LOCUS_21300 8694 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 9499 9684 gene locus_tag LOCUS_21310 9499 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 10204 11208 gene locus_tag LOCUS_21320 10204 11208 CDS product ParM/StbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391888.1 protein_id gnl|my_center|LOCUS_21320 11213 11524 gene locus_tag LOCUS_21330 11213 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 11528 11731 gene locus_tag LOCUS_21340 11528 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 11737 12171 gene locus_tag LOCUS_21350 11737 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 12270 13298 gene locus_tag LOCUS_21360 12270 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 13291 13674 gene locus_tag LOCUS_21370 13291 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 13678 15180 gene locus_tag LOCUS_21380 13678 15180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 15304 15714 gene locus_tag LOCUS_21390 15304 15714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 15711 17045 gene locus_tag LOCUS_21400 15711 17045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 17045 17215 gene locus_tag LOCUS_21410 17045 17215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 17326 18558 gene locus_tag LOCUS_21420 17326 18558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 18633 20351 gene locus_tag LOCUS_21430 18633 20351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 20658 22025 gene locus_tag LOCUS_21440 20658 22025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 22107 22370 gene locus_tag LOCUS_21450 22107 22370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 22533 22730 gene locus_tag LOCUS_21460 22533 22730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 23039 23896 gene locus_tag LOCUS_21470 23039 23896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 23958 24212 gene locus_tag LOCUS_21480 23958 24212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 24212 24451 gene locus_tag LOCUS_21490 24212 24451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 24536 24808 gene locus_tag LOCUS_21500 24536 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence046 2296 155 gene locus_tag LOCUS_21510 2296 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 3147 3737 gene locus_tag LOCUS_21520 3147 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 3816 4847 gene locus_tag LOCUS_21530 gene recA 3816 4847 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_21530 4844 5554 gene locus_tag LOCUS_21540 4844 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 5876 7393 gene locus_tag LOCUS_21550 gene rny 5876 7393 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_21550 7445 8365 gene locus_tag LOCUS_21560 7445 8365 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_21560 8663 8439 gene locus_tag LOCUS_21570 8663 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 8601 9434 gene locus_tag LOCUS_21580 8601 9434 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_21580 9659 9901 gene locus_tag LOCUS_21590 9659 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 10238 11800 gene locus_tag LOCUS_21600 10238 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 11797 11973 gene locus_tag LOCUS_21610 11797 11973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 12015 12362 gene locus_tag LOCUS_21620 12015 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 12290 12715 gene locus_tag LOCUS_21630 12290 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 13034 12864 gene locus_tag LOCUS_21640 13034 12864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 13352 14827 gene locus_tag LOCUS_21650 gene miaB 13352 14827 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_21650 15518 16954 gene locus_tag LOCUS_21660 15518 16954 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582767.1 protein_id gnl|my_center|LOCUS_21660 17140 17460 gene locus_tag LOCUS_21670 17140 17460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 17701 18648 gene locus_tag LOCUS_21680 17701 18648 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972768.1 protein_id gnl|my_center|LOCUS_21680 18687 19517 gene locus_tag LOCUS_21690 18687 19517 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532486.1 protein_id gnl|my_center|LOCUS_21690 19580 20206 gene locus_tag LOCUS_21700 19580 20206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 20160 20169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20211 20999 gene locus_tag LOCUS_21710 20211 20999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 21373 21182 gene locus_tag LOCUS_21720 21373 21182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 22122 21373 gene locus_tag LOCUS_21730 22122 21373 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119544.1 protein_id gnl|my_center|LOCUS_21730 23195 22431 gene locus_tag LOCUS_21740 23195 22431 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_21740 <24981 23743 gene locus_tag LOCUS_21750 <24981 23743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111696793.1:sulfatase-like hydrolase/transferase >Feature sequence047 283 1161 gene locus_tag LOCUS_21760 283 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2722 1583 gene locus_tag LOCUS_21770 2722 1583 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522681.1 protein_id gnl|my_center|LOCUS_21770 3318 2839 gene locus_tag LOCUS_21780 gene purE 3318 2839 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208569.1 protein_id gnl|my_center|LOCUS_21780 5132 3450 gene locus_tag LOCUS_21790 gene ilvD 5132 3450 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_21790 5434 6036 gene locus_tag LOCUS_21800 5434 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 6266 7135 gene locus_tag LOCUS_21810 6266 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 7185 7790 gene locus_tag LOCUS_21820 7185 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 8097 9689 gene locus_tag LOCUS_21830 8097 9689 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_21830 10194 9850 gene locus_tag LOCUS_21840 10194 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 10747 10974 gene locus_tag LOCUS_21850 10747 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 11191 11898 gene locus_tag LOCUS_21860 gene cpaB 11191 11898 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939395.1 protein_id gnl|my_center|LOCUS_21860 12019 13215 gene locus_tag LOCUS_21870 12019 13215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 13318 14796 gene locus_tag LOCUS_21880 13318 14796 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_21880 14799 15770 gene locus_tag LOCUS_21890 14799 15770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 15832 16746 gene locus_tag LOCUS_21900 15832 16746 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_21900 18816 17065 gene locus_tag LOCUS_21910 18816 17065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 19236 19442 gene locus_tag LOCUS_21920 19236 19442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 19938 19399 gene locus_tag LOCUS_21930 19938 19399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21930 20288 19836 gene locus_tag LOCUS_21940 20288 19836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 21788 21060 gene locus_tag LOCUS_21950 21788 21060 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_21950 22685 22371 gene locus_tag LOCUS_21960 22685 22371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 24058 22682 gene locus_tag LOCUS_21970 24058 22682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 24529 24110 gene locus_tag LOCUS_21980 24529 24110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 24542 24880 gene locus_tag LOCUS_21990 24542 24880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence048 1945 509 gene locus_tag LOCUS_22000 1945 509 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_22000 3433 1949 gene locus_tag LOCUS_22010 3433 1949 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_22010 5281 3437 gene locus_tag LOCUS_22020 gene nuoL 5281 3437 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_22020 5769 5446 gene locus_tag LOCUS_22030 gene nuoK 5769 5446 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_22030 6302 5766 gene locus_tag LOCUS_22040 6302 5766 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_22040 6889 6368 gene locus_tag LOCUS_22050 gene nuoI 6889 6368 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941014.1 protein_id gnl|my_center|LOCUS_22050 7857 6898 gene locus_tag LOCUS_22060 gene nuoH 7857 6898 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_22060 9169 7967 gene locus_tag LOCUS_22070 gene nuoD 9169 7967 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_22070 10022 9270 gene locus_tag LOCUS_22080 10022 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 10752 10102 gene locus_tag LOCUS_22090 10752 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 11036 10743 gene locus_tag LOCUS_22100 gene nuoA 11036 10743 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179273.1 protein_id gnl|my_center|LOCUS_22100 11469 12083 gene locus_tag LOCUS_22110 11469 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 13666 12839 gene locus_tag LOCUS_22120 13666 12839 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272779.1 protein_id gnl|my_center|LOCUS_22120 14680 13715 gene locus_tag LOCUS_22130 gene prfB 14680 13715 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018379.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22130 17989 14906 gene locus_tag LOCUS_22140 gene secA 17989 14906 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_22140 18854 18123 gene locus_tag LOCUS_22150 18854 18123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 20088 18913 gene locus_tag LOCUS_22160 20088 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 20686 20135 gene locus_tag LOCUS_22170 gene raiA 20686 20135 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_22170 20979 21953 gene locus_tag LOCUS_22180 20979 21953 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134749050.1 protein_id gnl|my_center|LOCUS_22180 23076 22159 gene locus_tag LOCUS_22190 23076 22159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 24389 23073 gene locus_tag LOCUS_22200 24389 23073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence049 571 203 gene locus_tag LOCUS_22210 571 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 1178 672 gene locus_tag LOCUS_22220 1178 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1587 1213 gene locus_tag LOCUS_22230 1587 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 1889 1614 gene locus_tag LOCUS_22240 1889 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2607 2002 gene locus_tag LOCUS_22250 2607 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 3123 2797 gene locus_tag LOCUS_22260 3123 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 6473 3030 gene locus_tag LOCUS_22270 6473 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 7786 6722 gene locus_tag LOCUS_22280 7786 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 10021 8849 gene locus_tag LOCUS_22290 10021 8849 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028858.1 protein_id gnl|my_center|LOCUS_22290 10525 10304 gene locus_tag LOCUS_22300 10525 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 12286 10568 gene locus_tag LOCUS_22310 12286 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 13091 12273 gene locus_tag LOCUS_22320 13091 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 13393 13091 gene locus_tag LOCUS_22330 13393 13091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 14283 13420 gene locus_tag LOCUS_22340 14283 13420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 14621 14382 gene locus_tag LOCUS_22350 14621 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 16571 14694 gene locus_tag LOCUS_22360 16571 14694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 17125 16568 gene locus_tag LOCUS_22370 17125 16568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 18337 17168 gene locus_tag LOCUS_22380 18337 17168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 18750 18334 gene locus_tag LOCUS_22390 18750 18334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 19157 18966 gene locus_tag LOCUS_22400 19157 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 19860 19189 gene locus_tag LOCUS_22410 19860 19189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 20775 19885 gene locus_tag LOCUS_22420 20775 19885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 21466 20942 gene locus_tag LOCUS_22430 21466 20942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 21610 22242 gene locus_tag LOCUS_22440 21610 22242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 22214 22969 gene locus_tag LOCUS_22450 22214 22969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 23496 23011 gene locus_tag LOCUS_22460 23496 23011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 23780 23496 gene locus_tag LOCUS_22470 23780 23496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence050 842 363 gene locus_tag LOCUS_22480 842 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1883 4171 gene locus_tag LOCUS_22490 1883 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 4477 4875 gene locus_tag LOCUS_22500 4477 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 5053 4853 gene locus_tag LOCUS_22510 5053 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 5282 5977 gene locus_tag LOCUS_22520 5282 5977 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257014.1 protein_id gnl|my_center|LOCUS_22520 7223 6222 gene locus_tag LOCUS_22530 7223 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 8599 7706 gene locus_tag LOCUS_22540 8599 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 10257 8863 gene locus_tag LOCUS_22550 10257 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 10772 12322 gene locus_tag LOCUS_22560 10772 12322 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223393.1 protein_id gnl|my_center|LOCUS_22560 12700 13329 gene locus_tag LOCUS_22570 12700 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 14445 13489 gene locus_tag LOCUS_22580 14445 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 14784 15872 gene locus_tag LOCUS_22590 14784 15872 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228181.1 protein_id gnl|my_center|LOCUS_22590 15894 17108 gene locus_tag LOCUS_22600 15894 17108 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228180.1 protein_id gnl|my_center|LOCUS_22600 18429 17122 gene locus_tag LOCUS_22610 18429 17122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 19320 19021 gene locus_tag LOCUS_22620 19320 19021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 20494 19313 gene locus_tag LOCUS_22630 20494 19313 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_22630 21480 20521 gene locus_tag LOCUS_22640 gene cysK 21480 20521 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_22640 22530 23525 gene locus_tag LOCUS_22650 22530 23525 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_22650 23608 23967 gene locus_tag LOCUS_22660 23608 23967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 23903 24076 gene locus_tag LOCUS_22670 23903 24076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence051 1941 772 gene locus_tag LOCUS_22680 1941 772 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 protein_id gnl|my_center|LOCUS_22680 2140 2403 gene locus_tag LOCUS_22690 2140 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 3277 2369 gene locus_tag LOCUS_22700 3277 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 5428 4175 gene locus_tag LOCUS_22710 5428 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 5628 5948 gene locus_tag LOCUS_22720 5628 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 5945 6730 gene locus_tag LOCUS_22730 5945 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 6827 7738 gene locus_tag LOCUS_22740 6827 7738 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_22740 7926 9998 gene locus_tag LOCUS_22750 7926 9998 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_22750 10663 10070 gene locus_tag LOCUS_22760 10663 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 10779 12230 gene locus_tag LOCUS_22770 10779 12230 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257259.1 protein_id gnl|my_center|LOCUS_22770 12628 13899 gene locus_tag LOCUS_22780 12628 13899 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065381.1 protein_id gnl|my_center|LOCUS_22780 13896 17924 gene locus_tag LOCUS_22790 13896 17924 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065380.1 protein_id gnl|my_center|LOCUS_22790 19292 18456 gene locus_tag LOCUS_22800 19292 18456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 19870 21339 gene locus_tag LOCUS_22810 19870 21339 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_22810 21910 21542 gene locus_tag LOCUS_22820 21910 21542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 23651 22626 gene locus_tag LOCUS_22830 23651 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence052 1724 225 gene locus_tag LOCUS_22840 1724 225 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_22840 3308 1875 gene locus_tag LOCUS_22850 3308 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 4679 3345 gene locus_tag LOCUS_22860 4679 3345 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_22860 5972 4914 gene locus_tag LOCUS_22870 5972 4914 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307767.1 protein_id gnl|my_center|LOCUS_22870 6805 5969 gene locus_tag LOCUS_22880 6805 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 7892 6858 gene locus_tag LOCUS_22890 7892 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 10976 8739 gene locus_tag LOCUS_22900 10976 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 11469 11167 gene locus_tag LOCUS_22910 11469 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 12200 11724 gene locus_tag LOCUS_22920 12200 11724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 14253 12817 gene locus_tag LOCUS_22930 14253 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 15899 14880 gene locus_tag LOCUS_22940 15899 14880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 16764 15949 gene locus_tag LOCUS_22950 16764 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 17831 16761 gene locus_tag LOCUS_22960 17831 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 18906 18427 gene locus_tag LOCUS_22970 18906 18427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 19843 19064 gene locus_tag LOCUS_22980 19843 19064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 20204 19905 gene locus_tag LOCUS_22990 20204 19905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 20561 21253 gene locus_tag LOCUS_23000 20561 21253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 21304 21540 gene locus_tag LOCUS_23010 21304 21540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 22265 21765 gene locus_tag LOCUS_23020 22265 21765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence053 1610 2191 gene locus_tag LOCUS_23030 1610 2191 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_23030 2227 2487 gene locus_tag LOCUS_23040 gene tusA 2227 2487 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_23040 2591 3202 gene locus_tag LOCUS_23050 2591 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 4357 3686 gene locus_tag LOCUS_23060 4357 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 4935 4861 gene locus_tag LOCUS_t00280 4935 4861 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5850 5116 gene locus_tag LOCUS_23070 5850 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 6873 6316 gene locus_tag LOCUS_23080 6873 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 6799 7281 gene locus_tag LOCUS_23090 6799 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 7612 7770 gene locus_tag LOCUS_23100 7612 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 7909 9273 gene locus_tag LOCUS_23110 7909 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 9361 10497 gene locus_tag LOCUS_23120 9361 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 10554 11048 gene locus_tag LOCUS_23130 10554 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 11100 11543 gene locus_tag LOCUS_23140 11100 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 11560 12225 gene locus_tag LOCUS_23150 11560 12225 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774859.1 protein_id gnl|my_center|LOCUS_23150 13047 12364 gene locus_tag LOCUS_23160 13047 12364 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081527.1 protein_id gnl|my_center|LOCUS_23160 14860 13322 gene locus_tag LOCUS_23170 14860 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 15845 15540 gene locus_tag LOCUS_23180 15845 15540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 17363 16239 gene locus_tag LOCUS_23190 17363 16239 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974245.1 protein_id gnl|my_center|LOCUS_23190 17496 18029 gene locus_tag LOCUS_23200 gene lepB 17496 18029 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056260.1 protein_id gnl|my_center|LOCUS_23200 18199 18705 gene locus_tag LOCUS_23210 18199 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 19387 18908 gene locus_tag LOCUS_23220 19387 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 20475 19567 gene locus_tag LOCUS_23230 20475 19567 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 protein_id gnl|my_center|LOCUS_23230 20972 21796 gene locus_tag LOCUS_23240 20972 21796 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031700.1 protein_id gnl|my_center|LOCUS_23240 21962 22690 gene locus_tag LOCUS_23250 21962 22690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence054 1377 565 gene locus_tag LOCUS_23260 1377 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1602 2462 gene locus_tag LOCUS_23270 1602 2462 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521810.1 protein_id gnl|my_center|LOCUS_23270 3549 2626 gene locus_tag LOCUS_23280 3549 2626 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_23280 4996 3959 gene locus_tag LOCUS_23290 4996 3959 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_23290 5090 5395 gene locus_tag LOCUS_23300 5090 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 5475 6479 gene locus_tag LOCUS_23310 5475 6479 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_23310 6546 6827 gene locus_tag LOCUS_23320 6546 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 6964 7452 gene locus_tag LOCUS_23330 6964 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 8739 7504 gene locus_tag LOCUS_23340 8739 7504 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762720.1 protein_id gnl|my_center|LOCUS_23340 10614 8923 gene locus_tag LOCUS_23350 10614 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 11074 13476 gene locus_tag LOCUS_23360 11074 13476 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918869.1 protein_id gnl|my_center|LOCUS_23360 14451 13510 gene locus_tag LOCUS_23370 14451 13510 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816041.1 protein_id gnl|my_center|LOCUS_23370 15442 14438 gene locus_tag LOCUS_23380 15442 14438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966899.1 protein_id gnl|my_center|LOCUS_23380 16463 15420 gene locus_tag LOCUS_23390 16463 15420 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048146.1 protein_id gnl|my_center|LOCUS_23390 17388 16465 gene locus_tag LOCUS_23400 17388 16465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966901.1 protein_id gnl|my_center|LOCUS_23400 19164 17494 gene locus_tag LOCUS_23410 19164 17494 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824544.1 protein_id gnl|my_center|LOCUS_23410 20006 19641 gene locus_tag LOCUS_23420 20006 19641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 21023 20172 gene locus_tag LOCUS_23430 21023 20172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23430 21275 21075 gene locus_tag LOCUS_23440 21275 21075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 22122 21625 gene locus_tag LOCUS_23450 22122 21625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 22315 22974 gene locus_tag LOCUS_23460 22315 22974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence055 2261 408 gene locus_tag LOCUS_23470 2261 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 2706 3392 gene locus_tag LOCUS_23480 2706 3392 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262987.1 protein_id gnl|my_center|LOCUS_23480 3560 4018 gene locus_tag LOCUS_23490 3560 4018 CDS product SACOL1771 family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830816.1 protein_id gnl|my_center|LOCUS_23490 4183 5997 gene locus_tag LOCUS_23500 4183 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 7373 6105 gene locus_tag LOCUS_23510 7373 6105 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929215.1 protein_id gnl|my_center|LOCUS_23510 8269 7448 gene locus_tag LOCUS_23520 8269 7448 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_23520 9208 8282 gene locus_tag LOCUS_23530 9208 8282 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_23530 10118 9759 gene locus_tag LOCUS_23540 10118 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 10744 10541 gene locus_tag LOCUS_23550 10744 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 11397 11750 gene locus_tag LOCUS_23560 11397 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 12681 14243 gene locus_tag LOCUS_23570 gene betC 12681 14243 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338340.1 protein_id gnl|my_center|LOCUS_23570 14265 14480 gene locus_tag LOCUS_23580 14265 14480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 14834 14607 gene locus_tag LOCUS_23590 14834 14607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 14947 15138 gene locus_tag LOCUS_23600 14947 15138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 16299 15244 gene locus_tag LOCUS_23610 16299 15244 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100168880.1 protein_id gnl|my_center|LOCUS_23610 16545 17462 gene locus_tag LOCUS_23620 16545 17462 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_23620 17539 17880 gene locus_tag LOCUS_23630 17539 17880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 19543 18113 gene locus_tag LOCUS_23640 19543 18113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 22896 19867 gene locus_tag LOCUS_23650 22896 19867 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911743.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence056 172 1890 gene locus_tag LOCUS_23660 172 1890 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_23660 2129 2851 gene locus_tag LOCUS_23670 2129 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 4168 5655 gene locus_tag LOCUS_23680 gene betC 4168 5655 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776263.1 protein_id gnl|my_center|LOCUS_23680 5691 6902 gene locus_tag LOCUS_23690 5691 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 6967 8424 gene locus_tag LOCUS_23700 6967 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 8516 9982 gene locus_tag LOCUS_23710 8516 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 10056 11513 gene locus_tag LOCUS_23720 10056 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 13540 11711 gene locus_tag LOCUS_23730 13540 11711 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172647606.1 protein_id gnl|my_center|LOCUS_23730 13778 14026 gene locus_tag LOCUS_23740 13778 14026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 14047 14253 gene locus_tag LOCUS_23750 14047 14253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 14679 14419 gene locus_tag LOCUS_23760 14679 14419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 14873 15112 gene locus_tag LOCUS_23770 14873 15112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 15602 15123 gene locus_tag LOCUS_23780 15602 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 16007 17287 gene locus_tag LOCUS_23790 16007 17287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 17323 18978 gene locus_tag LOCUS_23800 17323 18978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 19030 19197 gene locus_tag LOCUS_23810 19030 19197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 19861 20052 gene locus_tag LOCUS_23820 19861 20052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 20045 22243 gene locus_tag LOCUS_23830 20045 22243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence057 1203 145 gene locus_tag LOCUS_23840 1203 145 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958531.1 protein_id gnl|my_center|LOCUS_23840 1800 2270 gene locus_tag LOCUS_23850 1800 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2274 2669 gene locus_tag LOCUS_23860 gene flgC 2274 2669 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_23860 2722 3030 gene locus_tag LOCUS_23870 2722 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 3120 4709 gene locus_tag LOCUS_23880 gene fliF 3120 4709 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392292.1 protein_id gnl|my_center|LOCUS_23880 4744 5784 gene locus_tag LOCUS_23890 gene fliG 4744 5784 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870078.1 protein_id gnl|my_center|LOCUS_23890 5774 6466 gene locus_tag LOCUS_23900 5774 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 6459 7910 gene locus_tag LOCUS_23910 gene fliI 6459 7910 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_23910 7962 8417 gene locus_tag LOCUS_23920 7962 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 9025 9921 gene locus_tag LOCUS_23930 9025 9921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 9960 10313 gene locus_tag LOCUS_23940 9960 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 10371 11636 gene locus_tag LOCUS_23950 gene flgE 10371 11636 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_23950 11710 12150 gene locus_tag LOCUS_23960 11710 12150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 12188 13231 gene locus_tag LOCUS_23970 gene fliM 12188 13231 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666990.1 protein_id gnl|my_center|LOCUS_23970 13247 14158 gene locus_tag LOCUS_23980 13247 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 14196 14594 gene locus_tag LOCUS_23990 14196 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 14722 15543 gene locus_tag LOCUS_24000 gene fliP 14722 15543 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_24000 15728 15994 gene locus_tag LOCUS_24010 gene fliQ 15728 15994 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_24010 16040 16801 gene locus_tag LOCUS_24020 gene fliR 16040 16801 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455610.1 protein_id gnl|my_center|LOCUS_24020 16798 17979 gene locus_tag LOCUS_24030 gene flhB 16798 17979 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870058.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence058 1615 893 gene locus_tag LOCUS_24040 1615 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2998 1919 gene locus_tag LOCUS_24050 2998 1919 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887048.1 protein_id gnl|my_center|LOCUS_24050 3124 3759 gene locus_tag LOCUS_24060 3124 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 4601 3951 gene locus_tag LOCUS_24070 4601 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 5382 4816 gene locus_tag LOCUS_24080 5382 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 7216 5879 gene locus_tag LOCUS_24090 gene gabT 7216 5879 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_24090 7576 8061 gene locus_tag LOCUS_24100 7576 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 8399 9091 gene locus_tag LOCUS_24110 8399 9091 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393805.1 protein_id gnl|my_center|LOCUS_24110 9110 10765 gene locus_tag LOCUS_24120 9110 10765 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081361309.1 protein_id gnl|my_center|LOCUS_24120 10811 11410 gene locus_tag LOCUS_24130 10811 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 12317 11649 gene locus_tag LOCUS_24140 12317 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 13317 14609 gene locus_tag LOCUS_24150 13317 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 15066 15641 gene locus_tag LOCUS_24160 15066 15641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 15986 17590 gene locus_tag LOCUS_24170 15986 17590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 17640 18647 gene locus_tag LOCUS_24180 17640 18647 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_24180 18893 18693 gene locus_tag LOCUS_24190 18893 18693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 19034 19321 gene locus_tag LOCUS_24200 19034 19321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24200 >Feature sequence059 106 498 gene locus_tag LOCUS_24210 106 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2275 464 gene locus_tag LOCUS_24220 gene aspS 2275 464 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_24220 3580 2330 gene locus_tag LOCUS_24230 gene hisS 3580 2330 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_24230 4766 4221 gene locus_tag LOCUS_24240 4766 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 5654 4962 gene locus_tag LOCUS_24250 5654 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 6406 5942 gene locus_tag LOCUS_24260 gene dtd 6406 5942 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393181.1 protein_id gnl|my_center|LOCUS_24260 9505 7211 gene locus_tag LOCUS_24270 9505 7211 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_24270 10679 9615 gene locus_tag LOCUS_24280 gene ftsZ 10679 9615 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_24280 12142 10886 gene locus_tag LOCUS_24290 gene ftsA 12142 10886 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256643.1 protein_id gnl|my_center|LOCUS_24290 13100 12339 gene locus_tag LOCUS_24300 13100 12339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24300 13804 13589 gene locus_tag LOCUS_24310 13804 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 13695 14939 gene locus_tag LOCUS_24320 13695 14939 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391664.1 protein_id gnl|my_center|LOCUS_24320 16253 15000 gene locus_tag LOCUS_24330 gene icd 16253 15000 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868777.1 protein_id gnl|my_center|LOCUS_24330 16549 17490 gene locus_tag LOCUS_24340 16549 17490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 18067 18555 gene locus_tag LOCUS_24350 18067 18555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence060 <1 1327 gene locus_tag LOCUS_24360 <1 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766268.1:arylsulfatase 2876 1452 gene locus_tag LOCUS_24370 2876 1452 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 protein_id gnl|my_center|LOCUS_24370 4334 2931 gene locus_tag LOCUS_24380 4334 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 4868 4569 gene locus_tag LOCUS_24390 4868 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 4821 5273 gene locus_tag LOCUS_24400 4821 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 5435 6529 gene locus_tag LOCUS_24410 gene degA 5435 6529 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_24410 8980 6881 gene locus_tag LOCUS_24420 8980 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 9390 9977 gene locus_tag LOCUS_24430 9390 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 9886 9895 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10081 12162 gene locus_tag LOCUS_24440 10081 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 12188 13312 gene locus_tag LOCUS_24450 12188 13312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 13412 15148 gene locus_tag LOCUS_24460 gene mutL 13412 15148 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392628.1 protein_id gnl|my_center|LOCUS_24460 15254 16225 gene locus_tag LOCUS_24470 gene miaA 15254 16225 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_24470 16379 17371 gene locus_tag LOCUS_24480 16379 17371 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811577.1 protein_id gnl|my_center|LOCUS_24480 18150 17857 gene locus_tag LOCUS_24490 18150 17857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence061 495 2198 gene locus_tag LOCUS_24500 gene kdpA 495 2198 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391515.1 protein_id gnl|my_center|LOCUS_24500 2421 4496 gene locus_tag LOCUS_24510 gene kdpB 2421 4496 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965691.1 protein_id gnl|my_center|LOCUS_24510 4641 5276 gene locus_tag LOCUS_24520 4641 5276 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089516.1 protein_id gnl|my_center|LOCUS_24520 5555 5704 gene locus_tag LOCUS_24530 5555 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 6180 7478 gene locus_tag LOCUS_24540 6180 7478 CDS product aromatic-ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064970.1 protein_id gnl|my_center|LOCUS_24540 7465 8013 gene locus_tag LOCUS_24550 7465 8013 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814492.1 protein_id gnl|my_center|LOCUS_24550 8070 8306 gene locus_tag LOCUS_24560 8070 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 9310 8435 gene locus_tag LOCUS_24570 9310 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 9644 10444 gene locus_tag LOCUS_24580 9644 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 10852 10481 gene locus_tag LOCUS_24590 10852 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 12864 10849 gene locus_tag LOCUS_24600 12864 10849 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493712.1 protein_id gnl|my_center|LOCUS_24600 12939 13133 gene locus_tag LOCUS_24610 12939 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 13903 13052 gene locus_tag LOCUS_24620 13903 13052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 14926 13907 gene locus_tag LOCUS_24630 14926 13907 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_24630 16511 15549 gene locus_tag LOCUS_24640 gene argF 16511 15549 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_24640 17352 17777 gene locus_tag LOCUS_24650 17352 17777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence062 695 2017 gene locus_tag LOCUS_24660 695 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 3138 2092 gene locus_tag LOCUS_24670 3138 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 5571 3160 gene locus_tag LOCUS_24680 gene priA 5571 3160 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_24680 6840 5590 gene locus_tag LOCUS_24690 gene coaBC 6840 5590 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228764.1 protein_id gnl|my_center|LOCUS_24690 7225 6905 gene locus_tag LOCUS_24700 7225 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 7570 7265 gene locus_tag LOCUS_24710 7570 7265 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392410.1 protein_id gnl|my_center|LOCUS_24710 8482 7613 gene locus_tag LOCUS_24720 8482 7613 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_24720 8989 8576 gene locus_tag LOCUS_24730 8989 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 9722 9015 gene locus_tag LOCUS_24740 9722 9015 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393069.1 protein_id gnl|my_center|LOCUS_24740 10308 9715 gene locus_tag LOCUS_24750 10308 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 11267 10305 gene locus_tag LOCUS_24760 11267 10305 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409743.1 protein_id gnl|my_center|LOCUS_24760 11780 13291 gene locus_tag LOCUS_24770 11780 13291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 13446 14336 gene locus_tag LOCUS_24780 13446 14336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 14589 15059 gene locus_tag LOCUS_24790 14589 15059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 15450 16754 gene locus_tag LOCUS_24800 15450 16754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence063 1181 2425 gene locus_tag LOCUS_24810 1181 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 2445 3326 gene locus_tag LOCUS_24820 2445 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 3399 5279 gene locus_tag LOCUS_24830 3399 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 5793 5530 gene locus_tag LOCUS_24840 5793 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 6961 6197 gene locus_tag LOCUS_24850 6961 6197 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340751.1 protein_id gnl|my_center|LOCUS_24850 7549 7154 gene locus_tag LOCUS_24860 7549 7154 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101061.1 protein_id gnl|my_center|LOCUS_24860 7542 7859 gene locus_tag LOCUS_24870 7542 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 9451 8249 gene locus_tag LOCUS_24880 9451 8249 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392761.1 protein_id gnl|my_center|LOCUS_24880 10557 9445 gene locus_tag LOCUS_24890 10557 9445 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_24890 11191 13371 gene locus_tag LOCUS_24900 11191 13371 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142384.1 protein_id gnl|my_center|LOCUS_24900 13499 15775 gene locus_tag LOCUS_24910 13499 15775 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_24910 17226 15850 gene locus_tag LOCUS_24920 17226 15850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence064 122 616 gene locus_tag LOCUS_24930 122 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 693 2933 gene locus_tag LOCUS_24940 693 2933 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_24940 2930 3853 gene locus_tag LOCUS_24950 2930 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 3843 5069 gene locus_tag LOCUS_24960 gene tgt 3843 5069 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_24960 5464 7035 gene locus_tag LOCUS_24970 5464 7035 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_24970 7270 7683 gene locus_tag LOCUS_24980 7270 7683 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869046.1 protein_id gnl|my_center|LOCUS_24980 7724 8326 gene locus_tag LOCUS_24990 7724 8326 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_24990 8367 9272 gene locus_tag LOCUS_25000 8367 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 9392 10327 gene locus_tag LOCUS_25010 9392 10327 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_25010 10904 11953 gene locus_tag LOCUS_25020 gene ychF 10904 11953 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393954.1 protein_id gnl|my_center|LOCUS_25020 12324 13100 gene locus_tag LOCUS_25030 12324 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 13449 14453 gene locus_tag LOCUS_25040 13449 14453 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_25040 14583 14657 gene locus_tag LOCUS_t00290 14583 14657 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14674 14749 gene locus_tag LOCUS_t00300 14674 14749 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 15185 14862 gene locus_tag LOCUS_25050 15185 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25050 15820 15557 gene locus_tag LOCUS_25060 15820 15557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 16071 15817 gene locus_tag LOCUS_25070 16071 15817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 16624 16154 gene locus_tag LOCUS_25080 16624 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 16663 16932 gene locus_tag LOCUS_25090 16663 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence065 <1 1182 gene locus_tag LOCUS_25100 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391733.1:S-layer homology domain-containing protein 1866 2399 gene locus_tag LOCUS_25110 1866 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2424 2594 gene locus_tag LOCUS_25120 2424 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 3135 3524 gene locus_tag LOCUS_25130 3135 3524 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728177.1 protein_id gnl|my_center|LOCUS_25130 3521 4420 gene locus_tag LOCUS_25140 3521 4420 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228840.1 protein_id gnl|my_center|LOCUS_25140 5454 6596 gene locus_tag LOCUS_25150 5454 6596 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090007.1 protein_id gnl|my_center|LOCUS_25150 6593 9436 gene locus_tag LOCUS_25160 6593 9436 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730250.1 protein_id gnl|my_center|LOCUS_25160 11650 9368 gene locus_tag LOCUS_25170 11650 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 11919 12188 gene locus_tag LOCUS_25180 11919 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 12835 13641 gene locus_tag LOCUS_25190 12835 13641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 13638 14288 gene locus_tag LOCUS_25200 13638 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 14296 14760 gene locus_tag LOCUS_25210 14296 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 15357 15563 gene locus_tag LOCUS_25220 15357 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 15633 15851 gene locus_tag LOCUS_25230 15633 15851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence066 1717 3084 gene locus_tag LOCUS_25240 1717 3084 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 protein_id gnl|my_center|LOCUS_25240 3193 4242 gene locus_tag LOCUS_25250 3193 4242 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_25250 4273 5703 gene locus_tag LOCUS_25260 4273 5703 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_25260 5700 6473 gene locus_tag LOCUS_25270 5700 6473 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973533.1 protein_id gnl|my_center|LOCUS_25270 6508 7440 gene locus_tag LOCUS_25280 6508 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 8030 9661 gene locus_tag LOCUS_25290 8030 9661 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_25290 9719 9931 gene locus_tag LOCUS_25300 9719 9931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 11733 10231 gene locus_tag LOCUS_25310 11733 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 12813 14324 gene locus_tag LOCUS_25320 12813 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 14830 15897 gene locus_tag LOCUS_25330 14830 15897 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence067 1143 382 gene locus_tag LOCUS_25340 1143 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 1377 1177 gene locus_tag LOCUS_25350 1377 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3601 1355 gene locus_tag LOCUS_25360 3601 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 4071 3715 gene locus_tag LOCUS_25370 4071 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 5304 4156 gene locus_tag LOCUS_25380 5304 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 6449 5421 gene locus_tag LOCUS_25390 6449 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 7058 6618 gene locus_tag LOCUS_25400 7058 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 7532 7083 gene locus_tag LOCUS_25410 7532 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 7983 7516 gene locus_tag LOCUS_25420 7983 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 8295 8080 gene locus_tag LOCUS_25430 8295 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 8632 8369 gene locus_tag LOCUS_25440 8632 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 9523 8975 gene locus_tag LOCUS_25450 9523 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 9815 9582 gene locus_tag LOCUS_25460 9815 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 10182 9949 gene locus_tag LOCUS_25470 10182 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 11210 10302 gene locus_tag LOCUS_25480 11210 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 12134 11211 gene locus_tag LOCUS_25490 12134 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 13520 12162 gene locus_tag LOCUS_25500 13520 12162 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156528645.1 protein_id gnl|my_center|LOCUS_25500 14780 13533 gene locus_tag LOCUS_25510 14780 13533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 15675 14764 gene locus_tag LOCUS_25520 15675 14764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence068 282 127 gene locus_tag LOCUS_25530 282 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1103 555 gene locus_tag LOCUS_25540 1103 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2267 1791 gene locus_tag LOCUS_25550 2267 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2766 2422 gene locus_tag LOCUS_25560 2766 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 2870 3154 gene locus_tag LOCUS_25570 2870 3154 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458940.1 protein_id gnl|my_center|LOCUS_25570 3516 3244 gene locus_tag LOCUS_25580 3516 3244 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_25580 4518 3655 gene locus_tag LOCUS_25590 gene mazG 4518 3655 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_25590 6261 4582 gene locus_tag LOCUS_25600 gene spoVB 6261 4582 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812078.1 protein_id gnl|my_center|LOCUS_25600 6953 6399 gene locus_tag LOCUS_25610 gene spoVT 6953 6399 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_25610 8508 7246 gene locus_tag LOCUS_25620 8508 7246 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_25620 9120 8731 gene locus_tag LOCUS_25630 9120 8731 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_25630 13045 9146 gene locus_tag LOCUS_25640 gene mfd 13045 9146 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_25640 13708 13157 gene locus_tag LOCUS_25650 gene pth 13708 13157 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_25650 14513 13902 gene locus_tag LOCUS_25660 14513 13902 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768871.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence069 279 1091 gene locus_tag LOCUS_25670 279 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2424 1348 gene locus_tag LOCUS_25680 gene ispG 2424 1348 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_25680 3873 2794 gene locus_tag LOCUS_25690 gene rseP 3873 2794 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_25690 5144 3870 gene locus_tag LOCUS_25700 5144 3870 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_25700 6375 5311 gene locus_tag LOCUS_25710 6375 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 7376 6501 gene locus_tag LOCUS_25720 7376 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 8146 7391 gene locus_tag LOCUS_25730 8146 7391 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_25730 8421 8149 gene locus_tag LOCUS_25740 8421 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 9145 8588 gene locus_tag LOCUS_25750 gene frr 9145 8588 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_25750 10166 9438 gene locus_tag LOCUS_25760 gene pyrH 10166 9438 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_25760 10792 10163 gene locus_tag LOCUS_25770 gene tsf 10792 10163 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_25770 11693 10926 gene locus_tag LOCUS_25780 gene rpsB 11693 10926 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_25780 <14603 12324 gene locus_tag LOCUS_25790 <14603 12324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393841.1:S-layer homology domain-containing protein >Feature sequence070 446 1201 gene locus_tag LOCUS_25800 446 1201 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_25800 3066 1633 gene locus_tag LOCUS_25810 3066 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3381 5849 gene locus_tag LOCUS_25820 3381 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 6125 6523 gene locus_tag LOCUS_25830 6125 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 6570 6812 gene locus_tag LOCUS_25840 6570 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 8516 7212 gene locus_tag LOCUS_25850 8516 7212 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970459.1 protein_id gnl|my_center|LOCUS_25850 9902 9141 gene locus_tag LOCUS_25860 9902 9141 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084048.1 protein_id gnl|my_center|LOCUS_25860 10837 10466 gene locus_tag LOCUS_25870 10837 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 11896 11003 gene locus_tag LOCUS_25880 11896 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 <14054 12010 gene locus_tag LOCUS_25890 <14054 12010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122837.1:pyruvate carboxylase >Feature sequence071 2018 627 gene locus_tag LOCUS_25900 2018 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2317 1901 gene locus_tag LOCUS_25910 2317 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 3102 2425 gene locus_tag LOCUS_25920 3102 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 4374 3274 gene locus_tag LOCUS_25930 4374 3274 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_25930 5861 4476 gene locus_tag LOCUS_25940 5861 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 6922 6011 gene locus_tag LOCUS_25950 6922 6011 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_25950 8018 7008 gene locus_tag LOCUS_25960 8018 7008 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119268.1 protein_id gnl|my_center|LOCUS_25960 9136 8123 gene locus_tag LOCUS_25970 9136 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 10271 9477 gene locus_tag LOCUS_25980 10271 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 11376 10354 gene locus_tag LOCUS_25990 11376 10354 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259623.1 protein_id gnl|my_center|LOCUS_25990 12924 11470 gene locus_tag LOCUS_26000 12924 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence072 44 1393 gene locus_tag LOCUS_26010 gene flhF 44 1393 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922141.1 protein_id gnl|my_center|LOCUS_26010 1662 2720 gene locus_tag LOCUS_26020 1662 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2759 3508 gene locus_tag LOCUS_26030 2759 3508 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460743.1 protein_id gnl|my_center|LOCUS_26030 3614 3856 gene locus_tag LOCUS_26040 3614 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 4325 4792 gene locus_tag LOCUS_26050 gene lspA 4325 4792 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_26050 4789 5820 gene locus_tag LOCUS_26060 4789 5820 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_26060 5843 6607 gene locus_tag LOCUS_26070 5843 6607 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229453.1 protein_id gnl|my_center|LOCUS_26070 8043 6700 gene locus_tag LOCUS_26080 8043 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 8511 10790 gene locus_tag LOCUS_26090 8511 10790 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392047.1 protein_id gnl|my_center|LOCUS_26090 11239 12135 gene locus_tag LOCUS_26100 gene gnd 11239 12135 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_26100 13034 12405 gene locus_tag LOCUS_26110 13034 12405 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_26110 13567 13031 gene locus_tag LOCUS_26120 13567 13031 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence073 155 850 gene locus_tag LOCUS_26130 155 850 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_26130 847 1536 gene locus_tag LOCUS_26140 847 1536 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_26140 1533 2132 gene locus_tag LOCUS_26150 1533 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2244 2822 gene locus_tag LOCUS_26160 gene pgsA 2244 2822 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_26160 2809 3786 gene locus_tag LOCUS_26170 2809 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 3943 4719 gene locus_tag LOCUS_26180 3943 4719 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391013.1 protein_id gnl|my_center|LOCUS_26180 4898 5263 gene locus_tag LOCUS_26190 4898 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 5555 5908 gene locus_tag LOCUS_26200 5555 5908 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220586932.1 protein_id gnl|my_center|LOCUS_26200 7543 6140 gene locus_tag LOCUS_26210 7543 6140 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211039795.1 protein_id gnl|my_center|LOCUS_26210 8166 7540 gene locus_tag LOCUS_26220 8166 7540 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479889.1 protein_id gnl|my_center|LOCUS_26220 8488 8237 gene locus_tag LOCUS_26230 8488 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 8700 8969 gene locus_tag LOCUS_26240 8700 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 9253 9002 gene locus_tag LOCUS_26250 9253 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 9228 9353 gene locus_tag LOCUS_26260 9228 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 9465 10463 gene locus_tag LOCUS_26270 9465 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26270 10667 11764 gene locus_tag LOCUS_26280 10667 11764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 13376 11652 gene locus_tag LOCUS_26290 13376 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029003.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence074 1904 471 gene locus_tag LOCUS_26300 1904 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 3536 1911 gene locus_tag LOCUS_26310 3536 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26310 4040 5035 gene locus_tag LOCUS_26320 4040 5035 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_26320 5109 6878 gene locus_tag LOCUS_26330 5109 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 6910 8625 gene locus_tag LOCUS_26340 gene araD 6910 8625 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228759.1 protein_id gnl|my_center|LOCUS_26340 8622 9458 gene locus_tag LOCUS_26350 8622 9458 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846658.1 protein_id gnl|my_center|LOCUS_26350 9484 10830 gene locus_tag LOCUS_26360 gene hemL 9484 10830 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_26360 10922 12061 gene locus_tag LOCUS_26370 10922 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence075 70 2553 gene locus_tag LOCUS_26380 70 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 2570 3688 gene locus_tag LOCUS_26390 2570 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 3685 3951 gene locus_tag LOCUS_26400 3685 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26400 4312 5115 gene locus_tag LOCUS_26410 4312 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 5660 5307 gene locus_tag LOCUS_26420 5660 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 6274 5657 gene locus_tag LOCUS_26430 6274 5657 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_26430 6684 6376 gene locus_tag LOCUS_26440 6684 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 7450 6677 gene locus_tag LOCUS_26450 7450 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 8213 7422 gene locus_tag LOCUS_26460 8213 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 8161 8086 gene locus_tag LOCUS_t00310 8161 8086 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8431 8210 gene locus_tag LOCUS_26470 8431 8210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 9668 8502 gene locus_tag LOCUS_26480 9668 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence076 2357 2599 gene locus_tag LOCUS_26490 2357 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 3157 4596 gene locus_tag LOCUS_26500 3157 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 5294 5046 gene locus_tag LOCUS_26510 5294 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 5691 7199 gene locus_tag LOCUS_26520 5691 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 7480 7262 gene locus_tag LOCUS_26530 7480 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 7364 7891 gene locus_tag LOCUS_26540 7364 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 9243 8413 gene locus_tag LOCUS_26550 9243 8413 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225766.1 protein_id gnl|my_center|LOCUS_26550 10619 9555 gene locus_tag LOCUS_26560 gene pgl 10619 9555 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence077 <1 2259 gene locus_tag LOCUS_26570 <1 2259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257057.1:ATP-binding protein 3192 3644 gene locus_tag LOCUS_26580 3192 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 3629 5017 gene locus_tag LOCUS_26590 3629 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 5014 5652 gene locus_tag LOCUS_26600 5014 5652 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_26600 5957 6910 gene locus_tag LOCUS_26610 5957 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 7326 7835 gene locus_tag LOCUS_26620 7326 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 9115 7721 gene locus_tag LOCUS_26630 9115 7721 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616190.1 protein_id gnl|my_center|LOCUS_26630 10374 9499 gene locus_tag LOCUS_26640 10374 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_26640 10783 10460 gene locus_tag LOCUS_26650 10783 10460 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225051.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence078 249 34 gene locus_tag LOCUS_26660 249 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 1152 382 gene locus_tag LOCUS_26670 1152 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1755 1345 gene locus_tag LOCUS_26680 1755 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 2567 1773 gene locus_tag LOCUS_26690 2567 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 3118 2564 gene locus_tag LOCUS_26700 3118 2564 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_26700 3436 3445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5559 4552 gene locus_tag LOCUS_26710 5559 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 5888 6052 gene locus_tag LOCUS_26720 5888 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 6970 6134 gene locus_tag LOCUS_26730 6970 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 8229 6964 gene locus_tag LOCUS_26740 8229 6964 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705356.1 protein_id gnl|my_center|LOCUS_26740 9484 8204 gene locus_tag LOCUS_26750 9484 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 11016 9553 gene locus_tag LOCUS_26760 11016 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence079 1984 344 gene locus_tag LOCUS_26770 1984 344 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256527.1 protein_id gnl|my_center|LOCUS_26770 4652 2931 gene locus_tag LOCUS_26780 4652 2931 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272339.1 protein_id gnl|my_center|LOCUS_26780 5048 4973 gene locus_tag LOCUS_t00320 5048 4973 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6408 5125 gene locus_tag LOCUS_26790 6408 5125 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_26790 7798 6467 gene locus_tag LOCUS_26800 gene dnaB 7798 6467 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391682.1 protein_id gnl|my_center|LOCUS_26800 8261 7815 gene locus_tag LOCUS_26810 gene rplI 8261 7815 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391680.1 protein_id gnl|my_center|LOCUS_26810 9199 8258 gene locus_tag LOCUS_26820 9199 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 9938 9534 gene locus_tag LOCUS_26830 gene ssb 9938 9534 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981967.1 protein_id gnl|my_center|LOCUS_26830 10453 10001 gene locus_tag LOCUS_26840 10453 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 10931 10596 gene locus_tag LOCUS_26850 10931 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence080 553 1189 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq taacaacccccgtgcatacggggatgac 3504 1282 gene locus_tag LOCUS_26860 3504 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 4291 3497 gene locus_tag LOCUS_26870 4291 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 5432 4284 gene locus_tag LOCUS_26880 5432 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 6315 5530 gene locus_tag LOCUS_26890 6315 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 6340 6727 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tagtaacccccgtgtgtacggg 7439 6789 gene locus_tag LOCUS_26900 7439 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 8119 7658 gene locus_tag LOCUS_26910 8119 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 9424 8123 gene locus_tag LOCUS_26920 9424 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 9791 9462 gene locus_tag LOCUS_26930 9791 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 <10877 9792 gene locus_tag LOCUS_26940 <10877 9792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946475.1:replicative DNA helicase >Feature sequence081 1024 437 gene locus_tag LOCUS_26950 1024 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 1241 1165 gene locus_tag LOCUS_t00330 1241 1165 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1769 3031 gene locus_tag LOCUS_26960 1769 3031 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_26960 3028 5541 gene locus_tag LOCUS_26970 3028 5541 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_26970 6924 5821 gene locus_tag LOCUS_26980 6924 5821 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705009.1 protein_id gnl|my_center|LOCUS_26980 8901 7345 gene locus_tag LOCUS_26990 8901 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 10040 8949 gene locus_tag LOCUS_27000 10040 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 10831 10541 gene locus_tag LOCUS_27010 10831 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence082 2015 2968 gene locus_tag LOCUS_27020 2015 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 3160 3573 gene locus_tag LOCUS_27030 3160 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 3570 6947 gene locus_tag LOCUS_27040 3570 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 7124 8089 gene locus_tag LOCUS_27050 7124 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 8091 8399 gene locus_tag LOCUS_27060 8091 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 8524 8757 gene locus_tag LOCUS_27070 8524 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 8750 8998 gene locus_tag LOCUS_27080 8750 8998 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391794.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence083 1581 490 gene locus_tag LOCUS_27090 1581 490 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391697.1 protein_id gnl|my_center|LOCUS_27090 1814 2131 gene locus_tag LOCUS_27100 1814 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2309 3127 gene locus_tag LOCUS_27110 2309 3127 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_27110 3356 3093 gene locus_tag LOCUS_27120 3356 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3273 3506 gene locus_tag LOCUS_27130 3273 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 3826 3503 gene locus_tag LOCUS_27140 3826 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 4014 4643 gene locus_tag LOCUS_27150 gene lexA 4014 4643 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_27150 6201 4822 gene locus_tag LOCUS_27160 gene glnA 6201 4822 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_27160 7842 6364 gene locus_tag LOCUS_27170 gene spoIVA 7842 6364 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_27170 9448 8030 gene locus_tag LOCUS_27180 gene der 9448 8030 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_27180 10088 9480 gene locus_tag LOCUS_27190 10088 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence084 1473 778 gene locus_tag LOCUS_27200 1473 778 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_27200 1939 3051 gene locus_tag LOCUS_27210 1939 3051 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_27210 3118 3534 gene locus_tag LOCUS_27220 3118 3534 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110592.1 protein_id gnl|my_center|LOCUS_27220 3531 5033 gene locus_tag LOCUS_27230 3531 5033 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198383.1 protein_id gnl|my_center|LOCUS_27230 5102 5833 gene locus_tag LOCUS_27240 5102 5833 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_27240 6390 7331 gene locus_tag LOCUS_27250 6390 7331 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227723.1 protein_id gnl|my_center|LOCUS_27250 7909 8421 gene locus_tag LOCUS_27260 7909 8421 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725092.1 protein_id gnl|my_center|LOCUS_27260 8411 9253 gene locus_tag LOCUS_27270 8411 9253 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530129.1 protein_id gnl|my_center|LOCUS_27270 10186 9782 gene locus_tag LOCUS_27280 10186 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence085 860 57 gene locus_tag LOCUS_27290 860 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 1240 1315 gene locus_tag LOCUS_t00340 1240 1315 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1257 1946 gene locus_tag LOCUS_27300 1257 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514021.1 protein_id gnl|my_center|LOCUS_27300 1943 2617 gene locus_tag LOCUS_27310 1943 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 2647 2967 gene locus_tag LOCUS_27320 2647 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 3026 3745 gene locus_tag LOCUS_27330 3026 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3818 4003 gene locus_tag LOCUS_27340 3818 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 4012 4461 gene locus_tag LOCUS_27350 4012 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 4779 4597 gene locus_tag LOCUS_27360 4779 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 5599 4796 gene locus_tag LOCUS_27370 5599 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 7981 5645 gene locus_tag LOCUS_27380 7981 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 9150 7918 gene locus_tag LOCUS_27390 9150 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 7994 8003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9572 9147 gene locus_tag LOCUS_27400 9572 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 10436 9615 gene locus_tag LOCUS_27410 10436 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence086 1396 617 gene locus_tag LOCUS_27420 1396 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 1526 1993 gene locus_tag LOCUS_27430 1526 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1957 2349 gene locus_tag LOCUS_27440 1957 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2356 2904 gene locus_tag LOCUS_27450 2356 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 3082 3519 gene locus_tag LOCUS_27460 3082 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 3529 4029 gene locus_tag LOCUS_27470 3529 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27470 4140 4391 gene locus_tag LOCUS_27480 4140 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 4750 4616 gene locus_tag LOCUS_27490 4750 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 4971 5372 gene locus_tag LOCUS_27500 4971 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 5465 6271 gene locus_tag LOCUS_27510 5465 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 6350 6616 gene locus_tag LOCUS_27520 6350 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 6649 6840 gene locus_tag LOCUS_27530 6649 6840 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391841.1 protein_id gnl|my_center|LOCUS_27530 7024 7926 gene locus_tag LOCUS_27540 7024 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 7976 8305 gene locus_tag LOCUS_27550 7976 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 8349 9515 gene locus_tag LOCUS_27560 8349 9515 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_27560 10163 10005 gene locus_tag LOCUS_27570 10163 10005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence087 2474 333 gene locus_tag LOCUS_27580 gene brxL 2474 333 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942749.1 protein_id gnl|my_center|LOCUS_27580 3761 2478 gene locus_tag LOCUS_27590 3761 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 4903 3761 gene locus_tag LOCUS_27600 4903 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 5658 4900 gene locus_tag LOCUS_27610 5658 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 7857 6094 gene locus_tag LOCUS_27620 7857 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 7856 8776 gene locus_tag LOCUS_27630 7856 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 8844 9089 gene locus_tag LOCUS_27640 8844 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 9273 10277 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtcgatccccgcgcacgcgggggagcc >Feature sequence088 838 11 gene locus_tag LOCUS_27650 838 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 1994 1152 gene locus_tag LOCUS_27660 gene dat 1994 1152 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233305.1 protein_id gnl|my_center|LOCUS_27660 2090 3016 gene locus_tag LOCUS_27670 2090 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3255 3797 gene locus_tag LOCUS_27680 3255 3797 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 protein_id gnl|my_center|LOCUS_27680 4149 5234 gene locus_tag LOCUS_27690 4149 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 5400 6374 gene locus_tag LOCUS_27700 5400 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 6430 6933 gene locus_tag LOCUS_27710 6430 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 7043 7411 gene locus_tag LOCUS_27720 gene aroH 7043 7411 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258091.1 protein_id gnl|my_center|LOCUS_27720 7546 8349 gene locus_tag LOCUS_27730 gene cmk 7546 8349 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_27730 8346 8966 gene locus_tag LOCUS_27740 8346 8966 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_27740 >Feature sequence089 1255 392 gene locus_tag LOCUS_27750 1255 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 1512 1252 gene locus_tag LOCUS_27760 1512 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2144 1515 gene locus_tag LOCUS_27770 2144 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2465 2274 gene locus_tag LOCUS_27780 2465 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2830 2513 gene locus_tag LOCUS_27790 2830 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 3603 2917 gene locus_tag LOCUS_27800 3603 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 3860 3603 gene locus_tag LOCUS_27810 3860 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 4029 4736 gene locus_tag LOCUS_27820 4029 4736 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258296.1 protein_id gnl|my_center|LOCUS_27820 4733 5815 gene locus_tag LOCUS_27830 4733 5815 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259230.1 protein_id gnl|my_center|LOCUS_27830 6154 5852 gene locus_tag LOCUS_27840 6154 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 6390 6178 gene locus_tag LOCUS_27850 6390 6178 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689029.1 protein_id gnl|my_center|LOCUS_27850 8977 6473 gene locus_tag LOCUS_27860 gene copA 8977 6473 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_27860 10104 9481 gene locus_tag LOCUS_27870 10104 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence090 421 1626 gene locus_tag LOCUS_27880 421 1626 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 protein_id gnl|my_center|LOCUS_27880 2474 3910 gene locus_tag LOCUS_27890 2474 3910 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267581.1 protein_id gnl|my_center|LOCUS_27890 4322 5503 gene locus_tag LOCUS_27900 4322 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 5568 5948 gene locus_tag LOCUS_27910 5568 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 6019 6927 gene locus_tag LOCUS_27920 6019 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 7434 7736 gene locus_tag LOCUS_27930 7434 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 7699 9306 gene locus_tag LOCUS_27940 7699 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence091 282 1331 gene locus_tag LOCUS_27950 282 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 1428 2675 gene locus_tag LOCUS_27960 1428 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 2678 4213 gene locus_tag LOCUS_27970 2678 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 4245 5120 gene locus_tag LOCUS_27980 4245 5120 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_27980 5343 5975 gene locus_tag LOCUS_27990 5343 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 6077 7561 gene locus_tag LOCUS_28000 gene lysS 6077 7561 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_28000 8023 9545 gene locus_tag LOCUS_r00010 8023 9545 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 8423 8432 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9726 9802 gene locus_tag LOCUS_t00350 9726 9802 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence092 541 1521 gene locus_tag LOCUS_28010 541 1521 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940920.1 protein_id gnl|my_center|LOCUS_28010 3765 1531 gene locus_tag LOCUS_28020 3765 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 5561 3804 gene locus_tag LOCUS_28030 gene pelF 5561 3804 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887358.1 protein_id gnl|my_center|LOCUS_28030 6468 5566 gene locus_tag LOCUS_28040 6468 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 8675 6585 gene locus_tag LOCUS_28050 8675 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 9292 8675 gene locus_tag LOCUS_28060 9292 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence093 46 888 gene locus_tag LOCUS_28070 46 888 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768235.1 protein_id gnl|my_center|LOCUS_28070 1933 1181 gene locus_tag LOCUS_28080 1933 1181 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 protein_id gnl|my_center|LOCUS_28080 2208 3965 gene locus_tag LOCUS_28090 2208 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 4047 6431 gene locus_tag LOCUS_28100 4047 6431 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392767.1 protein_id gnl|my_center|LOCUS_28100 6424 7761 gene locus_tag LOCUS_28110 6424 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 7804 8526 gene locus_tag LOCUS_28120 7804 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28120 >Feature sequence094 953 648 gene locus_tag LOCUS_28130 953 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 1665 3107 gene locus_tag LOCUS_28140 1665 3107 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803772.1 protein_id gnl|my_center|LOCUS_28140 3902 3756 gene locus_tag LOCUS_28150 3902 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 4131 3973 gene locus_tag LOCUS_28160 4131 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 5659 4289 gene locus_tag LOCUS_28170 5659 4289 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_28170 7149 5713 gene locus_tag LOCUS_28180 7149 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 8062 7583 gene locus_tag LOCUS_28190 8062 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 8406 8059 gene locus_tag LOCUS_28200 8406 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence095 580 2166 gene locus_tag LOCUS_28210 580 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 2381 2455 gene locus_tag LOCUS_t00360 2381 2455 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2849 3841 gene locus_tag LOCUS_28220 2849 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 3947 4204 gene locus_tag LOCUS_28230 3947 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 4477 5841 gene locus_tag LOCUS_28240 4477 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 5838 6257 gene locus_tag LOCUS_28250 5838 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 6226 7389 gene locus_tag LOCUS_28260 6226 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 7456 7671 gene locus_tag LOCUS_28270 7456 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 7750 8367 gene locus_tag LOCUS_28280 7750 8367 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_28280 >Feature sequence096 530 219 gene locus_tag LOCUS_28290 530 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 766 545 gene locus_tag LOCUS_28300 766 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2784 892 gene locus_tag LOCUS_28310 2784 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 4598 3708 gene locus_tag LOCUS_28320 4598 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 5026 4694 gene locus_tag LOCUS_28330 5026 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 5940 5263 gene locus_tag LOCUS_28340 5940 5263 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_28340 7740 5986 gene locus_tag LOCUS_28350 7740 5986 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_28350 8184 7801 gene locus_tag LOCUS_28360 8184 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence097 589 765 gene locus_tag LOCUS_28370 589 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 818 1345 gene locus_tag LOCUS_28380 818 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1342 1860 gene locus_tag LOCUS_28390 1342 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 1965 2576 gene locus_tag LOCUS_28400 1965 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 2883 3272 gene locus_tag LOCUS_28410 2883 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3424 3822 gene locus_tag LOCUS_28420 3424 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 4102 5196 gene locus_tag LOCUS_28430 4102 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 5354 5725 gene locus_tag LOCUS_28440 5354 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 5771 6016 gene locus_tag LOCUS_28450 5771 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 6592 6831 gene locus_tag LOCUS_28460 6592 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 7840 6956 gene locus_tag LOCUS_28470 7840 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 8147 7833 gene locus_tag LOCUS_28480 8147 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence098 231 692 gene locus_tag LOCUS_28490 231 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 742 1428 gene locus_tag LOCUS_28500 742 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 1577 2104 gene locus_tag LOCUS_28510 1577 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2918 2346 gene locus_tag LOCUS_28520 2918 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 3235 2918 gene locus_tag LOCUS_28530 3235 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3517 3257 gene locus_tag LOCUS_28540 3517 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 3779 3576 gene locus_tag LOCUS_28550 3779 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3711 4187 gene locus_tag LOCUS_28560 3711 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 5938 4196 gene locus_tag LOCUS_28570 5938 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 6327 5971 gene locus_tag LOCUS_28580 6327 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 6472 6723 gene locus_tag LOCUS_28590 6472 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 6757 7965 gene locus_tag LOCUS_28600 6757 7965 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_28600 8125 8050 gene locus_tag LOCUS_t00370 8125 8050 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence099 2580 403 gene locus_tag LOCUS_28610 2580 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 3400 2777 gene locus_tag LOCUS_28620 3400 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 4841 3945 gene locus_tag LOCUS_28630 4841 3945 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259101.1 protein_id gnl|my_center|LOCUS_28630 6047 5610 gene locus_tag LOCUS_28640 6047 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 7470 5935 gene locus_tag LOCUS_28650 7470 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28650 7606 7457 gene locus_tag LOCUS_28660 7606 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 7917 7585 gene locus_tag LOCUS_28670 7917 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 >Feature sequence100 1497 1069 gene locus_tag LOCUS_28680 1497 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1774 1490 gene locus_tag LOCUS_28690 1774 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28690 2009 2227 gene locus_tag LOCUS_28700 2009 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2935 2156 gene locus_tag LOCUS_28710 2935 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 3701 2925 gene locus_tag LOCUS_28720 3701 2925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966753.1 protein_id gnl|my_center|LOCUS_28720 4917 3784 gene locus_tag LOCUS_28730 4917 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 5879 4992 gene locus_tag LOCUS_28740 gene tauC 5879 4992 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704532.1 protein_id gnl|my_center|LOCUS_28740 7368 7126 gene locus_tag LOCUS_28750 7368 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 >Feature sequence101 755 426 gene locus_tag LOCUS_28760 755 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 955 1218 gene locus_tag LOCUS_28770 955 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 2095 1280 gene locus_tag LOCUS_28780 2095 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 3422 2331 gene locus_tag LOCUS_28790 3422 2331 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_28790 3958 4893 gene locus_tag LOCUS_28800 3958 4893 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174450.1 protein_id gnl|my_center|LOCUS_28800 5275 6288 gene locus_tag LOCUS_28810 5275 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 <7428 6685 gene locus_tag LOCUS_28820 <7428 6685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222236.1:aldo/keto reductase >Feature sequence102 353 1942 gene locus_tag LOCUS_28830 353 1942 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_28830 3470 2583 gene locus_tag LOCUS_28840 3470 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 4725 3523 gene locus_tag LOCUS_28850 4725 3523 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_28850 6661 5075 gene locus_tag LOCUS_28860 6661 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 7051 6809 gene locus_tag LOCUS_28870 7051 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence103 <1 1423 gene locus_tag LOCUS_28880 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486197.1:DUF58 domain-containing protein 1556 3979 gene locus_tag LOCUS_28890 1556 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 4882 4475 gene locus_tag LOCUS_28900 4882 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 5133 6113 gene locus_tag LOCUS_28910 5133 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 6159 7004 gene locus_tag LOCUS_28920 6159 7004 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950166.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence104 271 909 gene locus_tag LOCUS_28930 271 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 1571 1194 gene locus_tag LOCUS_28940 1571 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 2263 3384 gene locus_tag LOCUS_28950 gene argJ 2263 3384 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966302.1 protein_id gnl|my_center|LOCUS_28950 3430 3804 gene locus_tag LOCUS_28960 3430 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 5175 4009 gene locus_tag LOCUS_28970 5175 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 5703 6386 gene locus_tag LOCUS_28980 5703 6386 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_28980 >Feature sequence105 487 496 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 656 1573 gene locus_tag LOCUS_28990 656 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 1613 2413 gene locus_tag LOCUS_29000 1613 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 2511 3200 gene locus_tag LOCUS_29010 2511 3200 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_29010 4803 3538 gene locus_tag LOCUS_29020 4803 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_29020 6092 4854 gene locus_tag LOCUS_29030 6092 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_29030 6702 6175 gene locus_tag LOCUS_29040 6702 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence106 215 493 gene locus_tag LOCUS_29050 215 493 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218330.1 protein_id gnl|my_center|LOCUS_29050 882 1784 gene locus_tag LOCUS_29060 gene ispE 882 1784 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140106.1 protein_id gnl|my_center|LOCUS_29060 1825 2589 gene locus_tag LOCUS_29070 1825 2589 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391622.1 protein_id gnl|my_center|LOCUS_29070 3889 5358 gene locus_tag LOCUS_29080 gene glmU 3889 5358 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_29080 5454 6470 gene locus_tag LOCUS_29090 5454 6470 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773653.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence107 660 301 gene locus_tag LOCUS_29100 660 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 1006 833 gene locus_tag LOCUS_29110 1006 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 1214 1138 gene locus_tag LOCUS_t00380 1214 1138 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1583 1789 gene locus_tag LOCUS_29120 1583 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 1804 2880 gene locus_tag LOCUS_29130 1804 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 2873 3829 gene locus_tag LOCUS_29140 2873 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 4112 4699 gene locus_tag LOCUS_29150 4112 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 5496 4702 gene locus_tag LOCUS_29160 gene xerC 5496 4702 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 protein_id gnl|my_center|LOCUS_29160 6018 5749 gene locus_tag LOCUS_29170 6018 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence108 698 1582 gene locus_tag LOCUS_29180 698 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 1782 2138 gene locus_tag LOCUS_29190 1782 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 2359 3645 gene locus_tag LOCUS_29200 2359 3645 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 protein_id gnl|my_center|LOCUS_29200 3753 5150 gene locus_tag LOCUS_29210 gene glcF 3753 5150 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_29210 >Feature sequence109 558 1331 gene locus_tag LOCUS_29220 558 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 1335 2096 gene locus_tag LOCUS_29230 1335 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 2695 2540 gene locus_tag LOCUS_29240 2695 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 3079 3600 gene locus_tag LOCUS_29250 3079 3600 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967412.1 protein_id gnl|my_center|LOCUS_29250 3539 3865 gene locus_tag LOCUS_29260 3539 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 3896 4264 gene locus_tag LOCUS_29270 3896 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 5491 5500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence110 503 2584 gene locus_tag LOCUS_29280 gene metG 503 2584 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_29280 2830 3432 gene locus_tag LOCUS_29290 2830 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 3429 4370 gene locus_tag LOCUS_29300 gene rsmA 3429 4370 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_29300 4524 4997 gene locus_tag LOCUS_29310 4524 4997 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773636.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence111 1283 435 gene locus_tag LOCUS_29320 gene rsmI 1283 435 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815011.1 protein_id gnl|my_center|LOCUS_29320 2068 1286 gene locus_tag LOCUS_29330 gene ricT 2068 1286 CDS product competence/sporulation regulator complex protein RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243571.1 protein_id gnl|my_center|LOCUS_29330 3234 2185 gene locus_tag LOCUS_29340 gene holB 3234 2185 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_29340 3567 3238 gene locus_tag LOCUS_29350 3567 3238 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781979.1 protein_id gnl|my_center|LOCUS_29350 4279 3572 gene locus_tag LOCUS_29360 gene tmk 4279 3572 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258097.1 protein_id gnl|my_center|LOCUS_29360 5285 4392 gene locus_tag LOCUS_29370 gene rocF 5285 4392 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_29370 5653 5579 gene locus_tag LOCUS_t00390 5653 5579 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence112 355 2055 gene locus_tag LOCUS_29380 355 2055 CDS product IS1634-like element ISMac10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021311.1 protein_id gnl|my_center|LOCUS_29380 2166 2756 gene locus_tag LOCUS_29390 2166 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339496.1 protein_id gnl|my_center|LOCUS_29390 3021 4274 gene locus_tag LOCUS_29400 3021 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 4328 4729 gene locus_tag LOCUS_29410 4328 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 5242 4775 gene locus_tag LOCUS_29420 5242 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence113 87 1814 gene locus_tag LOCUS_29430 87 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 4166 2253 gene locus_tag LOCUS_29440 4166 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 4464 4709 gene locus_tag LOCUS_29450 4464 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 4853 5050 gene locus_tag LOCUS_29460 4853 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence114 2837 918 gene locus_tag LOCUS_29470 2837 918 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460547.1 protein_id gnl|my_center|LOCUS_29470 3373 4047 gene locus_tag LOCUS_29480 3373 4047 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_29480 4094 5284 gene locus_tag LOCUS_29490 4094 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence115 145 561 gene locus_tag LOCUS_29500 145 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 846 1040 gene locus_tag LOCUS_29510 846 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 1062 2057 gene locus_tag LOCUS_29520 1062 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 2376 2627 gene locus_tag LOCUS_29530 2376 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29530 2564 2573 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2621 3013 gene locus_tag LOCUS_29540 2621 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29540 3210 3440 gene locus_tag LOCUS_29550 3210 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 >Feature sequence116 1475 66 gene locus_tag LOCUS_29560 1475 66 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_29560 1795 1869 gene locus_tag LOCUS_t00400 1795 1869 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2136 2711 gene locus_tag LOCUS_29570 2136 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 4225 2924 gene locus_tag LOCUS_29580 4225 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 >Feature sequence117 509 123 gene locus_tag LOCUS_29590 509 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 1202 711 gene locus_tag LOCUS_29600 1202 711 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228628.1 protein_id gnl|my_center|LOCUS_29600 1642 1223 gene locus_tag LOCUS_29610 1642 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 1893 2240 gene locus_tag LOCUS_29620 1893 2240 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_29620 2712 2284 gene locus_tag LOCUS_29630 2712 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 2711 3667 gene locus_tag LOCUS_29640 gene dapF 2711 3667 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_29640 3765 4937 gene locus_tag LOCUS_29650 3765 4937 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_29650 >Feature sequence118 342 136 gene locus_tag LOCUS_29660 342 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 2482 710 gene locus_tag LOCUS_29670 2482 710 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_29670 4057 2822 gene locus_tag LOCUS_29680 4057 2822 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978775.1 protein_id gnl|my_center|LOCUS_29680 4594 4211 gene locus_tag LOCUS_29690 4594 4211 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389622.1 protein_id gnl|my_center|LOCUS_29690 >Feature sequence119 412 669 gene locus_tag LOCUS_29700 412 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 908 2917 gene locus_tag LOCUS_29710 908 2917 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143126.1 protein_id gnl|my_center|LOCUS_29710 >Feature sequence120 759 490 gene locus_tag LOCUS_29720 759 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 969 2789 gene locus_tag LOCUS_29730 969 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 2840 3166 gene locus_tag LOCUS_29740 2840 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 3283 4899 gene locus_tag LOCUS_29750 3283 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence121 186 464 gene locus_tag LOCUS_29760 186 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 1000 584 gene locus_tag LOCUS_29770 1000 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 3083 1026 gene locus_tag LOCUS_29780 3083 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 4898 3096 gene locus_tag LOCUS_29790 4898 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence122 229 489 gene locus_tag LOCUS_29800 229 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 486 1406 gene locus_tag LOCUS_29810 486 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 1399 2415 gene locus_tag LOCUS_29820 1399 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 2415 2978 gene locus_tag LOCUS_29830 2415 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 2990 3208 gene locus_tag LOCUS_29840 2990 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 3433 3771 gene locus_tag LOCUS_29850 3433 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 3761 4459 gene locus_tag LOCUS_29860 3761 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 4437 4862 gene locus_tag LOCUS_29870 4437 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 >Feature sequence123 602 363 gene locus_tag LOCUS_29880 602 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 1008 718 gene locus_tag LOCUS_29890 1008 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 3482 1095 gene locus_tag LOCUS_29900 3482 1095 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103211.1 protein_id gnl|my_center|LOCUS_29900 4567 3479 gene locus_tag LOCUS_29910 4567 3479 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103210.1 protein_id gnl|my_center|LOCUS_29910 >Feature sequence124 648 1187 gene locus_tag LOCUS_29920 648 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 1254 1892 gene locus_tag LOCUS_29930 1254 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 1947 2513 gene locus_tag LOCUS_29940 1947 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 2645 2797 gene locus_tag LOCUS_29950 2645 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2852 3418 gene locus_tag LOCUS_29960 2852 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 3553 3960 gene locus_tag LOCUS_29970 3553 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 >Feature sequence125 150 569 gene locus_tag LOCUS_29980 150 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 571 729 gene locus_tag LOCUS_29990 571 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 1089 778 gene locus_tag LOCUS_30000 1089 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 1403 1089 gene locus_tag LOCUS_30010 1403 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 1746 1429 gene locus_tag LOCUS_30020 1746 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 2258 1962 gene locus_tag LOCUS_30030 2258 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 3479 2277 gene locus_tag LOCUS_30040 3479 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 3796 3620 gene locus_tag LOCUS_30050 3796 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 3740 4075 gene locus_tag LOCUS_30060 3740 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 <4924 4221 gene locus_tag LOCUS_30070 <4924 4221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043791004.1:ISAs1 family transposase >Feature sequence126 542 895 gene locus_tag LOCUS_30080 542 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 909 1259 gene locus_tag LOCUS_30090 909 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 1364 1594 gene locus_tag LOCUS_30100 1364 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1613 3277 gene locus_tag LOCUS_30110 gene merA 1613 3277 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193219.1 protein_id gnl|my_center|LOCUS_30110 3356 3916 gene locus_tag LOCUS_30120 3356 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 4171 4332 gene locus_tag LOCUS_30130 4171 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence127 1311 307 gene locus_tag LOCUS_30140 1311 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 2357 1308 gene locus_tag LOCUS_30150 2357 1308 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_30150 3529 2354 gene locus_tag LOCUS_30160 3529 2354 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_30160 >Feature sequence128 981 1403 gene locus_tag LOCUS_30170 981 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 1437 1805 gene locus_tag LOCUS_30180 1437 1805 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038312.1 protein_id gnl|my_center|LOCUS_30180 1812 3833 gene locus_tag LOCUS_30190 1812 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 4511 4236 gene locus_tag LOCUS_30200 4511 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 >Feature sequence129 257 811 gene locus_tag LOCUS_30210 257 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 824 1714 gene locus_tag LOCUS_30220 824 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 1711 2211 gene locus_tag LOCUS_30230 1711 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence130 586 425 gene locus_tag LOCUS_30240 586 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 636 2072 gene locus_tag LOCUS_30250 636 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 2341 2607 gene locus_tag LOCUS_30260 2341 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2826 3095 gene locus_tag LOCUS_30270 2826 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 3448 3266 gene locus_tag LOCUS_30280 3448 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 3567 3890 gene locus_tag LOCUS_30290 3567 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 3939 4217 gene locus_tag LOCUS_30300 3939 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 >Feature sequence131 1575 559 gene locus_tag LOCUS_30310 1575 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 2485 1568 gene locus_tag LOCUS_30320 2485 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 2882 2658 gene locus_tag LOCUS_30330 2882 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 3315 2863 gene locus_tag LOCUS_30340 3315 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence132 457 915 gene locus_tag LOCUS_30350 457 915 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869814.1 protein_id gnl|my_center|LOCUS_30350 1007 1843 gene locus_tag LOCUS_30360 gene speE 1007 1843 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393316.1 protein_id gnl|my_center|LOCUS_30360 1840 2682 gene locus_tag LOCUS_30370 gene speB 1840 2682 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393315.1 protein_id gnl|my_center|LOCUS_30370 2695 4374 gene locus_tag LOCUS_30380 gene argS 2695 4374 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_30380 >Feature sequence133 369 58 gene locus_tag LOCUS_30390 369 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 591 818 gene locus_tag LOCUS_30400 591 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 2221 815 gene locus_tag LOCUS_30410 2221 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 3480 2218 gene locus_tag LOCUS_30420 3480 2218 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396845.1 protein_id gnl|my_center|LOCUS_30420 3904 4065 gene locus_tag LOCUS_30430 3904 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 >Feature sequence134 >Feature sequence135 1 456 gene locus_tag LOCUS_30440 1 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 469 1005 gene locus_tag LOCUS_30450 469 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 1056 1244 gene locus_tag LOCUS_30460 1056 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 1324 1866 gene locus_tag LOCUS_30470 1324 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 1983 3311 gene locus_tag LOCUS_30480 1983 3311 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_30480 3322 3909 gene locus_tag LOCUS_30490 3322 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 3924 4196 gene locus_tag LOCUS_30500 3924 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 4302 4376 gene locus_tag LOCUS_t00410 4302 4376 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence136 209 628 gene locus_tag LOCUS_30510 209 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 671 1030 gene locus_tag LOCUS_30520 671 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1023 1514 gene locus_tag LOCUS_30530 1023 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 1511 1927 gene locus_tag LOCUS_30540 1511 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 1998 2183 gene locus_tag LOCUS_30550 1998 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 2187 2459 gene locus_tag LOCUS_30560 2187 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 2456 2710 gene locus_tag LOCUS_30570 2456 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 >Feature sequence137 2624 1188 gene locus_tag LOCUS_30580 2624 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 3537 2617 gene locus_tag LOCUS_30590 3537 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 4292 3678 gene locus_tag LOCUS_30600 4292 3678 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391695.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence138 2204 171 gene locus_tag LOCUS_30610 2204 171 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084759.1 protein_id gnl|my_center|LOCUS_30610 2936 2532 gene locus_tag LOCUS_30620 2936 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3922 3404 gene locus_tag LOCUS_30630 3922 3404 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967412.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence139 586 227 gene locus_tag LOCUS_30640 586 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30640 873 583 gene locus_tag LOCUS_30650 873 583 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206812040.1 protein_id gnl|my_center|LOCUS_30650 1079 1252 gene locus_tag LOCUS_30660 1079 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 1236 1406 gene locus_tag LOCUS_30670 1236 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 1403 1801 gene locus_tag LOCUS_30680 1403 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 2360 3652 gene locus_tag LOCUS_30690 2360 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30690 >Feature sequence140 <1 3382 gene locus_tag LOCUS_30700 <1 3382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398544.1:SNF2-related protein 3400 4044 gene locus_tag LOCUS_30710 3400 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 >Feature sequence141 1033 98 gene locus_tag LOCUS_30720 1033 98 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_30720 2237 1350 gene locus_tag LOCUS_30730 2237 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 3853 2402 gene locus_tag LOCUS_30740 3853 2402 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230704.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence142 270 1469 gene locus_tag LOCUS_30750 270 1469 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_30750 1701 1985 gene locus_tag LOCUS_30760 1701 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 2376 3272 gene locus_tag LOCUS_30770 2376 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3269 3646 gene locus_tag LOCUS_30780 3269 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence143 211 1320 gene locus_tag LOCUS_30790 211 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 3858 1414 gene locus_tag LOCUS_30800 3858 1414 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392767.1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence144 401 24 gene locus_tag LOCUS_30810 401 24 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582807.1 protein_id gnl|my_center|LOCUS_30810 1046 564 gene locus_tag LOCUS_30820 1046 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 2516 1113 gene locus_tag LOCUS_30830 gene murD 2516 1113 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_30830 2967 3932 gene locus_tag LOCUS_30840 2967 3932 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_30840 >Feature sequence145 162 863 gene locus_tag LOCUS_30850 162 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 851 2164 gene locus_tag LOCUS_30860 851 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 <4052 2244 gene locus_tag LOCUS_30870 <4052 2244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967414.1:recombinase family protein >Feature sequence146 1918 245 gene locus_tag LOCUS_30880 1918 245 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065483.1 protein_id gnl|my_center|LOCUS_30880 2814 1915 gene locus_tag LOCUS_30890 2814 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 3493 3068 gene locus_tag LOCUS_30900 3493 3068 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409913.1 protein_id gnl|my_center|LOCUS_30900 4008 3490 gene locus_tag LOCUS_30910 4008 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 >Feature sequence147 153 932 gene locus_tag LOCUS_30920 153 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 1187 2758 gene locus_tag LOCUS_30930 1187 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 2758 3525 gene locus_tag LOCUS_30940 2758 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 3561 3860 gene locus_tag LOCUS_30950 3561 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence148 69 479 gene locus_tag LOCUS_30960 69 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 555 788 gene locus_tag LOCUS_30970 555 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 917 1153 gene locus_tag LOCUS_30980 917 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 1174 1869 gene locus_tag LOCUS_30990 1174 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 2231 2581 gene locus_tag LOCUS_31000 2231 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 2936 2595 gene locus_tag LOCUS_31010 2936 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 3487 3822 gene locus_tag LOCUS_31020 3487 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 >Feature sequence149 235 699 gene locus_tag LOCUS_31030 235 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 716 970 gene locus_tag LOCUS_31040 716 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 1077 1166 gene locus_tag LOCUS_t00420 1077 1166 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1171 1248 gene locus_tag LOCUS_t00430 1171 1248 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2509 1343 gene locus_tag LOCUS_31050 2509 1343 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_31050 2756 2502 gene locus_tag LOCUS_31060 2756 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3416 2859 gene locus_tag LOCUS_31070 3416 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 >Feature sequence150 1100 597 gene locus_tag LOCUS_31080 1100 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 2599 1373 gene locus_tag LOCUS_31090 2599 1373 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_31090 3407 2853 gene locus_tag LOCUS_31100 3407 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 >Feature sequence151 <1 2159 gene locus_tag LOCUS_31110 <1 2159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224065207.1:helicase-related protein 2156 3709 gene locus_tag LOCUS_31120 2156 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence152 941 372 gene locus_tag LOCUS_31130 941 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31130 1294 1605 gene locus_tag LOCUS_31140 1294 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 2042 2569 gene locus_tag LOCUS_31150 2042 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 3478 2774 gene locus_tag LOCUS_31160 3478 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 >Feature sequence153 56 715 gene locus_tag LOCUS_31170 56 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 797 2413 gene locus_tag LOCUS_31180 797 2413 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163760282.1 protein_id gnl|my_center|LOCUS_31180 2389 3192 gene locus_tag LOCUS_31190 2389 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3227 3505 gene locus_tag LOCUS_31200 3227 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence154 1228 923 gene locus_tag LOCUS_31210 1228 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 2555 1263 gene locus_tag LOCUS_31220 2555 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 3041 2601 gene locus_tag LOCUS_31230 3041 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 3362 3141 gene locus_tag LOCUS_31240 3362 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 >Feature sequence155 278 1696 gene locus_tag LOCUS_31250 278 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 1746 3605 gene locus_tag LOCUS_31260 1746 3605 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_31260 >Feature sequence156 1057 1872 gene locus_tag LOCUS_31270 1057 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 >Feature sequence157 1062 265 gene locus_tag LOCUS_31280 1062 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 1908 1309 gene locus_tag LOCUS_31290 1908 1309 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088543.1 protein_id gnl|my_center|LOCUS_31290 2173 1940 gene locus_tag LOCUS_31300 2173 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3230 2328 gene locus_tag LOCUS_31310 3230 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 >Feature sequence158 727 1722 gene locus_tag LOCUS_31320 727 1722 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 protein_id gnl|my_center|LOCUS_31320 2114 1905 gene locus_tag LOCUS_31330 2114 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3216 2152 gene locus_tag LOCUS_31340 gene fbp 3216 2152 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056391.1 protein_id gnl|my_center|LOCUS_31340 >Feature sequence159 1253 150 gene locus_tag LOCUS_31350 1253 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 1877 2980 gene locus_tag LOCUS_31360 1877 2980 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_31360 >Feature sequence160 86 1588 gene locus_tag LOCUS_31370 86 1588 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812346.1 protein_id gnl|my_center|LOCUS_31370 806 815 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1693 2172 gene locus_tag LOCUS_31380 1693 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 2382 2738 gene locus_tag LOCUS_31390 2382 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 >Feature sequence161 1185 823 gene locus_tag LOCUS_31400 1185 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 1066 1395 gene locus_tag LOCUS_31410 1066 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 2724 1642 gene locus_tag LOCUS_31420 2724 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 >Feature sequence162 135 437 gene locus_tag LOCUS_31430 135 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 605 895 gene locus_tag LOCUS_31440 605 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 1079 3172 gene locus_tag LOCUS_31450 1079 3172 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173640842.1 protein_id gnl|my_center|LOCUS_31450 >Feature sequence163 125 955 gene locus_tag LOCUS_31460 125 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 975 1379 gene locus_tag LOCUS_31470 975 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 1376 1732 gene locus_tag LOCUS_31480 1376 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 1732 2508 gene locus_tag LOCUS_31490 1732 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 2510 3220 gene locus_tag LOCUS_31500 2510 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence164 683 231 gene locus_tag LOCUS_31510 683 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 1527 736 gene locus_tag LOCUS_31520 gene istB 1527 736 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_31520 3041 1524 gene locus_tag LOCUS_31530 gene istA 3041 1524 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189327688.1 protein_id gnl|my_center|LOCUS_31530 >Feature sequence165 97 399 gene locus_tag LOCUS_31540 97 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 567 857 gene locus_tag LOCUS_31550 567 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 1041 3134 gene locus_tag LOCUS_31560 1041 3134 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173640842.1 protein_id gnl|my_center|LOCUS_31560 >Feature sequence166 152 1543 gene locus_tag LOCUS_31570 152 1543 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_31570 1898 2203 gene locus_tag LOCUS_31580 1898 2203 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_31580 2987 2319 gene locus_tag LOCUS_31590 2987 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence167 1130 2212 gene locus_tag LOCUS_31600 1130 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 2212 2649 gene locus_tag LOCUS_31610 2212 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 2666 3052 gene locus_tag LOCUS_31620 2666 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 >Feature sequence168 1430 132 gene locus_tag LOCUS_31630 1430 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 2341 1430 gene locus_tag LOCUS_31640 2341 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 2489 2512 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2545 2898 gene locus_tag LOCUS_31650 2545 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 >Feature sequence169 >Feature sequence170 167 1060 gene locus_tag LOCUS_31660 167 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 1183 1007 gene locus_tag LOCUS_31670 1183 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 1344 1180 gene locus_tag LOCUS_31680 1344 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 1699 1403 gene locus_tag LOCUS_31690 1699 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 1997 1683 gene locus_tag LOCUS_31700 1997 1683 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229269.1 protein_id gnl|my_center|LOCUS_31700 2237 2055 gene locus_tag LOCUS_31710 2237 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 2611 2417 gene locus_tag LOCUS_31720 2611 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 2937 2614 gene locus_tag LOCUS_31730 2937 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence171 1952 654 gene locus_tag LOCUS_31740 1952 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 2875 1952 gene locus_tag LOCUS_31750 2875 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 >Feature sequence172 1322 543 gene locus_tag LOCUS_31760 1322 543 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_31760 2619 1324 gene locus_tag LOCUS_31770 2619 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence173 276 2093 gene locus_tag LOCUS_31780 276 2093 CDS product IS66-like element ISBj7 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084592.1 protein_id gnl|my_center|LOCUS_31780 2153 2986 gene locus_tag LOCUS_31790 2153 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence174 473 1309 gene locus_tag LOCUS_31800 473 1309 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_31800 1387 2367 gene locus_tag LOCUS_31810 1387 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 2379 2846 gene locus_tag LOCUS_31820 2379 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 >Feature sequence175 414 196 gene locus_tag LOCUS_31830 414 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 417 629 gene locus_tag LOCUS_31840 417 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 691 1689 gene locus_tag LOCUS_31850 691 1689 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331254.1 protein_id gnl|my_center|LOCUS_31850 1735 2781 gene locus_tag LOCUS_31860 1735 2781 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113026.1 protein_id gnl|my_center|LOCUS_31860 >Feature sequence176 200 619 gene locus_tag LOCUS_31870 200 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 1126 2547 gene locus_tag LOCUS_31880 1126 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence177 1340 339 gene locus_tag LOCUS_31890 1340 339 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164689163.1 protein_id gnl|my_center|LOCUS_31890 1834 1340 gene locus_tag LOCUS_31900 1834 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 2604 2613 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence178 194 1870 gene locus_tag LOCUS_31910 194 1870 CDS product IS66-like element ISEc23 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080200.1 protein_id gnl|my_center|LOCUS_31910 1867 2724 gene locus_tag LOCUS_31920 1867 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 >Feature sequence179 84 413 gene locus_tag LOCUS_31930 84 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 410 1036 gene locus_tag LOCUS_31940 410 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 1061 1534 gene locus_tag LOCUS_31950 1061 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 2169 1696 gene locus_tag LOCUS_31960 2169 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence180 1413 592 gene locus_tag LOCUS_31970 1413 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 >Feature sequence181 398 2095 gene locus_tag LOCUS_31980 398 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence182 857 375 gene locus_tag LOCUS_31990 857 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 2595 904 gene locus_tag LOCUS_32000 2595 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence183 500 724 gene locus_tag LOCUS_32010 500 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 721 1050 gene locus_tag LOCUS_32020 721 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 1054 1356 gene locus_tag LOCUS_32030 1054 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 1356 1712 gene locus_tag LOCUS_32040 1356 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 1709 2062 gene locus_tag LOCUS_32050 1709 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 2041 2409 gene locus_tag LOCUS_32060 2041 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence184 361 1305 gene locus_tag LOCUS_32070 361 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 >Feature sequence185 698 1225 gene locus_tag LOCUS_32080 698 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 >Feature sequence186 1316 564 gene locus_tag LOCUS_32090 1316 564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028267.1 protein_id gnl|my_center|LOCUS_32090 2224 1313 gene locus_tag LOCUS_32100 2224 1313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973848.1 protein_id gnl|my_center|LOCUS_32100 >Feature sequence187 74 718 gene locus_tag LOCUS_32110 74 718 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146551.1 protein_id gnl|my_center|LOCUS_32110 708 2315 gene locus_tag LOCUS_32120 708 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 >Feature sequence188