>Feature sequence001 <1 1010 gene locus_tag LOCUS_00010 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087119.1:GGDEF domain-containing protein 1086 1874 gene locus_tag LOCUS_00020 1086 1874 CDS product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085727.1 protein_id gnl|my_center|LOCUS_00020 2165 3352 gene locus_tag LOCUS_00030 2165 3352 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391224.1 protein_id gnl|my_center|LOCUS_00030 3719 3324 gene locus_tag LOCUS_00040 3719 3324 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463761.1 protein_id gnl|my_center|LOCUS_00040 4095 3730 gene locus_tag LOCUS_00050 4095 3730 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975619.1 protein_id gnl|my_center|LOCUS_00050 4550 4092 gene locus_tag LOCUS_00060 4550 4092 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_00060 5790 4555 gene locus_tag LOCUS_00070 5790 4555 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087114.1 protein_id gnl|my_center|LOCUS_00070 7016 5787 gene locus_tag LOCUS_00080 gene sufD 7016 5787 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_00080 7762 7013 gene locus_tag LOCUS_00090 gene sufC 7762 7013 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171266.1 protein_id gnl|my_center|LOCUS_00090 9216 7762 gene locus_tag LOCUS_00100 gene sufB 9216 7762 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975623.1 protein_id gnl|my_center|LOCUS_00100 10363 9224 gene locus_tag LOCUS_00110 10363 9224 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_00110 10835 10371 gene locus_tag LOCUS_00120 10835 10371 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_00120 11144 11797 gene locus_tag LOCUS_00130 11144 11797 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384250.1 protein_id gnl|my_center|LOCUS_00130 12929 11829 gene locus_tag LOCUS_00140 12929 11829 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389784.1 protein_id gnl|my_center|LOCUS_00140 12978 14240 gene locus_tag LOCUS_00150 gene tyrS 12978 14240 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532167.1 protein_id gnl|my_center|LOCUS_00150 17657 14244 gene locus_tag LOCUS_00160 17657 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17783 18268 gene locus_tag LOCUS_00170 gene bcp 17783 18268 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975630.1 protein_id gnl|my_center|LOCUS_00170 18410 19816 gene locus_tag LOCUS_00180 18410 19816 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463760.1 protein_id gnl|my_center|LOCUS_00180 20798 19830 gene locus_tag LOCUS_00190 gene prfB 20798 19830 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113519808.1 protein_id gnl|my_center|LOCUS_00190 21436 21032 gene locus_tag LOCUS_00200 21436 21032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23927 21531 gene locus_tag LOCUS_00210 23927 21531 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_00210 25192 23987 gene locus_tag LOCUS_00220 25192 23987 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_00220 25953 28571 gene locus_tag LOCUS_00230 25953 28571 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669211.1 protein_id gnl|my_center|LOCUS_00230 30084 28588 gene locus_tag LOCUS_00240 30084 28588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30214 31638 gene locus_tag LOCUS_00250 30214 31638 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087068.1 protein_id gnl|my_center|LOCUS_00250 31646 32392 gene locus_tag LOCUS_00260 31646 32392 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244437.1 protein_id gnl|my_center|LOCUS_00260 33421 32435 gene locus_tag LOCUS_00270 gene thiS 33421 32435 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390185.1 protein_id gnl|my_center|LOCUS_00270 33449 33961 gene locus_tag LOCUS_00280 gene aroQ 33449 33961 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_00280 33958 34455 gene locus_tag LOCUS_00290 gene accB 33958 34455 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919749.1 protein_id gnl|my_center|LOCUS_00290 34457 35803 gene locus_tag LOCUS_00300 gene accC 34457 35803 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 protein_id gnl|my_center|LOCUS_00300 35862 36248 gene locus_tag LOCUS_00310 35862 36248 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216361.1 protein_id gnl|my_center|LOCUS_00310 36790 36245 gene locus_tag LOCUS_00320 36790 36245 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_00320 37158 38402 gene locus_tag LOCUS_00330 37158 38402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967751.1 protein_id gnl|my_center|LOCUS_00330 38478 38807 gene locus_tag LOCUS_00340 38478 38807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 39816 39241 gene locus_tag LOCUS_00350 39816 39241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40442 39861 gene locus_tag LOCUS_00360 40442 39861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 40888 40442 gene locus_tag LOCUS_00370 gene mlaD 40888 40442 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921521.1 protein_id gnl|my_center|LOCUS_00370 41283 40900 gene locus_tag LOCUS_00380 41283 40900 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533066.1 protein_id gnl|my_center|LOCUS_00380 41797 45543 gene locus_tag LOCUS_00390 41797 45543 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975395.1 protein_id gnl|my_center|LOCUS_00390 47256 45688 gene locus_tag LOCUS_00400 gene gcvPB 47256 45688 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923258.1 protein_id gnl|my_center|LOCUS_00400 48602 47253 gene locus_tag LOCUS_00410 gene gcvPA 48602 47253 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921182.1 protein_id gnl|my_center|LOCUS_00410 48981 48607 gene locus_tag LOCUS_00420 gene gcvH 48981 48607 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971640.1 protein_id gnl|my_center|LOCUS_00420 50112 48991 gene locus_tag LOCUS_00430 gene gcvT 50112 48991 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921497.1 protein_id gnl|my_center|LOCUS_00430 52028 50559 gene locus_tag LOCUS_00440 gene argS 52028 50559 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921188.1 protein_id gnl|my_center|LOCUS_00440 51927 52301 gene locus_tag LOCUS_00450 51927 52301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 52849 52322 gene locus_tag LOCUS_00460 52849 52322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 53016 54002 gene locus_tag LOCUS_00470 gene ispH 53016 54002 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722409.1 protein_id gnl|my_center|LOCUS_00470 54018 54977 gene locus_tag LOCUS_00480 54018 54977 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971141.1 protein_id gnl|my_center|LOCUS_00480 54974 55405 gene locus_tag LOCUS_00490 gene rnhA 54974 55405 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532769.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00490 55968 55486 gene locus_tag LOCUS_00500 55968 55486 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_00500 56122 56715 gene locus_tag LOCUS_00510 56122 56715 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921224.1 protein_id gnl|my_center|LOCUS_00510 59576 56730 gene locus_tag LOCUS_00520 59576 56730 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532764.1 protein_id gnl|my_center|LOCUS_00520 60338 59742 gene locus_tag LOCUS_00530 60338 59742 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921226.1 protein_id gnl|my_center|LOCUS_00530 61612 60347 gene locus_tag LOCUS_00540 61612 60347 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_00540 63000 61609 gene locus_tag LOCUS_00550 gene thrC 63000 61609 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921382.1 protein_id gnl|my_center|LOCUS_00550 63766 63038 gene locus_tag LOCUS_00560 63766 63038 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992415.1 protein_id gnl|my_center|LOCUS_00560 64134 63763 gene locus_tag LOCUS_00570 64134 63763 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971138.1 protein_id gnl|my_center|LOCUS_00570 65046 64135 gene locus_tag LOCUS_00580 65046 64135 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 protein_id gnl|my_center|LOCUS_00580 66182 65241 gene locus_tag LOCUS_00590 66182 65241 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532778.1 protein_id gnl|my_center|LOCUS_00590 67800 66205 gene locus_tag LOCUS_00600 gene ctaD 67800 66205 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083990.1 protein_id gnl|my_center|LOCUS_00600 68656 67817 gene locus_tag LOCUS_00610 gene coxB 68656 67817 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083989.1 protein_id gnl|my_center|LOCUS_00610 68994 70421 gene locus_tag LOCUS_00620 gene tldD 68994 70421 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965288.1 protein_id gnl|my_center|LOCUS_00620 70444 70806 gene locus_tag LOCUS_00630 70444 70806 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083958.1 protein_id gnl|my_center|LOCUS_00630 70989 72017 gene locus_tag LOCUS_00640 70989 72017 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974245.1 protein_id gnl|my_center|LOCUS_00640 72323 71907 gene locus_tag LOCUS_00650 72323 71907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 72500 72336 gene locus_tag LOCUS_00660 72500 72336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 72459 72887 gene locus_tag LOCUS_00670 72459 72887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 72929 73120 gene locus_tag LOCUS_00680 72929 73120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 74513 73149 gene locus_tag LOCUS_00690 74513 73149 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_00690 75389 74640 gene locus_tag LOCUS_00700 75389 74640 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338653.1 protein_id gnl|my_center|LOCUS_00700 75639 76583 gene locus_tag LOCUS_00710 gene ubiA 75639 76583 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388330.1 protein_id gnl|my_center|LOCUS_00710 76715 77158 gene locus_tag LOCUS_00720 76715 77158 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067451.1 protein_id gnl|my_center|LOCUS_00720 77190 78143 gene locus_tag LOCUS_00730 77190 78143 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 protein_id gnl|my_center|LOCUS_00730 78169 78837 gene locus_tag LOCUS_00740 78169 78837 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388331.1 protein_id gnl|my_center|LOCUS_00740 80012 78801 gene locus_tag LOCUS_00750 80012 78801 CDS product citrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083014.1 protein_id gnl|my_center|LOCUS_00750 80089 81177 gene locus_tag LOCUS_00760 80089 81177 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083015.1 protein_id gnl|my_center|LOCUS_00760 82719 81187 gene locus_tag LOCUS_00770 gene bcaP 82719 81187 CDS product branched-chain amino acid transporter BcaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245791.1 protein_id gnl|my_center|LOCUS_00770 82918 84456 gene locus_tag LOCUS_00780 82918 84456 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918202.1 protein_id gnl|my_center|LOCUS_00780 84522 85508 gene locus_tag LOCUS_00790 84522 85508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 85703 86128 gene locus_tag LOCUS_00800 85703 86128 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070678.1 protein_id gnl|my_center|LOCUS_00800 86133 87476 gene locus_tag LOCUS_00810 86133 87476 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174621.1 protein_id gnl|my_center|LOCUS_00810 87463 88275 gene locus_tag LOCUS_00820 87463 88275 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918197.1 protein_id gnl|my_center|LOCUS_00820 88286 88519 gene locus_tag LOCUS_00830 88286 88519 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532345.1 protein_id gnl|my_center|LOCUS_00830 88594 90426 gene locus_tag LOCUS_00840 88594 90426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918194.1 protein_id gnl|my_center|LOCUS_00840 90432 91721 gene locus_tag LOCUS_00850 90432 91721 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 protein_id gnl|my_center|LOCUS_00850 91708 92679 gene locus_tag LOCUS_00860 gene lpxK 91708 92679 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336758.1 protein_id gnl|my_center|LOCUS_00860 92676 93680 gene locus_tag LOCUS_00870 92676 93680 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_00870 94453 93623 gene locus_tag LOCUS_00880 94453 93623 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275350.1 protein_id gnl|my_center|LOCUS_00880 94677 94450 gene locus_tag LOCUS_00890 94677 94450 CDS product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640448.1 protein_id gnl|my_center|LOCUS_00890 96183 94798 gene locus_tag LOCUS_00900 gene xseA 96183 94798 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920107.1 protein_id gnl|my_center|LOCUS_00900 96239 97522 gene locus_tag LOCUS_00910 gene purD 96239 97522 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971036.1 protein_id gnl|my_center|LOCUS_00910 97604 98695 gene locus_tag LOCUS_00920 97604 98695 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_00920 98780 100333 gene locus_tag LOCUS_00930 98780 100333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 101617 100388 gene locus_tag LOCUS_00940 101617 100388 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088203.1 protein_id gnl|my_center|LOCUS_00940 101745 102365 gene locus_tag LOCUS_00950 101745 102365 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926845.1 protein_id gnl|my_center|LOCUS_00950 103959 102550 gene locus_tag LOCUS_00960 103959 102550 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640321.1 protein_id gnl|my_center|LOCUS_00960 104638 103967 gene locus_tag LOCUS_00970 104638 103967 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_00970 104769 105419 gene locus_tag LOCUS_00980 104769 105419 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083641.1 protein_id gnl|my_center|LOCUS_00980 105423 106505 gene locus_tag LOCUS_00990 105423 106505 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_00990 106957 106502 gene locus_tag LOCUS_01000 gene tadA 106957 106502 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918120.1 protein_id gnl|my_center|LOCUS_01000 107017 107775 gene locus_tag LOCUS_01010 107017 107775 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388410.1 protein_id gnl|my_center|LOCUS_01010 108195 107818 gene locus_tag LOCUS_01020 108195 107818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 109041 108460 gene locus_tag LOCUS_01030 109041 108460 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807378.1 protein_id gnl|my_center|LOCUS_01030 110939 109113 gene locus_tag LOCUS_01040 gene thiC 110939 109113 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243935.1 protein_id gnl|my_center|LOCUS_01040 >Feature sequence002 417 1907 gene locus_tag LOCUS_01050 417 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 2072 2923 gene locus_tag LOCUS_01060 2072 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 3095 4231 gene locus_tag LOCUS_01070 3095 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012561197.1 protein_id gnl|my_center|LOCUS_01070 4394 6553 gene locus_tag LOCUS_01080 4394 6553 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490278.1 protein_id gnl|my_center|LOCUS_01080 6655 7152 gene locus_tag LOCUS_01090 6655 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 7163 7528 gene locus_tag LOCUS_01100 7163 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 7597 8094 gene locus_tag LOCUS_01110 7597 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 8412 8245 gene locus_tag LOCUS_01120 8412 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8926 8501 gene locus_tag LOCUS_01130 8926 8501 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529815.1 protein_id gnl|my_center|LOCUS_01130 9165 8923 gene locus_tag LOCUS_01140 9165 8923 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968496.1 protein_id gnl|my_center|LOCUS_01140 9293 10408 gene locus_tag LOCUS_01150 9293 10408 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091007.1 protein_id gnl|my_center|LOCUS_01150 10716 11690 gene locus_tag LOCUS_01160 10716 11690 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 protein_id gnl|my_center|LOCUS_01160 11832 13016 gene locus_tag LOCUS_01170 11832 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036781.1 protein_id gnl|my_center|LOCUS_01170 13013 13519 gene locus_tag LOCUS_01180 13013 13519 CDS product DUF6521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204896.1 protein_id gnl|my_center|LOCUS_01180 13516 15450 gene locus_tag LOCUS_01190 13516 15450 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036780.1 protein_id gnl|my_center|LOCUS_01190 16283 15582 gene locus_tag LOCUS_01200 16283 15582 CDS product DUF2290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112393.1 protein_id gnl|my_center|LOCUS_01200 18423 16276 gene locus_tag LOCUS_01210 18423 16276 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159898.1 protein_id gnl|my_center|LOCUS_01210 19083 18733 gene locus_tag LOCUS_01220 19083 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 18965 19285 gene locus_tag LOCUS_01230 18965 19285 CDS product DUF736 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394835.1 protein_id gnl|my_center|LOCUS_01230 19475 19771 gene locus_tag LOCUS_01240 19475 19771 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100678.1 protein_id gnl|my_center|LOCUS_01240 19768 20307 gene locus_tag LOCUS_01250 19768 20307 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301452.1 protein_id gnl|my_center|LOCUS_01250 20411 21034 gene locus_tag LOCUS_01260 20411 21034 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066871170.1 protein_id gnl|my_center|LOCUS_01260 21777 21082 gene locus_tag LOCUS_01270 21777 21082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 22712 21774 gene locus_tag LOCUS_01280 22712 21774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 23343 22738 gene locus_tag LOCUS_01290 23343 22738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 24666 25007 gene locus_tag LOCUS_01300 24666 25007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 25009 25341 gene locus_tag LOCUS_01310 25009 25341 CDS product type IV secretion system protein VirB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970879.1 protein_id gnl|my_center|LOCUS_01310 25331 27721 gene locus_tag LOCUS_01320 25331 27721 CDS product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970878.1 protein_id gnl|my_center|LOCUS_01320 27740 28447 gene locus_tag LOCUS_01330 27740 28447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 28450 28800 gene locus_tag LOCUS_01340 28450 28800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 28809 29738 gene locus_tag LOCUS_01350 28809 29738 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974917.1 protein_id gnl|my_center|LOCUS_01350 29735 30028 gene locus_tag LOCUS_01360 29735 30028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 30038 30730 gene locus_tag LOCUS_01370 30038 30730 CDS product type IV secretion system protein VirB8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533337.1 protein_id gnl|my_center|LOCUS_01370 30727 31704 gene locus_tag LOCUS_01380 gene virB9 30727 31704 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970873.1 protein_id gnl|my_center|LOCUS_01380 31701 32870 gene locus_tag LOCUS_01390 31701 32870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 32854 33900 gene locus_tag LOCUS_01400 gene virB11 32854 33900 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970871.1 protein_id gnl|my_center|LOCUS_01400 33903 35774 gene locus_tag LOCUS_01410 33903 35774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 35771 36736 gene locus_tag LOCUS_01420 35771 36736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 36746 36970 gene locus_tag LOCUS_01430 36746 36970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 36982 37302 gene locus_tag LOCUS_01440 36982 37302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 37304 41062 gene locus_tag LOCUS_01450 37304 41062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 42005 41076 gene locus_tag LOCUS_01460 42005 41076 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_01460 42501 42094 gene locus_tag LOCUS_01470 42501 42094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 43123 42494 gene locus_tag LOCUS_01480 43123 42494 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338977.1 protein_id gnl|my_center|LOCUS_01480 43396 43878 gene locus_tag LOCUS_01490 43396 43878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 43907 44881 gene locus_tag LOCUS_01500 43907 44881 CDS product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124712479.1 protein_id gnl|my_center|LOCUS_01500 44969 45679 gene locus_tag LOCUS_01510 44969 45679 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338973.1 protein_id gnl|my_center|LOCUS_01510 45730 46800 gene locus_tag LOCUS_01520 45730 46800 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035617.1 protein_id gnl|my_center|LOCUS_01520 46797 47195 gene locus_tag LOCUS_01530 46797 47195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 47183 47977 gene locus_tag LOCUS_01540 47183 47977 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338969.1 protein_id gnl|my_center|LOCUS_01540 47974 48906 gene locus_tag LOCUS_01550 47974 48906 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338970.1 protein_id gnl|my_center|LOCUS_01550 48893 49687 gene locus_tag LOCUS_01560 48893 49687 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_01560 49804 50121 gene locus_tag LOCUS_01570 49804 50121 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859020.1 protein_id gnl|my_center|LOCUS_01570 50649 50425 gene locus_tag LOCUS_01580 50649 50425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 50648 52282 gene locus_tag LOCUS_01590 50648 52282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 52326 53678 gene locus_tag LOCUS_01600 52326 53678 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_01600 53953 54921 gene locus_tag LOCUS_01610 53953 54921 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 protein_id gnl|my_center|LOCUS_01610 54946 57453 gene locus_tag LOCUS_01620 54946 57453 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_01620 59351 57606 gene locus_tag LOCUS_01630 59351 57606 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113245.1 protein_id gnl|my_center|LOCUS_01630 60113 59448 gene locus_tag LOCUS_01640 60113 59448 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140311.1 protein_id gnl|my_center|LOCUS_01640 60379 61449 gene locus_tag LOCUS_01650 60379 61449 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035617.1 protein_id gnl|my_center|LOCUS_01650 61645 62784 gene locus_tag LOCUS_01660 61645 62784 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088955.1 protein_id gnl|my_center|LOCUS_01660 62794 62964 gene locus_tag LOCUS_01670 62794 62964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 63033 63434 gene locus_tag LOCUS_01680 63033 63434 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811632.1 protein_id gnl|my_center|LOCUS_01680 63438 64283 gene locus_tag LOCUS_01690 gene fghA 63438 64283 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088926.1 protein_id gnl|my_center|LOCUS_01690 64280 65527 gene locus_tag LOCUS_01700 64280 65527 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859017.1 protein_id gnl|my_center|LOCUS_01700 65676 66851 gene locus_tag LOCUS_01710 65676 66851 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175239.1 protein_id gnl|my_center|LOCUS_01710 66854 67564 gene locus_tag LOCUS_01720 66854 67564 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089830.1 protein_id gnl|my_center|LOCUS_01720 67566 68237 gene locus_tag LOCUS_01730 67566 68237 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918096.1 protein_id gnl|my_center|LOCUS_01730 69746 69330 gene locus_tag LOCUS_01740 69746 69330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01740 70137 69730 gene locus_tag LOCUS_01750 70137 69730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01750 70222 71010 gene locus_tag LOCUS_01760 70222 71010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 71068 71358 gene locus_tag LOCUS_01770 71068 71358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 71355 71861 gene locus_tag LOCUS_01780 71355 71861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_01780 73232 72180 gene locus_tag LOCUS_01790 73232 72180 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252895.1 protein_id gnl|my_center|LOCUS_01790 74251 73262 gene locus_tag LOCUS_01800 74251 73262 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338543.1 protein_id gnl|my_center|LOCUS_01800 75367 74261 gene locus_tag LOCUS_01810 75367 74261 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010022659.1 protein_id gnl|my_center|LOCUS_01810 75484 76365 gene locus_tag LOCUS_01820 gene gcvA 75484 76365 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389869.1 protein_id gnl|my_center|LOCUS_01820 77241 77486 gene locus_tag LOCUS_01830 77241 77486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 77996 79165 gene locus_tag LOCUS_01840 77996 79165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 80890 79397 gene locus_tag LOCUS_01850 80890 79397 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331281.1 protein_id gnl|my_center|LOCUS_01850 81170 82018 gene locus_tag LOCUS_01860 81170 82018 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313648.1 protein_id gnl|my_center|LOCUS_01860 82077 83177 gene locus_tag LOCUS_01870 82077 83177 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973455.1 protein_id gnl|my_center|LOCUS_01870 83194 84039 gene locus_tag LOCUS_01880 83194 84039 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973454.1 protein_id gnl|my_center|LOCUS_01880 84036 84881 gene locus_tag LOCUS_01890 84036 84881 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973453.1 protein_id gnl|my_center|LOCUS_01890 85120 85842 gene locus_tag LOCUS_01900 85120 85842 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101372.1 protein_id gnl|my_center|LOCUS_01900 86336 87466 gene locus_tag LOCUS_01910 86336 87466 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_01910 87598 88908 gene locus_tag LOCUS_01920 87598 88908 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101374.1 protein_id gnl|my_center|LOCUS_01920 88922 89830 gene locus_tag LOCUS_01930 88922 89830 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973459.1 protein_id gnl|my_center|LOCUS_01930 90648 89911 gene locus_tag LOCUS_01940 90648 89911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 91427 90651 gene locus_tag LOCUS_01950 91427 90651 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968772.1 protein_id gnl|my_center|LOCUS_01950 91600 92409 gene locus_tag LOCUS_01960 91600 92409 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974528.1 protein_id gnl|my_center|LOCUS_01960 92557 94011 gene locus_tag LOCUS_01970 92557 94011 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731469.1 protein_id gnl|my_center|LOCUS_01970 95111 94194 gene locus_tag LOCUS_01980 95111 94194 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399686.1 protein_id gnl|my_center|LOCUS_01980 >Feature sequence003 707 378 gene locus_tag LOCUS_01990 707 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 887 714 gene locus_tag LOCUS_02000 887 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 1165 965 gene locus_tag LOCUS_02010 1165 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 1476 1168 gene locus_tag LOCUS_02020 1476 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 2723 1488 gene locus_tag LOCUS_02030 2723 1488 CDS product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533262.1 protein_id gnl|my_center|LOCUS_02030 3730 2738 gene locus_tag LOCUS_02040 gene trbG 3730 2738 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533263.1 protein_id gnl|my_center|LOCUS_02040 4440 3745 gene locus_tag LOCUS_02050 gene trbF 4440 3745 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533264.1 protein_id gnl|my_center|LOCUS_02050 5837 4446 gene locus_tag LOCUS_02060 gene trbL 5837 4446 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533265.1 protein_id gnl|my_center|LOCUS_02060 6562 5837 gene locus_tag LOCUS_02070 gene trbJ 6562 5837 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533266.1 protein_id gnl|my_center|LOCUS_02070 9037 6566 gene locus_tag LOCUS_02080 gene trbE 9037 6566 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 protein_id gnl|my_center|LOCUS_02080 9294 9031 gene locus_tag LOCUS_02090 9294 9031 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533268.1 protein_id gnl|my_center|LOCUS_02090 9521 9294 gene locus_tag LOCUS_02100 9521 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 10650 9649 gene locus_tag LOCUS_02110 gene trbB 10650 9649 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533270.1 protein_id gnl|my_center|LOCUS_02110 11084 10647 gene locus_tag LOCUS_02120 11084 10647 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533271.1 protein_id gnl|my_center|LOCUS_02120 13142 11097 gene locus_tag LOCUS_02130 13142 11097 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_02130 14412 13384 gene locus_tag LOCUS_02140 14412 13384 CDS product CBASS cGAMP-activated phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062610134.1 protein_id gnl|my_center|LOCUS_02140 14900 14409 gene locus_tag LOCUS_02150 14900 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331496.1 protein_id gnl|my_center|LOCUS_02150 16131 14908 gene locus_tag LOCUS_02160 16131 14908 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226782306.1 protein_id gnl|my_center|LOCUS_02160 16845 17144 gene locus_tag LOCUS_02170 16845 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 17147 18403 gene locus_tag LOCUS_02180 17147 18403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 18786 18577 gene locus_tag LOCUS_02190 18786 18577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 18966 18817 gene locus_tag LOCUS_02200 18966 18817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 19033 19974 gene locus_tag LOCUS_02210 19033 19974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 20319 22610 gene locus_tag LOCUS_02220 20319 22610 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113491.1 protein_id gnl|my_center|LOCUS_02220 22607 24454 gene locus_tag LOCUS_02230 22607 24454 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289508.1 protein_id gnl|my_center|LOCUS_02230 24486 25361 gene locus_tag LOCUS_02240 24486 25361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 25443 26180 gene locus_tag LOCUS_02250 25443 26180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 28344 26359 gene locus_tag LOCUS_02260 gene rlxS 28344 26359 CDS product relaxase/mobilization nuclease RlxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533275.1 protein_id gnl|my_center|LOCUS_02260 29365 28796 gene locus_tag LOCUS_02270 29365 28796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 30027 29491 gene locus_tag LOCUS_02280 30027 29491 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533277.1 protein_id gnl|my_center|LOCUS_02280 30292 30020 gene locus_tag LOCUS_02290 30292 30020 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533278.1 protein_id gnl|my_center|LOCUS_02290 30292 30483 gene locus_tag LOCUS_02300 30292 30483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 30634 30455 gene locus_tag LOCUS_02310 30634 30455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 31316 30993 gene locus_tag LOCUS_02320 31316 30993 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533279.1 protein_id gnl|my_center|LOCUS_02320 33809 32076 gene locus_tag LOCUS_02330 33809 32076 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533280.1 protein_id gnl|my_center|LOCUS_02330 34186 33989 gene locus_tag LOCUS_02340 34186 33989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 35136 34183 gene locus_tag LOCUS_02350 35136 34183 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533282.1 protein_id gnl|my_center|LOCUS_02350 35122 35301 gene locus_tag LOCUS_02360 35122 35301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 35547 35819 gene locus_tag LOCUS_02370 35547 35819 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167391325.1 protein_id gnl|my_center|LOCUS_02370 35879 36172 gene locus_tag LOCUS_02380 35879 36172 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538229.1 protein_id gnl|my_center|LOCUS_02380 36636 36151 gene locus_tag LOCUS_02390 36636 36151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 36967 36671 gene locus_tag LOCUS_02400 36967 36671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 37920 37003 gene locus_tag LOCUS_02410 37920 37003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 38554 37910 gene locus_tag LOCUS_02420 38554 37910 CDS product N-acylhomoserine lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528416.1 protein_id gnl|my_center|LOCUS_02420 39377 38631 gene locus_tag LOCUS_02430 39377 38631 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083882.1 protein_id gnl|my_center|LOCUS_02430 42234 39760 gene locus_tag LOCUS_02440 42234 39760 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_02440 43232 42231 gene locus_tag LOCUS_02450 43232 42231 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 protein_id gnl|my_center|LOCUS_02450 44841 43444 gene locus_tag LOCUS_02460 44841 43444 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_02460 46390 44858 gene locus_tag LOCUS_02470 46390 44858 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_02470 47270 47686 gene locus_tag LOCUS_02480 47270 47686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 48952 47972 gene locus_tag LOCUS_02490 48952 47972 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245963.1 protein_id gnl|my_center|LOCUS_02490 50198 49323 gene locus_tag LOCUS_02500 50198 49323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 50427 52112 gene locus_tag LOCUS_02510 50427 52112 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918829.1 protein_id gnl|my_center|LOCUS_02510 52578 53168 gene locus_tag LOCUS_02520 52578 53168 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896181.1 protein_id gnl|my_center|LOCUS_02520 54378 53326 gene locus_tag LOCUS_02530 54378 53326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405629.1 protein_id gnl|my_center|LOCUS_02530 55472 54609 gene locus_tag LOCUS_02540 55472 54609 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_02540 55863 55678 gene locus_tag LOCUS_02550 55863 55678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 55844 56656 gene locus_tag LOCUS_02560 55844 56656 CDS product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183771.1 protein_id gnl|my_center|LOCUS_02560 57941 56667 gene locus_tag LOCUS_02570 57941 56667 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730081.1 protein_id gnl|my_center|LOCUS_02570 58148 58939 gene locus_tag LOCUS_02580 58148 58939 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_02580 58967 60190 gene locus_tag LOCUS_02590 58967 60190 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_02590 60190 61227 gene locus_tag LOCUS_02600 60190 61227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 61333 62232 gene locus_tag LOCUS_02610 61333 62232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 62341 63108 gene locus_tag LOCUS_02620 62341 63108 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_02620 63148 63918 gene locus_tag LOCUS_02630 63148 63918 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228906.1 protein_id gnl|my_center|LOCUS_02630 64007 64564 gene locus_tag LOCUS_02640 64007 64564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 64591 65628 gene locus_tag LOCUS_02650 64591 65628 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857644.1 protein_id gnl|my_center|LOCUS_02650 65681 66337 gene locus_tag LOCUS_02660 65681 66337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 66596 67399 gene locus_tag LOCUS_02670 66596 67399 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_02670 67431 68477 gene locus_tag LOCUS_02680 67431 68477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405629.1 protein_id gnl|my_center|LOCUS_02680 69013 70395 gene locus_tag LOCUS_02690 69013 70395 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_02690 70762 71247 gene locus_tag LOCUS_02700 70762 71247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 72841 72056 gene locus_tag LOCUS_02710 72841 72056 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085604.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02710 73820 73035 gene locus_tag LOCUS_02720 73820 73035 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_02720 74285 73875 gene locus_tag LOCUS_02730 74285 73875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 75695 74367 gene locus_tag LOCUS_02740 75695 74367 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730666.1 protein_id gnl|my_center|LOCUS_02740 76621 76124 gene locus_tag LOCUS_02750 76621 76124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 77222 76671 gene locus_tag LOCUS_02760 77222 76671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 78928 77219 gene locus_tag LOCUS_02770 78928 77219 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256282.1 protein_id gnl|my_center|LOCUS_02770 80111 79206 gene locus_tag LOCUS_02780 80111 79206 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969781.1 protein_id gnl|my_center|LOCUS_02780 81686 80490 gene locus_tag LOCUS_02790 81686 80490 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_02790 81925 81852 gene locus_tag LOCUS_t00010 81925 81852 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence004 5582 2550 gene locus_tag LOCUS_02800 5582 2550 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920997.1 protein_id gnl|my_center|LOCUS_02800 8901 5914 gene locus_tag LOCUS_02810 8901 5914 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920997.1 protein_id gnl|my_center|LOCUS_02810 9563 9225 gene locus_tag LOCUS_02820 9563 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 10340 9618 gene locus_tag LOCUS_02830 10340 9618 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921493.1 protein_id gnl|my_center|LOCUS_02830 11796 10633 gene locus_tag LOCUS_02840 gene solA 11796 10633 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104498.1 protein_id gnl|my_center|LOCUS_02840 11872 13836 gene locus_tag LOCUS_02850 11872 13836 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727591.1 protein_id gnl|my_center|LOCUS_02850 14697 13822 gene locus_tag LOCUS_02860 14697 13822 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_02860 15188 14739 gene locus_tag LOCUS_02870 15188 14739 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_02870 16286 15273 gene locus_tag LOCUS_02880 16286 15273 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968467.1 protein_id gnl|my_center|LOCUS_02880 17320 16283 gene locus_tag LOCUS_02890 gene epmA 17320 16283 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918606.1 protein_id gnl|my_center|LOCUS_02890 17424 17993 gene locus_tag LOCUS_02900 gene efp 17424 17993 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532351.1 protein_id gnl|my_center|LOCUS_02900 17962 18186 gene locus_tag LOCUS_02910 17962 18186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 19179 18388 gene locus_tag LOCUS_02920 gene phyR 19179 18388 CDS product anti-anti sigma factor/receiver protein PhyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 protein_id gnl|my_center|LOCUS_02920 19432 19686 gene locus_tag LOCUS_02930 19432 19686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 19691 20353 gene locus_tag LOCUS_02940 19691 20353 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921304.1 protein_id gnl|my_center|LOCUS_02940 20391 22139 gene locus_tag LOCUS_02950 gene phyK 20391 22139 CDS product sensor histidine kinase PhyK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923290.1 protein_id gnl|my_center|LOCUS_02950 23034 22195 gene locus_tag LOCUS_02960 23034 22195 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 protein_id gnl|my_center|LOCUS_02960 24910 23144 gene locus_tag LOCUS_02970 24910 23144 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640463.1 protein_id gnl|my_center|LOCUS_02970 24986 25240 gene locus_tag LOCUS_02980 24986 25240 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388629.1 protein_id gnl|my_center|LOCUS_02980 25778 25218 gene locus_tag LOCUS_02990 25778 25218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 26139 26909 gene locus_tag LOCUS_03000 26139 26909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 27632 27375 gene locus_tag LOCUS_03010 27632 27375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 27573 28673 gene locus_tag LOCUS_03020 27573 28673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 28747 29268 gene locus_tag LOCUS_03030 28747 29268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 29482 31443 gene locus_tag LOCUS_03040 29482 31443 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104754.1 protein_id gnl|my_center|LOCUS_03040 31495 33060 gene locus_tag LOCUS_03050 31495 33060 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_03050 34386 33166 gene locus_tag LOCUS_03060 34386 33166 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626572.1 protein_id gnl|my_center|LOCUS_03060 35278 34463 gene locus_tag LOCUS_03070 35278 34463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 35452 35841 gene locus_tag LOCUS_03080 35452 35841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 35945 38053 gene locus_tag LOCUS_03090 35945 38053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 38172 39521 gene locus_tag LOCUS_03100 38172 39521 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_03100 40099 39842 gene locus_tag LOCUS_03110 40099 39842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 39980 40450 gene locus_tag LOCUS_03120 39980 40450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 40464 41495 gene locus_tag LOCUS_03130 40464 41495 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_03130 41603 42907 gene locus_tag LOCUS_03140 41603 42907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 46241 43131 gene locus_tag LOCUS_03150 46241 43131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_03150 46711 47610 gene locus_tag LOCUS_03160 46711 47610 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532086.1 protein_id gnl|my_center|LOCUS_03160 49186 47678 gene locus_tag LOCUS_03170 49186 47678 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_03170 49154 49378 gene locus_tag LOCUS_03180 49154 49378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 49606 51780 gene locus_tag LOCUS_03190 gene katG 49606 51780 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_03190 53742 52573 gene locus_tag LOCUS_03200 53742 52573 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728213.1 protein_id gnl|my_center|LOCUS_03200 53995 53786 gene locus_tag LOCUS_03210 53995 53786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 56386 54485 gene locus_tag LOCUS_03220 56386 54485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 56780 56466 gene locus_tag LOCUS_03230 56780 56466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 57247 56777 gene locus_tag LOCUS_03240 57247 56777 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 protein_id gnl|my_center|LOCUS_03240 57981 57247 gene locus_tag LOCUS_03250 57981 57247 CDS product DUF3034 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764776.1 protein_id gnl|my_center|LOCUS_03250 60097 58787 gene locus_tag LOCUS_03260 60097 58787 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_03260 60422 60347 gene locus_tag LOCUS_t00020 60422 60347 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 60613 61278 gene locus_tag LOCUS_03270 60613 61278 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086577.1 protein_id gnl|my_center|LOCUS_03270 61290 62096 gene locus_tag LOCUS_03280 gene pssA 61290 62096 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_03280 62159 63262 gene locus_tag LOCUS_03290 62159 63262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_03290 63259 64293 gene locus_tag LOCUS_03300 63259 64293 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640185.1 protein_id gnl|my_center|LOCUS_03300 64290 64733 gene locus_tag LOCUS_03310 64290 64733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 65641 64730 gene locus_tag LOCUS_03320 65641 64730 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083278.1 protein_id gnl|my_center|LOCUS_03320 66300 65617 gene locus_tag LOCUS_03330 66300 65617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 66355 68556 gene locus_tag LOCUS_03340 66355 68556 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970369.1 protein_id gnl|my_center|LOCUS_03340 69968 68553 gene locus_tag LOCUS_03350 gene leuC 69968 68553 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_03350 70170 69979 gene locus_tag LOCUS_03360 70170 69979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 70293 71306 gene locus_tag LOCUS_03370 70293 71306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 71750 71310 gene locus_tag LOCUS_03380 gene gloA 71750 71310 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_03380 74740 72047 gene locus_tag LOCUS_03390 gene mutS 74740 72047 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391288.1 protein_id gnl|my_center|LOCUS_03390 74851 77100 gene locus_tag LOCUS_03400 74851 77100 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence005 110 334 gene locus_tag LOCUS_03410 110 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 816 418 gene locus_tag LOCUS_03420 816 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 1209 910 gene locus_tag LOCUS_03430 1209 910 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_03430 1505 1224 gene locus_tag LOCUS_03440 1505 1224 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_03440 3278 2388 gene locus_tag LOCUS_03450 3278 2388 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_03450 4786 3275 gene locus_tag LOCUS_03460 4786 3275 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169161074.1 protein_id gnl|my_center|LOCUS_03460 6150 4783 gene locus_tag LOCUS_03470 6150 4783 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931030.1 protein_id gnl|my_center|LOCUS_03470 6847 6644 gene locus_tag LOCUS_03480 6847 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 6746 7498 gene locus_tag LOCUS_03490 6746 7498 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039793.1 protein_id gnl|my_center|LOCUS_03490 7495 9192 gene locus_tag LOCUS_03500 7495 9192 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 protein_id gnl|my_center|LOCUS_03500 9189 10316 gene locus_tag LOCUS_03510 9189 10316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812264.1 protein_id gnl|my_center|LOCUS_03510 10313 11440 gene locus_tag LOCUS_03520 10313 11440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 protein_id gnl|my_center|LOCUS_03520 11774 14152 gene locus_tag LOCUS_03530 11774 14152 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037536.1 protein_id gnl|my_center|LOCUS_03530 15355 14156 gene locus_tag LOCUS_03540 15355 14156 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037551.1 protein_id gnl|my_center|LOCUS_03540 16041 15373 gene locus_tag LOCUS_03550 16041 15373 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 protein_id gnl|my_center|LOCUS_03550 17046 16048 gene locus_tag LOCUS_03560 17046 16048 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389818.1 protein_id gnl|my_center|LOCUS_03560 17973 17053 gene locus_tag LOCUS_03570 17973 17053 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454899.1 protein_id gnl|my_center|LOCUS_03570 18046 19284 gene locus_tag LOCUS_03580 18046 19284 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532349.1 protein_id gnl|my_center|LOCUS_03580 19769 19497 gene locus_tag LOCUS_03590 19769 19497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 19656 20117 gene locus_tag LOCUS_03600 19656 20117 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_03600 20340 21344 gene locus_tag LOCUS_03610 20340 21344 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139988.1 protein_id gnl|my_center|LOCUS_03610 21344 22018 gene locus_tag LOCUS_03620 21344 22018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 22015 22545 gene locus_tag LOCUS_03630 22015 22545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 22648 23379 gene locus_tag LOCUS_03640 gene lptB 22648 23379 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_03640 23398 24906 gene locus_tag LOCUS_03650 gene rpoN 23398 24906 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921426.1 protein_id gnl|my_center|LOCUS_03650 25002 25334 gene locus_tag LOCUS_03660 25002 25334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 25341 25844 gene locus_tag LOCUS_03670 gene ptsN 25341 25844 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_03670 26169 25918 gene locus_tag LOCUS_03680 26169 25918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 26627 26166 gene locus_tag LOCUS_03690 26627 26166 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391502.1 protein_id gnl|my_center|LOCUS_03690 27222 26845 gene locus_tag LOCUS_03700 27222 26845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 28724 27219 gene locus_tag LOCUS_03710 28724 27219 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919511.1 protein_id gnl|my_center|LOCUS_03710 30304 29060 gene locus_tag LOCUS_03720 30304 29060 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_03720 30614 30539 gene locus_tag LOCUS_t00030 30614 30539 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 31183 30665 gene locus_tag LOCUS_03730 31183 30665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 31336 32679 gene locus_tag LOCUS_03740 gene aroA 31336 32679 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339439.1 protein_id gnl|my_center|LOCUS_03740 32679 33350 gene locus_tag LOCUS_03750 gene cmk 32679 33350 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388047.1 protein_id gnl|my_center|LOCUS_03750 33584 35299 gene locus_tag LOCUS_03760 gene rpsA 33584 35299 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027546860.1 protein_id gnl|my_center|LOCUS_03760 35538 37265 gene locus_tag LOCUS_03770 35538 37265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 37423 37740 gene locus_tag LOCUS_03780 gene ihfB 37423 37740 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388045.1 protein_id gnl|my_center|LOCUS_03780 37737 38036 gene locus_tag LOCUS_03790 37737 38036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 38033 38740 gene locus_tag LOCUS_03800 gene pyrF 38033 38740 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_03800 38980 38744 gene locus_tag LOCUS_03810 38980 38744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 39231 39905 gene locus_tag LOCUS_03820 39231 39905 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083568.1 protein_id gnl|my_center|LOCUS_03820 39902 41116 gene locus_tag LOCUS_03830 gene trpB 39902 41116 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391174.1 protein_id gnl|my_center|LOCUS_03830 41113 41934 gene locus_tag LOCUS_03840 gene trpA 41113 41934 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115801.1 protein_id gnl|my_center|LOCUS_03840 41953 42888 gene locus_tag LOCUS_03850 gene accD 41953 42888 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528321.1 protein_id gnl|my_center|LOCUS_03850 42885 44204 gene locus_tag LOCUS_03860 42885 44204 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_03860 44803 44234 gene locus_tag LOCUS_03870 44803 44234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 45829 44984 gene locus_tag LOCUS_03880 45829 44984 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229247.1 protein_id gnl|my_center|LOCUS_03880 45885 46484 gene locus_tag LOCUS_03890 45885 46484 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971535.1 protein_id gnl|my_center|LOCUS_03890 47483 46500 gene locus_tag LOCUS_03900 47483 46500 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_03900 48904 47663 gene locus_tag LOCUS_03910 48904 47663 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 protein_id gnl|my_center|LOCUS_03910 50032 48974 gene locus_tag LOCUS_03920 50032 48974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 51033 50245 gene locus_tag LOCUS_03930 51033 50245 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082969.1 protein_id gnl|my_center|LOCUS_03930 51130 51843 gene locus_tag LOCUS_03940 51130 51843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 52856 51870 gene locus_tag LOCUS_03950 52856 51870 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265998.1 protein_id gnl|my_center|LOCUS_03950 53006 53494 gene locus_tag LOCUS_03960 53006 53494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 53484 54992 gene locus_tag LOCUS_03970 53484 54992 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920791.1 protein_id gnl|my_center|LOCUS_03970 56701 55010 gene locus_tag LOCUS_03980 gene purH 56701 55010 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721490.1 protein_id gnl|my_center|LOCUS_03980 56899 58281 gene locus_tag LOCUS_03990 56899 58281 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_03990 58335 58784 gene locus_tag LOCUS_04000 58335 58784 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 protein_id gnl|my_center|LOCUS_04000 60152 58887 gene locus_tag LOCUS_04010 60152 58887 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818556.1 protein_id gnl|my_center|LOCUS_04010 61141 60167 gene locus_tag LOCUS_04020 gene bioB 61141 60167 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035642.1 protein_id gnl|my_center|LOCUS_04020 61227 62417 gene locus_tag LOCUS_04030 gene bioF 61227 62417 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640275.1 protein_id gnl|my_center|LOCUS_04030 62414 63079 gene locus_tag LOCUS_04040 gene bioD 62414 63079 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919449.1 protein_id gnl|my_center|LOCUS_04040 63122 63487 gene locus_tag LOCUS_04050 63122 63487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 63866 63952 gene locus_tag LOCUS_t00040 63866 63952 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence006 48 124 gene locus_tag LOCUS_t00050 48 124 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 612 2270 gene locus_tag LOCUS_04060 612 2270 CDS product anti-phage dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036788256.1 protein_id gnl|my_center|LOCUS_04060 2969 5731 gene locus_tag LOCUS_04070 2969 5731 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048879517.1 protein_id gnl|my_center|LOCUS_04070 5728 6510 gene locus_tag LOCUS_04080 5728 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 6507 8567 gene locus_tag LOCUS_04090 6507 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 protein_id gnl|my_center|LOCUS_04090 8560 9756 gene locus_tag LOCUS_04100 8560 9756 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037257.1 protein_id gnl|my_center|LOCUS_04100 9811 10710 gene locus_tag LOCUS_04110 9811 10710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 12174 10993 gene locus_tag LOCUS_04120 12174 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 12927 12175 gene locus_tag LOCUS_04130 12927 12175 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_04130 13852 13100 gene locus_tag LOCUS_04140 13852 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 14669 13893 gene locus_tag LOCUS_04150 14669 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 15312 14650 gene locus_tag LOCUS_04160 15312 14650 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174443.1 protein_id gnl|my_center|LOCUS_04160 17398 15305 gene locus_tag LOCUS_04170 17398 15305 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398395.1 protein_id gnl|my_center|LOCUS_04170 17589 18332 gene locus_tag LOCUS_04180 17589 18332 CDS product ImuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967468.1 protein_id gnl|my_center|LOCUS_04180 18259 19794 gene locus_tag LOCUS_04190 18259 19794 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257431.1 protein_id gnl|my_center|LOCUS_04190 19791 23072 gene locus_tag LOCUS_04200 19791 23072 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972863.1 protein_id gnl|my_center|LOCUS_04200 23348 23097 gene locus_tag LOCUS_04210 23348 23097 CDS product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 protein_id gnl|my_center|LOCUS_04210 24537 23359 gene locus_tag LOCUS_04220 24537 23359 CDS product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090987.1 protein_id gnl|my_center|LOCUS_04220 25526 24534 gene locus_tag LOCUS_04230 gene trbG 25526 24534 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 protein_id gnl|my_center|LOCUS_04230 26209 25526 gene locus_tag LOCUS_04240 gene trbF 26209 25526 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090989.1 protein_id gnl|my_center|LOCUS_04240 27528 26209 gene locus_tag LOCUS_04250 gene trbL 27528 26209 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090990.1 protein_id gnl|my_center|LOCUS_04250 28288 27539 gene locus_tag LOCUS_04260 gene trbJ 28288 27539 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 protein_id gnl|my_center|LOCUS_04260 30717 28288 gene locus_tag LOCUS_04270 gene trbE 30717 28288 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 protein_id gnl|my_center|LOCUS_04270 30996 30727 gene locus_tag LOCUS_04280 30996 30727 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388564.1 protein_id gnl|my_center|LOCUS_04280 31328 30996 gene locus_tag LOCUS_04290 31328 30996 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388565.1 protein_id gnl|my_center|LOCUS_04290 32269 31325 gene locus_tag LOCUS_04300 gene trbB 32269 31325 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090996.1 protein_id gnl|my_center|LOCUS_04300 32453 32743 gene locus_tag LOCUS_04310 32453 32743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 32982 34325 gene locus_tag LOCUS_04320 32982 34325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 34906 34487 gene locus_tag LOCUS_04330 34906 34487 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 protein_id gnl|my_center|LOCUS_04330 36901 34916 gene locus_tag LOCUS_04340 36901 34916 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018269525.1 protein_id gnl|my_center|LOCUS_04340 37094 37414 gene locus_tag LOCUS_04350 gene mqsR 37094 37414 CDS product type II toxin-antitoxin system toxin MqsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415584.1 protein_id gnl|my_center|LOCUS_04350 37416 37847 gene locus_tag LOCUS_04360 37416 37847 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809516.1 protein_id gnl|my_center|LOCUS_04360 39168 37870 gene locus_tag LOCUS_04370 39168 37870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 39502 39714 gene locus_tag LOCUS_04380 39502 39714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 40675 39872 gene locus_tag LOCUS_04390 40675 39872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 41202 40690 gene locus_tag LOCUS_04400 41202 40690 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082879.1 protein_id gnl|my_center|LOCUS_04400 41663 41199 gene locus_tag LOCUS_04410 41663 41199 CDS product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 protein_id gnl|my_center|LOCUS_04410 41911 41660 gene locus_tag LOCUS_04420 41911 41660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082881.1 protein_id gnl|my_center|LOCUS_04420 42546 41908 gene locus_tag LOCUS_04430 gene parA 42546 41908 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 protein_id gnl|my_center|LOCUS_04430 43678 42770 gene locus_tag LOCUS_04440 43678 42770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 43972 43682 gene locus_tag LOCUS_04450 43972 43682 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 protein_id gnl|my_center|LOCUS_04450 44533 44324 gene locus_tag LOCUS_04460 44533 44324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 44526 46745 gene locus_tag LOCUS_04470 44526 46745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 47370 47128 gene locus_tag LOCUS_04480 47370 47128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 47576 47839 gene locus_tag LOCUS_04490 47576 47839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 48318 48055 gene locus_tag LOCUS_04500 48318 48055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082886.1 protein_id gnl|my_center|LOCUS_04500 48735 48487 gene locus_tag LOCUS_04510 48735 48487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 49333 49010 gene locus_tag LOCUS_04520 49333 49010 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084751.1 protein_id gnl|my_center|LOCUS_04520 50342 49866 gene locus_tag LOCUS_04530 50342 49866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368632.1 protein_id gnl|my_center|LOCUS_04530 51956 50481 gene locus_tag LOCUS_04540 51956 50481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 52027 52473 gene locus_tag LOCUS_04550 52027 52473 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161531.1 protein_id gnl|my_center|LOCUS_04550 52470 53006 gene locus_tag LOCUS_04560 52470 53006 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161534.1 protein_id gnl|my_center|LOCUS_04560 53973 53035 gene locus_tag LOCUS_04570 53973 53035 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084737.1 protein_id gnl|my_center|LOCUS_04570 55349 54291 gene locus_tag LOCUS_04580 55349 54291 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084736.1 protein_id gnl|my_center|LOCUS_04580 57518 55419 gene locus_tag LOCUS_04590 57518 55419 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490278.1 protein_id gnl|my_center|LOCUS_04590 58896 57679 gene locus_tag LOCUS_04600 58896 57679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012561197.1 protein_id gnl|my_center|LOCUS_04600 59267 58971 gene locus_tag LOCUS_04610 59267 58971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 60281 59400 gene locus_tag LOCUS_04620 60281 59400 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_04620 61227 60334 gene locus_tag LOCUS_04630 61227 60334 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089011.1 protein_id gnl|my_center|LOCUS_04630 61995 61255 gene locus_tag LOCUS_04640 61995 61255 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900652.1 protein_id gnl|my_center|LOCUS_04640 62299 62886 gene locus_tag LOCUS_04650 62299 62886 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037087814.1 protein_id gnl|my_center|LOCUS_04650 63522 62899 gene locus_tag LOCUS_04660 63522 62899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04660 >Feature sequence007 172 864 gene locus_tag LOCUS_04670 172 864 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533388.1 protein_id gnl|my_center|LOCUS_04670 951 1310 gene locus_tag LOCUS_04680 951 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 1807 1421 gene locus_tag LOCUS_04690 1807 1421 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_04690 2661 2101 gene locus_tag LOCUS_04700 2661 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 3396 2989 gene locus_tag LOCUS_04710 3396 2989 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 protein_id gnl|my_center|LOCUS_04710 3463 4110 gene locus_tag LOCUS_04720 3463 4110 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_04720 4116 5087 gene locus_tag LOCUS_04730 4116 5087 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 protein_id gnl|my_center|LOCUS_04730 7925 5349 gene locus_tag LOCUS_04740 7925 5349 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_04740 8042 8317 gene locus_tag LOCUS_04750 8042 8317 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083527.1 protein_id gnl|my_center|LOCUS_04750 8338 9825 gene locus_tag LOCUS_04760 8338 9825 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613680.1 protein_id gnl|my_center|LOCUS_04760 9890 10156 gene locus_tag LOCUS_04770 9890 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 10784 11188 gene locus_tag LOCUS_04780 10784 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 11214 11537 gene locus_tag LOCUS_04790 11214 11537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 11633 12280 gene locus_tag LOCUS_04800 11633 12280 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_04800 12292 12555 gene locus_tag LOCUS_04810 12292 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 13095 14366 gene locus_tag LOCUS_04820 13095 14366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 14363 14749 gene locus_tag LOCUS_04830 14363 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 14749 15681 gene locus_tag LOCUS_04840 14749 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 15685 16500 gene locus_tag LOCUS_04850 15685 16500 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950166.1 protein_id gnl|my_center|LOCUS_04850 16605 17123 gene locus_tag LOCUS_04860 16605 17123 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113775.1 protein_id gnl|my_center|LOCUS_04860 17582 17172 gene locus_tag LOCUS_04870 gene cueR 17582 17172 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770083.1 protein_id gnl|my_center|LOCUS_04870 18114 19751 gene locus_tag LOCUS_04880 gene merA 18114 19751 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136268.1 protein_id gnl|my_center|LOCUS_04880 19816 20388 gene locus_tag LOCUS_04890 19816 20388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 20385 20906 gene locus_tag LOCUS_04900 20385 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 21808 23250 gene locus_tag LOCUS_04910 21808 23250 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939668.1 protein_id gnl|my_center|LOCUS_04910 23277 23738 gene locus_tag LOCUS_04920 23277 23738 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000382.1 protein_id gnl|my_center|LOCUS_04920 23780 24136 gene locus_tag LOCUS_04930 23780 24136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 24252 24698 gene locus_tag LOCUS_04940 24252 24698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 24695 26860 gene locus_tag LOCUS_04950 24695 26860 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390806.1 protein_id gnl|my_center|LOCUS_04950 26857 27471 gene locus_tag LOCUS_04960 26857 27471 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_04960 27468 28133 gene locus_tag LOCUS_04970 27468 28133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 28130 28690 gene locus_tag LOCUS_04980 28130 28690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 29228 29599 gene locus_tag LOCUS_04990 gene copC 29228 29599 CDS product copper homeostasis periplasmic binding protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185895.1 protein_id gnl|my_center|LOCUS_04990 29611 30531 gene locus_tag LOCUS_05000 29611 30531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 30595 32463 gene locus_tag LOCUS_05010 gene mrdA 30595 32463 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_05010 32627 33286 gene locus_tag LOCUS_05020 32627 33286 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_05020 33349 34383 gene locus_tag LOCUS_05030 33349 34383 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_05030 34467 35555 gene locus_tag LOCUS_05040 34467 35555 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328363.1 protein_id gnl|my_center|LOCUS_05040 36110 37525 gene locus_tag LOCUS_05050 36110 37525 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705295.1 protein_id gnl|my_center|LOCUS_05050 38837 37644 gene locus_tag LOCUS_05060 gene egtB 38837 37644 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551490.1 protein_id gnl|my_center|LOCUS_05060 39795 38821 gene locus_tag LOCUS_05070 gene egtD 39795 38821 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 protein_id gnl|my_center|LOCUS_05070 40308 39808 gene locus_tag LOCUS_05080 40308 39808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 40766 40305 gene locus_tag LOCUS_05090 gene cueR 40766 40305 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_05090 43171 40763 gene locus_tag LOCUS_05100 gene copA1 43171 40763 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_05100 43427 43152 gene locus_tag LOCUS_05110 43427 43152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05110 43833 44012 gene locus_tag LOCUS_05120 43833 44012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 44515 45987 gene locus_tag LOCUS_05130 44515 45987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 46307 46768 gene locus_tag LOCUS_05140 46307 46768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 46779 46988 gene locus_tag LOCUS_05150 46779 46988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 47297 47878 gene locus_tag LOCUS_05160 47297 47878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 48133 49185 gene locus_tag LOCUS_05170 48133 49185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012561197.1 protein_id gnl|my_center|LOCUS_05170 49301 49690 gene locus_tag LOCUS_05180 49301 49690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 49774 51897 gene locus_tag LOCUS_05190 49774 51897 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490278.1 protein_id gnl|my_center|LOCUS_05190 52000 52500 gene locus_tag LOCUS_05200 52000 52500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 54053 52749 gene locus_tag LOCUS_05210 54053 52749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 54281 54111 gene locus_tag LOCUS_05220 54281 54111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 54201 54410 gene locus_tag LOCUS_05230 54201 54410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 54478 54975 gene locus_tag LOCUS_05240 54478 54975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 >Feature sequence008 704 405 gene locus_tag LOCUS_05250 704 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 1374 1090 gene locus_tag LOCUS_05260 1374 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 1841 1617 gene locus_tag LOCUS_05270 1841 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1951 2472 gene locus_tag LOCUS_05280 1951 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2802 3011 gene locus_tag LOCUS_05290 2802 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 3002 6295 gene locus_tag LOCUS_05300 3002 6295 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117919.1 protein_id gnl|my_center|LOCUS_05300 6295 6945 gene locus_tag LOCUS_05310 6295 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 6939 10301 gene locus_tag LOCUS_05320 6939 10301 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459048.1 protein_id gnl|my_center|LOCUS_05320 10313 10867 gene locus_tag LOCUS_05330 10313 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 10873 13761 gene locus_tag LOCUS_05340 10873 13761 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117924.1 protein_id gnl|my_center|LOCUS_05340 13917 14774 gene locus_tag LOCUS_05350 13917 14774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 16472 15186 gene locus_tag LOCUS_05360 16472 15186 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019197495.1 protein_id gnl|my_center|LOCUS_05360 16786 16469 gene locus_tag LOCUS_05370 16786 16469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 17451 16939 gene locus_tag LOCUS_05380 17451 16939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 18542 17511 gene locus_tag LOCUS_05390 18542 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 18839 20200 gene locus_tag LOCUS_05400 18839 20200 CDS product ISL3-like element ISPpu12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574636.1 protein_id gnl|my_center|LOCUS_05400 21005 21709 gene locus_tag LOCUS_05410 21005 21709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 22364 22014 gene locus_tag LOCUS_05420 22364 22014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 22783 23139 gene locus_tag LOCUS_05430 22783 23139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 23375 23569 gene locus_tag LOCUS_05440 23375 23569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 24015 23581 gene locus_tag LOCUS_05450 24015 23581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 24319 24143 gene locus_tag LOCUS_05460 24319 24143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 24564 24256 gene locus_tag LOCUS_05470 24564 24256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 25041 24784 gene locus_tag LOCUS_05480 25041 24784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 25715 25038 gene locus_tag LOCUS_05490 25715 25038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05490 26066 25767 gene locus_tag LOCUS_05500 26066 25767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05500 26860 27648 gene locus_tag LOCUS_05510 26860 27648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 27740 28198 gene locus_tag LOCUS_05520 27740 28198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 30516 28300 gene locus_tag LOCUS_05530 30516 28300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 30673 30957 gene locus_tag LOCUS_05540 30673 30957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 31648 31349 gene locus_tag LOCUS_05550 31648 31349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 32073 31645 gene locus_tag LOCUS_05560 32073 31645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 32369 33151 gene locus_tag LOCUS_05570 32369 33151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 33613 33227 gene locus_tag LOCUS_05580 33613 33227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 34853 33756 gene locus_tag LOCUS_05590 34853 33756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 36072 35737 gene locus_tag LOCUS_05600 36072 35737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 36462 36265 gene locus_tag LOCUS_05610 36462 36265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 36890 36483 gene locus_tag LOCUS_05620 36890 36483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 37082 37246 gene locus_tag LOCUS_05630 37082 37246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 37356 38450 gene locus_tag LOCUS_05640 37356 38450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 38559 39554 gene locus_tag LOCUS_05650 38559 39554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 41119 39548 gene locus_tag LOCUS_05660 41119 39548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 42135 41221 gene locus_tag LOCUS_05670 42135 41221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 42883 42452 gene locus_tag LOCUS_05680 42883 42452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 43146 43727 gene locus_tag LOCUS_05690 43146 43727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 43766 44167 gene locus_tag LOCUS_05700 43766 44167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 45598 44717 gene locus_tag LOCUS_05710 45598 44717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 46587 45598 gene locus_tag LOCUS_05720 46587 45598 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_05720 47161 46580 gene locus_tag LOCUS_05730 47161 46580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 48412 47480 gene locus_tag LOCUS_05740 48412 47480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05740 48699 48409 gene locus_tag LOCUS_05750 48699 48409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05750 49598 48915 gene locus_tag LOCUS_05760 49598 48915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 50596 49640 gene locus_tag LOCUS_05770 50596 49640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 51916 50720 gene locus_tag LOCUS_05780 51916 50720 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024078840.1 protein_id gnl|my_center|LOCUS_05780 52725 52069 gene locus_tag LOCUS_05790 52725 52069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence009 86 913 gene locus_tag LOCUS_05800 86 913 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015685957.1 protein_id gnl|my_center|LOCUS_05800 1008 1970 gene locus_tag LOCUS_05810 1008 1970 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064634869.1 protein_id gnl|my_center|LOCUS_05810 2264 3043 gene locus_tag LOCUS_05820 2264 3043 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142544.1 protein_id gnl|my_center|LOCUS_05820 3046 4638 gene locus_tag LOCUS_05830 3046 4638 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918829.1 protein_id gnl|my_center|LOCUS_05830 4670 5107 gene locus_tag LOCUS_05840 4670 5107 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893800.1 protein_id gnl|my_center|LOCUS_05840 6028 5108 gene locus_tag LOCUS_05850 6028 5108 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089437.1 protein_id gnl|my_center|LOCUS_05850 6794 6018 gene locus_tag LOCUS_05860 6794 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 7639 6791 gene locus_tag LOCUS_05870 7639 6791 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_05870 8215 7829 gene locus_tag LOCUS_05880 8215 7829 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403928.1 protein_id gnl|my_center|LOCUS_05880 9067 8237 gene locus_tag LOCUS_05890 9067 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 9869 9099 gene locus_tag LOCUS_05900 9869 9099 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_05900 11182 10034 gene locus_tag LOCUS_05910 11182 10034 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085824.1 protein_id gnl|my_center|LOCUS_05910 11307 11750 gene locus_tag LOCUS_05920 11307 11750 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893617.1 protein_id gnl|my_center|LOCUS_05920 11838 12611 gene locus_tag LOCUS_05930 11838 12611 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919445.1 protein_id gnl|my_center|LOCUS_05930 13405 12614 gene locus_tag LOCUS_05940 13405 12614 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086453.1 protein_id gnl|my_center|LOCUS_05940 14138 13416 gene locus_tag LOCUS_05950 14138 13416 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966429.1 protein_id gnl|my_center|LOCUS_05950 15013 14156 gene locus_tag LOCUS_05960 15013 14156 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827762.1 protein_id gnl|my_center|LOCUS_05960 16218 15058 gene locus_tag LOCUS_05970 16218 15058 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082447.1 protein_id gnl|my_center|LOCUS_05970 18383 16221 gene locus_tag LOCUS_05980 18383 16221 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_05980 19623 18415 gene locus_tag LOCUS_05990 19623 18415 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_05990 21513 19843 gene locus_tag LOCUS_06000 21513 19843 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085507.1 protein_id gnl|my_center|LOCUS_06000 23985 21574 gene locus_tag LOCUS_06010 23985 21574 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_06010 25161 24028 gene locus_tag LOCUS_06020 25161 24028 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 protein_id gnl|my_center|LOCUS_06020 26682 25288 gene locus_tag LOCUS_06030 26682 25288 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_06030 28319 26703 gene locus_tag LOCUS_06040 28319 26703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 29922 28873 gene locus_tag LOCUS_06050 29922 28873 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726861.1 protein_id gnl|my_center|LOCUS_06050 31024 29975 gene locus_tag LOCUS_06060 31024 29975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966098.1 protein_id gnl|my_center|LOCUS_06060 31988 31044 gene locus_tag LOCUS_06070 31988 31044 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529820.1 protein_id gnl|my_center|LOCUS_06070 32149 32742 gene locus_tag LOCUS_06080 32149 32742 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081593.1 protein_id gnl|my_center|LOCUS_06080 32831 33850 gene locus_tag LOCUS_06090 32831 33850 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898842.1 protein_id gnl|my_center|LOCUS_06090 33925 34722 gene locus_tag LOCUS_06100 33925 34722 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 protein_id gnl|my_center|LOCUS_06100 34732 35877 gene locus_tag LOCUS_06110 34732 35877 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098538.1 protein_id gnl|my_center|LOCUS_06110 35901 36215 gene locus_tag LOCUS_06120 35901 36215 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_06120 36290 37132 gene locus_tag LOCUS_06130 gene fabG 36290 37132 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_06130 37137 38234 gene locus_tag LOCUS_06140 37137 38234 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_06140 39652 38231 gene locus_tag LOCUS_06150 39652 38231 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_06150 40438 39656 gene locus_tag LOCUS_06160 40438 39656 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459737.1 protein_id gnl|my_center|LOCUS_06160 41627 40464 gene locus_tag LOCUS_06170 41627 40464 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_06170 42325 41630 gene locus_tag LOCUS_06180 42325 41630 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327688.1 protein_id gnl|my_center|LOCUS_06180 42568 43713 gene locus_tag LOCUS_06190 42568 43713 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730164.1 protein_id gnl|my_center|LOCUS_06190 44129 43728 gene locus_tag LOCUS_06200 44129 43728 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731384.1 protein_id gnl|my_center|LOCUS_06200 45397 44126 gene locus_tag LOCUS_06210 45397 44126 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_06210 45597 46472 gene locus_tag LOCUS_06220 45597 46472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 46583 47368 gene locus_tag LOCUS_06230 46583 47368 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_06230 47408 47917 gene locus_tag LOCUS_06240 47408 47917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 49204 48119 gene locus_tag LOCUS_06250 49204 48119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 49466 50671 gene locus_tag LOCUS_06260 49466 50671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 50916 51719 gene locus_tag LOCUS_06270 50916 51719 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731385.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence010 2371 791 gene locus_tag LOCUS_06280 2371 791 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265667.1 protein_id gnl|my_center|LOCUS_06280 3476 5053 gene locus_tag LOCUS_06290 3476 5053 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918316.1 protein_id gnl|my_center|LOCUS_06290 5074 5379 gene locus_tag LOCUS_06300 5074 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 5372 5740 gene locus_tag LOCUS_06310 5372 5740 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918320.1 protein_id gnl|my_center|LOCUS_06310 5761 7896 gene locus_tag LOCUS_06320 5761 7896 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650306.1 protein_id gnl|my_center|LOCUS_06320 7893 8375 gene locus_tag LOCUS_06330 7893 8375 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324555.1 protein_id gnl|my_center|LOCUS_06330 8385 9266 gene locus_tag LOCUS_06340 8385 9266 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706839.1 protein_id gnl|my_center|LOCUS_06340 9263 10291 gene locus_tag LOCUS_06350 9263 10291 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918324.1 protein_id gnl|my_center|LOCUS_06350 10310 10699 gene locus_tag LOCUS_06360 10310 10699 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918325.1 protein_id gnl|my_center|LOCUS_06360 10699 11292 gene locus_tag LOCUS_06370 10699 11292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 11273 11683 gene locus_tag LOCUS_06380 11273 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 11865 13094 gene locus_tag LOCUS_06390 11865 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 14283 13153 gene locus_tag LOCUS_06400 14283 13153 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228921.1 protein_id gnl|my_center|LOCUS_06400 15499 14294 gene locus_tag LOCUS_06410 15499 14294 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228920.1 protein_id gnl|my_center|LOCUS_06410 16703 15513 gene locus_tag LOCUS_06420 16703 15513 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172653.1 protein_id gnl|my_center|LOCUS_06420 17337 16711 gene locus_tag LOCUS_06430 17337 16711 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_06430 19320 17341 gene locus_tag LOCUS_06440 gene atuF 19320 17341 CDS product geranyl-CoA carboxylase subunit apha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_06440 20134 19325 gene locus_tag LOCUS_06450 gene atuE 20134 19325 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_06450 21768 20146 gene locus_tag LOCUS_06460 21768 20146 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544675.1 protein_id gnl|my_center|LOCUS_06460 23580 21781 gene locus_tag LOCUS_06470 23580 21781 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_06470 25020 23986 gene locus_tag LOCUS_06480 25020 23986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 26409 25300 gene locus_tag LOCUS_06490 26409 25300 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920254.1 protein_id gnl|my_center|LOCUS_06490 27559 26426 gene locus_tag LOCUS_06500 27559 26426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_06500 29045 27768 gene locus_tag LOCUS_06510 29045 27768 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920352.1 protein_id gnl|my_center|LOCUS_06510 29487 30188 gene locus_tag LOCUS_06520 29487 30188 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265815.1 protein_id gnl|my_center|LOCUS_06520 30522 30199 gene locus_tag LOCUS_06530 30522 30199 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088626.1 protein_id gnl|my_center|LOCUS_06530 30949 30572 gene locus_tag LOCUS_06540 30949 30572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 31272 30946 gene locus_tag LOCUS_06550 31272 30946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 32918 31269 gene locus_tag LOCUS_06560 32918 31269 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339387.1 protein_id gnl|my_center|LOCUS_06560 34663 32963 gene locus_tag LOCUS_06570 34663 32963 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_06570 36415 34706 gene locus_tag LOCUS_06580 36415 34706 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_06580 36872 36633 gene locus_tag LOCUS_06590 36872 36633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 37813 37091 gene locus_tag LOCUS_06600 37813 37091 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530633.1 protein_id gnl|my_center|LOCUS_06600 38399 40813 gene locus_tag LOCUS_06610 38399 40813 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_06610 41791 40901 gene locus_tag LOCUS_06620 41791 40901 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038808.1 protein_id gnl|my_center|LOCUS_06620 41878 42849 gene locus_tag LOCUS_06630 41878 42849 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205699.1 protein_id gnl|my_center|LOCUS_06630 43565 43182 gene locus_tag LOCUS_06640 43565 43182 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172377.1 protein_id gnl|my_center|LOCUS_06640 43978 43826 gene locus_tag LOCUS_06650 43978 43826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 44030 45169 gene locus_tag LOCUS_06660 44030 45169 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223896.1 protein_id gnl|my_center|LOCUS_06660 45397 45215 gene locus_tag LOCUS_06670 45397 45215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 45541 46902 gene locus_tag LOCUS_06680 45541 46902 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088280.1 protein_id gnl|my_center|LOCUS_06680 47084 47299 gene locus_tag LOCUS_06690 47084 47299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 47301 47702 gene locus_tag LOCUS_06700 47301 47702 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_06700 48430 48050 gene locus_tag LOCUS_06710 48430 48050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 >Feature sequence011 110 26 gene locus_tag LOCUS_t00060 110 26 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 221 553 gene locus_tag LOCUS_06720 221 553 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_06720 564 848 gene locus_tag LOCUS_06730 564 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 977 1936 gene locus_tag LOCUS_06740 977 1936 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_06740 2275 3720 gene locus_tag LOCUS_06750 2275 3720 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 protein_id gnl|my_center|LOCUS_06750 3723 8261 gene locus_tag LOCUS_06760 gene gltB 3723 8261 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921434.1 protein_id gnl|my_center|LOCUS_06760 8511 9215 gene locus_tag LOCUS_06770 gene mtgA 8511 9215 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387788.1 protein_id gnl|my_center|LOCUS_06770 9269 9916 gene locus_tag LOCUS_06780 gene fzlA 9269 9916 CDS product FtsZ-binding protein FzlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921466.1 protein_id gnl|my_center|LOCUS_06780 9966 11039 gene locus_tag LOCUS_06790 gene queG 9966 11039 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083539.1 protein_id gnl|my_center|LOCUS_06790 11056 11913 gene locus_tag LOCUS_06800 11056 11913 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_06800 11910 13040 gene locus_tag LOCUS_06810 11910 13040 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 protein_id gnl|my_center|LOCUS_06810 13097 14437 gene locus_tag LOCUS_06820 13097 14437 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233175.1 protein_id gnl|my_center|LOCUS_06820 14649 14455 gene locus_tag LOCUS_06830 14649 14455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 14563 15576 gene locus_tag LOCUS_06840 14563 15576 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920725.1 protein_id gnl|my_center|LOCUS_06840 16473 15565 gene locus_tag LOCUS_06850 gene hisG 16473 15565 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921340.1 protein_id gnl|my_center|LOCUS_06850 17639 16473 gene locus_tag LOCUS_06860 17639 16473 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090256.1 protein_id gnl|my_center|LOCUS_06860 19105 17636 gene locus_tag LOCUS_06870 gene hisS 19105 17636 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399583.1 protein_id gnl|my_center|LOCUS_06870 21488 19245 gene locus_tag LOCUS_06880 21488 19245 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_06880 23666 21852 gene locus_tag LOCUS_06890 23666 21852 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994023.1 protein_id gnl|my_center|LOCUS_06890 23949 25211 gene locus_tag LOCUS_06900 23949 25211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 25475 25399 gene locus_tag LOCUS_t00070 25475 25399 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 25682 27634 gene locus_tag LOCUS_06910 25682 27634 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337150.1 protein_id gnl|my_center|LOCUS_06910 28607 27642 gene locus_tag LOCUS_06920 28607 27642 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523004.1 protein_id gnl|my_center|LOCUS_06920 28738 30270 gene locus_tag LOCUS_06930 gene hutH 28738 30270 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389056.1 protein_id gnl|my_center|LOCUS_06930 30435 31379 gene locus_tag LOCUS_06940 gene oppB 30435 31379 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 protein_id gnl|my_center|LOCUS_06940 31376 32311 gene locus_tag LOCUS_06950 31376 32311 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_06950 32313 34118 gene locus_tag LOCUS_06960 32313 34118 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336772.1 protein_id gnl|my_center|LOCUS_06960 34738 34130 gene locus_tag LOCUS_06970 34738 34130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920662.1 protein_id gnl|my_center|LOCUS_06970 34804 36411 gene locus_tag LOCUS_06980 34804 36411 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 protein_id gnl|my_center|LOCUS_06980 36585 37094 gene locus_tag LOCUS_06990 36585 37094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 38321 37632 gene locus_tag LOCUS_07000 38321 37632 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529648.1 protein_id gnl|my_center|LOCUS_07000 41020 38318 gene locus_tag LOCUS_07010 41020 38318 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529647.1 protein_id gnl|my_center|LOCUS_07010 41620 41030 gene locus_tag LOCUS_07020 41620 41030 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089516.1 protein_id gnl|my_center|LOCUS_07020 43699 41633 gene locus_tag LOCUS_07030 gene kdpB 43699 41633 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965691.1 protein_id gnl|my_center|LOCUS_07030 45439 43712 gene locus_tag LOCUS_07040 gene kdpA 45439 43712 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089518.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence012 609 193 gene locus_tag LOCUS_07050 609 193 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061303.1 protein_id gnl|my_center|LOCUS_07050 878 2488 gene locus_tag LOCUS_07060 878 2488 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480502.1 protein_id gnl|my_center|LOCUS_07060 2571 4142 gene locus_tag LOCUS_07070 2571 4142 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480502.1 protein_id gnl|my_center|LOCUS_07070 4729 4223 gene locus_tag LOCUS_07080 4729 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4643 6184 gene locus_tag LOCUS_07090 4643 6184 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_07090 6739 6320 gene locus_tag LOCUS_07100 6739 6320 CDS product DUF3775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173751.1 protein_id gnl|my_center|LOCUS_07100 9491 6819 gene locus_tag LOCUS_07110 9491 6819 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_07110 11016 9493 gene locus_tag LOCUS_07120 11016 9493 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390363.1 protein_id gnl|my_center|LOCUS_07120 11630 11046 gene locus_tag LOCUS_07130 11630 11046 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683439.1 protein_id gnl|my_center|LOCUS_07130 11811 11641 gene locus_tag LOCUS_07140 11811 11641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 11945 13108 gene locus_tag LOCUS_07150 11945 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 13105 13725 gene locus_tag LOCUS_07160 gene fixJ 13105 13725 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970952.1 protein_id gnl|my_center|LOCUS_07160 13827 14225 gene locus_tag LOCUS_07170 13827 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 14317 15012 gene locus_tag LOCUS_07180 14317 15012 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 protein_id gnl|my_center|LOCUS_07180 15019 15867 gene locus_tag LOCUS_07190 15019 15867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 16050 17279 gene locus_tag LOCUS_07200 16050 17279 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089071.1 protein_id gnl|my_center|LOCUS_07200 17291 18295 gene locus_tag LOCUS_07210 17291 18295 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089248.1 protein_id gnl|my_center|LOCUS_07210 18296 19567 gene locus_tag LOCUS_07220 18296 19567 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113728.1 protein_id gnl|my_center|LOCUS_07220 19570 20955 gene locus_tag LOCUS_07230 gene lpdA 19570 20955 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528744.1 protein_id gnl|my_center|LOCUS_07230 21117 21602 gene locus_tag LOCUS_07240 21117 21602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 22811 21639 gene locus_tag LOCUS_07250 22811 21639 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731042.1 protein_id gnl|my_center|LOCUS_07250 24281 22851 gene locus_tag LOCUS_07260 24281 22851 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086653.1 protein_id gnl|my_center|LOCUS_07260 24351 25385 gene locus_tag LOCUS_07270 24351 25385 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731043.1 protein_id gnl|my_center|LOCUS_07270 26458 25382 gene locus_tag LOCUS_07280 gene flhB 26458 25382 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 protein_id gnl|my_center|LOCUS_07280 27229 26462 gene locus_tag LOCUS_07290 gene fliR 27229 26462 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088554.1 protein_id gnl|my_center|LOCUS_07290 27504 27241 gene locus_tag LOCUS_07300 gene fliQ 27504 27241 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640137.1 protein_id gnl|my_center|LOCUS_07300 27850 27515 gene locus_tag LOCUS_07310 27850 27515 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390451.1 protein_id gnl|my_center|LOCUS_07310 28284 27874 gene locus_tag LOCUS_07320 gene flgC 28284 27874 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602149.1 protein_id gnl|my_center|LOCUS_07320 28716 28306 gene locus_tag LOCUS_07330 gene flgB 28716 28306 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088557.1 protein_id gnl|my_center|LOCUS_07330 28889 29173 gene locus_tag LOCUS_07340 28889 29173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 29170 29952 gene locus_tag LOCUS_07350 gene fliP 29170 29952 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088559.1 protein_id gnl|my_center|LOCUS_07350 30078 29851 gene locus_tag LOCUS_07360 30078 29851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 30153 30527 gene locus_tag LOCUS_07370 30153 30527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 30706 31146 gene locus_tag LOCUS_07380 30706 31146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 31578 31165 gene locus_tag LOCUS_07390 31578 31165 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336801.1 protein_id gnl|my_center|LOCUS_07390 31868 31578 gene locus_tag LOCUS_07400 31868 31578 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385406.1 protein_id gnl|my_center|LOCUS_07400 32866 31877 gene locus_tag LOCUS_07410 32866 31877 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083397.1 protein_id gnl|my_center|LOCUS_07410 32989 33621 gene locus_tag LOCUS_07420 32989 33621 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974635.1 protein_id gnl|my_center|LOCUS_07420 33662 34282 gene locus_tag LOCUS_07430 33662 34282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 34393 35070 gene locus_tag LOCUS_07440 34393 35070 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 protein_id gnl|my_center|LOCUS_07440 35189 36760 gene locus_tag LOCUS_07450 35189 36760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 37671 37054 gene locus_tag LOCUS_07460 gene rpsD 37671 37054 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719445.1 protein_id gnl|my_center|LOCUS_07460 38710 38438 gene locus_tag LOCUS_07470 38710 38438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 38606 39181 gene locus_tag LOCUS_07480 38606 39181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 41301 39898 gene locus_tag LOCUS_07490 gene lpdA 41301 39898 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265532.1 protein_id gnl|my_center|LOCUS_07490 42609 41362 gene locus_tag LOCUS_07500 gene odhB 42609 41362 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083283.1 protein_id gnl|my_center|LOCUS_07500 43373 42606 gene locus_tag LOCUS_07510 43373 42606 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081985.1 protein_id gnl|my_center|LOCUS_07510 <44575 43370 gene locus_tag LOCUS_07520 <44575 43370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528850.1:2-oxoglutarate dehydrogenase E1 component >Feature sequence013 892 380 gene locus_tag LOCUS_07530 892 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 1414 2238 gene locus_tag LOCUS_07540 gene panC 1414 2238 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258070.1 protein_id gnl|my_center|LOCUS_07540 2923 2321 gene locus_tag LOCUS_07550 2923 2321 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730986.1 protein_id gnl|my_center|LOCUS_07550 3236 3532 gene locus_tag LOCUS_07560 3236 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 4091 4411 gene locus_tag LOCUS_07570 4091 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 5572 5198 gene locus_tag LOCUS_07580 5572 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 5543 5911 gene locus_tag LOCUS_07590 5543 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 5913 6245 gene locus_tag LOCUS_07600 5913 6245 CDS product type IV secretion system protein VirB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533342.1 protein_id gnl|my_center|LOCUS_07600 6271 8631 gene locus_tag LOCUS_07610 6271 8631 CDS product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970878.1 protein_id gnl|my_center|LOCUS_07610 8645 9343 gene locus_tag LOCUS_07620 8645 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 9361 9690 gene locus_tag LOCUS_07630 9361 9690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 9687 10622 gene locus_tag LOCUS_07640 9687 10622 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974917.1 protein_id gnl|my_center|LOCUS_07640 10943 11635 gene locus_tag LOCUS_07650 10943 11635 CDS product type IV secretion system protein VirB8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533337.1 protein_id gnl|my_center|LOCUS_07650 11632 12546 gene locus_tag LOCUS_07660 gene virB9 11632 12546 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970873.1 protein_id gnl|my_center|LOCUS_07660 12543 13673 gene locus_tag LOCUS_07670 gene virB10 12543 13673 CDS product type IV secretion system protein VirB10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970872.1 protein_id gnl|my_center|LOCUS_07670 13663 14703 gene locus_tag LOCUS_07680 gene virB11 13663 14703 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970871.1 protein_id gnl|my_center|LOCUS_07680 14716 16560 gene locus_tag LOCUS_07690 14716 16560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 16553 16777 gene locus_tag LOCUS_07700 16553 16777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 20505 16774 gene locus_tag LOCUS_07710 20505 16774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 20839 20507 gene locus_tag LOCUS_07720 20839 20507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 21614 22495 gene locus_tag LOCUS_07730 21614 22495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 22483 23130 gene locus_tag LOCUS_07740 22483 23130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 24374 23358 gene locus_tag LOCUS_07750 24374 23358 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967225.1 protein_id gnl|my_center|LOCUS_07750 24960 24367 gene locus_tag LOCUS_07760 24960 24367 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526832.1 protein_id gnl|my_center|LOCUS_07760 25768 25097 gene locus_tag LOCUS_07770 25768 25097 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532730.1 protein_id gnl|my_center|LOCUS_07770 27964 25781 gene locus_tag LOCUS_07780 27964 25781 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398395.1 protein_id gnl|my_center|LOCUS_07780 28065 28817 gene locus_tag LOCUS_07790 28065 28817 CDS product ImuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967468.1 protein_id gnl|my_center|LOCUS_07790 28732 30267 gene locus_tag LOCUS_07800 28732 30267 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257431.1 protein_id gnl|my_center|LOCUS_07800 30264 33518 gene locus_tag LOCUS_07810 30264 33518 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972863.1 protein_id gnl|my_center|LOCUS_07810 34128 33817 gene locus_tag LOCUS_07820 34128 33817 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368635.1 protein_id gnl|my_center|LOCUS_07820 35751 34789 gene locus_tag LOCUS_07830 35751 34789 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860032.1 protein_id gnl|my_center|LOCUS_07830 36745 35798 gene locus_tag LOCUS_07840 36745 35798 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981715.1 protein_id gnl|my_center|LOCUS_07840 36888 37781 gene locus_tag LOCUS_07850 gene pgrR 36888 37781 CDS product DNA-binding transcriptional regulator PgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817708.1 protein_id gnl|my_center|LOCUS_07850 38192 37875 gene locus_tag LOCUS_07860 38192 37875 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640626.1 protein_id gnl|my_center|LOCUS_07860 38427 38182 gene locus_tag LOCUS_07870 38427 38182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 39565 38852 gene locus_tag LOCUS_07880 39565 38852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 40614 39685 gene locus_tag LOCUS_07890 40614 39685 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 protein_id gnl|my_center|LOCUS_07890 41986 40931 gene locus_tag LOCUS_07900 41986 40931 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082896.1 protein_id gnl|my_center|LOCUS_07900 <43052 41986 gene locus_tag LOCUS_07910 <43052 41986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_148736670.1:strawberry notch family protein >Feature sequence014 924 598 gene locus_tag LOCUS_07920 924 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1079 921 gene locus_tag LOCUS_07930 1079 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07930 1945 1271 gene locus_tag LOCUS_07940 1945 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2240 1959 gene locus_tag LOCUS_07950 2240 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07950 2548 2315 gene locus_tag LOCUS_07960 2548 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07960 2897 2682 gene locus_tag LOCUS_07970 2897 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 3938 2946 gene locus_tag LOCUS_07980 3938 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07980 4269 3928 gene locus_tag LOCUS_07990 4269 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 5241 4660 gene locus_tag LOCUS_08000 5241 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08000 5228 5494 gene locus_tag LOCUS_08010 5228 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 5867 5586 gene locus_tag LOCUS_08020 5867 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08020 7267 6029 gene locus_tag LOCUS_08030 7267 6029 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063790.1 protein_id gnl|my_center|LOCUS_08030 7517 7260 gene locus_tag LOCUS_08040 7517 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 8178 7609 gene locus_tag LOCUS_08050 8178 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 8357 8638 gene locus_tag LOCUS_08060 8357 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08060 8866 9561 gene locus_tag LOCUS_08070 8866 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 9683 11365 gene locus_tag LOCUS_08080 9683 11365 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921779.1 protein_id gnl|my_center|LOCUS_08080 11802 11584 gene locus_tag LOCUS_08090 11802 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 12071 11799 gene locus_tag LOCUS_08100 12071 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 12152 12334 gene locus_tag LOCUS_08110 12152 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 12428 13045 gene locus_tag LOCUS_08120 12428 13045 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_08120 13042 13902 gene locus_tag LOCUS_08130 13042 13902 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_08130 14503 14342 gene locus_tag LOCUS_08140 14503 14342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 18068 14589 gene locus_tag LOCUS_08150 18068 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 18554 21844 gene locus_tag LOCUS_08160 18554 21844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 22120 23295 gene locus_tag LOCUS_08170 22120 23295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 23388 26348 gene locus_tag LOCUS_08180 23388 26348 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_08180 26364 27008 gene locus_tag LOCUS_08190 26364 27008 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_08190 29567 27030 gene locus_tag LOCUS_08200 29567 27030 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027341.1 protein_id gnl|my_center|LOCUS_08200 29713 31899 gene locus_tag LOCUS_08210 29713 31899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 32438 32013 gene locus_tag LOCUS_08220 32438 32013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 32817 33086 gene locus_tag LOCUS_08230 32817 33086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 33101 33661 gene locus_tag LOCUS_08240 33101 33661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 34397 33681 gene locus_tag LOCUS_08250 34397 33681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 34407 34691 gene locus_tag LOCUS_08260 34407 34691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 34681 35082 gene locus_tag LOCUS_08270 34681 35082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 36400 35186 gene locus_tag LOCUS_08280 36400 35186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 37063 37905 gene locus_tag LOCUS_08290 37063 37905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 38025 38390 gene locus_tag LOCUS_08300 38025 38390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 38880 38482 gene locus_tag LOCUS_08310 38880 38482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 39175 38783 gene locus_tag LOCUS_08320 39175 38783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 39491 39321 gene locus_tag LOCUS_08330 39491 39321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08330 39782 39531 gene locus_tag LOCUS_08340 39782 39531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08340 39942 40952 gene locus_tag LOCUS_08350 39942 40952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 41339 41252 gene locus_tag LOCUS_t00080 41339 41252 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence015 344 2248 gene locus_tag LOCUS_08360 344 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 2566 3183 gene locus_tag LOCUS_08370 2566 3183 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932044.1 protein_id gnl|my_center|LOCUS_08370 4011 3262 gene locus_tag LOCUS_08380 4011 3262 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_08380 4867 4703 gene locus_tag LOCUS_08390 4867 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 4847 5548 gene locus_tag LOCUS_08400 4847 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 7917 5581 gene locus_tag LOCUS_08410 7917 5581 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_08410 8650 11931 gene locus_tag LOCUS_08420 8650 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 12117 13655 gene locus_tag LOCUS_08430 12117 13655 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919385.1 protein_id gnl|my_center|LOCUS_08430 13764 15611 gene locus_tag LOCUS_08440 gene ftsH 13764 15611 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388853.1 protein_id gnl|my_center|LOCUS_08440 15990 15757 gene locus_tag LOCUS_08450 15990 15757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 16210 15938 gene locus_tag LOCUS_08460 16210 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 16159 16485 gene locus_tag LOCUS_08470 16159 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 16539 17528 gene locus_tag LOCUS_08480 16539 17528 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_08480 17617 18723 gene locus_tag LOCUS_08490 17617 18723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 18782 19459 gene locus_tag LOCUS_08500 18782 19459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174699.1 protein_id gnl|my_center|LOCUS_08500 19887 19504 gene locus_tag LOCUS_08510 19887 19504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 19968 20558 gene locus_tag LOCUS_08520 gene mobA 19968 20558 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338451.1 protein_id gnl|my_center|LOCUS_08520 21333 20530 gene locus_tag LOCUS_08530 gene fdhD 21333 20530 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528554.1 protein_id gnl|my_center|LOCUS_08530 22397 21339 gene locus_tag LOCUS_08540 22397 21339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 22942 22616 gene locus_tag LOCUS_08550 22942 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 23039 23842 gene locus_tag LOCUS_08560 23039 23842 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_08560 24003 25535 gene locus_tag LOCUS_08570 24003 25535 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539579.1 protein_id gnl|my_center|LOCUS_08570 26340 25567 gene locus_tag LOCUS_08580 gene fabG 26340 25567 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_08580 26673 27713 gene locus_tag LOCUS_08590 gene dusA 26673 27713 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086515.1 protein_id gnl|my_center|LOCUS_08590 27713 28549 gene locus_tag LOCUS_08600 27713 28549 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389102.1 protein_id gnl|my_center|LOCUS_08600 30146 28647 gene locus_tag LOCUS_08610 30146 28647 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090848.1 protein_id gnl|my_center|LOCUS_08610 30286 31143 gene locus_tag LOCUS_08620 gene cobA 30286 31143 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975884.1 protein_id gnl|my_center|LOCUS_08620 31168 31959 gene locus_tag LOCUS_08630 31168 31959 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724181.1 protein_id gnl|my_center|LOCUS_08630 32137 31913 gene locus_tag LOCUS_08640 32137 31913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 32546 32181 gene locus_tag LOCUS_08650 32546 32181 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639894.1 protein_id gnl|my_center|LOCUS_08650 32968 32579 gene locus_tag LOCUS_08660 32968 32579 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072053.1 protein_id gnl|my_center|LOCUS_08660 34214 32970 gene locus_tag LOCUS_08670 34214 32970 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_08670 35366 34230 gene locus_tag LOCUS_08680 35366 34230 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_08680 35826 38468 gene locus_tag LOCUS_08690 gene pepN 35826 38468 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920339.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence016 1954 1046 gene locus_tag LOCUS_08700 1954 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2633 1959 gene locus_tag LOCUS_08710 2633 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 2914 2633 gene locus_tag LOCUS_08720 2914 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3767 3090 gene locus_tag LOCUS_08730 3767 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 3958 3764 gene locus_tag LOCUS_08740 3958 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 4385 3978 gene locus_tag LOCUS_08750 4385 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 4736 4404 gene locus_tag LOCUS_08760 4736 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 6126 4765 gene locus_tag LOCUS_08770 6126 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 6855 6244 gene locus_tag LOCUS_08780 6855 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 8394 6916 gene locus_tag LOCUS_08790 8394 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 8613 8398 gene locus_tag LOCUS_08800 8613 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 10062 8623 gene locus_tag LOCUS_08810 gene terL 10062 8623 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697216.1 protein_id gnl|my_center|LOCUS_08810 10841 10302 gene locus_tag LOCUS_08820 10841 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 11631 11020 gene locus_tag LOCUS_08830 11631 11020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 11762 11947 gene locus_tag LOCUS_08840 11762 11947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 12087 12395 gene locus_tag LOCUS_08850 12087 12395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 12399 12674 gene locus_tag LOCUS_08860 12399 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 12671 12865 gene locus_tag LOCUS_08870 12671 12865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 12967 13698 gene locus_tag LOCUS_08880 12967 13698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 13695 13922 gene locus_tag LOCUS_08890 13695 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 13919 14269 gene locus_tag LOCUS_08900 13919 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 14266 14457 gene locus_tag LOCUS_08910 14266 14457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 14485 14865 gene locus_tag LOCUS_08920 14485 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 14868 16238 gene locus_tag LOCUS_08930 14868 16238 CDS product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331420.1 protein_id gnl|my_center|LOCUS_08930 16271 16498 gene locus_tag LOCUS_08940 16271 16498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 17055 16558 gene locus_tag LOCUS_08950 17055 16558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 17363 17055 gene locus_tag LOCUS_08960 17363 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 18163 17360 gene locus_tag LOCUS_08970 18163 17360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 19268 18165 gene locus_tag LOCUS_08980 19268 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 19501 19265 gene locus_tag LOCUS_08990 19501 19265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 19901 19422 gene locus_tag LOCUS_09000 19901 19422 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087466.1 protein_id gnl|my_center|LOCUS_09000 20478 19945 gene locus_tag LOCUS_09010 20478 19945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 21029 20478 gene locus_tag LOCUS_09020 21029 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 21625 21086 gene locus_tag LOCUS_09030 21625 21086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 21929 21636 gene locus_tag LOCUS_09040 21929 21636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 22768 21929 gene locus_tag LOCUS_09050 22768 21929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 23904 22765 gene locus_tag LOCUS_09060 23904 22765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 24025 24216 gene locus_tag LOCUS_09070 24025 24216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 24554 24946 gene locus_tag LOCUS_09080 24554 24946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 25489 25800 gene locus_tag LOCUS_09090 25489 25800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 26007 26345 gene locus_tag LOCUS_09100 26007 26345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 26342 26578 gene locus_tag LOCUS_09110 26342 26578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 26741 26965 gene locus_tag LOCUS_09120 26741 26965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 27202 27480 gene locus_tag LOCUS_09130 27202 27480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 27480 28040 gene locus_tag LOCUS_09140 27480 28040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 28040 28279 gene locus_tag LOCUS_09150 28040 28279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 28353 29762 gene locus_tag LOCUS_09160 28353 29762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 29785 30558 gene locus_tag LOCUS_09170 29785 30558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 30555 31256 gene locus_tag LOCUS_09180 30555 31256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 31287 32006 gene locus_tag LOCUS_09190 gene exoX 31287 32006 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816172.1 protein_id gnl|my_center|LOCUS_09190 32048 32350 gene locus_tag LOCUS_09200 32048 32350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 32469 32347 gene locus_tag LOCUS_09210 32469 32347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 32571 32765 gene locus_tag LOCUS_09220 32571 32765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 32792 33106 gene locus_tag LOCUS_09230 32792 33106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 33069 33725 gene locus_tag LOCUS_09240 33069 33725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 33763 33972 gene locus_tag LOCUS_09250 33763 33972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 33969 34562 gene locus_tag LOCUS_09260 33969 34562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 34559 34918 gene locus_tag LOCUS_09270 34559 34918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 35484 36596 gene locus_tag LOCUS_09280 35484 36596 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387389.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence017 1254 670 gene locus_tag LOCUS_09290 1254 670 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640037.1 protein_id gnl|my_center|LOCUS_09290 1813 1256 gene locus_tag LOCUS_09300 gene lspA 1813 1256 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174654.1 protein_id gnl|my_center|LOCUS_09300 4692 1810 gene locus_tag LOCUS_09310 gene ileS 4692 1810 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338324.1 protein_id gnl|my_center|LOCUS_09310 5848 4874 gene locus_tag LOCUS_09320 5848 4874 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383736.1 protein_id gnl|my_center|LOCUS_09320 6279 5857 gene locus_tag LOCUS_09330 6279 5857 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_09330 7164 6310 gene locus_tag LOCUS_09340 7164 6310 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174657.1 protein_id gnl|my_center|LOCUS_09340 8449 7196 gene locus_tag LOCUS_09350 8449 7196 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918596.1 protein_id gnl|my_center|LOCUS_09350 8904 9668 gene locus_tag LOCUS_09360 8904 9668 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_09360 9747 10592 gene locus_tag LOCUS_09370 9747 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 11774 10656 gene locus_tag LOCUS_09380 gene ald 11774 10656 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_09380 12840 12304 gene locus_tag LOCUS_09390 12840 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 14155 12953 gene locus_tag LOCUS_09400 14155 12953 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_09400 14158 14991 gene locus_tag LOCUS_09410 14158 14991 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028804.1 protein_id gnl|my_center|LOCUS_09410 15274 16314 gene locus_tag LOCUS_09420 gene aphA 15274 16314 CDS product acetylpolyamine amidohydrolase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112424.1 protein_id gnl|my_center|LOCUS_09420 16674 16408 gene locus_tag LOCUS_09430 16674 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 17236 16772 gene locus_tag LOCUS_09440 17236 16772 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921141.1 protein_id gnl|my_center|LOCUS_09440 17141 17356 gene locus_tag LOCUS_09450 17141 17356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 17481 17798 gene locus_tag LOCUS_09460 gene groES 17481 17798 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530718.1 protein_id gnl|my_center|LOCUS_09460 17895 19538 gene locus_tag LOCUS_09470 gene groL 17895 19538 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090265.1 protein_id gnl|my_center|LOCUS_09470 19821 20327 gene locus_tag LOCUS_09480 19821 20327 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_09480 20597 20355 gene locus_tag LOCUS_09490 20597 20355 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920053.1 protein_id gnl|my_center|LOCUS_09490 21346 20771 gene locus_tag LOCUS_09500 21346 20771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 21783 21433 gene locus_tag LOCUS_09510 21783 21433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 22136 21780 gene locus_tag LOCUS_09520 22136 21780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 22298 24277 gene locus_tag LOCUS_09530 gene thrS 22298 24277 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 protein_id gnl|my_center|LOCUS_09530 24537 25067 gene locus_tag LOCUS_09540 gene infC 24537 25067 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527030.1 protein_id gnl|my_center|LOCUS_09540 26175 25189 gene locus_tag LOCUS_09550 26175 25189 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528653.1 protein_id gnl|my_center|LOCUS_09550 26755 26961 gene locus_tag LOCUS_09560 26755 26961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 26958 27869 gene locus_tag LOCUS_09570 26958 27869 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532624.1 protein_id gnl|my_center|LOCUS_09570 28340 27864 gene locus_tag LOCUS_09580 28340 27864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 29137 28337 gene locus_tag LOCUS_09590 29137 28337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 29087 29284 gene locus_tag LOCUS_09600 29087 29284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 30300 29299 gene locus_tag LOCUS_09610 30300 29299 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_09610 31608 30304 gene locus_tag LOCUS_09620 gene ablA 31608 30304 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399420.1 protein_id gnl|my_center|LOCUS_09620 33462 31993 gene locus_tag LOCUS_09630 33462 31993 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 protein_id gnl|my_center|LOCUS_09630 35141 33459 gene locus_tag LOCUS_09640 35141 33459 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918356.1 protein_id gnl|my_center|LOCUS_09640 35397 36122 gene locus_tag LOCUS_09650 35397 36122 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918357.1 protein_id gnl|my_center|LOCUS_09650 36122 36448 gene locus_tag LOCUS_09660 36122 36448 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_09660 36620 36712 gene locus_tag LOCUS_t00090 36620 36712 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence018 78 953 gene locus_tag LOCUS_09670 78 953 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722439.1 protein_id gnl|my_center|LOCUS_09670 1951 1043 gene locus_tag LOCUS_09680 gene rarD 1951 1043 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791842.1 protein_id gnl|my_center|LOCUS_09680 3633 2038 gene locus_tag LOCUS_09690 gene cimA 3633 2038 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086573.1 protein_id gnl|my_center|LOCUS_09690 4209 3703 gene locus_tag LOCUS_09700 4209 3703 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966251.1 protein_id gnl|my_center|LOCUS_09700 5682 4276 gene locus_tag LOCUS_09710 gene cysS 5682 4276 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086571.1 protein_id gnl|my_center|LOCUS_09710 7126 5798 gene locus_tag LOCUS_09720 gene gltX 7126 5798 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388446.1 protein_id gnl|my_center|LOCUS_09720 8775 7123 gene locus_tag LOCUS_09730 8775 7123 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086561.1 protein_id gnl|my_center|LOCUS_09730 9809 9036 gene locus_tag LOCUS_09740 9809 9036 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919881.1 protein_id gnl|my_center|LOCUS_09740 9822 10091 gene locus_tag LOCUS_09750 9822 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 10190 11218 gene locus_tag LOCUS_09760 10190 11218 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919882.1 protein_id gnl|my_center|LOCUS_09760 11984 11247 gene locus_tag LOCUS_09770 11984 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 13383 12010 gene locus_tag LOCUS_09780 13383 12010 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086559.1 protein_id gnl|my_center|LOCUS_09780 14231 13494 gene locus_tag LOCUS_09790 14231 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 15763 14381 gene locus_tag LOCUS_09800 gene gor 15763 14381 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531664.1 protein_id gnl|my_center|LOCUS_09800 16467 15760 gene locus_tag LOCUS_09810 gene rpiA 16467 15760 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258577.1 protein_id gnl|my_center|LOCUS_09810 18546 16717 gene locus_tag LOCUS_09820 gene glmS 18546 16717 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087378.1 protein_id gnl|my_center|LOCUS_09820 19911 18550 gene locus_tag LOCUS_09830 gene glmU 19911 18550 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626497.1 protein_id gnl|my_center|LOCUS_09830 20064 20726 gene locus_tag LOCUS_09840 20064 20726 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086535.1 protein_id gnl|my_center|LOCUS_09840 20852 20926 gene locus_tag LOCUS_t00100 20852 20926 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21790 21134 gene locus_tag LOCUS_09850 21790 21134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 23214 21790 gene locus_tag LOCUS_09860 23214 21790 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539284.1 protein_id gnl|my_center|LOCUS_09860 25050 23440 gene locus_tag LOCUS_09870 25050 23440 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205720.1 protein_id gnl|my_center|LOCUS_09870 26784 25564 gene locus_tag LOCUS_09880 gene kch 26784 25564 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807739.1 protein_id gnl|my_center|LOCUS_09880 27132 27365 gene locus_tag LOCUS_09890 27132 27365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 27491 28666 gene locus_tag LOCUS_09900 gene hpnI 27491 28666 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197829.1 protein_id gnl|my_center|LOCUS_09900 28686 30113 gene locus_tag LOCUS_09910 gene hpnJ 28686 30113 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_09910 30137 30976 gene locus_tag LOCUS_09920 gene hpnK 30137 30976 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552372.1 protein_id gnl|my_center|LOCUS_09920 31094 31993 gene locus_tag LOCUS_09930 31094 31993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266244.1 protein_id gnl|my_center|LOCUS_09930 32025 33020 gene locus_tag LOCUS_09940 32025 33020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 33017 34006 gene locus_tag LOCUS_09950 33017 34006 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529382.1 protein_id gnl|my_center|LOCUS_09950 34003 35160 gene locus_tag LOCUS_09960 34003 35160 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188250.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence019 462 599 gene locus_tag LOCUS_09970 462 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 703 1182 gene locus_tag LOCUS_09980 gene rplM 703 1182 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529229.1 protein_id gnl|my_center|LOCUS_09980 1185 1682 gene locus_tag LOCUS_09990 gene rpsI 1185 1682 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720163.1 protein_id gnl|my_center|LOCUS_09990 2081 3397 gene locus_tag LOCUS_10000 2081 3397 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729025.1 protein_id gnl|my_center|LOCUS_10000 4416 3532 gene locus_tag LOCUS_10010 gene pstA 4416 3532 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404794.1 protein_id gnl|my_center|LOCUS_10010 5387 4419 gene locus_tag LOCUS_10020 gene pstC 5387 4419 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404792.1 protein_id gnl|my_center|LOCUS_10020 6553 5456 gene locus_tag LOCUS_10030 gene pstS 6553 5456 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900236.1 protein_id gnl|my_center|LOCUS_10030 6855 8267 gene locus_tag LOCUS_10040 6855 8267 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 protein_id gnl|my_center|LOCUS_10040 8300 9238 gene locus_tag LOCUS_10050 gene argC 8300 9238 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_10050 9256 9936 gene locus_tag LOCUS_10060 9256 9936 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920422.1 protein_id gnl|my_center|LOCUS_10060 11091 9871 gene locus_tag LOCUS_10070 11091 9871 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_10070 13058 11124 gene locus_tag LOCUS_10080 13058 11124 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265707.1 protein_id gnl|my_center|LOCUS_10080 13238 14299 gene locus_tag LOCUS_10090 13238 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 14374 15588 gene locus_tag LOCUS_10100 14374 15588 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919258.1 protein_id gnl|my_center|LOCUS_10100 15585 16871 gene locus_tag LOCUS_10110 15585 16871 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390163.1 protein_id gnl|my_center|LOCUS_10110 16900 17859 gene locus_tag LOCUS_10120 gene glpX 16900 17859 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531987.1 protein_id gnl|my_center|LOCUS_10120 17849 19639 gene locus_tag LOCUS_10130 gene recJ 17849 19639 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110375784.1 protein_id gnl|my_center|LOCUS_10130 19714 19788 gene locus_tag LOCUS_t00110 19714 19788 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20459 19938 gene locus_tag LOCUS_10140 20459 19938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_10140 20776 20462 gene locus_tag LOCUS_10150 20776 20462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 21193 21014 gene locus_tag LOCUS_10160 21193 21014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 21922 21287 gene locus_tag LOCUS_10170 21922 21287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 22055 22207 gene locus_tag LOCUS_10180 22055 22207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 23043 22657 gene locus_tag LOCUS_10190 23043 22657 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_10190 23294 23052 gene locus_tag LOCUS_10200 23294 23052 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_10200 24257 23943 gene locus_tag LOCUS_10210 24257 23943 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188824681.1 protein_id gnl|my_center|LOCUS_10210 24760 24317 gene locus_tag LOCUS_10220 24760 24317 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970313.1 protein_id gnl|my_center|LOCUS_10220 25002 24757 gene locus_tag LOCUS_10230 25002 24757 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535711.1 protein_id gnl|my_center|LOCUS_10230 26132 25848 gene locus_tag LOCUS_10240 26132 25848 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532246.1 protein_id gnl|my_center|LOCUS_10240 26407 26138 gene locus_tag LOCUS_10250 26407 26138 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970754.1 protein_id gnl|my_center|LOCUS_10250 27785 26982 gene locus_tag LOCUS_10260 27785 26982 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047873.1 protein_id gnl|my_center|LOCUS_10260 31295 28152 gene locus_tag LOCUS_10270 31295 28152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_10270 35441 32268 gene locus_tag LOCUS_10280 35441 32268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence020 686 336 gene locus_tag LOCUS_10290 686 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10290 1085 717 gene locus_tag LOCUS_10300 1085 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10300 1758 1228 gene locus_tag LOCUS_10310 1758 1228 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730078.1 protein_id gnl|my_center|LOCUS_10310 2470 1802 gene locus_tag LOCUS_10320 2470 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 3471 3061 gene locus_tag LOCUS_10330 3471 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 5120 3645 gene locus_tag LOCUS_10340 5120 3645 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079346.1 protein_id gnl|my_center|LOCUS_10340 5547 5257 gene locus_tag LOCUS_10350 5547 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 5950 6594 gene locus_tag LOCUS_10360 5950 6594 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886614.1 protein_id gnl|my_center|LOCUS_10360 7039 6797 gene locus_tag LOCUS_10370 7039 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 7578 7027 gene locus_tag LOCUS_10380 7578 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 7903 7634 gene locus_tag LOCUS_10390 7903 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10390 8485 8027 gene locus_tag LOCUS_10400 8485 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10400 9420 8674 gene locus_tag LOCUS_10410 9420 8674 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729763.1 protein_id gnl|my_center|LOCUS_10410 9583 10005 gene locus_tag LOCUS_10420 9583 10005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 10486 10025 gene locus_tag LOCUS_10430 10486 10025 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084268.1 protein_id gnl|my_center|LOCUS_10430 10640 12772 gene locus_tag LOCUS_10440 10640 12772 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135545767.1 protein_id gnl|my_center|LOCUS_10440 12769 13500 gene locus_tag LOCUS_10450 12769 13500 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_10450 13641 14810 gene locus_tag LOCUS_10460 13641 14810 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252726.1 protein_id gnl|my_center|LOCUS_10460 15239 14865 gene locus_tag LOCUS_10470 15239 14865 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467525.1 protein_id gnl|my_center|LOCUS_10470 16055 15270 gene locus_tag LOCUS_10480 16055 15270 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419223.1 protein_id gnl|my_center|LOCUS_10480 17691 16633 gene locus_tag LOCUS_10490 17691 16633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 18477 17716 gene locus_tag LOCUS_10500 18477 17716 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 protein_id gnl|my_center|LOCUS_10500 19412 18480 gene locus_tag LOCUS_10510 19412 18480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 20631 19402 gene locus_tag LOCUS_10520 20631 19402 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228930.1 protein_id gnl|my_center|LOCUS_10520 21819 20650 gene locus_tag LOCUS_10530 21819 20650 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964038.1 protein_id gnl|my_center|LOCUS_10530 22986 22054 gene locus_tag LOCUS_10540 22986 22054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 23918 23223 gene locus_tag LOCUS_10550 23918 23223 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071741.1 protein_id gnl|my_center|LOCUS_10550 25653 24631 gene locus_tag LOCUS_10560 25653 24631 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533083.1 protein_id gnl|my_center|LOCUS_10560 27751 25694 gene locus_tag LOCUS_10570 27751 25694 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086230.1 protein_id gnl|my_center|LOCUS_10570 28880 27789 gene locus_tag LOCUS_10580 28880 27789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 29812 28877 gene locus_tag LOCUS_10590 29812 28877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 31354 30656 gene locus_tag LOCUS_10600 31354 30656 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967292.1 protein_id gnl|my_center|LOCUS_10600 31503 31763 gene locus_tag LOCUS_10610 31503 31763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10610 31887 32087 gene locus_tag LOCUS_10620 31887 32087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10620 32727 32242 gene locus_tag LOCUS_10630 32727 32242 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391345.1 protein_id gnl|my_center|LOCUS_10630 33261 32815 gene locus_tag LOCUS_10640 33261 32815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 34288 33653 gene locus_tag LOCUS_10650 34288 33653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 <35220 34386 gene locus_tag LOCUS_10660 <35220 34386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000092667.1:Gly-Xaa-Xaa repeat protein >Feature sequence021 946 11 gene locus_tag LOCUS_10670 946 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 2784 943 gene locus_tag LOCUS_10680 2784 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3828 2788 gene locus_tag LOCUS_10690 gene virB11 3828 2788 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974918.1 protein_id gnl|my_center|LOCUS_10690 4987 3818 gene locus_tag LOCUS_10700 gene virB10 4987 3818 CDS product type IV secretion system protein VirB10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891494.1 protein_id gnl|my_center|LOCUS_10700 5910 4984 gene locus_tag LOCUS_10710 gene virB9 5910 4984 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970873.1 protein_id gnl|my_center|LOCUS_10710 6599 5907 gene locus_tag LOCUS_10720 6599 5907 CDS product type IV secretion system protein VirB8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533337.1 protein_id gnl|my_center|LOCUS_10720 6905 6609 gene locus_tag LOCUS_10730 6905 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 7825 6902 gene locus_tag LOCUS_10740 7825 6902 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974917.1 protein_id gnl|my_center|LOCUS_10740 8199 7834 gene locus_tag LOCUS_10750 8199 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 8909 8196 gene locus_tag LOCUS_10760 8909 8196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 11311 8921 gene locus_tag LOCUS_10770 11311 8921 CDS product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970878.1 protein_id gnl|my_center|LOCUS_10770 11633 11298 gene locus_tag LOCUS_10780 11633 11298 CDS product type IV secretion system protein VirB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970879.1 protein_id gnl|my_center|LOCUS_10780 11979 11635 gene locus_tag LOCUS_10790 11979 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 12894 11983 gene locus_tag LOCUS_10800 12894 11983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 13926 13141 gene locus_tag LOCUS_10810 13926 13141 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_10810 14886 15794 gene locus_tag LOCUS_10820 14886 15794 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086903.1 protein_id gnl|my_center|LOCUS_10820 16343 16882 gene locus_tag LOCUS_10830 16343 16882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 16910 17842 gene locus_tag LOCUS_10840 16910 17842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 17830 18528 gene locus_tag LOCUS_10850 17830 18528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 19898 19302 gene locus_tag LOCUS_10860 19898 19302 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198721.1 protein_id gnl|my_center|LOCUS_10860 20485 20165 gene locus_tag LOCUS_10870 20485 20165 CDS product DUF736 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967482.1 protein_id gnl|my_center|LOCUS_10870 22014 21019 gene locus_tag LOCUS_10880 22014 21019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 22314 22018 gene locus_tag LOCUS_10890 22314 22018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 23629 22445 gene locus_tag LOCUS_10900 23629 22445 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091010.1 protein_id gnl|my_center|LOCUS_10900 24808 23750 gene locus_tag LOCUS_10910 24808 23750 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084736.1 protein_id gnl|my_center|LOCUS_10910 25184 24792 gene locus_tag LOCUS_10920 25184 24792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 25624 25184 gene locus_tag LOCUS_10930 25624 25184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 25994 25617 gene locus_tag LOCUS_10940 25994 25617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 26205 26408 gene locus_tag LOCUS_10950 26205 26408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 26996 26490 gene locus_tag LOCUS_10960 26996 26490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 27426 27061 gene locus_tag LOCUS_10970 27426 27061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 27934 27437 gene locus_tag LOCUS_10980 27934 27437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 30169 28034 gene locus_tag LOCUS_10990 30169 28034 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490278.1 protein_id gnl|my_center|LOCUS_10990 30642 30247 gene locus_tag LOCUS_11000 30642 30247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 31996 30791 gene locus_tag LOCUS_11010 31996 30791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012561197.1 protein_id gnl|my_center|LOCUS_11010 32369 32635 gene locus_tag LOCUS_11020 32369 32635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 32632 32970 gene locus_tag LOCUS_11030 32632 32970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 34615 33128 gene locus_tag LOCUS_11040 34615 33128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 34923 34847 gene locus_tag LOCUS_t00120 34923 34847 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence022 141 1421 gene locus_tag LOCUS_11050 141 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1479 1754 gene locus_tag LOCUS_11060 1479 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2024 4471 gene locus_tag LOCUS_11070 2024 4471 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_11070 4475 5932 gene locus_tag LOCUS_11080 4475 5932 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939433.1 protein_id gnl|my_center|LOCUS_11080 5929 7542 gene locus_tag LOCUS_11090 5929 7542 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110093.1 protein_id gnl|my_center|LOCUS_11090 7546 8040 gene locus_tag LOCUS_11100 7546 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 8073 8420 gene locus_tag LOCUS_11110 8073 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 8420 9355 gene locus_tag LOCUS_11120 8420 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 9722 9390 gene locus_tag LOCUS_11130 9722 9390 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390589.1 protein_id gnl|my_center|LOCUS_11130 11166 9763 gene locus_tag LOCUS_11140 11166 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 12167 11169 gene locus_tag LOCUS_11150 12167 11169 CDS product CBASS cGAMP-activated phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133548.1 protein_id gnl|my_center|LOCUS_11150 12975 13901 gene locus_tag LOCUS_11160 12975 13901 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011313588.1 protein_id gnl|my_center|LOCUS_11160 15622 13961 gene locus_tag LOCUS_11170 15622 13961 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974229.1 protein_id gnl|my_center|LOCUS_11170 16139 15615 gene locus_tag LOCUS_11180 16139 15615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 16780 16235 gene locus_tag LOCUS_11190 16780 16235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 17081 19474 gene locus_tag LOCUS_11200 17081 19474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 19619 19852 gene locus_tag LOCUS_11210 19619 19852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 19852 21174 gene locus_tag LOCUS_11220 19852 21174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 23421 21589 gene locus_tag LOCUS_11230 23421 21589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 23681 23511 gene locus_tag LOCUS_11240 23681 23511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 23987 24256 gene locus_tag LOCUS_11250 23987 24256 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770970.1 protein_id gnl|my_center|LOCUS_11250 24656 24237 gene locus_tag LOCUS_11260 24656 24237 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 protein_id gnl|my_center|LOCUS_11260 24901 24656 gene locus_tag LOCUS_11270 24901 24656 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141676.1 protein_id gnl|my_center|LOCUS_11270 26094 25078 gene locus_tag LOCUS_11280 gene rtcA 26094 25078 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112809.1 protein_id gnl|my_center|LOCUS_11280 27343 26099 gene locus_tag LOCUS_11290 27343 26099 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112811.1 protein_id gnl|my_center|LOCUS_11290 29387 27834 gene locus_tag LOCUS_11300 29387 27834 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_11300 29570 31168 gene locus_tag LOCUS_11310 gene rtcR 29570 31168 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 protein_id gnl|my_center|LOCUS_11310 31307 32323 gene locus_tag LOCUS_11320 31307 32323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 33470 32403 gene locus_tag LOCUS_11330 33470 32403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence023 278 105 gene locus_tag LOCUS_11340 278 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 811 275 gene locus_tag LOCUS_11350 811 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921100.1 protein_id gnl|my_center|LOCUS_11350 1182 808 gene locus_tag LOCUS_11360 1182 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2027 1272 gene locus_tag LOCUS_11370 2027 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1911 2138 gene locus_tag LOCUS_11380 1911 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2292 2852 gene locus_tag LOCUS_11390 2292 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2849 4015 gene locus_tag LOCUS_11400 2849 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_11400 4085 4960 gene locus_tag LOCUS_11410 4085 4960 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245963.1 protein_id gnl|my_center|LOCUS_11410 5136 5453 gene locus_tag LOCUS_11420 5136 5453 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859020.1 protein_id gnl|my_center|LOCUS_11420 5493 6764 gene locus_tag LOCUS_11430 5493 6764 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730081.1 protein_id gnl|my_center|LOCUS_11430 6782 7537 gene locus_tag LOCUS_11440 6782 7537 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726819.1 protein_id gnl|my_center|LOCUS_11440 7600 8154 gene locus_tag LOCUS_11450 7600 8154 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898046.1 protein_id gnl|my_center|LOCUS_11450 8148 9014 gene locus_tag LOCUS_11460 8148 9014 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_11460 9601 9023 gene locus_tag LOCUS_11470 9601 9023 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896181.1 protein_id gnl|my_center|LOCUS_11470 9838 11283 gene locus_tag LOCUS_11480 9838 11283 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 protein_id gnl|my_center|LOCUS_11480 11295 12158 gene locus_tag LOCUS_11490 11295 12158 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727351.1 protein_id gnl|my_center|LOCUS_11490 12459 12169 gene locus_tag LOCUS_11500 12459 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 13092 12484 gene locus_tag LOCUS_11510 13092 12484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 13659 13099 gene locus_tag LOCUS_11520 13659 13099 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898046.1 protein_id gnl|my_center|LOCUS_11520 14534 13671 gene locus_tag LOCUS_11530 14534 13671 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_11530 15271 14708 gene locus_tag LOCUS_11540 15271 14708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 15977 15303 gene locus_tag LOCUS_11550 15977 15303 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_11550 17003 16020 gene locus_tag LOCUS_11560 17003 16020 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994140.1 protein_id gnl|my_center|LOCUS_11560 17783 17043 gene locus_tag LOCUS_11570 17783 17043 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203813331.1 protein_id gnl|my_center|LOCUS_11570 18041 19891 gene locus_tag LOCUS_11580 18041 19891 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730664.1 protein_id gnl|my_center|LOCUS_11580 19903 20316 gene locus_tag LOCUS_11590 19903 20316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 20848 22236 gene locus_tag LOCUS_11600 20848 22236 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_11600 22393 22944 gene locus_tag LOCUS_11610 22393 22944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 23507 22992 gene locus_tag LOCUS_11620 23507 22992 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_11620 23631 24767 gene locus_tag LOCUS_11630 23631 24767 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230545.1 protein_id gnl|my_center|LOCUS_11630 25144 24764 gene locus_tag LOCUS_11640 25144 24764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 26718 25141 gene locus_tag LOCUS_11650 26718 25141 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224032.1 protein_id gnl|my_center|LOCUS_11650 27446 26781 gene locus_tag LOCUS_11660 27446 26781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 28258 28061 gene locus_tag LOCUS_11670 28258 28061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 28492 30183 gene locus_tag LOCUS_11680 28492 30183 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_11680 30237 31619 gene locus_tag LOCUS_11690 30237 31619 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence024 3875 2238 gene locus_tag LOCUS_11700 3875 2238 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390241.1 protein_id gnl|my_center|LOCUS_11700 4593 4772 gene locus_tag LOCUS_11710 4593 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 4772 5086 gene locus_tag LOCUS_11720 4772 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5751 6428 gene locus_tag LOCUS_11730 5751 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6583 8370 gene locus_tag LOCUS_11740 6583 8370 CDS product DUF4209 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545693.1 protein_id gnl|my_center|LOCUS_11740 8686 11691 gene locus_tag LOCUS_11750 8686 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 12651 11722 gene locus_tag LOCUS_11760 12651 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 13023 12865 gene locus_tag LOCUS_11770 13023 12865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 13141 13007 gene locus_tag LOCUS_11780 13141 13007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 13526 13251 gene locus_tag LOCUS_11790 13526 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 15712 13541 gene locus_tag LOCUS_11800 15712 13541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 16038 15712 gene locus_tag LOCUS_11810 16038 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 17395 17087 gene locus_tag LOCUS_11820 17395 17087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 17985 17392 gene locus_tag LOCUS_11830 17985 17392 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_11830 18566 18309 gene locus_tag LOCUS_11840 18566 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 18975 19532 gene locus_tag LOCUS_11850 18975 19532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 19722 20246 gene locus_tag LOCUS_11860 19722 20246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 20243 21037 gene locus_tag LOCUS_11870 20243 21037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 22045 21116 gene locus_tag LOCUS_11880 22045 21116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 22150 22159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22387 22184 gene locus_tag LOCUS_11890 22387 22184 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005760693.1 protein_id gnl|my_center|LOCUS_11890 23563 22505 gene locus_tag LOCUS_11900 23563 22505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 24833 23631 gene locus_tag LOCUS_11910 24833 23631 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218908.1 protein_id gnl|my_center|LOCUS_11910 25131 25055 gene locus_tag LOCUS_t00130 25131 25055 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25223 26515 gene locus_tag LOCUS_11920 gene ribD 25223 26515 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_11920 26572 27426 gene locus_tag LOCUS_11930 26572 27426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 27544 27723 gene locus_tag LOCUS_11940 27544 27723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 27713 28231 gene locus_tag LOCUS_11950 27713 28231 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940818.1 protein_id gnl|my_center|LOCUS_11950 28238 29287 gene locus_tag LOCUS_11960 28238 29287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 29416 30660 gene locus_tag LOCUS_11970 29416 30660 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence025 1724 96 gene locus_tag LOCUS_11980 1724 96 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087573.1 protein_id gnl|my_center|LOCUS_11980 2264 1824 gene locus_tag LOCUS_11990 2264 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2441 2806 gene locus_tag LOCUS_12000 2441 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3786 2812 gene locus_tag LOCUS_12010 3786 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 4585 3818 gene locus_tag LOCUS_12020 gene tpiA 4585 3818 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337104.1 protein_id gnl|my_center|LOCUS_12020 4716 6593 gene locus_tag LOCUS_12030 4716 6593 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087576.1 protein_id gnl|my_center|LOCUS_12030 6601 8127 gene locus_tag LOCUS_12040 gene trpE 6601 8127 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_12040 9029 8172 gene locus_tag LOCUS_12050 9029 8172 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246844.1 protein_id gnl|my_center|LOCUS_12050 9838 9272 gene locus_tag LOCUS_12060 9838 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 11212 9911 gene locus_tag LOCUS_12070 gene proP 11212 9911 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 protein_id gnl|my_center|LOCUS_12070 11346 12767 gene locus_tag LOCUS_12080 11346 12767 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967081.1 protein_id gnl|my_center|LOCUS_12080 12818 13852 gene locus_tag LOCUS_12090 12818 13852 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919302.1 protein_id gnl|my_center|LOCUS_12090 13849 14703 gene locus_tag LOCUS_12100 gene sseA 13849 14703 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_12100 14700 15230 gene locus_tag LOCUS_12110 14700 15230 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531462.1 protein_id gnl|my_center|LOCUS_12110 15320 16819 gene locus_tag LOCUS_12120 15320 16819 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142259.1 protein_id gnl|my_center|LOCUS_12120 16816 17970 gene locus_tag LOCUS_12130 gene metC 16816 17970 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087217.1 protein_id gnl|my_center|LOCUS_12130 17967 18338 gene locus_tag LOCUS_12140 gene hisI 17967 18338 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403778.1 protein_id gnl|my_center|LOCUS_12140 19847 18474 gene locus_tag LOCUS_12150 19847 18474 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114363.1 protein_id gnl|my_center|LOCUS_12150 19983 20504 gene locus_tag LOCUS_12160 19983 20504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 20513 21370 gene locus_tag LOCUS_12170 20513 21370 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_12170 21597 23537 gene locus_tag LOCUS_12180 21597 23537 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 protein_id gnl|my_center|LOCUS_12180 23701 23625 gene locus_tag LOCUS_t00140 23701 23625 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24116 23766 gene locus_tag LOCUS_12190 24116 23766 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 protein_id gnl|my_center|LOCUS_12190 24167 24091 gene locus_tag LOCUS_t00150 24167 24091 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 25015 24545 gene locus_tag LOCUS_12200 25015 24545 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975603.1 protein_id gnl|my_center|LOCUS_12200 25643 25077 gene locus_tag LOCUS_12210 25643 25077 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531329.1 protein_id gnl|my_center|LOCUS_12210 25795 26502 gene locus_tag LOCUS_12220 25795 26502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 26566 27033 gene locus_tag LOCUS_12230 26566 27033 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067096.1 protein_id gnl|my_center|LOCUS_12230 27030 27833 gene locus_tag LOCUS_12240 27030 27833 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088410.1 protein_id gnl|my_center|LOCUS_12240 27830 28852 gene locus_tag LOCUS_12250 27830 28852 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_12250 28975 29700 gene locus_tag LOCUS_12260 28975 29700 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence026 1330 71 gene locus_tag LOCUS_12270 gene cpaE 1330 71 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920780.1 protein_id gnl|my_center|LOCUS_12270 2011 1346 gene locus_tag LOCUS_12280 2011 1346 CDS product CpaD family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241792.1 protein_id gnl|my_center|LOCUS_12280 3497 2022 gene locus_tag LOCUS_12290 3497 2022 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920782.1 protein_id gnl|my_center|LOCUS_12290 4274 3501 gene locus_tag LOCUS_12300 gene cpaB 4274 3501 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965364.1 protein_id gnl|my_center|LOCUS_12300 4855 4349 gene locus_tag LOCUS_12310 4855 4349 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084258.1 protein_id gnl|my_center|LOCUS_12310 5191 4952 gene locus_tag LOCUS_12320 5191 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 5482 5934 gene locus_tag LOCUS_12330 5482 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 6745 5999 gene locus_tag LOCUS_12340 gene tesB 6745 5999 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972544.1 protein_id gnl|my_center|LOCUS_12340 6689 6994 gene locus_tag LOCUS_12350 6689 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 6984 8210 gene locus_tag LOCUS_12360 6984 8210 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969759.1 protein_id gnl|my_center|LOCUS_12360 8207 8938 gene locus_tag LOCUS_12370 8207 8938 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_12370 9064 10152 gene locus_tag LOCUS_12380 9064 10152 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_12380 10847 10290 gene locus_tag LOCUS_12390 10847 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 10992 11846 gene locus_tag LOCUS_12400 gene kynA 10992 11846 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661971.1 protein_id gnl|my_center|LOCUS_12400 11846 13060 gene locus_tag LOCUS_12410 11846 13060 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420380.1 protein_id gnl|my_center|LOCUS_12410 13260 14285 gene locus_tag LOCUS_12420 13260 14285 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531790.1 protein_id gnl|my_center|LOCUS_12420 14942 14310 gene locus_tag LOCUS_12430 gene petA 14942 14310 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216574.1 protein_id gnl|my_center|LOCUS_12430 15865 15038 gene locus_tag LOCUS_12440 gene pdxY 15865 15038 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_12440 15942 16808 gene locus_tag LOCUS_12450 15942 16808 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_12450 16810 17865 gene locus_tag LOCUS_12460 16810 17865 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388956.1 protein_id gnl|my_center|LOCUS_12460 17862 18953 gene locus_tag LOCUS_12470 gene zapE 17862 18953 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310852.1 protein_id gnl|my_center|LOCUS_12470 18966 19361 gene locus_tag LOCUS_12480 18966 19361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 20612 19383 gene locus_tag LOCUS_12490 20612 19383 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639881.1 protein_id gnl|my_center|LOCUS_12490 20840 21178 gene locus_tag LOCUS_12500 20840 21178 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528889.1 protein_id gnl|my_center|LOCUS_12500 21223 22548 gene locus_tag LOCUS_12510 21223 22548 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_12510 22658 23326 gene locus_tag LOCUS_12520 22658 23326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 23455 24675 gene locus_tag LOCUS_12530 23455 24675 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385507.1 protein_id gnl|my_center|LOCUS_12530 24678 27122 gene locus_tag LOCUS_12540 24678 27122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 28135 27506 gene locus_tag LOCUS_12550 28135 27506 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_12550 29593 28136 gene locus_tag LOCUS_12560 29593 28136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence027 2047 3063 gene locus_tag LOCUS_12570 2047 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 6318 3193 gene locus_tag LOCUS_12580 6318 3193 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921044.1 protein_id gnl|my_center|LOCUS_12580 7574 6315 gene locus_tag LOCUS_12590 7574 6315 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921045.1 protein_id gnl|my_center|LOCUS_12590 7974 7534 gene locus_tag LOCUS_12600 7974 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 8677 8997 gene locus_tag LOCUS_12610 8677 8997 CDS product DUF736 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394835.1 protein_id gnl|my_center|LOCUS_12610 9791 9096 gene locus_tag LOCUS_12620 9791 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 10726 9788 gene locus_tag LOCUS_12630 10726 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 11358 10753 gene locus_tag LOCUS_12640 11358 10753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 12050 12763 gene locus_tag LOCUS_12650 12050 12763 CDS product type IV secretion system lytic transglycosylase VirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970881.1 protein_id gnl|my_center|LOCUS_12650 12767 13111 gene locus_tag LOCUS_12660 12767 13111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 13113 13448 gene locus_tag LOCUS_12670 13113 13448 CDS product type IV secretion system protein VirB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970879.1 protein_id gnl|my_center|LOCUS_12670 13435 15825 gene locus_tag LOCUS_12680 13435 15825 CDS product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970878.1 protein_id gnl|my_center|LOCUS_12680 15844 16551 gene locus_tag LOCUS_12690 15844 16551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 16554 16904 gene locus_tag LOCUS_12700 16554 16904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 16913 17839 gene locus_tag LOCUS_12710 16913 17839 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974917.1 protein_id gnl|my_center|LOCUS_12710 17836 18129 gene locus_tag LOCUS_12720 17836 18129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 18139 18831 gene locus_tag LOCUS_12730 18139 18831 CDS product type IV secretion system protein VirB8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533337.1 protein_id gnl|my_center|LOCUS_12730 18828 19784 gene locus_tag LOCUS_12740 gene virB9 18828 19784 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970873.1 protein_id gnl|my_center|LOCUS_12740 19781 20944 gene locus_tag LOCUS_12750 19781 20944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 20934 21974 gene locus_tag LOCUS_12760 gene virB11 20934 21974 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970871.1 protein_id gnl|my_center|LOCUS_12760 21976 22653 gene locus_tag LOCUS_12770 21976 22653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12770 22676 23863 gene locus_tag LOCUS_12780 22676 23863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12780 23860 24801 gene locus_tag LOCUS_12790 23860 24801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 24813 25037 gene locus_tag LOCUS_12800 24813 25037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 25045 25389 gene locus_tag LOCUS_12810 25045 25389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 25391 29152 gene locus_tag LOCUS_12820 25391 29152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence028 2651 2235 gene locus_tag LOCUS_12830 2651 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 3589 2711 gene locus_tag LOCUS_12840 gene sucD 3589 2711 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_12840 4758 3592 gene locus_tag LOCUS_12850 gene sucC 4758 3592 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083287.1 protein_id gnl|my_center|LOCUS_12850 5219 5923 gene locus_tag LOCUS_12860 5219 5923 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_12860 6026 6745 gene locus_tag LOCUS_12870 6026 6745 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531342.1 protein_id gnl|my_center|LOCUS_12870 7061 6753 gene locus_tag LOCUS_12880 7061 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8869 7223 gene locus_tag LOCUS_12890 8869 7223 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_12890 9538 8936 gene locus_tag LOCUS_12900 9538 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 9730 10368 gene locus_tag LOCUS_12910 9730 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 10533 11312 gene locus_tag LOCUS_12920 10533 11312 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_12920 16266 11389 gene locus_tag LOCUS_12930 16266 11389 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_12930 16702 17331 gene locus_tag LOCUS_12940 16702 17331 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531881.1 protein_id gnl|my_center|LOCUS_12940 17328 17888 gene locus_tag LOCUS_12950 17328 17888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 18699 17932 gene locus_tag LOCUS_12960 18699 17932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 19644 18838 gene locus_tag LOCUS_12970 19644 18838 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_12970 19776 22475 gene locus_tag LOCUS_12980 gene acnA 19776 22475 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528828.1 protein_id gnl|my_center|LOCUS_12980 24378 22564 gene locus_tag LOCUS_12990 24378 22564 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965204.1 protein_id gnl|my_center|LOCUS_12990 24513 24830 gene locus_tag LOCUS_13000 24513 24830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 25138 24827 gene locus_tag LOCUS_13010 25138 24827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 25706 25140 gene locus_tag LOCUS_13020 25706 25140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13020 25887 26096 gene locus_tag LOCUS_13030 25887 26096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 26086 26328 gene locus_tag LOCUS_13040 26086 26328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 26944 26339 gene locus_tag LOCUS_13050 gene phaR 26944 26339 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918397.1 protein_id gnl|my_center|LOCUS_13050 27177 28349 gene locus_tag LOCUS_13060 27177 28349 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175239.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence029 1200 313 gene locus_tag LOCUS_13070 1200 313 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_13070 1775 4306 gene locus_tag LOCUS_13080 1775 4306 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_13080 5183 4410 gene locus_tag LOCUS_13090 5183 4410 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086009.1 protein_id gnl|my_center|LOCUS_13090 6664 5186 gene locus_tag LOCUS_13100 6664 5186 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224903.1 protein_id gnl|my_center|LOCUS_13100 8133 6676 gene locus_tag LOCUS_13110 8133 6676 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_13110 9517 8123 gene locus_tag LOCUS_13120 9517 8123 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_13120 11653 9539 gene locus_tag LOCUS_13130 11653 9539 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_13130 11808 12533 gene locus_tag LOCUS_13140 11808 12533 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967030.1 protein_id gnl|my_center|LOCUS_13140 12619 13692 gene locus_tag LOCUS_13150 12619 13692 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064355.1 protein_id gnl|my_center|LOCUS_13150 14143 15027 gene locus_tag LOCUS_13160 14143 15027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 15399 16751 gene locus_tag LOCUS_13170 15399 16751 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170976.1 protein_id gnl|my_center|LOCUS_13170 16763 17281 gene locus_tag LOCUS_13180 16763 17281 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086719.1 protein_id gnl|my_center|LOCUS_13180 17268 17825 gene locus_tag LOCUS_13190 17268 17825 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086720.1 protein_id gnl|my_center|LOCUS_13190 18489 17953 gene locus_tag LOCUS_13200 18489 17953 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_13200 20002 18497 gene locus_tag LOCUS_13210 20002 18497 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089083.1 protein_id gnl|my_center|LOCUS_13210 21455 20007 gene locus_tag LOCUS_13220 21455 20007 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089082.1 protein_id gnl|my_center|LOCUS_13220 22114 21452 gene locus_tag LOCUS_13230 22114 21452 CDS product hydrogenase-4 component E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548289.1 protein_id gnl|my_center|LOCUS_13230 23071 22115 gene locus_tag LOCUS_13240 23071 22115 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_13240 25071 23062 gene locus_tag LOCUS_13250 gene hyfB 25071 23062 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_13250 25372 25082 gene locus_tag LOCUS_13260 25372 25082 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528670.1 protein_id gnl|my_center|LOCUS_13260 26329 25688 gene locus_tag LOCUS_13270 26329 25688 CDS product heme-binding beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence030 <1 582 gene locus_tag LOCUS_13280 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015415380.1:SIR2 family protein 575 2470 gene locus_tag LOCUS_13290 575 2470 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266186.1 protein_id gnl|my_center|LOCUS_13290 2470 2688 gene locus_tag LOCUS_13300 2470 2688 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266187.1 protein_id gnl|my_center|LOCUS_13300 2872 2657 gene locus_tag LOCUS_13310 2872 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 5638 2951 gene locus_tag LOCUS_13320 5638 2951 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063890.1 protein_id gnl|my_center|LOCUS_13320 6761 5643 gene locus_tag LOCUS_13330 6761 5643 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931043.1 protein_id gnl|my_center|LOCUS_13330 8184 6793 gene locus_tag LOCUS_13340 8184 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 9681 8653 gene locus_tag LOCUS_13350 9681 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 10876 9671 gene locus_tag LOCUS_13360 gene repA 10876 9671 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215636.1 protein_id gnl|my_center|LOCUS_13360 12425 11307 gene locus_tag LOCUS_13370 12425 11307 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_13370 12625 12422 gene locus_tag LOCUS_13380 12625 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 13008 12820 gene locus_tag LOCUS_13390 13008 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 12913 14028 gene locus_tag LOCUS_13400 12913 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 14261 14515 gene locus_tag LOCUS_13410 14261 14515 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766946.1 protein_id gnl|my_center|LOCUS_13410 14515 14988 gene locus_tag LOCUS_13420 14515 14988 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_13420 15129 15392 gene locus_tag LOCUS_13430 15129 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082886.1 protein_id gnl|my_center|LOCUS_13430 15505 16020 gene locus_tag LOCUS_13440 15505 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13440 17266 26565 gene locus_tag LOCUS_13450 17266 26565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 26646 27020 gene locus_tag LOCUS_13460 26646 27020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 27007 27300 gene locus_tag LOCUS_13470 27007 27300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 27468 27301 gene locus_tag LOCUS_13480 27468 27301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence031 1601 204 gene locus_tag LOCUS_13490 1601 204 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146571912.1 protein_id gnl|my_center|LOCUS_13490 4657 1598 gene locus_tag LOCUS_13500 4657 1598 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275504.1 protein_id gnl|my_center|LOCUS_13500 5702 4662 gene locus_tag LOCUS_13510 5702 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6598 5702 gene locus_tag LOCUS_13520 6598 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 6995 6588 gene locus_tag LOCUS_13530 6995 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 7374 9392 gene locus_tag LOCUS_13540 7374 9392 CDS product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958113.1 protein_id gnl|my_center|LOCUS_13540 9793 9530 gene locus_tag LOCUS_13550 9793 9530 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970291.1 protein_id gnl|my_center|LOCUS_13550 10115 9891 gene locus_tag LOCUS_13560 10115 9891 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533400.1 protein_id gnl|my_center|LOCUS_13560 10193 10489 gene locus_tag LOCUS_13570 10193 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 10924 11676 gene locus_tag LOCUS_13580 10924 11676 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067384.1 protein_id gnl|my_center|LOCUS_13580 12422 12667 gene locus_tag LOCUS_13590 12422 12667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 13372 13040 gene locus_tag LOCUS_13600 13372 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 13829 13479 gene locus_tag LOCUS_13610 13829 13479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 14869 13955 gene locus_tag LOCUS_13620 14869 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 15000 14866 gene locus_tag LOCUS_13630 15000 14866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 17904 15367 gene locus_tag LOCUS_13640 17904 15367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 18742 18131 gene locus_tag LOCUS_13650 18742 18131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 19070 19603 gene locus_tag LOCUS_13660 19070 19603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 19801 20091 gene locus_tag LOCUS_13670 19801 20091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 20826 20999 gene locus_tag LOCUS_13680 20826 20999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 21670 20996 gene locus_tag LOCUS_13690 21670 20996 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845178.1 protein_id gnl|my_center|LOCUS_13690 21941 22717 gene locus_tag LOCUS_13700 21941 22717 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083902.1 protein_id gnl|my_center|LOCUS_13700 23198 23836 gene locus_tag LOCUS_13710 23198 23836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266513.1 protein_id gnl|my_center|LOCUS_13710 23883 24818 gene locus_tag LOCUS_13720 23883 24818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 25539 24835 gene locus_tag LOCUS_13730 25539 24835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 27073 25556 gene locus_tag LOCUS_13740 27073 25556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence032 <1 1069 gene locus_tag LOCUS_13750 <1 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704252.1:HlyD family efflux transporter periplasmic adaptor subunit 1066 3813 gene locus_tag LOCUS_13760 gene rbbA 1066 3813 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943324.1 protein_id gnl|my_center|LOCUS_13760 3817 4950 gene locus_tag LOCUS_13770 3817 4950 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943323.1 protein_id gnl|my_center|LOCUS_13770 5279 5752 gene locus_tag LOCUS_13780 gene greA 5279 5752 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920688.1 protein_id gnl|my_center|LOCUS_13780 5957 6664 gene locus_tag LOCUS_13790 5957 6664 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528337.1 protein_id gnl|my_center|LOCUS_13790 6678 8342 gene locus_tag LOCUS_13800 6678 8342 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528336.1 protein_id gnl|my_center|LOCUS_13800 8335 8814 gene locus_tag LOCUS_13810 8335 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 8897 9301 gene locus_tag LOCUS_13820 8897 9301 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639920.1 protein_id gnl|my_center|LOCUS_13820 9305 9586 gene locus_tag LOCUS_13830 9305 9586 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918130.1 protein_id gnl|my_center|LOCUS_13830 9719 10642 gene locus_tag LOCUS_13840 9719 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 10653 11078 gene locus_tag LOCUS_13850 10653 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 11251 11757 gene locus_tag LOCUS_13860 11251 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 12127 13347 gene locus_tag LOCUS_13870 gene hemA 12127 13347 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312336.1 protein_id gnl|my_center|LOCUS_13870 13885 13355 gene locus_tag LOCUS_13880 13885 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 14807 13875 gene locus_tag LOCUS_13890 14807 13875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 15272 14883 gene locus_tag LOCUS_13900 15272 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 16387 15353 gene locus_tag LOCUS_13910 16387 15353 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813493.1 protein_id gnl|my_center|LOCUS_13910 18124 16397 gene locus_tag LOCUS_13920 18124 16397 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926642.1 protein_id gnl|my_center|LOCUS_13920 18257 19189 gene locus_tag LOCUS_13930 18257 19189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 20815 19205 gene locus_tag LOCUS_13940 20815 19205 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640335.1 protein_id gnl|my_center|LOCUS_13940 20930 24229 gene locus_tag LOCUS_13950 20930 24229 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965449.1 protein_id gnl|my_center|LOCUS_13950 24937 24257 gene locus_tag LOCUS_13960 24937 24257 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence033 261 34 gene locus_tag LOCUS_13970 261 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 651 1388 gene locus_tag LOCUS_13980 651 1388 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199747194.1 protein_id gnl|my_center|LOCUS_13980 1385 2299 gene locus_tag LOCUS_13990 1385 2299 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038852.1 protein_id gnl|my_center|LOCUS_13990 2681 2502 gene locus_tag LOCUS_14000 2681 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3208 2693 gene locus_tag LOCUS_14010 3208 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 3418 5202 gene locus_tag LOCUS_14020 3418 5202 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_14020 6949 6128 gene locus_tag LOCUS_14030 6949 6128 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229653.1 protein_id gnl|my_center|LOCUS_14030 8272 7043 gene locus_tag LOCUS_14040 8272 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 8441 9217 gene locus_tag LOCUS_14050 8441 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 9392 9871 gene locus_tag LOCUS_14060 9392 9871 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_14060 10692 9916 gene locus_tag LOCUS_14070 10692 9916 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085757.1 protein_id gnl|my_center|LOCUS_14070 12064 10760 gene locus_tag LOCUS_14080 12064 10760 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550878.1 protein_id gnl|my_center|LOCUS_14080 12275 13126 gene locus_tag LOCUS_14090 12275 13126 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_14090 13157 13681 gene locus_tag LOCUS_14100 13157 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 13840 15552 gene locus_tag LOCUS_14110 13840 15552 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_14110 16753 15830 gene locus_tag LOCUS_14120 16753 15830 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401124.1 protein_id gnl|my_center|LOCUS_14120 16860 17603 gene locus_tag LOCUS_14130 16860 17603 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113039.1 protein_id gnl|my_center|LOCUS_14130 18139 17900 gene locus_tag LOCUS_14140 18139 17900 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563132.1 protein_id gnl|my_center|LOCUS_14140 21479 18621 gene locus_tag LOCUS_14150 gene fdhF 21479 18621 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974090.1 protein_id gnl|my_center|LOCUS_14150 23026 21500 gene locus_tag LOCUS_14160 23026 21500 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085921.1 protein_id gnl|my_center|LOCUS_14160 23424 23029 gene locus_tag LOCUS_14170 23424 23029 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330013.1 protein_id gnl|my_center|LOCUS_14170 23957 24592 gene locus_tag LOCUS_14180 23957 24592 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_14180 24776 25237 gene locus_tag LOCUS_14190 24776 25237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 25336 25812 gene locus_tag LOCUS_14200 25336 25812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence034 238 11 gene locus_tag LOCUS_14210 238 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 131 721 gene locus_tag LOCUS_14220 131 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2245 722 gene locus_tag LOCUS_14230 gene glgA 2245 722 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020156.1 protein_id gnl|my_center|LOCUS_14230 2381 4369 gene locus_tag LOCUS_14240 gene glgX 2381 4369 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389296.1 protein_id gnl|my_center|LOCUS_14240 4366 6489 gene locus_tag LOCUS_14250 gene malQ 4366 6489 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389297.1 protein_id gnl|my_center|LOCUS_14250 6600 7079 gene locus_tag LOCUS_14260 6600 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 7431 8576 gene locus_tag LOCUS_14270 7431 8576 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_14270 8960 10723 gene locus_tag LOCUS_14280 8960 10723 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 protein_id gnl|my_center|LOCUS_14280 10723 14892 gene locus_tag LOCUS_14290 10723 14892 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389851.1 protein_id gnl|my_center|LOCUS_14290 15912 14896 gene locus_tag LOCUS_14300 15912 14896 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919081.1 protein_id gnl|my_center|LOCUS_14300 16879 15923 gene locus_tag LOCUS_14310 16879 15923 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919082.1 protein_id gnl|my_center|LOCUS_14310 17553 16876 gene locus_tag LOCUS_14320 17553 16876 CDS product DUF969 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919083.1 protein_id gnl|my_center|LOCUS_14320 18100 20721 gene locus_tag LOCUS_14330 18100 20721 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085792.1 protein_id gnl|my_center|LOCUS_14330 21391 20735 gene locus_tag LOCUS_14340 21391 20735 CDS product HpnM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387817.1 protein_id gnl|my_center|LOCUS_14340 21688 22452 gene locus_tag LOCUS_14350 21688 22452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 23466 22549 gene locus_tag LOCUS_14360 23466 22549 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_14360 24129 24344 gene locus_tag LOCUS_14370 24129 24344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 24328 25476 gene locus_tag LOCUS_14380 gene hpnH 24328 25476 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187762.1 protein_id gnl|my_center|LOCUS_14380 25492 25929 gene locus_tag LOCUS_14390 25492 25929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence035 3456 2266 gene locus_tag LOCUS_14400 3456 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 3995 3453 gene locus_tag LOCUS_14410 3995 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 4343 4113 gene locus_tag LOCUS_14420 4343 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4842 4504 gene locus_tag LOCUS_14430 4842 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 5027 4839 gene locus_tag LOCUS_14440 5027 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 5218 5024 gene locus_tag LOCUS_14450 5218 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 6548 5313 gene locus_tag LOCUS_14460 6548 5313 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_14460 6983 7540 gene locus_tag LOCUS_14470 6983 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 10704 7618 gene locus_tag LOCUS_14480 10704 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 11260 10718 gene locus_tag LOCUS_14490 gene pncA 11260 10718 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521275.1 protein_id gnl|my_center|LOCUS_14490 11165 11365 gene locus_tag LOCUS_14500 11165 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 11457 12209 gene locus_tag LOCUS_14510 11457 12209 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536803.1 protein_id gnl|my_center|LOCUS_14510 12221 14002 gene locus_tag LOCUS_14520 12221 14002 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086692.1 protein_id gnl|my_center|LOCUS_14520 14851 14057 gene locus_tag LOCUS_14530 14851 14057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_14530 15396 14983 gene locus_tag LOCUS_14540 gene cueR 15396 14983 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975862.1 protein_id gnl|my_center|LOCUS_14540 18484 15422 gene locus_tag LOCUS_14550 18484 15422 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921619.1 protein_id gnl|my_center|LOCUS_14550 19678 18494 gene locus_tag LOCUS_14560 19678 18494 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171251.1 protein_id gnl|my_center|LOCUS_14560 20940 19675 gene locus_tag LOCUS_14570 20940 19675 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_14570 21390 22079 gene locus_tag LOCUS_14580 21390 22079 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067011.1 protein_id gnl|my_center|LOCUS_14580 22904 22035 gene locus_tag LOCUS_14590 gene paaX 22904 22035 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085674.1 protein_id gnl|my_center|LOCUS_14590 22987 23205 gene locus_tag LOCUS_14600 22987 23205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 23428 24030 gene locus_tag LOCUS_14610 23428 24030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 24193 24399 gene locus_tag LOCUS_14620 24193 24399 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918551.1 protein_id gnl|my_center|LOCUS_14620 24633 24839 gene locus_tag LOCUS_14630 24633 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 24836 25051 gene locus_tag LOCUS_14640 24836 25051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence036 1885 503 gene locus_tag LOCUS_14650 1885 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2010 2222 gene locus_tag LOCUS_14660 2010 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 5589 2344 gene locus_tag LOCUS_14670 5589 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 5892 7265 gene locus_tag LOCUS_14680 5892 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 8021 9166 gene locus_tag LOCUS_14690 8021 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 10912 9344 gene locus_tag LOCUS_14700 10912 9344 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_14700 14378 11136 gene locus_tag LOCUS_14710 14378 11136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 14938 14750 gene locus_tag LOCUS_14720 14938 14750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 15211 16482 gene locus_tag LOCUS_14730 15211 16482 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_14730 16683 18095 gene locus_tag LOCUS_14740 16683 18095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 18152 20716 gene locus_tag LOCUS_14750 18152 20716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 21761 21303 gene locus_tag LOCUS_14760 21761 21303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 22506 21913 gene locus_tag LOCUS_14770 22506 21913 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_14770 22615 25254 gene locus_tag LOCUS_14780 22615 25254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence037 353 3796 gene locus_tag LOCUS_14790 gene dnaE 353 3796 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087634.1 protein_id gnl|my_center|LOCUS_14790 4995 3799 gene locus_tag LOCUS_14800 4995 3799 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181060039.1 protein_id gnl|my_center|LOCUS_14800 5211 6002 gene locus_tag LOCUS_14810 gene rpsB 5211 6002 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919789.1 protein_id gnl|my_center|LOCUS_14810 6035 6961 gene locus_tag LOCUS_14820 gene tsf 6035 6961 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 protein_id gnl|my_center|LOCUS_14820 6985 7734 gene locus_tag LOCUS_14830 gene pyrH 6985 7734 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919787.1 protein_id gnl|my_center|LOCUS_14830 7754 8317 gene locus_tag LOCUS_14840 gene frr 7754 8317 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389464.1 protein_id gnl|my_center|LOCUS_14840 8352 9086 gene locus_tag LOCUS_14850 8352 9086 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971573.1 protein_id gnl|my_center|LOCUS_14850 9212 9994 gene locus_tag LOCUS_14860 9212 9994 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531757.1 protein_id gnl|my_center|LOCUS_14860 9991 11211 gene locus_tag LOCUS_14870 9991 11211 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_14870 11233 12369 gene locus_tag LOCUS_14880 gene rseP 11233 12369 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312540.1 protein_id gnl|my_center|LOCUS_14880 12432 14813 gene locus_tag LOCUS_14890 gene bamA 12432 14813 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640362.1 protein_id gnl|my_center|LOCUS_14890 14810 15448 gene locus_tag LOCUS_14900 14810 15448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 15479 16555 gene locus_tag LOCUS_14910 gene lpxD 15479 16555 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087620.1 protein_id gnl|my_center|LOCUS_14910 16548 17018 gene locus_tag LOCUS_14920 gene fabZ 16548 17018 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389471.1 protein_id gnl|my_center|LOCUS_14920 17015 17824 gene locus_tag LOCUS_14930 gene lpxA 17015 17824 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919777.1 protein_id gnl|my_center|LOCUS_14930 17824 18666 gene locus_tag LOCUS_14940 17824 18666 CDS product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 protein_id gnl|my_center|LOCUS_14940 18663 19826 gene locus_tag LOCUS_14950 gene lpxB 18663 19826 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337682.1 protein_id gnl|my_center|LOCUS_14950 20144 21040 gene locus_tag LOCUS_14960 20144 21040 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919059.1 protein_id gnl|my_center|LOCUS_14960 21056 21475 gene locus_tag LOCUS_14970 21056 21475 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 protein_id gnl|my_center|LOCUS_14970 21478 21771 gene locus_tag LOCUS_14980 21478 21771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 23739 21859 gene locus_tag LOCUS_14990 gene cobT 23739 21859 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 protein_id gnl|my_center|LOCUS_14990 24811 23747 gene locus_tag LOCUS_15000 gene cobS 24811 23747 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175820.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence038 295 20 gene locus_tag LOCUS_15010 295 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1341 295 gene locus_tag LOCUS_15020 1341 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2024 1356 gene locus_tag LOCUS_15030 2024 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4627 2189 gene locus_tag LOCUS_15040 4627 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 6426 4792 gene locus_tag LOCUS_15050 6426 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 6582 6740 gene locus_tag LOCUS_15060 6582 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 7413 6808 gene locus_tag LOCUS_15070 7413 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 7950 7417 gene locus_tag LOCUS_15080 7950 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 8245 7967 gene locus_tag LOCUS_15090 8245 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 11292 8263 gene locus_tag LOCUS_15100 11292 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 12000 11293 gene locus_tag LOCUS_15110 12000 11293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 13043 12063 gene locus_tag LOCUS_15120 13043 12063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 13392 13111 gene locus_tag LOCUS_15130 13392 13111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 14078 13440 gene locus_tag LOCUS_15140 14078 13440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 14742 14164 gene locus_tag LOCUS_15150 14742 14164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 16003 14834 gene locus_tag LOCUS_15160 16003 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 16862 16020 gene locus_tag LOCUS_15170 16862 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 17275 16865 gene locus_tag LOCUS_15180 17275 16865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 19473 17278 gene locus_tag LOCUS_15190 19473 17278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 21160 19466 gene locus_tag LOCUS_15200 21160 19466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 21550 21164 gene locus_tag LOCUS_15210 21550 21164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 22174 21569 gene locus_tag LOCUS_15220 22174 21569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 22655 22158 gene locus_tag LOCUS_15230 22655 22158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 23424 22645 gene locus_tag LOCUS_15240 23424 22645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 23733 23425 gene locus_tag LOCUS_15250 23733 23425 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150389682.1 protein_id gnl|my_center|LOCUS_15250 23839 24162 gene locus_tag LOCUS_15260 23839 24162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence039 899 549 gene locus_tag LOCUS_15270 899 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1050 1256 gene locus_tag LOCUS_15280 1050 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1285 3288 gene locus_tag LOCUS_15290 1285 3288 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_15290 3288 5309 gene locus_tag LOCUS_15300 3288 5309 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_15300 5960 6700 gene locus_tag LOCUS_15310 5960 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 6700 10851 gene locus_tag LOCUS_15320 6700 10851 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071654.1 protein_id gnl|my_center|LOCUS_15320 10841 12523 gene locus_tag LOCUS_15330 10841 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071655.1 protein_id gnl|my_center|LOCUS_15330 12520 17967 gene locus_tag LOCUS_15340 12520 17967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 18020 21703 gene locus_tag LOCUS_15350 18020 21703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 24114 21850 gene locus_tag LOCUS_15360 24114 21850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence040 <1 1056 gene locus_tag LOCUS_15370 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014498060.1:P-type conjugative transfer protein TrbG 1059 2666 gene locus_tag LOCUS_15380 gene trbI 1059 2666 CDS product IncP-type conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974832.1 protein_id gnl|my_center|LOCUS_15380 2647 3048 gene locus_tag LOCUS_15390 2647 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 3124 4932 gene locus_tag LOCUS_15400 3124 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 4929 6260 gene locus_tag LOCUS_15410 4929 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 7994 6387 gene locus_tag LOCUS_15420 7994 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 9052 8087 gene locus_tag LOCUS_15430 9052 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 9575 9859 gene locus_tag LOCUS_15440 9575 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 9964 10896 gene locus_tag LOCUS_15450 9964 10896 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205285.1 protein_id gnl|my_center|LOCUS_15450 12493 12125 gene locus_tag LOCUS_15460 12493 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 16346 12714 gene locus_tag LOCUS_15470 16346 12714 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871043.1 protein_id gnl|my_center|LOCUS_15470 16572 16399 gene locus_tag LOCUS_15480 16572 16399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 17205 16597 gene locus_tag LOCUS_15490 17205 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 20570 17202 gene locus_tag LOCUS_15500 20570 17202 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_15500 23720 20574 gene locus_tag LOCUS_15510 23720 20574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 24378 23749 gene locus_tag LOCUS_15520 24378 23749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence041 <1 722 gene locus_tag LOCUS_15530 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533185.1:FdhF/YdeP family oxidoreductase 1494 688 gene locus_tag LOCUS_15540 1494 688 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_15540 2346 2948 gene locus_tag LOCUS_15550 2346 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2953 3705 gene locus_tag LOCUS_15560 2953 3705 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_15560 3709 4929 gene locus_tag LOCUS_15570 3709 4929 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_15570 4926 6152 gene locus_tag LOCUS_15580 4926 6152 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_15580 6169 6870 gene locus_tag LOCUS_15590 6169 6870 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_15590 6938 8098 gene locus_tag LOCUS_15600 6938 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8411 10852 gene locus_tag LOCUS_15610 8411 10852 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921186.1 protein_id gnl|my_center|LOCUS_15610 11704 10991 gene locus_tag LOCUS_15620 11704 10991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 12324 13196 gene locus_tag LOCUS_15630 gene yghU 12324 13196 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_15630 13493 13308 gene locus_tag LOCUS_15640 gene yacG 13493 13308 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720789.1 protein_id gnl|my_center|LOCUS_15640 15003 13480 gene locus_tag LOCUS_15650 gene rng 15003 13480 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461826.1 protein_id gnl|my_center|LOCUS_15650 15619 15035 gene locus_tag LOCUS_15660 15619 15035 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640472.1 protein_id gnl|my_center|LOCUS_15660 15841 15623 gene locus_tag LOCUS_15670 gene infA 15841 15623 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617696.1 protein_id gnl|my_center|LOCUS_15670 16498 16040 gene locus_tag LOCUS_15680 16498 16040 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084076.1 protein_id gnl|my_center|LOCUS_15680 16983 16504 gene locus_tag LOCUS_15690 16983 16504 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920203.1 protein_id gnl|my_center|LOCUS_15690 18280 16985 gene locus_tag LOCUS_15700 gene hisD 18280 16985 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390581.1 protein_id gnl|my_center|LOCUS_15700 18714 18280 gene locus_tag LOCUS_15710 18714 18280 CDS product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265795.1 protein_id gnl|my_center|LOCUS_15710 19991 18711 gene locus_tag LOCUS_15720 gene murA 19991 18711 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920208.1 protein_id gnl|my_center|LOCUS_15720 20328 20149 gene locus_tag LOCUS_15730 20328 20149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 20432 20506 gene locus_tag LOCUS_t00160 20432 20506 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20691 21878 gene locus_tag LOCUS_15740 20691 21878 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_15740 22176 21946 gene locus_tag LOCUS_15750 22176 21946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 22324 22776 gene locus_tag LOCUS_15760 22324 22776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 23124 23378 gene locus_tag LOCUS_15770 23124 23378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence042 1235 879 gene locus_tag LOCUS_15780 1235 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2183 1359 gene locus_tag LOCUS_15790 gene fljL 2183 1359 CDS product flagellin FljL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919336.1 protein_id gnl|my_center|LOCUS_15790 3328 2504 gene locus_tag LOCUS_15800 gene fljL 3328 2504 CDS product flagellin FljL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919336.1 protein_id gnl|my_center|LOCUS_15800 3616 5631 gene locus_tag LOCUS_15810 3616 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 6918 5623 gene locus_tag LOCUS_15820 6918 5623 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_15820 7101 7337 gene locus_tag LOCUS_15830 7101 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 7416 7979 gene locus_tag LOCUS_15840 7416 7979 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_15840 7983 8654 gene locus_tag LOCUS_15850 gene tsaB 7983 8654 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083621.1 protein_id gnl|my_center|LOCUS_15850 8651 9118 gene locus_tag LOCUS_15860 8651 9118 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391511.1 protein_id gnl|my_center|LOCUS_15860 9153 9605 gene locus_tag LOCUS_15870 9153 9605 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 protein_id gnl|my_center|LOCUS_15870 9614 10480 gene locus_tag LOCUS_15880 9614 10480 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974254.1 protein_id gnl|my_center|LOCUS_15880 10545 11900 gene locus_tag LOCUS_15890 gene miaB 10545 11900 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503457.1 protein_id gnl|my_center|LOCUS_15890 11897 12901 gene locus_tag LOCUS_15900 11897 12901 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383550.1 protein_id gnl|my_center|LOCUS_15900 12898 13350 gene locus_tag LOCUS_15910 gene ybeY 12898 13350 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265493.1 protein_id gnl|my_center|LOCUS_15910 13355 14275 gene locus_tag LOCUS_15920 13355 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 14279 15904 gene locus_tag LOCUS_15930 gene lnt 14279 15904 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 protein_id gnl|my_center|LOCUS_15930 16011 16346 gene locus_tag LOCUS_15940 16011 16346 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083612.1 protein_id gnl|my_center|LOCUS_15940 16666 16349 gene locus_tag LOCUS_15950 16666 16349 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337341.1 protein_id gnl|my_center|LOCUS_15950 18342 16666 gene locus_tag LOCUS_15960 18342 16666 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 protein_id gnl|my_center|LOCUS_15960 19327 18632 gene locus_tag LOCUS_15970 19327 18632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 20206 19499 gene locus_tag LOCUS_15980 20206 19499 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_15980 21267 20203 gene locus_tag LOCUS_15990 21267 20203 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839725.1 protein_id gnl|my_center|LOCUS_15990 22022 22576 gene locus_tag LOCUS_16000 22022 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967303.1 protein_id gnl|my_center|LOCUS_16000 22578 22871 gene locus_tag LOCUS_16010 22578 22871 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090236.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence043 1471 347 gene locus_tag LOCUS_16020 1471 347 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_16020 2819 3997 gene locus_tag LOCUS_16030 2819 3997 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_16030 4011 4682 gene locus_tag LOCUS_16040 4011 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 4706 5386 gene locus_tag LOCUS_16050 4706 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 5542 6078 gene locus_tag LOCUS_16060 5542 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 6065 7054 gene locus_tag LOCUS_16070 6065 7054 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967329.1 protein_id gnl|my_center|LOCUS_16070 7045 7956 gene locus_tag LOCUS_16080 7045 7956 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967330.1 protein_id gnl|my_center|LOCUS_16080 11497 8390 gene locus_tag LOCUS_16090 11497 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_16090 12690 13502 gene locus_tag LOCUS_16100 12690 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 14161 14751 gene locus_tag LOCUS_16110 14161 14751 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566395.1 protein_id gnl|my_center|LOCUS_16110 14748 15773 gene locus_tag LOCUS_16120 gene trpD 14748 15773 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389649.1 protein_id gnl|my_center|LOCUS_16120 15767 16561 gene locus_tag LOCUS_16130 gene trpC 15767 16561 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328328.1 protein_id gnl|my_center|LOCUS_16130 16558 17346 gene locus_tag LOCUS_16140 16558 17346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 17343 18542 gene locus_tag LOCUS_16150 17343 18542 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_16150 19753 18716 gene locus_tag LOCUS_16160 19753 18716 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920677.1 protein_id gnl|my_center|LOCUS_16160 20579 19842 gene locus_tag LOCUS_16170 20579 19842 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920676.1 protein_id gnl|my_center|LOCUS_16170 21087 21833 gene locus_tag LOCUS_16180 gene lexA 21087 21833 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531746.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence044 813 2339 gene locus_tag LOCUS_16190 gene ltrA 813 2339 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967989.1 protein_id gnl|my_center|LOCUS_16190 3262 2483 gene locus_tag LOCUS_16200 gene trbJ 3262 2483 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090992.1 protein_id gnl|my_center|LOCUS_16200 5703 3259 gene locus_tag LOCUS_16210 gene trbE 5703 3259 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090993.1 protein_id gnl|my_center|LOCUS_16210 5991 5716 gene locus_tag LOCUS_16220 5991 5716 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312513.1 protein_id gnl|my_center|LOCUS_16220 6353 5991 gene locus_tag LOCUS_16230 6353 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 7327 6350 gene locus_tag LOCUS_16240 gene trbB 7327 6350 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090996.1 protein_id gnl|my_center|LOCUS_16240 7988 7521 gene locus_tag LOCUS_16250 7988 7521 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 protein_id gnl|my_center|LOCUS_16250 9988 7997 gene locus_tag LOCUS_16260 9988 7997 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018269525.1 protein_id gnl|my_center|LOCUS_16260 11017 10136 gene locus_tag LOCUS_16270 11017 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251578.1 protein_id gnl|my_center|LOCUS_16270 12106 11249 gene locus_tag LOCUS_16280 12106 11249 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770800.1 protein_id gnl|my_center|LOCUS_16280 13685 12111 gene locus_tag LOCUS_16290 13685 12111 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104676.1 protein_id gnl|my_center|LOCUS_16290 15784 14138 gene locus_tag LOCUS_16300 15784 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 17539 16469 gene locus_tag LOCUS_16310 17539 16469 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 protein_id gnl|my_center|LOCUS_16310 18431 17553 gene locus_tag LOCUS_16320 18431 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 18594 18965 gene locus_tag LOCUS_16330 18594 18965 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315823.1 protein_id gnl|my_center|LOCUS_16330 20219 19317 gene locus_tag LOCUS_16340 20219 19317 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087264598.1 protein_id gnl|my_center|LOCUS_16340 20330 20740 gene locus_tag LOCUS_16350 20330 20740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 20778 21335 gene locus_tag LOCUS_16360 20778 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 22302 21403 gene locus_tag LOCUS_16370 22302 21403 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926200.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence045 593 2356 gene locus_tag LOCUS_16380 593 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2332 3732 gene locus_tag LOCUS_16390 2332 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3725 6364 gene locus_tag LOCUS_16400 3725 6364 CDS product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 protein_id gnl|my_center|LOCUS_16400 6718 7074 gene locus_tag LOCUS_16410 6718 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 7229 9205 gene locus_tag LOCUS_16420 7229 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 9212 12523 gene locus_tag LOCUS_16430 gene drmA 9212 12523 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083688.1 protein_id gnl|my_center|LOCUS_16430 13052 12747 gene locus_tag LOCUS_16440 13052 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 13362 14435 gene locus_tag LOCUS_16450 13362 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 14437 16164 gene locus_tag LOCUS_16460 14437 16164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 16219 19410 gene locus_tag LOCUS_16470 16219 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 19435 21078 gene locus_tag LOCUS_16480 19435 21078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 21168 21668 gene locus_tag LOCUS_16490 21168 21668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 21665 22621 gene locus_tag LOCUS_16500 21665 22621 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence046 772 503 gene locus_tag LOCUS_16510 772 503 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261491.1 protein_id gnl|my_center|LOCUS_16510 1653 1297 gene locus_tag LOCUS_16520 1653 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2090 1665 gene locus_tag LOCUS_16530 2090 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 3021 2104 gene locus_tag LOCUS_16540 3021 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494047.1 protein_id gnl|my_center|LOCUS_16540 3941 3024 gene locus_tag LOCUS_16550 3941 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 5475 4780 gene locus_tag LOCUS_16560 5475 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 6458 6228 gene locus_tag LOCUS_16570 6458 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 7328 6600 gene locus_tag LOCUS_16580 7328 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 8337 7336 gene locus_tag LOCUS_16590 8337 7336 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640144.1 protein_id gnl|my_center|LOCUS_16590 10453 8339 gene locus_tag LOCUS_16600 10453 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 10779 10456 gene locus_tag LOCUS_16610 10779 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 11024 12514 gene locus_tag LOCUS_16620 11024 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 12694 13911 gene locus_tag LOCUS_16630 12694 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012561197.1 protein_id gnl|my_center|LOCUS_16630 14181 16487 gene locus_tag LOCUS_16640 14181 16487 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490278.1 protein_id gnl|my_center|LOCUS_16640 16513 17154 gene locus_tag LOCUS_16650 16513 17154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 17546 17322 gene locus_tag LOCUS_16660 17546 17322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 18025 17600 gene locus_tag LOCUS_16670 18025 17600 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529815.1 protein_id gnl|my_center|LOCUS_16670 18264 18022 gene locus_tag LOCUS_16680 18264 18022 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968496.1 protein_id gnl|my_center|LOCUS_16680 18631 19905 gene locus_tag LOCUS_16690 18631 19905 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082896.1 protein_id gnl|my_center|LOCUS_16690 20331 20107 gene locus_tag LOCUS_16700 20331 20107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 20346 21284 gene locus_tag LOCUS_16710 20346 21284 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084737.1 protein_id gnl|my_center|LOCUS_16710 22121 22285 gene locus_tag LOCUS_16720 22121 22285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 22831 22415 gene locus_tag LOCUS_16730 22831 22415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence047 607 957 gene locus_tag LOCUS_16740 607 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 976 1653 gene locus_tag LOCUS_16750 gene feuP 976 1653 CDS product two-component system response regulator FeuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974832.1 protein_id gnl|my_center|LOCUS_16750 1705 3165 gene locus_tag LOCUS_16760 1705 3165 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_16760 3419 3162 gene locus_tag LOCUS_16770 3419 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 4801 3623 gene locus_tag LOCUS_16780 4801 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_16780 5321 4881 gene locus_tag LOCUS_16790 5321 4881 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509099.1 protein_id gnl|my_center|LOCUS_16790 5637 5963 gene locus_tag LOCUS_16800 5637 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 6565 5882 gene locus_tag LOCUS_16810 6565 5882 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_16810 6467 6661 gene locus_tag LOCUS_16820 6467 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 7939 6668 gene locus_tag LOCUS_16830 7939 6668 CDS product citrate-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170457.1 protein_id gnl|my_center|LOCUS_16830 8793 7936 gene locus_tag LOCUS_16840 gene pcaD 8793 7936 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_16840 9713 8865 gene locus_tag LOCUS_16850 9713 8865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384595.1 protein_id gnl|my_center|LOCUS_16850 10549 9710 gene locus_tag LOCUS_16860 10549 9710 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_16860 13437 10546 gene locus_tag LOCUS_16870 13437 10546 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389791.1 protein_id gnl|my_center|LOCUS_16870 14312 13803 gene locus_tag LOCUS_16880 14312 13803 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_16880 15972 14299 gene locus_tag LOCUS_16890 15972 14299 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975275.1 protein_id gnl|my_center|LOCUS_16890 16348 15959 gene locus_tag LOCUS_16900 16348 15959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 16530 18452 gene locus_tag LOCUS_16910 16530 18452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 18528 19931 gene locus_tag LOCUS_16920 18528 19931 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102289.1 protein_id gnl|my_center|LOCUS_16920 21171 20023 gene locus_tag LOCUS_16930 21171 20023 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_16930 21591 21196 gene locus_tag LOCUS_16940 21591 21196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 22569 21640 gene locus_tag LOCUS_16950 gene speE 22569 21640 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829972.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence048 990 208 gene locus_tag LOCUS_16960 990 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870226.1 protein_id gnl|my_center|LOCUS_16960 2963 987 gene locus_tag LOCUS_16970 gene pglZ 2963 987 CDS product BREX-3 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870227.1 protein_id gnl|my_center|LOCUS_16970 5742 2956 gene locus_tag LOCUS_16980 5742 2956 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870228.1 protein_id gnl|my_center|LOCUS_16980 6864 5806 gene locus_tag LOCUS_16990 6864 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 7790 6864 gene locus_tag LOCUS_17000 7790 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 11560 8765 gene locus_tag LOCUS_17010 11560 8765 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280509.1 protein_id gnl|my_center|LOCUS_17010 15317 11589 gene locus_tag LOCUS_17020 15317 11589 CDS product DUF6079 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870232.1 protein_id gnl|my_center|LOCUS_17020 15813 15337 gene locus_tag LOCUS_17030 gene brxF 15813 15337 CDS product BREX-3 system P-loop-containing protein BrxF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870233.1 protein_id gnl|my_center|LOCUS_17030 16056 15814 gene locus_tag LOCUS_17040 16056 15814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 16805 16137 gene locus_tag LOCUS_17050 16805 16137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 19060 16787 gene locus_tag LOCUS_17060 19060 16787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 20169 19060 gene locus_tag LOCUS_17070 20169 19060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 20390 21271 gene locus_tag LOCUS_17080 20390 21271 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 protein_id gnl|my_center|LOCUS_17080 21452 22051 gene locus_tag LOCUS_17090 21452 22051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence049 888 355 gene locus_tag LOCUS_17100 888 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1302 889 gene locus_tag LOCUS_17110 gene mscL 1302 889 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338438.1 protein_id gnl|my_center|LOCUS_17110 1600 1797 gene locus_tag LOCUS_17120 gene rpmI 1600 1797 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383043.1 protein_id gnl|my_center|LOCUS_17120 1809 2156 gene locus_tag LOCUS_17130 gene rplT 1809 2156 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710091.1 protein_id gnl|my_center|LOCUS_17130 2278 3357 gene locus_tag LOCUS_17140 gene pheS 2278 3357 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083532.1 protein_id gnl|my_center|LOCUS_17140 3354 5750 gene locus_tag LOCUS_17150 gene pheT 3354 5750 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391271.1 protein_id gnl|my_center|LOCUS_17150 5773 6951 gene locus_tag LOCUS_17160 5773 6951 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_17160 7041 8843 gene locus_tag LOCUS_17170 gene lepA 7041 8843 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014530015.1 protein_id gnl|my_center|LOCUS_17170 9795 8860 gene locus_tag LOCUS_17180 9795 8860 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 protein_id gnl|my_center|LOCUS_17180 10889 9795 gene locus_tag LOCUS_17190 gene hisC 10889 9795 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973186.1 protein_id gnl|my_center|LOCUS_17190 11749 10886 gene locus_tag LOCUS_17200 11749 10886 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_17200 11983 12186 gene locus_tag LOCUS_17210 11983 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 12416 12132 gene locus_tag LOCUS_17220 12416 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 13335 12625 gene locus_tag LOCUS_17230 13335 12625 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083053.1 protein_id gnl|my_center|LOCUS_17230 13422 14177 gene locus_tag LOCUS_17240 gene gloB 13422 14177 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066773.1 protein_id gnl|my_center|LOCUS_17240 14789 14184 gene locus_tag LOCUS_17250 14789 14184 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819076.1 protein_id gnl|my_center|LOCUS_17250 15156 14947 gene locus_tag LOCUS_17260 15156 14947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 15283 15705 gene locus_tag LOCUS_17270 15283 15705 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919492.1 protein_id gnl|my_center|LOCUS_17270 16340 15702 gene locus_tag LOCUS_17280 16340 15702 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316615.1 protein_id gnl|my_center|LOCUS_17280 16459 17076 gene locus_tag LOCUS_17290 16459 17076 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_17290 18481 17132 gene locus_tag LOCUS_17300 18481 17132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17300 19716 18367 gene locus_tag LOCUS_17310 19716 18367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17310 18571 18580 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21715 19841 gene locus_tag LOCUS_17320 gene dnaG 21715 19841 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530148.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence050 11 100 gene locus_tag LOCUS_t00170 11 100 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1016 201 gene locus_tag LOCUS_17330 1016 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1904 1536 gene locus_tag LOCUS_17340 1904 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2433 1915 gene locus_tag LOCUS_17350 2433 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2679 2530 gene locus_tag LOCUS_17360 2679 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 3037 2762 gene locus_tag LOCUS_17370 3037 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3109 4284 gene locus_tag LOCUS_17380 3109 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026192137.1 protein_id gnl|my_center|LOCUS_17380 4410 4658 gene locus_tag LOCUS_17390 4410 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 4965 5561 gene locus_tag LOCUS_17400 4965 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 7077 5590 gene locus_tag LOCUS_17410 7077 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 8750 7074 gene locus_tag LOCUS_17420 8750 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 9748 8747 gene locus_tag LOCUS_17430 9748 8747 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470622.1 protein_id gnl|my_center|LOCUS_17430 10431 10832 gene locus_tag LOCUS_17440 10431 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 11002 12075 gene locus_tag LOCUS_17450 11002 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 12119 12409 gene locus_tag LOCUS_17460 12119 12409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 13643 12597 gene locus_tag LOCUS_17470 13643 12597 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004240.1 protein_id gnl|my_center|LOCUS_17470 15249 13654 gene locus_tag LOCUS_17480 15249 13654 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339589.1 protein_id gnl|my_center|LOCUS_17480 15546 15980 gene locus_tag LOCUS_17490 15546 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 15983 16630 gene locus_tag LOCUS_17500 15983 16630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 17851 17066 gene locus_tag LOCUS_17510 17851 17066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 19014 17848 gene locus_tag LOCUS_17520 gene dcm 19014 17848 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 protein_id gnl|my_center|LOCUS_17520 19294 19001 gene locus_tag LOCUS_17530 19294 19001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 19594 19388 gene locus_tag LOCUS_17540 19594 19388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 19842 19600 gene locus_tag LOCUS_17550 19842 19600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 20730 19918 gene locus_tag LOCUS_17560 20730 19918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 21981 20734 gene locus_tag LOCUS_17570 21981 20734 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_17570 22208 21999 gene locus_tag LOCUS_17580 22208 21999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence051 383 1618 gene locus_tag LOCUS_17590 383 1618 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218080540.1 protein_id gnl|my_center|LOCUS_17590 1615 2190 gene locus_tag LOCUS_17600 1615 2190 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_17600 5479 2300 gene locus_tag LOCUS_17610 5479 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_17610 5863 6585 gene locus_tag LOCUS_17620 5863 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 6667 7791 gene locus_tag LOCUS_17630 6667 7791 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_17630 8259 7852 gene locus_tag LOCUS_17640 8259 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 9081 8470 gene locus_tag LOCUS_17650 9081 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 10147 8975 gene locus_tag LOCUS_17660 10147 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 11220 10234 gene locus_tag LOCUS_17670 11220 10234 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_17670 11341 12699 gene locus_tag LOCUS_17680 11341 12699 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_17680 12696 13334 gene locus_tag LOCUS_17690 gene pncA 12696 13334 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087320.1 protein_id gnl|my_center|LOCUS_17690 13736 13969 gene locus_tag LOCUS_17700 13736 13969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528305.1 protein_id gnl|my_center|LOCUS_17700 14502 16352 gene locus_tag LOCUS_17710 gene ilvD 14502 16352 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528037.1 protein_id gnl|my_center|LOCUS_17710 16801 16541 gene locus_tag LOCUS_17720 16801 16541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 16691 16960 gene locus_tag LOCUS_17730 16691 16960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 18450 16930 gene locus_tag LOCUS_17740 18450 16930 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_17740 18831 20675 gene locus_tag LOCUS_17750 18831 20675 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088960.1 protein_id gnl|my_center|LOCUS_17750 20692 21201 gene locus_tag LOCUS_17760 20692 21201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence052 867 2033 gene locus_tag LOCUS_17770 867 2033 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089530.1 protein_id gnl|my_center|LOCUS_17770 2728 2027 gene locus_tag LOCUS_17780 gene queC 2728 2027 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 protein_id gnl|my_center|LOCUS_17780 2909 4306 gene locus_tag LOCUS_17790 gene ahcY 2909 4306 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391191.1 protein_id gnl|my_center|LOCUS_17790 4571 6967 gene locus_tag LOCUS_17800 4571 6967 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330406.1 protein_id gnl|my_center|LOCUS_17800 7312 6992 gene locus_tag LOCUS_17810 7312 6992 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_17810 8549 7341 gene locus_tag LOCUS_17820 8549 7341 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 protein_id gnl|my_center|LOCUS_17820 8672 9136 gene locus_tag LOCUS_17830 gene tsaE 8672 9136 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921363.1 protein_id gnl|my_center|LOCUS_17830 9153 10265 gene locus_tag LOCUS_17840 9153 10265 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921364.1 protein_id gnl|my_center|LOCUS_17840 10262 10987 gene locus_tag LOCUS_17850 10262 10987 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 protein_id gnl|my_center|LOCUS_17850 10994 13927 gene locus_tag LOCUS_17860 gene addB 10994 13927 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_17860 14179 17679 gene locus_tag LOCUS_17870 gene addA 14179 17679 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336808.1 protein_id gnl|my_center|LOCUS_17870 17631 17951 gene locus_tag LOCUS_17880 gene trxA 17631 17951 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391180.1 protein_id gnl|my_center|LOCUS_17880 18801 17923 gene locus_tag LOCUS_17890 18801 17923 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967072.1 protein_id gnl|my_center|LOCUS_17890 18910 20259 gene locus_tag LOCUS_17900 gene murC 18910 20259 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972052.1 protein_id gnl|my_center|LOCUS_17900 20469 20393 gene locus_tag LOCUS_t00180 20469 20393 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20712 20786 gene locus_tag LOCUS_t00190 20712 20786 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 21783 21472 gene locus_tag LOCUS_17910 21783 21472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence053 230 2122 gene locus_tag LOCUS_17920 gene asnB 230 2122 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_17920 3166 2174 gene locus_tag LOCUS_17930 3166 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3547 3170 gene locus_tag LOCUS_17940 3547 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5507 4383 gene locus_tag LOCUS_17950 5507 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 6393 5713 gene locus_tag LOCUS_17960 6393 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 6738 7853 gene locus_tag LOCUS_17970 6738 7853 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942620.1 protein_id gnl|my_center|LOCUS_17970 8649 7900 gene locus_tag LOCUS_17980 8649 7900 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966663.1 protein_id gnl|my_center|LOCUS_17980 8978 10828 gene locus_tag LOCUS_17990 8978 10828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 11584 12360 gene locus_tag LOCUS_18000 11584 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 12357 13757 gene locus_tag LOCUS_18010 12357 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 14360 14920 gene locus_tag LOCUS_18020 14360 14920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 14920 16443 gene locus_tag LOCUS_18030 14920 16443 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176627.1 protein_id gnl|my_center|LOCUS_18030 16513 18453 gene locus_tag LOCUS_18040 gene asnB 16513 18453 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039037.1 protein_id gnl|my_center|LOCUS_18040 18502 19491 gene locus_tag LOCUS_18050 18502 19491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 19514 20560 gene locus_tag LOCUS_18060 19514 20560 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559357.1 protein_id gnl|my_center|LOCUS_18060 <22059 20570 gene locus_tag LOCUS_18070 <22059 20570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037392341.1:AMP-binding protein >Feature sequence054 868 5253 gene locus_tag LOCUS_18080 868 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 5232 6695 gene locus_tag LOCUS_18090 5232 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 6849 7658 gene locus_tag LOCUS_18100 6849 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 8384 7668 gene locus_tag LOCUS_18110 8384 7668 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_18110 11485 8384 gene locus_tag LOCUS_18120 11485 8384 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_18120 12056 11478 gene locus_tag LOCUS_18130 12056 11478 CDS product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039060.1 protein_id gnl|my_center|LOCUS_18130 13362 12046 gene locus_tag LOCUS_18140 13362 12046 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039059.1 protein_id gnl|my_center|LOCUS_18140 14612 13359 gene locus_tag LOCUS_18150 14612 13359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 16423 14603 gene locus_tag LOCUS_18160 16423 14603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18160 17082 16414 gene locus_tag LOCUS_18170 17082 16414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18170 17993 17091 gene locus_tag LOCUS_18180 17993 17091 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_18180 18421 18645 gene locus_tag LOCUS_18190 18421 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 18723 19187 gene locus_tag LOCUS_18200 18723 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 19199 19852 gene locus_tag LOCUS_18210 19199 19852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 19932 20267 gene locus_tag LOCUS_18220 19932 20267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 20273 20983 gene locus_tag LOCUS_18230 gene stbB 20273 20983 CDS product StbB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264012.1 protein_id gnl|my_center|LOCUS_18230 20996 21649 gene locus_tag LOCUS_18240 20996 21649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence055 923 267 gene locus_tag LOCUS_18250 gene actII 923 267 CDS product TetR family transcriptional regulator ActII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030045.1 protein_id gnl|my_center|LOCUS_18250 1036 2130 gene locus_tag LOCUS_18260 1036 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2127 4844 gene locus_tag LOCUS_18270 2127 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 5222 5034 gene locus_tag LOCUS_18280 5222 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 5573 5223 gene locus_tag LOCUS_18290 5573 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18290 6290 5949 gene locus_tag LOCUS_18300 6290 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18300 6432 6617 gene locus_tag LOCUS_18310 6432 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 6800 6618 gene locus_tag LOCUS_18320 6800 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 7353 6772 gene locus_tag LOCUS_18330 7353 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 8139 7354 gene locus_tag LOCUS_18340 8139 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 9079 8174 gene locus_tag LOCUS_18350 9079 8174 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_18350 10393 9143 gene locus_tag LOCUS_18360 10393 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 10806 10444 gene locus_tag LOCUS_18370 10806 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 10995 12704 gene locus_tag LOCUS_18380 10995 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 13148 13951 gene locus_tag LOCUS_18390 13148 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 14203 16332 gene locus_tag LOCUS_18400 14203 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 17095 16619 gene locus_tag LOCUS_18410 17095 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 17950 17129 gene locus_tag LOCUS_18420 17950 17129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 18991 18143 gene locus_tag LOCUS_18430 18991 18143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 20246 19386 gene locus_tag LOCUS_18440 20246 19386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 20801 21343 gene locus_tag LOCUS_18450 20801 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531700.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence056 26 352 gene locus_tag LOCUS_18460 26 352 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084751.1 protein_id gnl|my_center|LOCUS_18460 703 1335 gene locus_tag LOCUS_18470 703 1335 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538228.1 protein_id gnl|my_center|LOCUS_18470 1487 1756 gene locus_tag LOCUS_18480 1487 1756 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 protein_id gnl|my_center|LOCUS_18480 2337 2879 gene locus_tag LOCUS_18490 2337 2879 CDS product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 protein_id gnl|my_center|LOCUS_18490 2876 3427 gene locus_tag LOCUS_18500 2876 3427 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082879.1 protein_id gnl|my_center|LOCUS_18500 3460 3798 gene locus_tag LOCUS_18510 3460 3798 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082878.1 protein_id gnl|my_center|LOCUS_18510 3802 5331 gene locus_tag LOCUS_18520 3802 5331 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186448606.1 protein_id gnl|my_center|LOCUS_18520 5783 5220 gene locus_tag LOCUS_18530 5783 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 6221 6030 gene locus_tag LOCUS_18540 6221 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 6794 6477 gene locus_tag LOCUS_18550 6794 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 6793 7305 gene locus_tag LOCUS_18560 6793 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 7583 9640 gene locus_tag LOCUS_18570 7583 9640 CDS product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538232.1 protein_id gnl|my_center|LOCUS_18570 9687 10004 gene locus_tag LOCUS_18580 9687 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 10008 10505 gene locus_tag LOCUS_18590 10008 10505 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_18590 10712 11341 gene locus_tag LOCUS_18600 10712 11341 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328888.1 protein_id gnl|my_center|LOCUS_18600 11631 11353 gene locus_tag LOCUS_18610 11631 11353 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266521.1 protein_id gnl|my_center|LOCUS_18610 11739 12038 gene locus_tag LOCUS_18620 11739 12038 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538229.1 protein_id gnl|my_center|LOCUS_18620 12166 12798 gene locus_tag LOCUS_18630 12166 12798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 12795 13031 gene locus_tag LOCUS_18640 12795 13031 CDS product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 protein_id gnl|my_center|LOCUS_18640 14288 13347 gene locus_tag LOCUS_18650 14288 13347 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368405.1 protein_id gnl|my_center|LOCUS_18650 15819 14632 gene locus_tag LOCUS_18660 15819 14632 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966157.1 protein_id gnl|my_center|LOCUS_18660 16594 15869 gene locus_tag LOCUS_18670 16594 15869 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067323.1 protein_id gnl|my_center|LOCUS_18670 18978 16609 gene locus_tag LOCUS_18680 18978 16609 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205761.1 protein_id gnl|my_center|LOCUS_18680 19730 19008 gene locus_tag LOCUS_18690 gene phbB 19730 19008 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083057.1 protein_id gnl|my_center|LOCUS_18690 20606 19821 gene locus_tag LOCUS_18700 gene fabI 20606 19821 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195584.1 protein_id gnl|my_center|LOCUS_18700 21025 20603 gene locus_tag LOCUS_18710 21025 20603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 <21804 21098 gene locus_tag LOCUS_18720 <21804 21098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_082827568.1:acetate/propionate family kinase >Feature sequence057 <1 514 gene locus_tag LOCUS_18730 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037401737.1:RluA family pseudouridine synthase 561 1280 gene locus_tag LOCUS_18740 561 1280 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_18740 2028 1273 gene locus_tag LOCUS_18750 2028 1273 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532200.1 protein_id gnl|my_center|LOCUS_18750 3653 2253 gene locus_tag LOCUS_18760 3653 2253 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_18760 4216 3665 gene locus_tag LOCUS_18770 4216 3665 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919832.1 protein_id gnl|my_center|LOCUS_18770 5988 4426 gene locus_tag LOCUS_18780 5988 4426 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640376.1 protein_id gnl|my_center|LOCUS_18780 7167 5992 gene locus_tag LOCUS_18790 7167 5992 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150041682.1 protein_id gnl|my_center|LOCUS_18790 7440 7778 gene locus_tag LOCUS_18800 7440 7778 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 protein_id gnl|my_center|LOCUS_18800 7817 9226 gene locus_tag LOCUS_18810 gene glnA 7817 9226 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389839.1 protein_id gnl|my_center|LOCUS_18810 10715 9282 gene locus_tag LOCUS_18820 10715 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 12195 10798 gene locus_tag LOCUS_18830 12195 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 12356 14329 gene locus_tag LOCUS_18840 gene parE 12356 14329 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919840.1 protein_id gnl|my_center|LOCUS_18840 14523 14930 gene locus_tag LOCUS_18850 14523 14930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 14927 15412 gene locus_tag LOCUS_18860 14927 15412 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383229.1 protein_id gnl|my_center|LOCUS_18860 17532 15409 gene locus_tag LOCUS_18870 17532 15409 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 protein_id gnl|my_center|LOCUS_18870 17951 19939 gene locus_tag LOCUS_18880 17951 19939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 21394 19955 gene locus_tag LOCUS_18890 21394 19955 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919715.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence058 161 913 gene locus_tag LOCUS_18900 161 913 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339467.1 protein_id gnl|my_center|LOCUS_18900 1220 2635 gene locus_tag LOCUS_18910 1220 2635 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 protein_id gnl|my_center|LOCUS_18910 3516 2665 gene locus_tag LOCUS_18920 3516 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4088 3612 gene locus_tag LOCUS_18930 4088 3612 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722321.1 protein_id gnl|my_center|LOCUS_18930 4383 5318 gene locus_tag LOCUS_18940 gene trxB 4383 5318 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265863.1 protein_id gnl|my_center|LOCUS_18940 5361 6254 gene locus_tag LOCUS_18950 5361 6254 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_18950 6577 7239 gene locus_tag LOCUS_18960 6577 7239 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206353.1 protein_id gnl|my_center|LOCUS_18960 8321 7332 gene locus_tag LOCUS_18970 gene msrP 8321 7332 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_18970 10802 8757 gene locus_tag LOCUS_18980 10802 8757 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090149.1 protein_id gnl|my_center|LOCUS_18980 11410 11790 gene locus_tag LOCUS_18990 11410 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18990 12089 12343 gene locus_tag LOCUS_19000 12089 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 13742 12510 gene locus_tag LOCUS_19010 13742 12510 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972134.1 protein_id gnl|my_center|LOCUS_19010 13894 14337 gene locus_tag LOCUS_19020 13894 14337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 14448 15071 gene locus_tag LOCUS_19030 14448 15071 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919897.1 protein_id gnl|my_center|LOCUS_19030 15400 16911 gene locus_tag LOCUS_19040 15400 16911 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494095.1 protein_id gnl|my_center|LOCUS_19040 17426 16935 gene locus_tag LOCUS_19050 17426 16935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19050 17783 17442 gene locus_tag LOCUS_19060 17783 17442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19060 20033 18012 gene locus_tag LOCUS_19070 20033 18012 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_19070 21497 20442 gene locus_tag LOCUS_19080 21497 20442 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085570.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence059 269 817 gene locus_tag LOCUS_19090 269 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 820 1047 gene locus_tag LOCUS_19100 820 1047 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108924.1 protein_id gnl|my_center|LOCUS_19100 4631 1221 gene locus_tag LOCUS_19110 4631 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 4857 6167 gene locus_tag LOCUS_19120 4857 6167 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 protein_id gnl|my_center|LOCUS_19120 6686 6219 gene locus_tag LOCUS_19130 6686 6219 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066931.1 protein_id gnl|my_center|LOCUS_19130 7068 7391 gene locus_tag LOCUS_19140 7068 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 7448 8326 gene locus_tag LOCUS_19150 7448 8326 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920114.1 protein_id gnl|my_center|LOCUS_19150 9112 8312 gene locus_tag LOCUS_19160 gene hisN 9112 8312 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_19160 9163 10014 gene locus_tag LOCUS_19170 9163 10014 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966484.1 protein_id gnl|my_center|LOCUS_19170 11843 10011 gene locus_tag LOCUS_19180 gene typA 11843 10011 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720611.1 protein_id gnl|my_center|LOCUS_19180 12292 13455 gene locus_tag LOCUS_19190 12292 13455 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_19190 13452 16544 gene locus_tag LOCUS_19200 13452 16544 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937745.1 protein_id gnl|my_center|LOCUS_19200 17599 16568 gene locus_tag LOCUS_19210 17599 16568 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389904.1 protein_id gnl|my_center|LOCUS_19210 17733 18935 gene locus_tag LOCUS_19220 17733 18935 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_19220 18947 20083 gene locus_tag LOCUS_19230 18947 20083 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_19230 20387 20106 gene locus_tag LOCUS_19240 20387 20106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 21422 20616 gene locus_tag LOCUS_19250 21422 20616 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence060 1231 2838 gene locus_tag LOCUS_19260 1231 2838 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338336.1 protein_id gnl|my_center|LOCUS_19260 2835 3602 gene locus_tag LOCUS_19270 2835 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 4184 3603 gene locus_tag LOCUS_19280 4184 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 4304 5350 gene locus_tag LOCUS_19290 4304 5350 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 protein_id gnl|my_center|LOCUS_19290 5830 5375 gene locus_tag LOCUS_19300 5830 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19300 6222 5782 gene locus_tag LOCUS_19310 6222 5782 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 protein_id gnl|my_center|LOCUS_19310 6337 6978 gene locus_tag LOCUS_19320 6337 6978 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265622.1 protein_id gnl|my_center|LOCUS_19320 6975 7946 gene locus_tag LOCUS_19330 6975 7946 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640058.1 protein_id gnl|my_center|LOCUS_19330 9049 7943 gene locus_tag LOCUS_19340 gene leuB 9049 7943 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535893.1 protein_id gnl|my_center|LOCUS_19340 9667 9062 gene locus_tag LOCUS_19350 gene leuD 9667 9062 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388945.1 protein_id gnl|my_center|LOCUS_19350 10237 9863 gene locus_tag LOCUS_19360 10237 9863 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328553.1 protein_id gnl|my_center|LOCUS_19360 10428 10234 gene locus_tag LOCUS_19370 10428 10234 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083431.1 protein_id gnl|my_center|LOCUS_19370 11107 10442 gene locus_tag LOCUS_19380 11107 10442 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917998.1 protein_id gnl|my_center|LOCUS_19380 12062 11115 gene locus_tag LOCUS_19390 gene trxA 12062 11115 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083423.1 protein_id gnl|my_center|LOCUS_19390 12738 12154 gene locus_tag LOCUS_19400 12738 12154 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406246.1 protein_id gnl|my_center|LOCUS_19400 13466 12732 gene locus_tag LOCUS_19410 13466 12732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 14089 13487 gene locus_tag LOCUS_19420 14089 13487 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921284.1 protein_id gnl|my_center|LOCUS_19420 15150 14191 gene locus_tag LOCUS_19430 15150 14191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 16682 15153 gene locus_tag LOCUS_19440 16682 15153 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_19440 17493 20684 gene locus_tag LOCUS_19450 17493 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_19450 <21356 20719 gene locus_tag LOCUS_19460 <21356 20719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_018207916.1:HAD family hydrolase >Feature sequence061 1206 1811 gene locus_tag LOCUS_19470 1206 1811 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_19470 2710 1826 gene locus_tag LOCUS_19480 gene folD 2710 1826 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_19480 3209 2910 gene locus_tag LOCUS_19490 3209 2910 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598721.1 protein_id gnl|my_center|LOCUS_19490 3100 3330 gene locus_tag LOCUS_19500 3100 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3373 3448 gene locus_tag LOCUS_t00200 3373 3448 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4500 3871 gene locus_tag LOCUS_19510 4500 3871 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918669.1 protein_id gnl|my_center|LOCUS_19510 5405 4497 gene locus_tag LOCUS_19520 5405 4497 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704306.1 protein_id gnl|my_center|LOCUS_19520 6151 5402 gene locus_tag LOCUS_19530 6151 5402 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086172.1 protein_id gnl|my_center|LOCUS_19530 7800 6151 gene locus_tag LOCUS_19540 7800 6151 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241211.1 protein_id gnl|my_center|LOCUS_19540 9866 7905 gene locus_tag LOCUS_19550 9866 7905 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_19550 11092 10232 gene locus_tag LOCUS_19560 11092 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 13244 11097 gene locus_tag LOCUS_19570 13244 11097 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420832.1 protein_id gnl|my_center|LOCUS_19570 13542 14273 gene locus_tag LOCUS_19580 13542 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 14623 16887 gene locus_tag LOCUS_19590 14623 16887 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_19590 16859 17152 gene locus_tag LOCUS_19600 16859 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 17180 17602 gene locus_tag LOCUS_19610 17180 17602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 18193 17630 gene locus_tag LOCUS_19620 18193 17630 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_19620 21048 18289 gene locus_tag LOCUS_19630 gene flaEY 21048 18289 CDS product regulatory protein FlaEY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919340.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence062 <1 754 gene locus_tag LOCUS_19640 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958017.1:dienelactone hydrolase family protein 1596 1835 gene locus_tag LOCUS_19650 1596 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1985 1857 gene locus_tag LOCUS_19660 1985 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2152 3795 gene locus_tag LOCUS_19670 2152 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 3939 4319 gene locus_tag LOCUS_19680 3939 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 5281 5916 gene locus_tag LOCUS_19690 5281 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19690 5913 6332 gene locus_tag LOCUS_19700 5913 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19700 6452 7987 gene locus_tag LOCUS_19710 6452 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 9173 8145 gene locus_tag LOCUS_19720 9173 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 10358 9231 gene locus_tag LOCUS_19730 10358 9231 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081140.1 protein_id gnl|my_center|LOCUS_19730 10972 10526 gene locus_tag LOCUS_19740 10972 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 11187 11585 gene locus_tag LOCUS_19750 11187 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 12018 11809 gene locus_tag LOCUS_19760 12018 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 12112 12456 gene locus_tag LOCUS_19770 12112 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 13244 12768 gene locus_tag LOCUS_19780 13244 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 14401 13856 gene locus_tag LOCUS_19790 14401 13856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 15243 14416 gene locus_tag LOCUS_19800 15243 14416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 17101 15548 gene locus_tag LOCUS_19810 17101 15548 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073856744.1 protein_id gnl|my_center|LOCUS_19810 17040 17255 gene locus_tag LOCUS_19820 17040 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 17865 17680 gene locus_tag LOCUS_19830 17865 17680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 18281 19789 gene locus_tag LOCUS_19840 18281 19789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 20343 20765 gene locus_tag LOCUS_19850 20343 20765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19850 20693 21133 gene locus_tag LOCUS_19860 20693 21133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19860 >Feature sequence063 401 1078 gene locus_tag LOCUS_19870 401 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 1450 3714 gene locus_tag LOCUS_19880 1450 3714 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_19880 3901 3722 gene locus_tag LOCUS_19890 3901 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4145 3957 gene locus_tag LOCUS_19900 4145 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 4063 4485 gene locus_tag LOCUS_19910 4063 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 5076 4513 gene locus_tag LOCUS_19920 5076 4513 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_19920 7957 5171 gene locus_tag LOCUS_19930 gene flaEY 7957 5171 CDS product regulatory protein FlaEY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919340.1 protein_id gnl|my_center|LOCUS_19930 8044 9543 gene locus_tag LOCUS_19940 gene flmG 8044 9543 CDS product glycosyltransferase FlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919333.1 protein_id gnl|my_center|LOCUS_19940 11386 9560 gene locus_tag LOCUS_19950 11386 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 12234 11368 gene locus_tag LOCUS_19960 12234 11368 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073144.1 protein_id gnl|my_center|LOCUS_19960 12310 13242 gene locus_tag LOCUS_19970 12310 13242 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073150.1 protein_id gnl|my_center|LOCUS_19970 13239 14069 gene locus_tag LOCUS_19980 13239 14069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 14117 15292 gene locus_tag LOCUS_19990 14117 15292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 15306 16205 gene locus_tag LOCUS_20000 15306 16205 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 protein_id gnl|my_center|LOCUS_20000 16202 17179 gene locus_tag LOCUS_20010 16202 17179 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_20010 17176 17928 gene locus_tag LOCUS_20020 gene fabG 17176 17928 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_20020 17928 19145 gene locus_tag LOCUS_20030 17928 19145 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073148.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence064 1569 7 gene locus_tag LOCUS_20040 1569 7 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528502.1 protein_id gnl|my_center|LOCUS_20040 1800 2594 gene locus_tag LOCUS_20050 1800 2594 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086826.1 protein_id gnl|my_center|LOCUS_20050 2591 4021 gene locus_tag LOCUS_20060 2591 4021 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384150.1 protein_id gnl|my_center|LOCUS_20060 4098 5456 gene locus_tag LOCUS_20070 gene der 4098 5456 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919527.1 protein_id gnl|my_center|LOCUS_20070 5453 6247 gene locus_tag LOCUS_20080 5453 6247 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022097.1 protein_id gnl|my_center|LOCUS_20080 6250 6996 gene locus_tag LOCUS_20090 6250 6996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022096.1 protein_id gnl|my_center|LOCUS_20090 7738 7031 gene locus_tag LOCUS_20100 7738 7031 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971379.1 protein_id gnl|my_center|LOCUS_20100 9155 7812 gene locus_tag LOCUS_20110 gene purF 9155 7812 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532528.1 protein_id gnl|my_center|LOCUS_20110 9042 9350 gene locus_tag LOCUS_20120 9042 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 9952 9281 gene locus_tag LOCUS_20130 9952 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 11341 9980 gene locus_tag LOCUS_20140 gene radA 11341 9980 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240906.1 protein_id gnl|my_center|LOCUS_20140 12160 11390 gene locus_tag LOCUS_20150 12160 11390 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_20150 12951 12166 gene locus_tag LOCUS_20160 12951 12166 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 protein_id gnl|my_center|LOCUS_20160 14048 12948 gene locus_tag LOCUS_20170 gene alr 14048 12948 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919534.1 protein_id gnl|my_center|LOCUS_20170 14945 14244 gene locus_tag LOCUS_20180 14945 14244 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_20180 16527 15085 gene locus_tag LOCUS_20190 16527 15085 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532525.1 protein_id gnl|my_center|LOCUS_20190 17884 16643 gene locus_tag LOCUS_20200 17884 16643 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_20200 18792 18448 gene locus_tag LOCUS_20210 18792 18448 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967551.1 protein_id gnl|my_center|LOCUS_20210 19242 20033 gene locus_tag LOCUS_20220 19242 20033 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815086.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence065 558 2138 gene locus_tag LOCUS_20230 558 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2135 4198 gene locus_tag LOCUS_20240 2135 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 4508 4867 gene locus_tag LOCUS_20250 4508 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 4864 5058 gene locus_tag LOCUS_20260 4864 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 5058 5501 gene locus_tag LOCUS_20270 5058 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689093.1 protein_id gnl|my_center|LOCUS_20270 5471 6757 gene locus_tag LOCUS_20280 5471 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 6760 6939 gene locus_tag LOCUS_20290 6760 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 6939 7181 gene locus_tag LOCUS_20300 6939 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 7163 8647 gene locus_tag LOCUS_20310 7163 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 8690 9226 gene locus_tag LOCUS_20320 8690 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 9346 10695 gene locus_tag LOCUS_20330 9346 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 10697 10930 gene locus_tag LOCUS_20340 10697 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 10937 11344 gene locus_tag LOCUS_20350 10937 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 11345 12016 gene locus_tag LOCUS_20360 11345 12016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 12013 12471 gene locus_tag LOCUS_20370 12013 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 12468 12686 gene locus_tag LOCUS_20380 12468 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 12683 13126 gene locus_tag LOCUS_20390 12683 13126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 13138 14184 gene locus_tag LOCUS_20400 13138 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 14188 14679 gene locus_tag LOCUS_20410 14188 14679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 14780 18169 gene locus_tag LOCUS_20420 14780 18169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 18171 19085 gene locus_tag LOCUS_20430 18171 19085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 19146 19331 gene locus_tag LOCUS_20440 19146 19331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence066 384 16 gene locus_tag LOCUS_20450 384 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2022 931 gene locus_tag LOCUS_20460 2022 931 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837503.1 protein_id gnl|my_center|LOCUS_20460 3071 2268 gene locus_tag LOCUS_20470 3071 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 3531 3013 gene locus_tag LOCUS_20480 3531 3013 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088388.1 protein_id gnl|my_center|LOCUS_20480 3881 4459 gene locus_tag LOCUS_20490 3881 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 4540 5178 gene locus_tag LOCUS_20500 4540 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 5277 5861 gene locus_tag LOCUS_20510 5277 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 6073 6570 gene locus_tag LOCUS_20520 6073 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 7583 9223 gene locus_tag LOCUS_20530 7583 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 9641 9850 gene locus_tag LOCUS_20540 9641 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 12304 9827 gene locus_tag LOCUS_20550 12304 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 13112 12777 gene locus_tag LOCUS_20560 13112 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 13761 14981 gene locus_tag LOCUS_20570 gene ltrA 13761 14981 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118084.1 protein_id gnl|my_center|LOCUS_20570 15009 15641 gene locus_tag LOCUS_20580 15009 15641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 16976 16512 gene locus_tag LOCUS_20590 16976 16512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 17208 16981 gene locus_tag LOCUS_20600 17208 16981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20600 17627 17205 gene locus_tag LOCUS_20610 17627 17205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20610 17580 18401 gene locus_tag LOCUS_20620 17580 18401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 18402 19166 gene locus_tag LOCUS_20630 18402 19166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 19163 19537 gene locus_tag LOCUS_20640 19163 19537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 19737 19534 gene locus_tag LOCUS_20650 19737 19534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence067 <1 2939 gene locus_tag LOCUS_20660 <1 2939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036642.1:DEAD/DEAH box helicase 9104 3057 gene locus_tag LOCUS_20670 9104 3057 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220355262.1 protein_id gnl|my_center|LOCUS_20670 12577 9116 gene locus_tag LOCUS_20680 12577 9116 CDS product STY4851/ECs_5259 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222857981.1 protein_id gnl|my_center|LOCUS_20680 16160 13041 gene locus_tag LOCUS_20690 16160 13041 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554541.1 protein_id gnl|my_center|LOCUS_20690 17503 16157 gene locus_tag LOCUS_20700 17503 16157 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_20700 17709 17500 gene locus_tag LOCUS_20710 17709 17500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 19547 17706 gene locus_tag LOCUS_20720 19547 17706 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204925.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence068 158 859 gene locus_tag LOCUS_20730 158 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1334 1005 gene locus_tag LOCUS_20740 1334 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2643 1669 gene locus_tag LOCUS_20750 2643 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 2755 3300 gene locus_tag LOCUS_20760 2755 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 3328 3816 gene locus_tag LOCUS_20770 3328 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 4058 5221 gene locus_tag LOCUS_20780 4058 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012561197.1 protein_id gnl|my_center|LOCUS_20780 5365 5862 gene locus_tag LOCUS_20790 5365 5862 CDS product DUF2958 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533281.1 protein_id gnl|my_center|LOCUS_20790 5990 6385 gene locus_tag LOCUS_20800 5990 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 6463 8607 gene locus_tag LOCUS_20810 6463 8607 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490278.1 protein_id gnl|my_center|LOCUS_20810 8708 9205 gene locus_tag LOCUS_20820 8708 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 9216 9581 gene locus_tag LOCUS_20830 9216 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 9649 10155 gene locus_tag LOCUS_20840 9649 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 10828 10274 gene locus_tag LOCUS_20850 10828 10274 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533351.1 protein_id gnl|my_center|LOCUS_20850 11090 10818 gene locus_tag LOCUS_20860 11090 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390699.1 protein_id gnl|my_center|LOCUS_20860 11493 11744 gene locus_tag LOCUS_20870 11493 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 11744 12136 gene locus_tag LOCUS_20880 11744 12136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 12120 13199 gene locus_tag LOCUS_20890 12120 13199 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084736.1 protein_id gnl|my_center|LOCUS_20890 13528 13280 gene locus_tag LOCUS_20900 13528 13280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 13542 14480 gene locus_tag LOCUS_20910 13542 14480 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091010.1 protein_id gnl|my_center|LOCUS_20910 15688 14654 gene locus_tag LOCUS_20920 15688 14654 CDS product CBASS cGAMP-activated phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062610134.1 protein_id gnl|my_center|LOCUS_20920 17449 16193 gene locus_tag LOCUS_20930 17449 16193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 17590 17913 gene locus_tag LOCUS_20940 17590 17913 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668232.1 protein_id gnl|my_center|LOCUS_20940 17910 18818 gene locus_tag LOCUS_20950 17910 18818 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084482.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence069 866 387 gene locus_tag LOCUS_20960 866 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 3104 966 gene locus_tag LOCUS_20970 3104 966 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176021.1 protein_id gnl|my_center|LOCUS_20970 3489 3181 gene locus_tag LOCUS_20980 3489 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 4496 3486 gene locus_tag LOCUS_20990 4496 3486 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498063.1 protein_id gnl|my_center|LOCUS_20990 4812 5027 gene locus_tag LOCUS_21000 4812 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 5024 6571 gene locus_tag LOCUS_21010 5024 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 6575 7180 gene locus_tag LOCUS_21020 6575 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 7735 7920 gene locus_tag LOCUS_21030 7735 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 7920 9398 gene locus_tag LOCUS_21040 7920 9398 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 protein_id gnl|my_center|LOCUS_21040 9395 12055 gene locus_tag LOCUS_21050 9395 12055 CDS product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 protein_id gnl|my_center|LOCUS_21050 12048 13013 gene locus_tag LOCUS_21060 12048 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 13013 15073 gene locus_tag LOCUS_21070 13013 15073 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_21070 15066 15341 gene locus_tag LOCUS_21080 15066 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 15349 17517 gene locus_tag LOCUS_21090 15349 17517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 17517 18830 gene locus_tag LOCUS_21100 17517 18830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence070 309 485 gene locus_tag LOCUS_21110 309 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1931 522 gene locus_tag LOCUS_21120 1931 522 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_21120 3814 1934 gene locus_tag LOCUS_21130 3814 1934 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250346.1 protein_id gnl|my_center|LOCUS_21130 4218 10109 gene locus_tag LOCUS_21140 4218 10109 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267807.1 protein_id gnl|my_center|LOCUS_21140 10937 10176 gene locus_tag LOCUS_21150 10937 10176 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331492.1 protein_id gnl|my_center|LOCUS_21150 11358 10930 gene locus_tag LOCUS_21160 11358 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 11915 11355 gene locus_tag LOCUS_21170 11915 11355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 12153 12359 gene locus_tag LOCUS_21180 12153 12359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 12381 12599 gene locus_tag LOCUS_21190 12381 12599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 12965 13987 gene locus_tag LOCUS_21200 12965 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 13980 15146 gene locus_tag LOCUS_21210 13980 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 15150 16868 gene locus_tag LOCUS_21220 15150 16868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 18459 17419 gene locus_tag LOCUS_21230 18459 17419 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992495.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence071 <1 1326 gene locus_tag LOCUS_21240 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257221.1:NAD(P)/FAD-dependent oxidoreductase 1423 1659 gene locus_tag LOCUS_21250 1423 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 1866 2861 gene locus_tag LOCUS_21260 1866 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 3758 2922 gene locus_tag LOCUS_21270 3758 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 4740 3892 gene locus_tag LOCUS_21280 4740 3892 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727584.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21280 6389 4974 gene locus_tag LOCUS_21290 6389 4974 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225725.1 protein_id gnl|my_center|LOCUS_21290 7766 6408 gene locus_tag LOCUS_21300 7766 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225724.1 protein_id gnl|my_center|LOCUS_21300 9317 8229 gene locus_tag LOCUS_21310 9317 8229 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086613.1 protein_id gnl|my_center|LOCUS_21310 9625 9407 gene locus_tag LOCUS_21320 9625 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 9728 11116 gene locus_tag LOCUS_21330 9728 11116 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211170.1 protein_id gnl|my_center|LOCUS_21330 11148 11723 gene locus_tag LOCUS_21340 11148 11723 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276062.1 protein_id gnl|my_center|LOCUS_21340 11727 12905 gene locus_tag LOCUS_21350 11727 12905 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_21350 12902 13714 gene locus_tag LOCUS_21360 12902 13714 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_21360 13711 14352 gene locus_tag LOCUS_21370 13711 14352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 14356 15582 gene locus_tag LOCUS_21380 14356 15582 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083663.1 protein_id gnl|my_center|LOCUS_21380 16154 15579 gene locus_tag LOCUS_21390 gene cofC 16154 15579 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256112.1 protein_id gnl|my_center|LOCUS_21390 17092 16151 gene locus_tag LOCUS_21400 gene cofD 17092 16151 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_21400 17847 17089 gene locus_tag LOCUS_21410 gene cofE 17847 17089 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_21410 18503 17844 gene locus_tag LOCUS_21420 gene npdG 18503 17844 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence072 1335 217 gene locus_tag LOCUS_21430 1335 217 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_21430 1874 1473 gene locus_tag LOCUS_21440 1874 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 1755 2891 gene locus_tag LOCUS_21450 1755 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 3573 2857 gene locus_tag LOCUS_21460 gene hisA 3573 2857 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965127.1 protein_id gnl|my_center|LOCUS_21460 4208 3570 gene locus_tag LOCUS_21470 gene hisH 4208 3570 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391343.1 protein_id gnl|my_center|LOCUS_21470 6186 4378 gene locus_tag LOCUS_21480 6186 4378 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921248.1 protein_id gnl|my_center|LOCUS_21480 6406 6585 gene locus_tag LOCUS_21490 6406 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 6582 9509 gene locus_tag LOCUS_21500 gene polA 6582 9509 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173101.1 protein_id gnl|my_center|LOCUS_21500 11239 9575 gene locus_tag LOCUS_21510 11239 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 12157 11396 gene locus_tag LOCUS_21520 gene moeB 12157 11396 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_21520 12361 13977 gene locus_tag LOCUS_21530 12361 13977 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528338.1 protein_id gnl|my_center|LOCUS_21530 14072 15025 gene locus_tag LOCUS_21540 14072 15025 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383348.1 protein_id gnl|my_center|LOCUS_21540 15625 15029 gene locus_tag LOCUS_21550 15625 15029 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528588.1 protein_id gnl|my_center|LOCUS_21550 17007 15874 gene locus_tag LOCUS_21560 gene dnaJ 17007 15874 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338764.1 protein_id gnl|my_center|LOCUS_21560 <18923 17114 gene locus_tag LOCUS_21570 <18923 17114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083506.1:molecular chaperone DnaK >Feature sequence073 927 1331 gene locus_tag LOCUS_21580 gene crcB 927 1331 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_21580 1333 1722 gene locus_tag LOCUS_21590 1333 1722 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085423.1 protein_id gnl|my_center|LOCUS_21590 1789 3321 gene locus_tag LOCUS_21600 1789 3321 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088112.1 protein_id gnl|my_center|LOCUS_21600 3318 3848 gene locus_tag LOCUS_21610 3318 3848 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_21610 4239 3856 gene locus_tag LOCUS_21620 4239 3856 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 protein_id gnl|my_center|LOCUS_21620 5115 4258 gene locus_tag LOCUS_21630 5115 4258 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409413.1 protein_id gnl|my_center|LOCUS_21630 6113 5256 gene locus_tag LOCUS_21640 gene nadC 6113 5256 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389186.1 protein_id gnl|my_center|LOCUS_21640 7699 6110 gene locus_tag LOCUS_21650 7699 6110 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085328.1 protein_id gnl|my_center|LOCUS_21650 8764 7706 gene locus_tag LOCUS_21660 gene nadA 8764 7706 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391193.1 protein_id gnl|my_center|LOCUS_21660 8983 10191 gene locus_tag LOCUS_21670 8983 10191 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230672.1 protein_id gnl|my_center|LOCUS_21670 11148 10195 gene locus_tag LOCUS_21680 11148 10195 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974905.1 protein_id gnl|my_center|LOCUS_21680 11672 11148 gene locus_tag LOCUS_21690 11672 11148 CDS product tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971361.1 protein_id gnl|my_center|LOCUS_21690 12323 11730 gene locus_tag LOCUS_21700 12323 11730 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265716.1 protein_id gnl|my_center|LOCUS_21700 12553 13416 gene locus_tag LOCUS_21710 12553 13416 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_21710 14606 13485 gene locus_tag LOCUS_21720 14606 13485 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 protein_id gnl|my_center|LOCUS_21720 14666 15334 gene locus_tag LOCUS_21730 gene queE 14666 15334 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810901.1 protein_id gnl|my_center|LOCUS_21730 16883 15351 gene locus_tag LOCUS_21740 16883 15351 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_21740 17582 16992 gene locus_tag LOCUS_21750 17582 16992 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534715.1 protein_id gnl|my_center|LOCUS_21750 18628 17843 gene locus_tag LOCUS_21760 18628 17843 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence074 487 170 gene locus_tag LOCUS_21770 487 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 1043 567 gene locus_tag LOCUS_21780 1043 567 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919458.1 protein_id gnl|my_center|LOCUS_21780 1553 1044 gene locus_tag LOCUS_21790 gene coaD 1553 1044 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720119.1 protein_id gnl|my_center|LOCUS_21790 4360 1568 gene locus_tag LOCUS_21800 gene gyrA 4360 1568 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087464.1 protein_id gnl|my_center|LOCUS_21800 5087 4323 gene locus_tag LOCUS_21810 5087 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 5544 5092 gene locus_tag LOCUS_21820 5544 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 7885 5849 gene locus_tag LOCUS_21830 7885 5849 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_21830 8225 10354 gene locus_tag LOCUS_21840 8225 10354 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918820.1 protein_id gnl|my_center|LOCUS_21840 11604 10471 gene locus_tag LOCUS_21850 11604 10471 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087276.1 protein_id gnl|my_center|LOCUS_21850 11813 12439 gene locus_tag LOCUS_21860 11813 12439 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_21860 13408 12560 gene locus_tag LOCUS_21870 13408 12560 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387901.1 protein_id gnl|my_center|LOCUS_21870 13541 14488 gene locus_tag LOCUS_21880 13541 14488 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038808.1 protein_id gnl|my_center|LOCUS_21880 14620 16755 gene locus_tag LOCUS_21890 14620 16755 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173315.1 protein_id gnl|my_center|LOCUS_21890 16862 18352 gene locus_tag LOCUS_21900 16862 18352 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence075 3670 2849 gene locus_tag LOCUS_21910 3670 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 4098 3667 gene locus_tag LOCUS_21920 4098 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 5148 4108 gene locus_tag LOCUS_21930 gene fliM 5148 4108 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640397.1 protein_id gnl|my_center|LOCUS_21930 5696 5163 gene locus_tag LOCUS_21940 5696 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 5910 6656 gene locus_tag LOCUS_21950 gene flgF 5910 6656 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088570.1 protein_id gnl|my_center|LOCUS_21950 6669 7451 gene locus_tag LOCUS_21960 gene flgG 6669 7451 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390470.1 protein_id gnl|my_center|LOCUS_21960 7460 7954 gene locus_tag LOCUS_21970 7460 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 7982 8731 gene locus_tag LOCUS_21980 gene flgH 7982 8731 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088573.1 protein_id gnl|my_center|LOCUS_21980 9288 8872 gene locus_tag LOCUS_21990 gene dksA 9288 8872 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920436.1 protein_id gnl|my_center|LOCUS_21990 9827 9396 gene locus_tag LOCUS_22000 9827 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 10364 9885 gene locus_tag LOCUS_22010 gene rlmH 10364 9885 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383438.1 protein_id gnl|my_center|LOCUS_22010 10907 10368 gene locus_tag LOCUS_22020 10907 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 11538 10912 gene locus_tag LOCUS_22030 11538 10912 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561934.1 protein_id gnl|my_center|LOCUS_22030 12778 11519 gene locus_tag LOCUS_22040 12778 11519 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529069.1 protein_id gnl|my_center|LOCUS_22040 13908 12775 gene locus_tag LOCUS_22050 gene proB 13908 12775 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972562.1 protein_id gnl|my_center|LOCUS_22050 15068 13905 gene locus_tag LOCUS_22060 gene obgE 15068 13905 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529067.1 protein_id gnl|my_center|LOCUS_22060 15644 15078 gene locus_tag LOCUS_22070 15644 15078 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531224.1 protein_id gnl|my_center|LOCUS_22070 16021 15743 gene locus_tag LOCUS_22080 gene rpmA 16021 15743 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383240.1 protein_id gnl|my_center|LOCUS_22080 16404 16093 gene locus_tag LOCUS_22090 gene rplU 16404 16093 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003516451.1 protein_id gnl|my_center|LOCUS_22090 16571 17260 gene locus_tag LOCUS_22100 16571 17260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 17345 17962 gene locus_tag LOCUS_22110 17345 17962 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067461.1 protein_id gnl|my_center|LOCUS_22110 18579 18247 gene locus_tag LOCUS_22120 gene grxD 18579 18247 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971914.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence076 653 1411 gene locus_tag LOCUS_22130 653 1411 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970595.1 protein_id gnl|my_center|LOCUS_22130 1634 2245 gene locus_tag LOCUS_22140 1634 2245 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534106.1 protein_id gnl|my_center|LOCUS_22140 2326 2649 gene locus_tag LOCUS_22150 2326 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 2902 3795 gene locus_tag LOCUS_22160 2902 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 3798 4139 gene locus_tag LOCUS_22170 3798 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 4141 4473 gene locus_tag LOCUS_22180 4141 4473 CDS product type IV secretion system protein VirB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970879.1 protein_id gnl|my_center|LOCUS_22180 4463 6853 gene locus_tag LOCUS_22190 4463 6853 CDS product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970878.1 protein_id gnl|my_center|LOCUS_22190 6865 7578 gene locus_tag LOCUS_22200 6865 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 7575 7931 gene locus_tag LOCUS_22210 7575 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 7940 8863 gene locus_tag LOCUS_22220 7940 8863 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974917.1 protein_id gnl|my_center|LOCUS_22220 8864 9028 gene locus_tag LOCUS_22230 8864 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 9038 9730 gene locus_tag LOCUS_22240 9038 9730 CDS product type IV secretion system protein VirB8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533337.1 protein_id gnl|my_center|LOCUS_22240 9727 10680 gene locus_tag LOCUS_22250 gene virB9 9727 10680 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970873.1 protein_id gnl|my_center|LOCUS_22250 11208 11843 gene locus_tag LOCUS_22260 11208 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 11833 12873 gene locus_tag LOCUS_22270 gene virB11 11833 12873 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970871.1 protein_id gnl|my_center|LOCUS_22270 12877 14721 gene locus_tag LOCUS_22280 12877 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 14718 15662 gene locus_tag LOCUS_22290 14718 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 15684 15908 gene locus_tag LOCUS_22300 15684 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 15925 16305 gene locus_tag LOCUS_22310 15925 16305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence077 918 1946 gene locus_tag LOCUS_22320 918 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2511 3473 gene locus_tag LOCUS_22330 2511 3473 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202065485.1 protein_id gnl|my_center|LOCUS_22330 3726 3896 gene locus_tag LOCUS_22340 3726 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 4873 4187 gene locus_tag LOCUS_22350 4873 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 6534 4870 gene locus_tag LOCUS_22360 6534 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 7555 6521 gene locus_tag LOCUS_22370 7555 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 9903 7552 gene locus_tag LOCUS_22380 9903 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 10811 9900 gene locus_tag LOCUS_22390 10811 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 10732 10929 gene locus_tag LOCUS_22400 10732 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 11295 10903 gene locus_tag LOCUS_22410 11295 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 11506 12726 gene locus_tag LOCUS_22420 11506 12726 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 protein_id gnl|my_center|LOCUS_22420 12723 13649 gene locus_tag LOCUS_22430 12723 13649 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_22430 13646 14635 gene locus_tag LOCUS_22440 13646 14635 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_22440 14787 15179 gene locus_tag LOCUS_22450 14787 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 15837 15292 gene locus_tag LOCUS_22460 15837 15292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 16566 16003 gene locus_tag LOCUS_22470 16566 16003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 16978 16754 gene locus_tag LOCUS_22480 16978 16754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 18521 17802 gene locus_tag LOCUS_22490 18521 17802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence078 <1 555 gene locus_tag LOCUS_22500 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393616.1:phosphoglycerate kinase 555 1580 gene locus_tag LOCUS_22510 555 1580 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_22510 1577 2197 gene locus_tag LOCUS_22520 gene thiE 1577 2197 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388835.1 protein_id gnl|my_center|LOCUS_22520 2374 2940 gene locus_tag LOCUS_22530 gene efp 2374 2940 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529127.1 protein_id gnl|my_center|LOCUS_22530 2950 3771 gene locus_tag LOCUS_22540 2950 3771 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329745.1 protein_id gnl|my_center|LOCUS_22540 3827 4714 gene locus_tag LOCUS_22550 3827 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 5944 4715 gene locus_tag LOCUS_22560 5944 4715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192776.1 protein_id gnl|my_center|LOCUS_22560 6664 6035 gene locus_tag LOCUS_22570 6664 6035 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_22570 7397 6696 gene locus_tag LOCUS_22580 7397 6696 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 protein_id gnl|my_center|LOCUS_22580 8072 7455 gene locus_tag LOCUS_22590 8072 7455 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_22590 9485 8208 gene locus_tag LOCUS_22600 9485 8208 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252323.1 protein_id gnl|my_center|LOCUS_22600 10570 9485 gene locus_tag LOCUS_22610 10570 9485 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_22610 10706 11590 gene locus_tag LOCUS_22620 10706 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 12133 11669 gene locus_tag LOCUS_22630 12133 11669 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918221.1 protein_id gnl|my_center|LOCUS_22630 13466 12183 gene locus_tag LOCUS_22640 13466 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 13975 13628 gene locus_tag LOCUS_22650 13975 13628 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087690.1 protein_id gnl|my_center|LOCUS_22650 14712 14284 gene locus_tag LOCUS_22660 14712 14284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 15470 14769 gene locus_tag LOCUS_22670 gene trmD 15470 14769 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083317.1 protein_id gnl|my_center|LOCUS_22670 15931 15467 gene locus_tag LOCUS_22680 15931 15467 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 protein_id gnl|my_center|LOCUS_22680 16467 15928 gene locus_tag LOCUS_22690 gene rimM 16467 15928 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528858.1 protein_id gnl|my_center|LOCUS_22690 16835 16479 gene locus_tag LOCUS_22700 16835 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 18357 16927 gene locus_tag LOCUS_22710 gene ffh 18357 16927 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528802.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence079 1563 268 gene locus_tag LOCUS_22720 1563 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2475 1612 gene locus_tag LOCUS_22730 2475 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3385 2489 gene locus_tag LOCUS_22740 3385 2489 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071741117.1 protein_id gnl|my_center|LOCUS_22740 4148 3390 gene locus_tag LOCUS_22750 4148 3390 CDS product CmcI family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987003.1 protein_id gnl|my_center|LOCUS_22750 4708 4151 gene locus_tag LOCUS_22760 gene rfbC 4708 4151 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613584.1 protein_id gnl|my_center|LOCUS_22760 5937 4708 gene locus_tag LOCUS_22770 5937 4708 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909598.1 protein_id gnl|my_center|LOCUS_22770 6129 7205 gene locus_tag LOCUS_22780 6129 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 8298 7174 gene locus_tag LOCUS_22790 8298 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 11122 8513 gene locus_tag LOCUS_22800 11122 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 11931 13034 gene locus_tag LOCUS_22810 11931 13034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 13267 14109 gene locus_tag LOCUS_22820 13267 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 14102 14737 gene locus_tag LOCUS_22830 14102 14737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 14749 16599 gene locus_tag LOCUS_22840 14749 16599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 16769 18442 gene locus_tag LOCUS_22850 16769 18442 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 protein_id gnl|my_center|LOCUS_22850 18461 18386 gene locus_tag LOCUS_t00210 18461 18386 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence080 1293 559 gene locus_tag LOCUS_22860 1293 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2506 1352 gene locus_tag LOCUS_22870 2506 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3785 2565 gene locus_tag LOCUS_22880 3785 2565 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_22880 3982 3758 gene locus_tag LOCUS_22890 3982 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 3890 5218 gene locus_tag LOCUS_22900 3890 5218 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082804.1 protein_id gnl|my_center|LOCUS_22900 5354 7099 gene locus_tag LOCUS_22910 5354 7099 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_22910 9066 7276 gene locus_tag LOCUS_22920 9066 7276 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207316.1 protein_id gnl|my_center|LOCUS_22920 9159 9635 gene locus_tag LOCUS_22930 9159 9635 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536762.1 protein_id gnl|my_center|LOCUS_22930 10962 9688 gene locus_tag LOCUS_22940 10962 9688 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921028.1 protein_id gnl|my_center|LOCUS_22940 12463 10988 gene locus_tag LOCUS_22950 12463 10988 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_22950 12664 13935 gene locus_tag LOCUS_22960 12664 13935 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083910.1 protein_id gnl|my_center|LOCUS_22960 13971 14723 gene locus_tag LOCUS_22970 gene phoU 13971 14723 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918182.1 protein_id gnl|my_center|LOCUS_22970 14726 15436 gene locus_tag LOCUS_22980 gene phoB 14726 15436 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_22980 15601 16521 gene locus_tag LOCUS_22990 15601 16521 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036777.1 protein_id gnl|my_center|LOCUS_22990 16978 16529 gene locus_tag LOCUS_23000 gene gcrA 16978 16529 CDS product cell cycle sigma 70 cofactor GcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265783.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence081 <1 1015 gene locus_tag LOCUS_23010 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921045.1:DNA polymerase Y family protein 1012 4284 gene locus_tag LOCUS_23020 1012 4284 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537424.1 protein_id gnl|my_center|LOCUS_23020 7074 4384 gene locus_tag LOCUS_23030 7074 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 7603 7379 gene locus_tag LOCUS_23040 7603 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 7523 8446 gene locus_tag LOCUS_23050 7523 8446 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079950.1 protein_id gnl|my_center|LOCUS_23050 9284 8835 gene locus_tag LOCUS_23060 9284 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 10804 9554 gene locus_tag LOCUS_23070 10804 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 11098 10883 gene locus_tag LOCUS_23080 11098 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 11265 11189 gene locus_tag LOCUS_t00220 11265 11189 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11676 12956 gene locus_tag LOCUS_23090 11676 12956 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329028.1 protein_id gnl|my_center|LOCUS_23090 13067 13555 gene locus_tag LOCUS_23100 13067 13555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 13836 14519 gene locus_tag LOCUS_23110 13836 14519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 15859 14861 gene locus_tag LOCUS_23120 15859 14861 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 protein_id gnl|my_center|LOCUS_23120 16650 15856 gene locus_tag LOCUS_23130 16650 15856 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729564.1 protein_id gnl|my_center|LOCUS_23130 16805 16996 gene locus_tag LOCUS_23140 16805 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 17884 16895 gene locus_tag LOCUS_23150 17884 16895 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence082 1189 101 gene locus_tag LOCUS_23160 1189 101 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 protein_id gnl|my_center|LOCUS_23160 1745 2026 gene locus_tag LOCUS_23170 1745 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2361 2110 gene locus_tag LOCUS_23180 2361 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 3124 2585 gene locus_tag LOCUS_23190 3124 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 3445 3996 gene locus_tag LOCUS_23200 3445 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 4219 4013 gene locus_tag LOCUS_23210 4219 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 4112 4966 gene locus_tag LOCUS_23220 4112 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 6619 5699 gene locus_tag LOCUS_23230 6619 5699 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803754.1 protein_id gnl|my_center|LOCUS_23230 9790 6623 gene locus_tag LOCUS_23240 9790 6623 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_23240 11955 9793 gene locus_tag LOCUS_23250 11955 9793 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084409.1 protein_id gnl|my_center|LOCUS_23250 12530 11952 gene locus_tag LOCUS_23260 12530 11952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 13918 12527 gene locus_tag LOCUS_23270 13918 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 15240 13915 gene locus_tag LOCUS_23280 15240 13915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 16783 15230 gene locus_tag LOCUS_23290 16783 15230 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_23290 17275 16790 gene locus_tag LOCUS_23300 17275 16790 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770968.1 protein_id gnl|my_center|LOCUS_23300 17532 17272 gene locus_tag LOCUS_23310 17532 17272 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770970.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence083 250 681 gene locus_tag LOCUS_23320 250 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1323 1961 gene locus_tag LOCUS_23330 1323 1961 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974308.1 protein_id gnl|my_center|LOCUS_23330 2012 2608 gene locus_tag LOCUS_23340 2012 2608 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983963.1 protein_id gnl|my_center|LOCUS_23340 2656 3330 gene locus_tag LOCUS_23350 2656 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 3287 3745 gene locus_tag LOCUS_23360 3287 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 3995 4579 gene locus_tag LOCUS_23370 3995 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 4826 4536 gene locus_tag LOCUS_23380 4826 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 4710 5267 gene locus_tag LOCUS_23390 4710 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 6106 5363 gene locus_tag LOCUS_23400 6106 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 6597 6103 gene locus_tag LOCUS_23410 6597 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 6585 7082 gene locus_tag LOCUS_23420 6585 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 9220 7145 gene locus_tag LOCUS_23430 9220 7145 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122376.1 protein_id gnl|my_center|LOCUS_23430 9454 9242 gene locus_tag LOCUS_23440 9454 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 9976 10389 gene locus_tag LOCUS_23450 9976 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 10392 11303 gene locus_tag LOCUS_23460 10392 11303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 11846 14617 gene locus_tag LOCUS_23470 gene mobF 11846 14617 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_23470 14693 14956 gene locus_tag LOCUS_23480 14693 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 15497 15063 gene locus_tag LOCUS_23490 15497 15063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 16044 15643 gene locus_tag LOCUS_23500 16044 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 16379 16041 gene locus_tag LOCUS_23510 16379 16041 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703181.1 protein_id gnl|my_center|LOCUS_23510 17613 16438 gene locus_tag LOCUS_23520 17613 16438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence084 245 318 gene locus_tag LOCUS_t00230 245 318 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 484 1710 gene locus_tag LOCUS_23530 484 1710 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_23530 1703 2557 gene locus_tag LOCUS_23540 1703 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2727 2900 gene locus_tag LOCUS_23550 2727 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 3373 3735 gene locus_tag LOCUS_23560 3373 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 3735 5582 gene locus_tag LOCUS_23570 3735 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 5582 8383 gene locus_tag LOCUS_23580 gene mobF 5582 8383 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_23580 8676 8867 gene locus_tag LOCUS_23590 8676 8867 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263390.1 protein_id gnl|my_center|LOCUS_23590 9016 12240 gene locus_tag LOCUS_23600 9016 12240 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_23600 12233 16354 gene locus_tag LOCUS_23610 12233 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 16351 17817 gene locus_tag LOCUS_23620 16351 17817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence085 403 3090 gene locus_tag LOCUS_23630 gene topA 403 3090 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920309.1 protein_id gnl|my_center|LOCUS_23630 3092 5332 gene locus_tag LOCUS_23640 gene rnr 3092 5332 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338736.1 protein_id gnl|my_center|LOCUS_23640 5381 6079 gene locus_tag LOCUS_23650 5381 6079 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265812.1 protein_id gnl|my_center|LOCUS_23650 6076 7215 gene locus_tag LOCUS_23660 6076 7215 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162688197.1 protein_id gnl|my_center|LOCUS_23660 7405 7647 gene locus_tag LOCUS_23670 7405 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 7785 8078 gene locus_tag LOCUS_23680 7785 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 9035 8136 gene locus_tag LOCUS_23690 9035 8136 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890781.1 protein_id gnl|my_center|LOCUS_23690 9940 9035 gene locus_tag LOCUS_23700 9940 9035 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_23700 10562 12190 gene locus_tag LOCUS_23710 10562 12190 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_23710 12187 13125 gene locus_tag LOCUS_23720 12187 13125 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_23720 13198 14865 gene locus_tag LOCUS_23730 13198 14865 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729741.1 protein_id gnl|my_center|LOCUS_23730 15787 14852 gene locus_tag LOCUS_23740 15787 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 16078 15863 gene locus_tag LOCUS_23750 16078 15863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 17703 16234 gene locus_tag LOCUS_23760 17703 16234 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921167.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence086 2065 2382 gene locus_tag LOCUS_23770 2065 2382 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859020.1 protein_id gnl|my_center|LOCUS_23770 3274 2447 gene locus_tag LOCUS_23780 3274 2447 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 protein_id gnl|my_center|LOCUS_23780 4041 3292 gene locus_tag LOCUS_23790 gene fabG 4041 3292 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172504.1 protein_id gnl|my_center|LOCUS_23790 4565 4041 gene locus_tag LOCUS_23800 4565 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 4989 4588 gene locus_tag LOCUS_23810 4989 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 5441 4986 gene locus_tag LOCUS_23820 5441 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 6605 5442 gene locus_tag LOCUS_23830 6605 5442 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878160.1 protein_id gnl|my_center|LOCUS_23830 6816 7541 gene locus_tag LOCUS_23840 6816 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 7569 8786 gene locus_tag LOCUS_23850 7569 8786 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533500.1 protein_id gnl|my_center|LOCUS_23850 9682 8783 gene locus_tag LOCUS_23860 9682 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 10895 9687 gene locus_tag LOCUS_23870 10895 9687 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533500.1 protein_id gnl|my_center|LOCUS_23870 11843 10920 gene locus_tag LOCUS_23880 11843 10920 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876826.1 protein_id gnl|my_center|LOCUS_23880 12428 11901 gene locus_tag LOCUS_23890 12428 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 12947 13906 gene locus_tag LOCUS_23900 12947 13906 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827760.1 protein_id gnl|my_center|LOCUS_23900 14031 14333 gene locus_tag LOCUS_23910 14031 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 14373 15140 gene locus_tag LOCUS_23920 14373 15140 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218136709.1 protein_id gnl|my_center|LOCUS_23920 15161 15904 gene locus_tag LOCUS_23930 15161 15904 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_23930 15904 16827 gene locus_tag LOCUS_23940 15904 16827 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557395.1 protein_id gnl|my_center|LOCUS_23940 17334 16996 gene locus_tag LOCUS_23950 17334 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence087 29 631 gene locus_tag LOCUS_23960 29 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 1910 684 gene locus_tag LOCUS_23970 1910 684 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_23970 2236 1907 gene locus_tag LOCUS_23980 2236 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2802 2239 gene locus_tag LOCUS_23990 2802 2239 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228982.1 protein_id gnl|my_center|LOCUS_23990 3203 2859 gene locus_tag LOCUS_24000 3203 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 3754 3918 gene locus_tag LOCUS_24010 3754 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 3958 4668 gene locus_tag LOCUS_24020 3958 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 4776 6170 gene locus_tag LOCUS_24030 4776 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 9168 6367 gene locus_tag LOCUS_24040 9168 6367 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280508.1 protein_id gnl|my_center|LOCUS_24040 9542 10225 gene locus_tag LOCUS_24050 9542 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 10300 10680 gene locus_tag LOCUS_24060 10300 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 10737 11189 gene locus_tag LOCUS_24070 10737 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24070 11204 11578 gene locus_tag LOCUS_24080 11204 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24080 11631 12149 gene locus_tag LOCUS_24090 11631 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 15305 12717 gene locus_tag LOCUS_24100 15305 12717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 16079 15321 gene locus_tag LOCUS_24110 16079 15321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 16534 16079 gene locus_tag LOCUS_24120 16534 16079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 16885 16958 gene locus_tag LOCUS_t00240 16885 16958 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17081 17157 gene locus_tag LOCUS_t00250 17081 17157 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 17199 17393 gene locus_tag LOCUS_24130 17199 17393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence088 542 1168 gene locus_tag LOCUS_24140 542 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 2612 1455 gene locus_tag LOCUS_24150 2612 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 5667 5158 gene locus_tag LOCUS_24160 5667 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 7286 5988 gene locus_tag LOCUS_24170 7286 5988 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 protein_id gnl|my_center|LOCUS_24170 10506 7279 gene locus_tag LOCUS_24180 10506 7279 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385732.1 protein_id gnl|my_center|LOCUS_24180 11828 10503 gene locus_tag LOCUS_24190 11828 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202946090.1 protein_id gnl|my_center|LOCUS_24190 13551 11836 gene locus_tag LOCUS_24200 13551 11836 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_24200 15588 13567 gene locus_tag LOCUS_24210 15588 13567 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385729.1 protein_id gnl|my_center|LOCUS_24210 17074 15890 gene locus_tag LOCUS_24220 17074 15890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence089 659 1957 gene locus_tag LOCUS_24230 659 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 1954 2889 gene locus_tag LOCUS_24240 1954 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 4054 3128 gene locus_tag LOCUS_24250 4054 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 4168 4542 gene locus_tag LOCUS_24260 4168 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 4740 5648 gene locus_tag LOCUS_24270 4740 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 5636 7834 gene locus_tag LOCUS_24280 5636 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 8022 9107 gene locus_tag LOCUS_24290 8022 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 9539 9126 gene locus_tag LOCUS_24300 9539 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 10672 10307 gene locus_tag LOCUS_24310 10672 10307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 12483 10717 gene locus_tag LOCUS_24320 12483 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 13047 12703 gene locus_tag LOCUS_24330 13047 12703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 13259 13582 gene locus_tag LOCUS_24340 13259 13582 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092409793.1 protein_id gnl|my_center|LOCUS_24340 14788 13850 gene locus_tag LOCUS_24350 14788 13850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 15393 14788 gene locus_tag LOCUS_24360 15393 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 16256 15486 gene locus_tag LOCUS_24370 16256 15486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 16798 16565 gene locus_tag LOCUS_24380 16798 16565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 <17486 16881 gene locus_tag LOCUS_24390 <17486 16881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974303.1:plasmid partitioning protein RepB C-terminal domain-containing protein >Feature sequence090 490 1086 gene locus_tag LOCUS_24400 490 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1842 1156 gene locus_tag LOCUS_24410 1842 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2813 1845 gene locus_tag LOCUS_24420 2813 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 3283 2837 gene locus_tag LOCUS_24430 3283 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 5505 3448 gene locus_tag LOCUS_24440 gene vgrG1b 5505 3448 CDS product type VI secretion system spike protein VgrG1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 protein_id gnl|my_center|LOCUS_24440 8235 5566 gene locus_tag LOCUS_24450 gene tssH 8235 5566 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269330.1 protein_id gnl|my_center|LOCUS_24450 9359 8292 gene locus_tag LOCUS_24460 gene tssG 9359 8292 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269329.1 protein_id gnl|my_center|LOCUS_24460 11194 9323 gene locus_tag LOCUS_24470 gene tssF 11194 9323 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343627.1 protein_id gnl|my_center|LOCUS_24470 11662 11198 gene locus_tag LOCUS_24480 11662 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 13113 11746 gene locus_tag LOCUS_24490 13113 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 13828 13103 gene locus_tag LOCUS_24500 gene tagJ 13828 13103 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 protein_id gnl|my_center|LOCUS_24500 14311 13835 gene locus_tag LOCUS_24510 14311 13835 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312802.1 protein_id gnl|my_center|LOCUS_24510 15704 14388 gene locus_tag LOCUS_24520 gene tssC 15704 14388 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343625.1 protein_id gnl|my_center|LOCUS_24520 15612 15863 gene locus_tag LOCUS_24530 15612 15863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 16402 15878 gene locus_tag LOCUS_24540 gene tssB 16402 15878 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318241.1 protein_id gnl|my_center|LOCUS_24540 17110 16496 gene locus_tag LOCUS_24550 17110 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence091 <1 1215 gene locus_tag LOCUS_24560 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530092.1:sigma-54-dependent Fis family transcriptional regulator 2293 2218 gene locus_tag LOCUS_t00260 2293 2218 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3518 2364 gene locus_tag LOCUS_24570 gene rodA 3518 2364 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719488.1 protein_id gnl|my_center|LOCUS_24570 5404 3515 gene locus_tag LOCUS_24580 gene mrdA 5404 3515 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_24580 5925 5404 gene locus_tag LOCUS_24590 5925 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 7209 5932 gene locus_tag LOCUS_24600 7209 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 8303 7260 gene locus_tag LOCUS_24610 8303 7260 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625945.1 protein_id gnl|my_center|LOCUS_24610 9937 8363 gene locus_tag LOCUS_24620 9937 8363 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919415.1 protein_id gnl|my_center|LOCUS_24620 10533 12260 gene locus_tag LOCUS_24630 10533 12260 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936411.1 protein_id gnl|my_center|LOCUS_24630 12275 13588 gene locus_tag LOCUS_24640 12275 13588 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401361.1 protein_id gnl|my_center|LOCUS_24640 14824 13619 gene locus_tag LOCUS_24650 gene purT 14824 13619 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186479.1 protein_id gnl|my_center|LOCUS_24650 15959 14943 gene locus_tag LOCUS_24660 gene ilvC 15959 14943 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089237.1 protein_id gnl|my_center|LOCUS_24660 16615 16100 gene locus_tag LOCUS_24670 gene ilvN 16615 16100 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719784.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence092 523 89 gene locus_tag LOCUS_24680 523 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 1845 829 gene locus_tag LOCUS_24690 1845 829 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440682.1 protein_id gnl|my_center|LOCUS_24690 2636 1971 gene locus_tag LOCUS_24700 2636 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 3338 2949 gene locus_tag LOCUS_24710 3338 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 6293 5055 gene locus_tag LOCUS_24720 gene dncV 6293 5055 CDS product cyclic AMP-GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001901330.1 protein_id gnl|my_center|LOCUS_24720 7304 6621 gene locus_tag LOCUS_24730 7304 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 8506 7385 gene locus_tag LOCUS_24740 8506 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 9598 8546 gene locus_tag LOCUS_24750 9598 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 10018 11133 gene locus_tag LOCUS_24760 10018 11133 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_24760 12382 11357 gene locus_tag LOCUS_24770 12382 11357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 13627 12440 gene locus_tag LOCUS_24780 gene sopA 13627 12440 CDS product plasmid-partitioning protein SopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087133.1 protein_id gnl|my_center|LOCUS_24780 14299 15651 gene locus_tag LOCUS_24790 14299 15651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 15928 16227 gene locus_tag LOCUS_24800 15928 16227 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068504438.1 protein_id gnl|my_center|LOCUS_24800 16231 16608 gene locus_tag LOCUS_24810 16231 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 16810 16583 gene locus_tag LOCUS_24820 16810 16583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence093 909 142 gene locus_tag LOCUS_24830 909 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 297 306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2386 1007 gene locus_tag LOCUS_24840 2386 1007 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029495.1 protein_id gnl|my_center|LOCUS_24840 2815 4590 gene locus_tag LOCUS_24850 2815 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 4900 4824 gene locus_tag LOCUS_t00270 4900 4824 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6172 5096 gene locus_tag LOCUS_24860 6172 5096 CDS product DUF2817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533436.1 protein_id gnl|my_center|LOCUS_24860 7020 6169 gene locus_tag LOCUS_24870 7020 6169 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266006.1 protein_id gnl|my_center|LOCUS_24870 7853 7017 gene locus_tag LOCUS_24880 7853 7017 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528736.1 protein_id gnl|my_center|LOCUS_24880 8469 7819 gene locus_tag LOCUS_24890 gene rsmG 8469 7819 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923358.1 protein_id gnl|my_center|LOCUS_24890 10370 8469 gene locus_tag LOCUS_24900 gene mnmG 10370 8469 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083460.1 protein_id gnl|my_center|LOCUS_24900 11825 10458 gene locus_tag LOCUS_24910 gene mnmE 11825 10458 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391371.1 protein_id gnl|my_center|LOCUS_24910 12051 11782 gene locus_tag LOCUS_24920 12051 11782 CDS product DUF6489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391370.1 protein_id gnl|my_center|LOCUS_24920 12141 14225 gene locus_tag LOCUS_24930 12141 14225 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_24930 14313 15011 gene locus_tag LOCUS_24940 14313 15011 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_24940 16236 15004 gene locus_tag LOCUS_24950 16236 15004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence094 802 1812 gene locus_tag LOCUS_24960 802 1812 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_24960 1812 2393 gene locus_tag LOCUS_24970 gene rsmD 1812 2393 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090226.1 protein_id gnl|my_center|LOCUS_24970 3595 2399 gene locus_tag LOCUS_24980 3595 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 5430 3655 gene locus_tag LOCUS_24990 gene mutL 5430 3655 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537966.1 protein_id gnl|my_center|LOCUS_24990 6060 5695 gene locus_tag LOCUS_25000 6060 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 6292 7272 gene locus_tag LOCUS_25010 6292 7272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_25010 7269 8003 gene locus_tag LOCUS_25020 7269 8003 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_25020 8007 9896 gene locus_tag LOCUS_25030 8007 9896 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_25030 9908 10984 gene locus_tag LOCUS_25040 9908 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 11025 12077 gene locus_tag LOCUS_25050 11025 12077 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640051.1 protein_id gnl|my_center|LOCUS_25050 12336 15674 gene locus_tag LOCUS_25060 gene carB 12336 15674 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090112.1 protein_id gnl|my_center|LOCUS_25060 16175 15684 gene locus_tag LOCUS_25070 16175 15684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 16255 16476 gene locus_tag LOCUS_25080 16255 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence095 1095 1 gene locus_tag LOCUS_25090 gene hisC 1095 1 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529387.1 protein_id gnl|my_center|LOCUS_25090 1952 1092 gene locus_tag LOCUS_25100 1952 1092 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_25100 2633 2346 gene locus_tag LOCUS_25110 2633 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 3554 2844 gene locus_tag LOCUS_25120 3554 2844 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083053.1 protein_id gnl|my_center|LOCUS_25120 3641 4396 gene locus_tag LOCUS_25130 gene gloB 3641 4396 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240047.1 protein_id gnl|my_center|LOCUS_25130 5008 4403 gene locus_tag LOCUS_25140 5008 4403 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819076.1 protein_id gnl|my_center|LOCUS_25140 5411 5202 gene locus_tag LOCUS_25150 5411 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 5537 5959 gene locus_tag LOCUS_25160 5537 5959 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919492.1 protein_id gnl|my_center|LOCUS_25160 6591 5956 gene locus_tag LOCUS_25170 6591 5956 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316615.1 protein_id gnl|my_center|LOCUS_25170 6671 7330 gene locus_tag LOCUS_25180 6671 7330 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_25180 9946 7391 gene locus_tag LOCUS_25190 gene rpoD 9946 7391 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976352.1 protein_id gnl|my_center|LOCUS_25190 11945 10071 gene locus_tag LOCUS_25200 gene dnaG 11945 10071 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530148.1 protein_id gnl|my_center|LOCUS_25200 12597 12064 gene locus_tag LOCUS_25210 12597 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 13063 12599 gene locus_tag LOCUS_25220 13063 12599 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383803.1 protein_id gnl|my_center|LOCUS_25220 13210 14388 gene locus_tag LOCUS_25230 gene carA 13210 14388 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530125.1 protein_id gnl|my_center|LOCUS_25230 15271 14411 gene locus_tag LOCUS_25240 gene fabI 15271 14411 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067646.1 protein_id gnl|my_center|LOCUS_25240 <16523 15347 gene locus_tag LOCUS_25250 <16523 15347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083592.1:beta-ketoacyl-ACP synthase I >Feature sequence096 270 1004 gene locus_tag LOCUS_25260 270 1004 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339467.1 protein_id gnl|my_center|LOCUS_25260 1362 2774 gene locus_tag LOCUS_25270 1362 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 3672 2809 gene locus_tag LOCUS_25280 3672 2809 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_25280 4732 4172 gene locus_tag LOCUS_25290 4732 4172 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439348.1 protein_id gnl|my_center|LOCUS_25290 5106 6119 gene locus_tag LOCUS_25300 5106 6119 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 protein_id gnl|my_center|LOCUS_25300 7745 6246 gene locus_tag LOCUS_25310 7745 6246 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082963.1 protein_id gnl|my_center|LOCUS_25310 10011 8128 gene locus_tag LOCUS_25320 10011 8128 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_25320 10395 11741 gene locus_tag LOCUS_25330 10395 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 12163 13842 gene locus_tag LOCUS_25340 12163 13842 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532968.1 protein_id gnl|my_center|LOCUS_25340 14024 16141 gene locus_tag LOCUS_25350 14024 16141 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence097 <1 733 gene locus_tag LOCUS_25360 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000169624.1:GDP-mannose 4,6-dehydratase 730 1671 gene locus_tag LOCUS_25370 730 1671 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937401.1 protein_id gnl|my_center|LOCUS_25370 1668 2477 gene locus_tag LOCUS_25380 1668 2477 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143776.1 protein_id gnl|my_center|LOCUS_25380 2527 2958 gene locus_tag LOCUS_25390 2527 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 3077 4093 gene locus_tag LOCUS_25400 3077 4093 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_25400 4365 5567 gene locus_tag LOCUS_25410 4365 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 5677 6450 gene locus_tag LOCUS_25420 5677 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 7320 8648 gene locus_tag LOCUS_25430 7320 8648 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122761.1 protein_id gnl|my_center|LOCUS_25430 8638 9432 gene locus_tag LOCUS_25440 8638 9432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 9483 10424 gene locus_tag LOCUS_25450 9483 10424 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_25450 10424 11830 gene locus_tag LOCUS_25460 10424 11830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 11850 13022 gene locus_tag LOCUS_25470 11850 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 13034 13960 gene locus_tag LOCUS_25480 13034 13960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 14102 15253 gene locus_tag LOCUS_25490 14102 15253 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 protein_id gnl|my_center|LOCUS_25490 16021 15278 gene locus_tag LOCUS_25500 16021 15278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence098 1183 458 gene locus_tag LOCUS_25510 1183 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2112 1216 gene locus_tag LOCUS_25520 2112 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2612 2112 gene locus_tag LOCUS_25530 2612 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 3085 2609 gene locus_tag LOCUS_25540 3085 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 4005 3082 gene locus_tag LOCUS_25550 4005 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 4164 4517 gene locus_tag LOCUS_25560 4164 4517 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082902.1 protein_id gnl|my_center|LOCUS_25560 4514 5035 gene locus_tag LOCUS_25570 4514 5035 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082901.1 protein_id gnl|my_center|LOCUS_25570 5053 6465 gene locus_tag LOCUS_25580 5053 6465 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082900.1 protein_id gnl|my_center|LOCUS_25580 6542 8506 gene locus_tag LOCUS_25590 6542 8506 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047326435.1 protein_id gnl|my_center|LOCUS_25590 8509 10392 gene locus_tag LOCUS_25600 8509 10392 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102967.1 protein_id gnl|my_center|LOCUS_25600 10389 11756 gene locus_tag LOCUS_25610 10389 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223839770.1 protein_id gnl|my_center|LOCUS_25610 11801 12724 gene locus_tag LOCUS_25620 11801 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 12736 13797 gene locus_tag LOCUS_25630 12736 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 14936 13875 gene locus_tag LOCUS_25640 14936 13875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626133.1 protein_id gnl|my_center|LOCUS_25640 <16138 14943 gene locus_tag LOCUS_25650 <16138 14943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403128.1:ATP-binding protein >Feature sequence099 140 1504 gene locus_tag LOCUS_25660 140 1504 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057361.1 protein_id gnl|my_center|LOCUS_25660 2085 2630 gene locus_tag LOCUS_25670 2085 2630 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722321.1 protein_id gnl|my_center|LOCUS_25670 2735 3949 gene locus_tag LOCUS_25680 2735 3949 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539575.1 protein_id gnl|my_center|LOCUS_25680 3984 5018 gene locus_tag LOCUS_25690 gene tdh 3984 5018 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646007.1 protein_id gnl|my_center|LOCUS_25690 7048 5153 gene locus_tag LOCUS_25700 7048 5153 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477696.1 protein_id gnl|my_center|LOCUS_25700 7737 7171 gene locus_tag LOCUS_25710 7737 7171 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705937.1 protein_id gnl|my_center|LOCUS_25710 8092 8988 gene locus_tag LOCUS_25720 8092 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 11219 9282 gene locus_tag LOCUS_25730 gene acs 11219 9282 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174953.1 protein_id gnl|my_center|LOCUS_25730 11654 12256 gene locus_tag LOCUS_25740 11654 12256 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705131.1 protein_id gnl|my_center|LOCUS_25740 15657 12292 gene locus_tag LOCUS_25750 15657 12292 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_25750 >Feature sequence100 1458 1189 gene locus_tag LOCUS_25760 1458 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2453 1896 gene locus_tag LOCUS_25770 2453 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3307 2885 gene locus_tag LOCUS_25780 3307 2885 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_25780 3558 3304 gene locus_tag LOCUS_25790 3558 3304 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101799467.1 protein_id gnl|my_center|LOCUS_25790 4364 4128 gene locus_tag LOCUS_25800 4364 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 4636 4824 gene locus_tag LOCUS_25810 4636 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 5699 5950 gene locus_tag LOCUS_25820 gene vapB 5699 5950 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517661.1 protein_id gnl|my_center|LOCUS_25820 5947 6366 gene locus_tag LOCUS_25830 5947 6366 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047368852.1 protein_id gnl|my_center|LOCUS_25830 6366 6734 gene locus_tag LOCUS_25840 6366 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 8104 7187 gene locus_tag LOCUS_25850 8104 7187 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_25850 8654 8094 gene locus_tag LOCUS_25860 8654 8094 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312796.1 protein_id gnl|my_center|LOCUS_25860 9565 9182 gene locus_tag LOCUS_25870 9565 9182 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971025.1 protein_id gnl|my_center|LOCUS_25870 9791 9555 gene locus_tag LOCUS_25880 9791 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 10689 10237 gene locus_tag LOCUS_25890 10689 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 10988 12031 gene locus_tag LOCUS_25900 10988 12031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 12536 13132 gene locus_tag LOCUS_25910 12536 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 14006 13680 gene locus_tag LOCUS_25920 14006 13680 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969960.1 protein_id gnl|my_center|LOCUS_25920 14361 13981 gene locus_tag LOCUS_25930 14361 13981 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969959.1 protein_id gnl|my_center|LOCUS_25930 15782 14862 gene locus_tag LOCUS_25940 15782 14862 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence101 2816 1653 gene locus_tag LOCUS_25950 2816 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 3228 2860 gene locus_tag LOCUS_25960 3228 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 4757 3279 gene locus_tag LOCUS_25970 4757 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 5789 5337 gene locus_tag LOCUS_25980 5789 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 6370 5822 gene locus_tag LOCUS_25990 6370 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 7233 6412 gene locus_tag LOCUS_26000 7233 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 7696 7223 gene locus_tag LOCUS_26010 7696 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 8908 7709 gene locus_tag LOCUS_26020 8908 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 9188 8979 gene locus_tag LOCUS_26030 9188 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 10027 10749 gene locus_tag LOCUS_26040 10027 10749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 10746 13622 gene locus_tag LOCUS_26050 10746 13622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 13626 14021 gene locus_tag LOCUS_26060 13626 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 14231 14635 gene locus_tag LOCUS_26070 14231 14635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26070 14571 15149 gene locus_tag LOCUS_26080 14571 15149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 <15893 15248 gene locus_tag LOCUS_26090 <15893 15248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000399648.1:IS110-like element IS621 family transposase >Feature sequence102 279 1304 gene locus_tag LOCUS_26100 279 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1658 1419 gene locus_tag LOCUS_26110 1658 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1887 1660 gene locus_tag LOCUS_26120 1887 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2359 2087 gene locus_tag LOCUS_26130 2359 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 3175 2909 gene locus_tag LOCUS_26140 3175 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 3567 4565 gene locus_tag LOCUS_26150 3567 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 5203 4874 gene locus_tag LOCUS_26160 5203 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 6814 6614 gene locus_tag LOCUS_26170 6814 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 7687 7520 gene locus_tag LOCUS_26180 7687 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 8122 9669 gene locus_tag LOCUS_26190 8122 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 11103 9712 gene locus_tag LOCUS_26200 11103 9712 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936324.1 protein_id gnl|my_center|LOCUS_26200 11514 11239 gene locus_tag LOCUS_26210 11514 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 11527 11760 gene locus_tag LOCUS_26220 11527 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 13730 12375 gene locus_tag LOCUS_26230 13730 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 14472 15677 gene locus_tag LOCUS_26240 14472 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence103 271 480 gene locus_tag LOCUS_26250 271 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 383 1057 gene locus_tag LOCUS_26260 383 1057 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128937095.1 protein_id gnl|my_center|LOCUS_26260 1278 1571 gene locus_tag LOCUS_26270 1278 1571 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490270.1 protein_id gnl|my_center|LOCUS_26270 1586 2776 gene locus_tag LOCUS_26280 1586 2776 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368640.1 protein_id gnl|my_center|LOCUS_26280 2773 3279 gene locus_tag LOCUS_26290 2773 3279 CDS product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 protein_id gnl|my_center|LOCUS_26290 3620 3366 gene locus_tag LOCUS_26300 3620 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 3860 4036 gene locus_tag LOCUS_26310 3860 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26310 4530 4318 gene locus_tag LOCUS_26320 4530 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 4616 5125 gene locus_tag LOCUS_26330 4616 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 5388 7151 gene locus_tag LOCUS_26340 5388 7151 CDS product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626034.1 protein_id gnl|my_center|LOCUS_26340 8593 7205 gene locus_tag LOCUS_26350 8593 7205 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088606.1 protein_id gnl|my_center|LOCUS_26350 8660 9385 gene locus_tag LOCUS_26360 8660 9385 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974790.1 protein_id gnl|my_center|LOCUS_26360 9769 10572 gene locus_tag LOCUS_26370 9769 10572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 10569 11336 gene locus_tag LOCUS_26380 10569 11336 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525296.1 protein_id gnl|my_center|LOCUS_26380 11466 12470 gene locus_tag LOCUS_26390 11466 12470 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_26390 13547 13215 gene locus_tag LOCUS_26400 13547 13215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26400 14287 13772 gene locus_tag LOCUS_26410 14287 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26410 15328 14357 gene locus_tag LOCUS_26420 15328 14357 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035566.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence104 4420 908 gene locus_tag LOCUS_26430 gene pglX 4420 908 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939304.1 protein_id gnl|my_center|LOCUS_26430 7941 4420 gene locus_tag LOCUS_26440 gene brxC 7941 4420 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 protein_id gnl|my_center|LOCUS_26440 8548 7946 gene locus_tag LOCUS_26450 8548 7946 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014819602.1 protein_id gnl|my_center|LOCUS_26450 9162 8545 gene locus_tag LOCUS_26460 9162 8545 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228220.1 protein_id gnl|my_center|LOCUS_26460 10034 9153 gene locus_tag LOCUS_26470 10034 9153 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 protein_id gnl|my_center|LOCUS_26470 10967 10446 gene locus_tag LOCUS_26480 10967 10446 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002730154.1 protein_id gnl|my_center|LOCUS_26480 11290 10967 gene locus_tag LOCUS_26490 11290 10967 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068504438.1 protein_id gnl|my_center|LOCUS_26490 15118 11336 gene locus_tag LOCUS_26500 15118 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 15493 15119 gene locus_tag LOCUS_26510 15493 15119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence105 1446 229 gene locus_tag LOCUS_26520 1446 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 1636 1382 gene locus_tag LOCUS_26530 1636 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 1563 2246 gene locus_tag LOCUS_26540 1563 2246 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391090.1 protein_id gnl|my_center|LOCUS_26540 2243 3067 gene locus_tag LOCUS_26550 gene dapD 2243 3067 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391226.1 protein_id gnl|my_center|LOCUS_26550 4824 3064 gene locus_tag LOCUS_26560 gene flmG 4824 3064 CDS product glycosyltransferase FlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919333.1 protein_id gnl|my_center|LOCUS_26560 4988 5413 gene locus_tag LOCUS_26570 gene flbT 4988 5413 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919334.1 protein_id gnl|my_center|LOCUS_26570 5373 5723 gene locus_tag LOCUS_26580 gene flaF 5373 5723 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919335.1 protein_id gnl|my_center|LOCUS_26580 5915 6625 gene locus_tag LOCUS_26590 5915 6625 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391054.1 protein_id gnl|my_center|LOCUS_26590 6760 7104 gene locus_tag LOCUS_26600 6760 7104 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531879.1 protein_id gnl|my_center|LOCUS_26600 7242 8282 gene locus_tag LOCUS_26610 7242 8282 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531877.1 protein_id gnl|my_center|LOCUS_26610 8303 8611 gene locus_tag LOCUS_26620 8303 8611 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088626.1 protein_id gnl|my_center|LOCUS_26620 8921 9553 gene locus_tag LOCUS_26630 8921 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 9592 10212 gene locus_tag LOCUS_26640 9592 10212 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921310.1 protein_id gnl|my_center|LOCUS_26640 10354 12351 gene locus_tag LOCUS_26650 10354 12351 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391431.1 protein_id gnl|my_center|LOCUS_26650 13050 12415 gene locus_tag LOCUS_26660 13050 12415 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920924.1 protein_id gnl|my_center|LOCUS_26660 13673 13065 gene locus_tag LOCUS_26670 13673 13065 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_26670 14963 13788 gene locus_tag LOCUS_26680 14963 13788 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_26680 15651 15043 gene locus_tag LOCUS_26690 15651 15043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence106 <1 565 gene locus_tag LOCUS_26700 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967214.1:alpha-hydroxy acid oxidase 1191 2051 gene locus_tag LOCUS_26710 1191 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26710 2009 2521 gene locus_tag LOCUS_26720 2009 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26720 2796 3668 gene locus_tag LOCUS_26730 2796 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 3956 3732 gene locus_tag LOCUS_26740 3956 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 6222 7232 gene locus_tag LOCUS_26750 6222 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 7552 7286 gene locus_tag LOCUS_26760 7552 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 7874 8050 gene locus_tag LOCUS_26770 7874 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 8047 9840 gene locus_tag LOCUS_26780 8047 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 9916 10545 gene locus_tag LOCUS_26790 9916 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 12840 10702 gene locus_tag LOCUS_26800 12840 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 13196 14110 gene locus_tag LOCUS_26810 13196 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 14855 15184 gene locus_tag LOCUS_26820 14855 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 15645 15181 gene locus_tag LOCUS_26830 15645 15181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence107 504 163 gene locus_tag LOCUS_26840 504 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 2479 866 gene locus_tag LOCUS_26850 2479 866 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122406836.1 protein_id gnl|my_center|LOCUS_26850 2881 2531 gene locus_tag LOCUS_26860 gene tnpB 2881 2531 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041414013.1 protein_id gnl|my_center|LOCUS_26860 3372 2878 gene locus_tag LOCUS_26870 3372 2878 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082866.1 protein_id gnl|my_center|LOCUS_26870 3923 4243 gene locus_tag LOCUS_26880 3923 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 5017 4313 gene locus_tag LOCUS_26890 5017 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 5455 5090 gene locus_tag LOCUS_26900 5455 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 6189 5638 gene locus_tag LOCUS_26910 6189 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087459406.1 protein_id gnl|my_center|LOCUS_26910 6725 6186 gene locus_tag LOCUS_26920 6725 6186 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252838.1 protein_id gnl|my_center|LOCUS_26920 7193 8578 gene locus_tag LOCUS_26930 7193 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 9140 8628 gene locus_tag LOCUS_26940 9140 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 9240 9623 gene locus_tag LOCUS_26950 9240 9623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 10002 10235 gene locus_tag LOCUS_26960 10002 10235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 10237 11529 gene locus_tag LOCUS_26970 10237 11529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 14988 12991 gene locus_tag LOCUS_26980 14988 12991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence108 <1 860 gene locus_tag LOCUS_26990 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000644533.1:zinc-binding dehydrogenase 857 1639 gene locus_tag LOCUS_27000 857 1639 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_27000 1766 3442 gene locus_tag LOCUS_27010 1766 3442 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877899.1 protein_id gnl|my_center|LOCUS_27010 3578 3760 gene locus_tag LOCUS_27020 3578 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 4272 3763 gene locus_tag LOCUS_27030 4272 3763 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966016.1 protein_id gnl|my_center|LOCUS_27030 4596 5432 gene locus_tag LOCUS_27040 4596 5432 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 protein_id gnl|my_center|LOCUS_27040 5481 5771 gene locus_tag LOCUS_27050 5481 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 6403 5768 gene locus_tag LOCUS_27060 6403 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 6530 7423 gene locus_tag LOCUS_27070 6530 7423 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730112.1 protein_id gnl|my_center|LOCUS_27070 8787 7492 gene locus_tag LOCUS_27080 8787 7492 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728246.1 protein_id gnl|my_center|LOCUS_27080 8981 9931 gene locus_tag LOCUS_27090 8981 9931 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827760.1 protein_id gnl|my_center|LOCUS_27090 9989 11263 gene locus_tag LOCUS_27100 9989 11263 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_27100 11293 12672 gene locus_tag LOCUS_27110 11293 12672 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211170.1 protein_id gnl|my_center|LOCUS_27110 12701 13252 gene locus_tag LOCUS_27120 12701 13252 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 protein_id gnl|my_center|LOCUS_27120 13338 14561 gene locus_tag LOCUS_27130 13338 14561 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533500.1 protein_id gnl|my_center|LOCUS_27130 15355 14618 gene locus_tag LOCUS_27140 15355 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence109 530 1063 gene locus_tag LOCUS_27150 530 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 1076 4264 gene locus_tag LOCUS_27160 1076 4264 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_27160 4270 4713 gene locus_tag LOCUS_27170 4270 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 4751 4915 gene locus_tag LOCUS_27180 4751 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 4923 5450 gene locus_tag LOCUS_27190 4923 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 5450 6220 gene locus_tag LOCUS_27200 5450 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 6804 6235 gene locus_tag LOCUS_27210 6804 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 7527 6853 gene locus_tag LOCUS_27220 7527 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 7879 7727 gene locus_tag LOCUS_27230 7879 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 10599 7921 gene locus_tag LOCUS_27240 gene mobF 10599 7921 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_27240 12530 10683 gene locus_tag LOCUS_27250 12530 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 12892 12530 gene locus_tag LOCUS_27260 12892 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 13555 13097 gene locus_tag LOCUS_27270 13555 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 13867 13664 gene locus_tag LOCUS_27280 13867 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 14749 13976 gene locus_tag LOCUS_27290 14749 13976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 <15367 14793 gene locus_tag LOCUS_27300 <15367 14793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973356.1:site-specific integrase >Feature sequence110 683 1864 gene locus_tag LOCUS_27310 683 1864 CDS product IS701 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151614010.1 protein_id gnl|my_center|LOCUS_27310 2033 2422 gene locus_tag LOCUS_27320 2033 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 3225 2452 gene locus_tag LOCUS_27330 gene bacC 3225 2452 CDS product dihydroanticapsin 7-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243359.1 protein_id gnl|my_center|LOCUS_27330 4025 3237 gene locus_tag LOCUS_27340 4025 3237 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198379.1 protein_id gnl|my_center|LOCUS_27340 4840 4028 gene locus_tag LOCUS_27350 4840 4028 CDS product molybdenum cofactor biosynthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554926.1 protein_id gnl|my_center|LOCUS_27350 4969 5997 gene locus_tag LOCUS_27360 4969 5997 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388784.1 protein_id gnl|my_center|LOCUS_27360 6143 6583 gene locus_tag LOCUS_27370 6143 6583 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971017.1 protein_id gnl|my_center|LOCUS_27370 6771 7379 gene locus_tag LOCUS_27380 6771 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 7808 7479 gene locus_tag LOCUS_27390 7808 7479 CDS product DOPA 4,5-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193180291.1 protein_id gnl|my_center|LOCUS_27390 8978 8151 gene locus_tag LOCUS_27400 8978 8151 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974527.1 protein_id gnl|my_center|LOCUS_27400 9105 10697 gene locus_tag LOCUS_27410 9105 10697 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529187.1 protein_id gnl|my_center|LOCUS_27410 10699 11451 gene locus_tag LOCUS_27420 10699 11451 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974528.1 protein_id gnl|my_center|LOCUS_27420 12187 12372 gene locus_tag LOCUS_27430 12187 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27430 12384 12794 gene locus_tag LOCUS_27440 12384 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27440 12968 14335 gene locus_tag LOCUS_27450 12968 14335 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531781.1 protein_id gnl|my_center|LOCUS_27450 14561 15001 gene locus_tag LOCUS_27460 14561 15001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence111 580 2964 gene locus_tag LOCUS_27470 580 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 3111 3368 gene locus_tag LOCUS_27480 3111 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 3649 4830 gene locus_tag LOCUS_27490 3649 4830 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974637.1 protein_id gnl|my_center|LOCUS_27490 5067 4837 gene locus_tag LOCUS_27500 5067 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 5974 5054 gene locus_tag LOCUS_27510 5974 5054 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568594.1 protein_id gnl|my_center|LOCUS_27510 6050 6274 gene locus_tag LOCUS_27520 6050 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 6271 7251 gene locus_tag LOCUS_27530 6271 7251 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525849.1 protein_id gnl|my_center|LOCUS_27530 8321 7785 gene locus_tag LOCUS_27540 8321 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 8638 8318 gene locus_tag LOCUS_27550 8638 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 8813 9124 gene locus_tag LOCUS_27560 8813 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 9117 9542 gene locus_tag LOCUS_27570 9117 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 9539 10003 gene locus_tag LOCUS_27580 9539 10003 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026616817.1 protein_id gnl|my_center|LOCUS_27580 10000 11373 gene locus_tag LOCUS_27590 10000 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 11421 13025 gene locus_tag LOCUS_27600 11421 13025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 13087 13713 gene locus_tag LOCUS_27610 13087 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 14089 14394 gene locus_tag LOCUS_27620 14089 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence112 210 1490 gene locus_tag LOCUS_27630 210 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 2036 2254 gene locus_tag LOCUS_27640 2036 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 2303 5161 gene locus_tag LOCUS_27650 2303 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 6795 5158 gene locus_tag LOCUS_27660 6795 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 7029 6805 gene locus_tag LOCUS_27670 7029 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 8037 8447 gene locus_tag LOCUS_27680 8037 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 8450 10480 gene locus_tag LOCUS_27690 8450 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 10485 13232 gene locus_tag LOCUS_27700 gene mobF 10485 13232 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_27700 13310 14251 gene locus_tag LOCUS_27710 13310 14251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 14908 14994 gene locus_tag LOCUS_t00280 14908 14994 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence113 1723 161 gene locus_tag LOCUS_27720 1723 161 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522161.1 protein_id gnl|my_center|LOCUS_27720 3176 2373 gene locus_tag LOCUS_27730 3176 2373 CDS product IS5-like element ISPssy family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923181.1 protein_id gnl|my_center|LOCUS_27730 6071 5601 gene locus_tag LOCUS_27740 6071 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27740 6392 6138 gene locus_tag LOCUS_27750 6392 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27750 8000 7026 gene locus_tag LOCUS_27760 8000 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 10565 8718 gene locus_tag LOCUS_27770 10565 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 12821 10578 gene locus_tag LOCUS_27780 12821 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 14081 13359 gene locus_tag LOCUS_27790 14081 13359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194135.1 protein_id gnl|my_center|LOCUS_27790 <15267 14143 gene locus_tag LOCUS_27800 <15267 14143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196469.1:capsular polysaccharide export inner-membrane protein, BexC/CtrB/KpsE family >Feature sequence114 130 1074 gene locus_tag LOCUS_27810 130 1074 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085438.1 protein_id gnl|my_center|LOCUS_27810 1098 1355 gene locus_tag LOCUS_27820 1098 1355 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003503059.1 protein_id gnl|my_center|LOCUS_27820 1404 2222 gene locus_tag LOCUS_27830 1404 2222 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_27830 2244 4160 gene locus_tag LOCUS_27840 gene dxs 2244 4160 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175335.1 protein_id gnl|my_center|LOCUS_27840 4157 4906 gene locus_tag LOCUS_27850 4157 4906 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532785.1 protein_id gnl|my_center|LOCUS_27850 6888 4879 gene locus_tag LOCUS_27860 6888 4879 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_27860 9075 7108 gene locus_tag LOCUS_27870 9075 7108 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_27870 9217 10287 gene locus_tag LOCUS_27880 9217 10287 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385454.1 protein_id gnl|my_center|LOCUS_27880 10339 11400 gene locus_tag LOCUS_27890 10339 11400 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919204.1 protein_id gnl|my_center|LOCUS_27890 12494 11397 gene locus_tag LOCUS_27900 gene aroC 12494 11397 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_27900 13356 12535 gene locus_tag LOCUS_27910 gene fabI 13356 12535 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719509.1 protein_id gnl|my_center|LOCUS_27910 14368 13451 gene locus_tag LOCUS_27920 14368 13451 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence115 961 365 gene locus_tag LOCUS_27930 gene wrbA 961 365 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328347.1 protein_id gnl|my_center|LOCUS_27930 1060 1980 gene locus_tag LOCUS_27940 1060 1980 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007014614.1 protein_id gnl|my_center|LOCUS_27940 2670 1993 gene locus_tag LOCUS_27950 2670 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 3788 3138 gene locus_tag LOCUS_27960 3788 3138 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143439.1 protein_id gnl|my_center|LOCUS_27960 3859 5262 gene locus_tag LOCUS_27970 3859 5262 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 protein_id gnl|my_center|LOCUS_27970 5269 6048 gene locus_tag LOCUS_27980 gene cysQ 5269 6048 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338755.1 protein_id gnl|my_center|LOCUS_27980 6475 6182 gene locus_tag LOCUS_27990 6475 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 7243 6479 gene locus_tag LOCUS_28000 7243 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 8891 7260 gene locus_tag LOCUS_28010 8891 7260 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 protein_id gnl|my_center|LOCUS_28010 9239 10558 gene locus_tag LOCUS_28020 9239 10558 CDS product citrate-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170457.1 protein_id gnl|my_center|LOCUS_28020 10589 11974 gene locus_tag LOCUS_28030 10589 11974 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_28030 12086 12298 gene locus_tag LOCUS_28040 12086 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 12628 13224 gene locus_tag LOCUS_28050 12628 13224 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_28050 13260 13805 gene locus_tag LOCUS_28060 13260 13805 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917970.1 protein_id gnl|my_center|LOCUS_28060 13889 15097 gene locus_tag LOCUS_28070 13889 15097 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_28070 >Feature sequence116 497 775 gene locus_tag LOCUS_28080 gene xanC 497 775 CDS product xanthomonadin biosynthesis acyl carrier protein XanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039083.1 protein_id gnl|my_center|LOCUS_28080 772 1329 gene locus_tag LOCUS_28090 772 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 1337 2353 gene locus_tag LOCUS_28100 1337 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28100 2483 2677 gene locus_tag LOCUS_28110 2483 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 2674 2964 gene locus_tag LOCUS_28120 2674 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 2961 3872 gene locus_tag LOCUS_28130 2961 3872 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 protein_id gnl|my_center|LOCUS_28130 3874 4464 gene locus_tag LOCUS_28140 3874 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 4544 6781 gene locus_tag LOCUS_28150 4544 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 6727 7443 gene locus_tag LOCUS_28160 6727 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 7491 8690 gene locus_tag LOCUS_28170 7491 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 8687 9877 gene locus_tag LOCUS_28180 8687 9877 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_28180 9874 10668 gene locus_tag LOCUS_28190 9874 10668 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039070.1 protein_id gnl|my_center|LOCUS_28190 10665 11108 gene locus_tag LOCUS_28200 10665 11108 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039075.1 protein_id gnl|my_center|LOCUS_28200 11105 11824 gene locus_tag LOCUS_28210 gene fabG 11105 11824 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 protein_id gnl|my_center|LOCUS_28210 12431 11805 gene locus_tag LOCUS_28220 12431 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28220 13732 12521 gene locus_tag LOCUS_28230 13732 12521 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_28230 13673 13888 gene locus_tag LOCUS_28240 13673 13888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 13938 14714 gene locus_tag LOCUS_28250 gene ubiE 13938 14714 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073882.1 protein_id gnl|my_center|LOCUS_28250 14728 14958 gene locus_tag LOCUS_28260 14728 14958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence117 2219 588 gene locus_tag LOCUS_28270 2219 588 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_28270 3481 2372 gene locus_tag LOCUS_28280 3481 2372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_28280 4657 3491 gene locus_tag LOCUS_28290 4657 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 6431 4644 gene locus_tag LOCUS_28300 6431 4644 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704811.1 protein_id gnl|my_center|LOCUS_28300 6658 6969 gene locus_tag LOCUS_28310 6658 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 8610 7048 gene locus_tag LOCUS_28320 8610 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28320 11065 8687 gene locus_tag LOCUS_28330 11065 8687 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265751.1 protein_id gnl|my_center|LOCUS_28330 11568 11807 gene locus_tag LOCUS_28340 11568 11807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 12039 11824 gene locus_tag LOCUS_28350 12039 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 12804 12589 gene locus_tag LOCUS_28360 12804 12589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 14476 13349 gene locus_tag LOCUS_28370 14476 13349 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920313.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence118 817 1740 gene locus_tag LOCUS_28380 817 1740 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 protein_id gnl|my_center|LOCUS_28380 1740 2360 gene locus_tag LOCUS_28390 1740 2360 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228220.1 protein_id gnl|my_center|LOCUS_28390 2360 2971 gene locus_tag LOCUS_28400 2360 2971 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014819602.1 protein_id gnl|my_center|LOCUS_28400 2979 6512 gene locus_tag LOCUS_28410 gene brxC 2979 6512 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 protein_id gnl|my_center|LOCUS_28410 6512 7687 gene locus_tag LOCUS_28420 6512 7687 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038869.1 protein_id gnl|my_center|LOCUS_28420 7684 8235 gene locus_tag LOCUS_28430 7684 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 8235 11786 gene locus_tag LOCUS_28440 gene pglX 8235 11786 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939304.1 protein_id gnl|my_center|LOCUS_28440 11789 14290 gene locus_tag LOCUS_28450 gene pglZ 11789 14290 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939302.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence119 199 783 gene locus_tag LOCUS_28460 199 783 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640037.1 protein_id gnl|my_center|LOCUS_28460 770 2242 gene locus_tag LOCUS_28470 770 2242 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532355.1 protein_id gnl|my_center|LOCUS_28470 2315 2707 gene locus_tag LOCUS_28480 2315 2707 CDS product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721547.1 protein_id gnl|my_center|LOCUS_28480 3605 2853 gene locus_tag LOCUS_28490 3605 2853 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174871.1 protein_id gnl|my_center|LOCUS_28490 6412 3887 gene locus_tag LOCUS_28500 6412 3887 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252344.1 protein_id gnl|my_center|LOCUS_28500 7190 6699 gene locus_tag LOCUS_28510 7190 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 7098 7346 gene locus_tag LOCUS_28520 7098 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 7441 8118 gene locus_tag LOCUS_28530 7441 8118 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_28530 8118 9665 gene locus_tag LOCUS_28540 gene murJ 8118 9665 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088657.1 protein_id gnl|my_center|LOCUS_28540 9665 10198 gene locus_tag LOCUS_28550 gene thpR 9665 10198 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972484.1 protein_id gnl|my_center|LOCUS_28550 10709 10317 gene locus_tag LOCUS_28560 10709 10317 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265965.1 protein_id gnl|my_center|LOCUS_28560 10748 11050 gene locus_tag LOCUS_28570 10748 11050 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918134.1 protein_id gnl|my_center|LOCUS_28570 12224 11088 gene locus_tag LOCUS_28580 12224 11088 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808865.1 protein_id gnl|my_center|LOCUS_28580 12427 13173 gene locus_tag LOCUS_28590 12427 13173 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_28590 13210 14172 gene locus_tag LOCUS_28600 13210 14172 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106575.1 protein_id gnl|my_center|LOCUS_28600 14660 14169 gene locus_tag LOCUS_28610 14660 14169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 >Feature sequence120 736 1941 gene locus_tag LOCUS_28620 736 1941 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064343.1 protein_id gnl|my_center|LOCUS_28620 1974 3209 gene locus_tag LOCUS_28630 1974 3209 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_28630 3219 4904 gene locus_tag LOCUS_28640 3219 4904 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 protein_id gnl|my_center|LOCUS_28640 4941 5756 gene locus_tag LOCUS_28650 4941 5756 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877643.1 protein_id gnl|my_center|LOCUS_28650 5768 6109 gene locus_tag LOCUS_28660 5768 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 6138 7841 gene locus_tag LOCUS_28670 6138 7841 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_28670 8529 9200 gene locus_tag LOCUS_28680 8529 9200 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265815.1 protein_id gnl|my_center|LOCUS_28680 9294 10982 gene locus_tag LOCUS_28690 9294 10982 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_28690 12138 11098 gene locus_tag LOCUS_28700 12138 11098 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920677.1 protein_id gnl|my_center|LOCUS_28700 13699 12152 gene locus_tag LOCUS_28710 13699 12152 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_28710 14927 13725 gene locus_tag LOCUS_28720 14927 13725 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085773.1 protein_id gnl|my_center|LOCUS_28720 >Feature sequence121 2864 1680 gene locus_tag LOCUS_28730 2864 1680 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391834.1 protein_id gnl|my_center|LOCUS_28730 3443 3120 gene locus_tag LOCUS_28740 3443 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 4711 3647 gene locus_tag LOCUS_28750 4711 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 6742 4715 gene locus_tag LOCUS_28760 6742 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 7376 7128 gene locus_tag LOCUS_28770 7376 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 7829 7984 gene locus_tag LOCUS_28780 7829 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28780 8915 8331 gene locus_tag LOCUS_28790 8915 8331 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339016.1 protein_id gnl|my_center|LOCUS_28790 10677 9010 gene locus_tag LOCUS_28800 10677 9010 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090321.1 protein_id gnl|my_center|LOCUS_28800 11798 10674 gene locus_tag LOCUS_28810 11798 10674 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090320.1 protein_id gnl|my_center|LOCUS_28810 11928 12815 gene locus_tag LOCUS_28820 11928 12815 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090319.1 protein_id gnl|my_center|LOCUS_28820 13782 12892 gene locus_tag LOCUS_28830 13782 12892 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530651.1 protein_id gnl|my_center|LOCUS_28830 13902 14645 gene locus_tag LOCUS_28840 13902 14645 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975354.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence122 1782 1474 gene locus_tag LOCUS_28850 1782 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28850 3194 1710 gene locus_tag LOCUS_28860 3194 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 3424 4803 gene locus_tag LOCUS_28870 3424 4803 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087909.1 protein_id gnl|my_center|LOCUS_28870 4800 5660 gene locus_tag LOCUS_28880 4800 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 5727 6665 gene locus_tag LOCUS_28890 5727 6665 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967479.1 protein_id gnl|my_center|LOCUS_28890 6731 9136 gene locus_tag LOCUS_28900 gene ppsA 6731 9136 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087424.1 protein_id gnl|my_center|LOCUS_28900 9173 10657 gene locus_tag LOCUS_28910 9173 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28910 10325 10334 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10582 11691 gene locus_tag LOCUS_28920 10582 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28920 11766 12572 gene locus_tag LOCUS_28930 11766 12572 CDS product YmdB family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 protein_id gnl|my_center|LOCUS_28930 12621 13052 gene locus_tag LOCUS_28940 12621 13052 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_28940 14679 13219 gene locus_tag LOCUS_28950 14679 13219 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142259.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence123 2011 1340 gene locus_tag LOCUS_28960 gene purQ 2011 1340 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088468.1 protein_id gnl|my_center|LOCUS_28960 2358 2116 gene locus_tag LOCUS_28970 gene purS 2358 2116 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532128.1 protein_id gnl|my_center|LOCUS_28970 3131 2367 gene locus_tag LOCUS_28980 3131 2367 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975652.1 protein_id gnl|my_center|LOCUS_28980 3364 3690 gene locus_tag LOCUS_28990 3364 3690 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_28990 4608 3997 gene locus_tag LOCUS_29000 4608 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 5146 4760 gene locus_tag LOCUS_29010 5146 4760 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083216.1 protein_id gnl|my_center|LOCUS_29010 6231 5494 gene locus_tag LOCUS_29020 gene zupT 6231 5494 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020444.1 protein_id gnl|my_center|LOCUS_29020 7219 6596 gene locus_tag LOCUS_29030 7219 6596 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_29030 7646 8338 gene locus_tag LOCUS_29040 7646 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 9024 8533 gene locus_tag LOCUS_29050 9024 8533 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941703.1 protein_id gnl|my_center|LOCUS_29050 10547 9813 gene locus_tag LOCUS_29060 10547 9813 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965382.1 protein_id gnl|my_center|LOCUS_29060 11958 11521 gene locus_tag LOCUS_29070 11958 11521 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532560.1 protein_id gnl|my_center|LOCUS_29070 12200 12502 gene locus_tag LOCUS_29080 12200 12502 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141200.1 protein_id gnl|my_center|LOCUS_29080 12505 13026 gene locus_tag LOCUS_29090 12505 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_29090 13060 13593 gene locus_tag LOCUS_29100 13060 13593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence124 1221 1508 gene locus_tag LOCUS_29110 1221 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29110 1932 2609 gene locus_tag LOCUS_29120 1932 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29120 2591 3346 gene locus_tag LOCUS_29130 2591 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29130 4150 3452 gene locus_tag LOCUS_29140 4150 3452 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400381.1 protein_id gnl|my_center|LOCUS_29140 4586 4819 gene locus_tag LOCUS_29150 4586 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 5122 6858 gene locus_tag LOCUS_29160 5122 6858 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086825.1 protein_id gnl|my_center|LOCUS_29160 6920 7708 gene locus_tag LOCUS_29170 6920 7708 CDS product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469273.1 protein_id gnl|my_center|LOCUS_29170 7714 7911 gene locus_tag LOCUS_29180 7714 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 7982 8857 gene locus_tag LOCUS_29190 gene surE 7982 8857 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036883.1 protein_id gnl|my_center|LOCUS_29190 8850 9674 gene locus_tag LOCUS_29200 8850 9674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 9700 10722 gene locus_tag LOCUS_29210 9700 10722 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030805.1 protein_id gnl|my_center|LOCUS_29210 11836 11288 gene locus_tag LOCUS_29220 11836 11288 CDS product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532768.1 protein_id gnl|my_center|LOCUS_29220 13108 11855 gene locus_tag LOCUS_29230 13108 11855 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970397.1 protein_id gnl|my_center|LOCUS_29230 13761 13105 gene locus_tag LOCUS_29240 13761 13105 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 protein_id gnl|my_center|LOCUS_29240 14052 13912 gene locus_tag LOCUS_29250 14052 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 14358 14092 gene locus_tag LOCUS_29260 14358 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 14569 14494 gene locus_tag LOCUS_t00290 14569 14494 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence125 493 197 gene locus_tag LOCUS_29270 493 197 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325581.1 protein_id gnl|my_center|LOCUS_29270 765 493 gene locus_tag LOCUS_29280 765 493 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532247.1 protein_id gnl|my_center|LOCUS_29280 1409 4549 gene locus_tag LOCUS_29290 1409 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 5185 4724 gene locus_tag LOCUS_29300 5185 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29300 5156 5341 gene locus_tag LOCUS_29310 5156 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 5543 5788 gene locus_tag LOCUS_29320 5543 5788 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_29320 5785 6171 gene locus_tag LOCUS_29330 5785 6171 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_29330 7735 6785 gene locus_tag LOCUS_29340 7735 6785 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089011.1 protein_id gnl|my_center|LOCUS_29340 8163 7777 gene locus_tag LOCUS_29350 8163 7777 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530093.1 protein_id gnl|my_center|LOCUS_29350 9059 8199 gene locus_tag LOCUS_29360 9059 8199 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089316.1 protein_id gnl|my_center|LOCUS_29360 9696 9148 gene locus_tag LOCUS_29370 9696 9148 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947825.1 protein_id gnl|my_center|LOCUS_29370 9815 10765 gene locus_tag LOCUS_29380 9815 10765 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 protein_id gnl|my_center|LOCUS_29380 11438 11698 gene locus_tag LOCUS_29390 11438 11698 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970757.1 protein_id gnl|my_center|LOCUS_29390 12872 11895 gene locus_tag LOCUS_29400 12872 11895 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085560.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29400 13383 13084 gene locus_tag LOCUS_29410 13383 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 14379 13882 gene locus_tag LOCUS_29420 14379 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence126 884 675 gene locus_tag LOCUS_29430 884 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 1013 1288 gene locus_tag LOCUS_29440 1013 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 2372 1257 gene locus_tag LOCUS_29450 2372 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 3678 2419 gene locus_tag LOCUS_29460 3678 2419 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958074.1 protein_id gnl|my_center|LOCUS_29460 6793 3665 gene locus_tag LOCUS_29470 6793 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 7803 6853 gene locus_tag LOCUS_29480 gene folD 7803 6853 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267523.1 protein_id gnl|my_center|LOCUS_29480 10904 7851 gene locus_tag LOCUS_29490 10904 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 11598 11086 gene locus_tag LOCUS_29500 11598 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 13158 11686 gene locus_tag LOCUS_29510 13158 11686 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551694.1 protein_id gnl|my_center|LOCUS_29510 13814 13545 gene locus_tag LOCUS_29520 13814 13545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence127 24 108 gene locus_tag LOCUS_t00300 24 108 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 260 1276 gene locus_tag LOCUS_29530 260 1276 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926402.1 protein_id gnl|my_center|LOCUS_29530 1442 3175 gene locus_tag LOCUS_29540 1442 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 3452 3186 gene locus_tag LOCUS_29550 3452 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 4161 4499 gene locus_tag LOCUS_29560 4161 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 4499 5650 gene locus_tag LOCUS_29570 4499 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 5643 6176 gene locus_tag LOCUS_29580 5643 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 6173 7354 gene locus_tag LOCUS_29590 6173 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 7412 7831 gene locus_tag LOCUS_29600 7412 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 8132 9040 gene locus_tag LOCUS_29610 8132 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 9040 9726 gene locus_tag LOCUS_29620 9040 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 10093 9791 gene locus_tag LOCUS_29630 10093 9791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 11204 10221 gene locus_tag LOCUS_29640 11204 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 12481 11414 gene locus_tag LOCUS_29650 12481 11414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 13691 12468 gene locus_tag LOCUS_29660 13691 12468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 14247 14098 gene locus_tag LOCUS_29670 14247 14098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence128 1301 81 gene locus_tag LOCUS_29680 1301 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3061 1574 gene locus_tag LOCUS_29690 3061 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 7016 3063 gene locus_tag LOCUS_29700 7016 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 10270 7013 gene locus_tag LOCUS_29710 10270 7013 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_29710 10551 10345 gene locus_tag LOCUS_29720 10551 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 11000 13114 gene locus_tag LOCUS_29730 11000 13114 CDS product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538232.1 protein_id gnl|my_center|LOCUS_29730 13179 13475 gene locus_tag LOCUS_29740 13179 13475 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969011.1 protein_id gnl|my_center|LOCUS_29740 13499 13801 gene locus_tag LOCUS_29750 13499 13801 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626089.1 protein_id gnl|my_center|LOCUS_29750 13941 14165 gene locus_tag LOCUS_29760 13941 14165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 >Feature sequence129 311 1489 gene locus_tag LOCUS_29770 311 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 1504 2013 gene locus_tag LOCUS_29780 1504 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 2035 2478 gene locus_tag LOCUS_29790 2035 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 2813 3049 gene locus_tag LOCUS_29800 2813 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 4538 3537 gene locus_tag LOCUS_29810 4538 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 5405 4764 gene locus_tag LOCUS_29820 5405 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 5925 5755 gene locus_tag LOCUS_29830 5925 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 6099 7061 gene locus_tag LOCUS_29840 6099 7061 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_29840 7193 7861 gene locus_tag LOCUS_29850 gene parA 7193 7861 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_29850 7827 8108 gene locus_tag LOCUS_29860 7827 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 8183 9334 gene locus_tag LOCUS_29870 8183 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 9996 9772 gene locus_tag LOCUS_29880 9996 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 10149 10331 gene locus_tag LOCUS_29890 10149 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 10331 10606 gene locus_tag LOCUS_29900 gene yafQ 10331 10606 CDS product type II toxin-antitoxin system mRNA interferase toxin YafQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615974.1 protein_id gnl|my_center|LOCUS_29900 10599 10766 gene locus_tag LOCUS_29910 10599 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 11427 10909 gene locus_tag LOCUS_29920 11427 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 12904 11438 gene locus_tag LOCUS_29930 12904 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 12929 13117 gene locus_tag LOCUS_29940 12929 13117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 13077 14036 gene locus_tag LOCUS_29950 13077 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 >Feature sequence130 <1 622 gene locus_tag LOCUS_29960 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083296.1:DUF1223 domain-containing protein 624 935 gene locus_tag LOCUS_29970 624 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 1111 932 gene locus_tag LOCUS_29980 1111 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 1384 3171 gene locus_tag LOCUS_29990 1384 3171 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965204.1 protein_id gnl|my_center|LOCUS_29990 5991 3292 gene locus_tag LOCUS_30000 gene acnA 5991 3292 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528828.1 protein_id gnl|my_center|LOCUS_30000 6123 6929 gene locus_tag LOCUS_30010 6123 6929 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_30010 6992 7834 gene locus_tag LOCUS_30020 6992 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 8306 7875 gene locus_tag LOCUS_30030 8306 7875 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337528.1 protein_id gnl|my_center|LOCUS_30030 9149 8565 gene locus_tag LOCUS_30040 9149 8565 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531881.1 protein_id gnl|my_center|LOCUS_30040 >Feature sequence131 153 386 gene locus_tag LOCUS_30050 153 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 1368 286 gene locus_tag LOCUS_30060 1368 286 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228623.1 protein_id gnl|my_center|LOCUS_30060 1555 1358 gene locus_tag LOCUS_30070 1555 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 5649 2434 gene locus_tag LOCUS_30080 5649 2434 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_30080 6707 5646 gene locus_tag LOCUS_30090 6707 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 7183 6722 gene locus_tag LOCUS_30100 7183 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 8490 7180 gene locus_tag LOCUS_30110 8490 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 9503 8490 gene locus_tag LOCUS_30120 9503 8490 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035718.1 protein_id gnl|my_center|LOCUS_30120 11013 9490 gene locus_tag LOCUS_30130 11013 9490 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_30130 11612 11010 gene locus_tag LOCUS_30140 11612 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 11780 12790 gene locus_tag LOCUS_30150 11780 12790 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205298.1 protein_id gnl|my_center|LOCUS_30150 13666 13181 gene locus_tag LOCUS_30160 13666 13181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence132 1650 706 gene locus_tag LOCUS_30170 1650 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 2934 2005 gene locus_tag LOCUS_30180 2934 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3320 5737 gene locus_tag LOCUS_30190 3320 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 6753 5920 gene locus_tag LOCUS_30200 6753 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975733.1 protein_id gnl|my_center|LOCUS_30200 11823 7159 gene locus_tag LOCUS_30210 11823 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 12350 12099 gene locus_tag LOCUS_30220 12350 12099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 12799 12632 gene locus_tag LOCUS_30230 12799 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 13317 12766 gene locus_tag LOCUS_30240 13317 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 13694 13353 gene locus_tag LOCUS_30250 13694 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence133 1104 2339 gene locus_tag LOCUS_30260 1104 2339 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_30260 2696 3673 gene locus_tag LOCUS_30270 2696 3673 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_30270 3941 4909 gene locus_tag LOCUS_30280 3941 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 5446 7479 gene locus_tag LOCUS_30290 5446 7479 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 protein_id gnl|my_center|LOCUS_30290 7578 8054 gene locus_tag LOCUS_30300 7578 8054 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 protein_id gnl|my_center|LOCUS_30300 8066 10732 gene locus_tag LOCUS_30310 8066 10732 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388279.1 protein_id gnl|my_center|LOCUS_30310 10729 11115 gene locus_tag LOCUS_30320 10729 11115 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923289.1 protein_id gnl|my_center|LOCUS_30320 11112 12203 gene locus_tag LOCUS_30330 11112 12203 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197948963.1 protein_id gnl|my_center|LOCUS_30330 12200 13084 gene locus_tag LOCUS_30340 12200 13084 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084985.1 protein_id gnl|my_center|LOCUS_30340 13081 13473 gene locus_tag LOCUS_30350 13081 13473 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390464.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence134 388 74 gene locus_tag LOCUS_30360 388 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30360 852 382 gene locus_tag LOCUS_30370 852 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30370 1344 916 gene locus_tag LOCUS_30380 1344 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 1691 2947 gene locus_tag LOCUS_30390 1691 2947 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224442.1 protein_id gnl|my_center|LOCUS_30390 2982 3653 gene locus_tag LOCUS_30400 2982 3653 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038852.1 protein_id gnl|my_center|LOCUS_30400 4357 4025 gene locus_tag LOCUS_30410 4357 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 5861 5619 gene locus_tag LOCUS_30420 5861 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 8794 8009 gene locus_tag LOCUS_30430 8794 8009 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_30430 12174 8950 gene locus_tag LOCUS_30440 12174 8950 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088515.1 protein_id gnl|my_center|LOCUS_30440 13202 12177 gene locus_tag LOCUS_30450 13202 12177 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967177.1 protein_id gnl|my_center|LOCUS_30450 13560 13210 gene locus_tag LOCUS_30460 13560 13210 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210342306.1 protein_id gnl|my_center|LOCUS_30460 >Feature sequence135 3464 621 gene locus_tag LOCUS_30470 3464 621 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968623.1 protein_id gnl|my_center|LOCUS_30470 6352 3461 gene locus_tag LOCUS_30480 6352 3461 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_30480 6983 6363 gene locus_tag LOCUS_30490 6983 6363 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880077.1 protein_id gnl|my_center|LOCUS_30490 10668 7135 gene locus_tag LOCUS_30500 10668 7135 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968627.1 protein_id gnl|my_center|LOCUS_30500 11585 10692 gene locus_tag LOCUS_30510 11585 10692 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_30510 12227 12847 gene locus_tag LOCUS_30520 12227 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 12840 13727 gene locus_tag LOCUS_30530 12840 13727 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807609.1 protein_id gnl|my_center|LOCUS_30530 >Feature sequence136 1245 370 gene locus_tag LOCUS_30540 1245 370 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224863.1 protein_id gnl|my_center|LOCUS_30540 2055 1282 gene locus_tag LOCUS_30550 2055 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 3078 2191 gene locus_tag LOCUS_30560 3078 2191 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970070.1 protein_id gnl|my_center|LOCUS_30560 4828 3083 gene locus_tag LOCUS_30570 4828 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 5101 5253 gene locus_tag LOCUS_30580 5101 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 5398 6417 gene locus_tag LOCUS_30590 5398 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 6467 11431 gene locus_tag LOCUS_30600 6467 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 11470 12021 gene locus_tag LOCUS_30610 11470 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 13149 12733 gene locus_tag LOCUS_30620 13149 12733 CDS product DUF1398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905247.1 protein_id gnl|my_center|LOCUS_30620 13643 13161 gene locus_tag LOCUS_30630 13643 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 >Feature sequence137 1579 719 gene locus_tag LOCUS_30640 1579 719 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922304.1 protein_id gnl|my_center|LOCUS_30640 2955 1576 gene locus_tag LOCUS_30650 2955 1576 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087909.1 protein_id gnl|my_center|LOCUS_30650 3120 6287 gene locus_tag LOCUS_30660 3120 6287 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231857455.1 protein_id gnl|my_center|LOCUS_30660 6227 9538 gene locus_tag LOCUS_30670 gene treS 6227 9538 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088929.1 protein_id gnl|my_center|LOCUS_30670 9528 11741 gene locus_tag LOCUS_30680 gene glgB 9528 11741 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275125.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence138 234 464 gene locus_tag LOCUS_30690 234 464 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389736.1 protein_id gnl|my_center|LOCUS_30690 1222 476 gene locus_tag LOCUS_30700 1222 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 1423 1716 gene locus_tag LOCUS_30710 1423 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 2490 1750 gene locus_tag LOCUS_30720 2490 1750 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640545.1 protein_id gnl|my_center|LOCUS_30720 2850 3380 gene locus_tag LOCUS_30730 2850 3380 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_30730 3479 6127 gene locus_tag LOCUS_30740 3479 6127 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038275.1 protein_id gnl|my_center|LOCUS_30740 6284 7219 gene locus_tag LOCUS_30750 6284 7219 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257650.1 protein_id gnl|my_center|LOCUS_30750 9016 7229 gene locus_tag LOCUS_30760 gene sdhA 9016 7229 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265974.1 protein_id gnl|my_center|LOCUS_30760 9410 9036 gene locus_tag LOCUS_30770 gene sdhD 9410 9036 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067168.1 protein_id gnl|my_center|LOCUS_30770 9826 9410 gene locus_tag LOCUS_30780 gene sdhC 9826 9410 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531169.1 protein_id gnl|my_center|LOCUS_30780 10046 10702 gene locus_tag LOCUS_30790 gene rpe 10046 10702 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639879.1 protein_id gnl|my_center|LOCUS_30790 10714 12426 gene locus_tag LOCUS_30800 10714 12426 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 protein_id gnl|my_center|LOCUS_30800 12423 13145 gene locus_tag LOCUS_30810 12423 13145 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257343.1 protein_id gnl|my_center|LOCUS_30810 >Feature sequence139 101 523 gene locus_tag LOCUS_30820 101 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 1716 772 gene locus_tag LOCUS_30830 1716 772 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331308.1 protein_id gnl|my_center|LOCUS_30830 2235 1759 gene locus_tag LOCUS_30840 2235 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 2677 2282 gene locus_tag LOCUS_30850 2677 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 3720 2674 gene locus_tag LOCUS_30860 3720 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405629.1 protein_id gnl|my_center|LOCUS_30860 4598 3795 gene locus_tag LOCUS_30870 4598 3795 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_30870 4820 5695 gene locus_tag LOCUS_30880 4820 5695 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730102.1 protein_id gnl|my_center|LOCUS_30880 6687 5704 gene locus_tag LOCUS_30890 6687 5704 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_30890 8355 6694 gene locus_tag LOCUS_30900 8355 6694 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089722.1 protein_id gnl|my_center|LOCUS_30900 8541 9488 gene locus_tag LOCUS_30910 8541 9488 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529025.1 protein_id gnl|my_center|LOCUS_30910 9500 10294 gene locus_tag LOCUS_30920 9500 10294 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_30920 10959 10306 gene locus_tag LOCUS_30930 10959 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 11323 12546 gene locus_tag LOCUS_30940 11323 12546 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026178447.1 protein_id gnl|my_center|LOCUS_30940 12594 13049 gene locus_tag LOCUS_30950 12594 13049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 13128 13523 gene locus_tag LOCUS_30960 13128 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 >Feature sequence140 2321 321 gene locus_tag LOCUS_30970 gene kdpB 2321 321 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973322.1 protein_id gnl|my_center|LOCUS_30970 4127 2400 gene locus_tag LOCUS_30980 gene kdpA 4127 2400 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089518.1 protein_id gnl|my_center|LOCUS_30980 6573 7982 gene locus_tag LOCUS_30990 6573 7982 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920866.1 protein_id gnl|my_center|LOCUS_30990 8068 9390 gene locus_tag LOCUS_31000 8068 9390 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394859.1 protein_id gnl|my_center|LOCUS_31000 9398 10534 gene locus_tag LOCUS_31010 9398 10534 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_31010 10589 11257 gene locus_tag LOCUS_31020 10589 11257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 13666 11297 gene locus_tag LOCUS_31030 13666 11297 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140331.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence141 2219 867 gene locus_tag LOCUS_31040 2219 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 2346 3254 gene locus_tag LOCUS_31050 2346 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 3929 3231 gene locus_tag LOCUS_31060 3929 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3939 4121 gene locus_tag LOCUS_31070 3939 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 5448 4147 gene locus_tag LOCUS_31080 5448 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 6353 5445 gene locus_tag LOCUS_31090 6353 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 7353 6400 gene locus_tag LOCUS_31100 7353 6400 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257056.1 protein_id gnl|my_center|LOCUS_31100 7787 7350 gene locus_tag LOCUS_31110 7787 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 9614 8838 gene locus_tag LOCUS_31120 9614 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 11648 11289 gene locus_tag LOCUS_31130 11648 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 11879 11700 gene locus_tag LOCUS_31140 11879 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 13329 12253 gene locus_tag LOCUS_31150 13329 12253 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 protein_id gnl|my_center|LOCUS_31150 >Feature sequence142 270 2120 gene locus_tag LOCUS_31160 270 2120 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921248.1 protein_id gnl|my_center|LOCUS_31160 2298 2936 gene locus_tag LOCUS_31170 gene hisH 2298 2936 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391343.1 protein_id gnl|my_center|LOCUS_31170 2933 3649 gene locus_tag LOCUS_31180 gene hisA 2933 3649 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965127.1 protein_id gnl|my_center|LOCUS_31180 4988 3615 gene locus_tag LOCUS_31190 4988 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 5172 6290 gene locus_tag LOCUS_31200 5172 6290 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_31200 6593 6294 gene locus_tag LOCUS_31210 6593 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 8835 6670 gene locus_tag LOCUS_31220 gene pnp 8835 6670 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083601.1 protein_id gnl|my_center|LOCUS_31220 9303 9034 gene locus_tag LOCUS_31230 gene rpsO 9303 9034 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_31230 10263 9319 gene locus_tag LOCUS_31240 gene truB 10263 9319 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172518.1 protein_id gnl|my_center|LOCUS_31240 10661 10305 gene locus_tag LOCUS_31250 gene rbfA 10661 10305 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917927.1 protein_id gnl|my_center|LOCUS_31250 13370 10794 gene locus_tag LOCUS_31260 13370 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 >Feature sequence143 549 1082 gene locus_tag LOCUS_31270 549 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 1620 1147 gene locus_tag LOCUS_31280 1620 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 2670 1882 gene locus_tag LOCUS_31290 2670 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 2801 3559 gene locus_tag LOCUS_31300 2801 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3546 3734 gene locus_tag LOCUS_31310 3546 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 3678 3687 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3731 3937 gene locus_tag LOCUS_31320 3731 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 3984 4394 gene locus_tag LOCUS_31330 3984 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 4435 4872 gene locus_tag LOCUS_31340 4435 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 5376 4858 gene locus_tag LOCUS_31350 5376 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 5586 5380 gene locus_tag LOCUS_31360 5586 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 5488 5817 gene locus_tag LOCUS_31370 5488 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 6806 5946 gene locus_tag LOCUS_31380 6806 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 8468 8244 gene locus_tag LOCUS_31390 8468 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 8801 10312 gene locus_tag LOCUS_31400 8801 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 11161 11820 gene locus_tag LOCUS_31410 11161 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 12313 12107 gene locus_tag LOCUS_31420 12313 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 12697 12467 gene locus_tag LOCUS_31430 12697 12467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 12810 13421 gene locus_tag LOCUS_31440 12810 13421 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence144 1548 3275 gene locus_tag LOCUS_31450 1548 3275 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085855.1 protein_id gnl|my_center|LOCUS_31450 3329 3883 gene locus_tag LOCUS_31460 3329 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 3868 4203 gene locus_tag LOCUS_31470 3868 4203 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_31470 4402 4217 gene locus_tag LOCUS_31480 4402 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 4713 6299 gene locus_tag LOCUS_31490 4713 6299 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918954.1 protein_id gnl|my_center|LOCUS_31490 7567 6401 gene locus_tag LOCUS_31500 7567 6401 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957762.1 protein_id gnl|my_center|LOCUS_31500 7753 8229 gene locus_tag LOCUS_31510 gene ccmE 7753 8229 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387797.1 protein_id gnl|my_center|LOCUS_31510 8226 10163 gene locus_tag LOCUS_31520 8226 10163 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 protein_id gnl|my_center|LOCUS_31520 10160 10606 gene locus_tag LOCUS_31530 10160 10606 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241025.1 protein_id gnl|my_center|LOCUS_31530 10764 12377 gene locus_tag LOCUS_31540 10764 12377 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339151.1 protein_id gnl|my_center|LOCUS_31540 12478 13161 gene locus_tag LOCUS_31550 12478 13161 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965709.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence145 <1 1143 gene locus_tag LOCUS_31560 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626572.1:class I SAM-dependent rRNA methyltransferase 2813 1248 gene locus_tag LOCUS_31570 2813 1248 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_31570 4826 2865 gene locus_tag LOCUS_31580 4826 2865 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104754.1 protein_id gnl|my_center|LOCUS_31580 5561 5040 gene locus_tag LOCUS_31590 5561 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 7170 5635 gene locus_tag LOCUS_31600 7170 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 8145 7378 gene locus_tag LOCUS_31610 8145 7378 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957343.1 protein_id gnl|my_center|LOCUS_31610 8505 9065 gene locus_tag LOCUS_31620 8505 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 9297 9043 gene locus_tag LOCUS_31630 9297 9043 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337257.1 protein_id gnl|my_center|LOCUS_31630 9372 11138 gene locus_tag LOCUS_31640 9372 11138 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640463.1 protein_id gnl|my_center|LOCUS_31640 11248 12084 gene locus_tag LOCUS_31650 11248 12084 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 protein_id gnl|my_center|LOCUS_31650 <13480 12209 gene locus_tag LOCUS_31660 <13480 12209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923290.1:sensor histidine kinase PhyK >Feature sequence146 <1 2014 gene locus_tag LOCUS_31670 <1 2014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083732.1:penicillin-binding protein 1A 2550 2020 gene locus_tag LOCUS_31680 2550 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31680 2482 2790 gene locus_tag LOCUS_31690 2482 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 3896 2706 gene locus_tag LOCUS_31700 gene metK 3896 2706 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088686.1 protein_id gnl|my_center|LOCUS_31700 5340 4033 gene locus_tag LOCUS_31710 gene hslU 5340 4033 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083473.1 protein_id gnl|my_center|LOCUS_31710 5894 5337 gene locus_tag LOCUS_31720 gene hslV 5894 5337 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391346.1 protein_id gnl|my_center|LOCUS_31720 5952 6557 gene locus_tag LOCUS_31730 gene hisB 5952 6557 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391344.1 protein_id gnl|my_center|LOCUS_31730 6670 7782 gene locus_tag LOCUS_31740 6670 7782 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_31740 8824 9288 gene locus_tag LOCUS_31750 8824 9288 CDS product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183417335.1 protein_id gnl|my_center|LOCUS_31750 9578 11485 gene locus_tag LOCUS_31760 gene dnaK 9578 11485 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083506.1 protein_id gnl|my_center|LOCUS_31760 11595 12725 gene locus_tag LOCUS_31770 gene dnaJ 11595 12725 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338764.1 protein_id gnl|my_center|LOCUS_31770 12913 12662 gene locus_tag LOCUS_31780 12913 12662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence147 77 259 gene locus_tag LOCUS_31790 77 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1159 311 gene locus_tag LOCUS_31800 1159 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 1559 1954 gene locus_tag LOCUS_31810 1559 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 2731 2027 gene locus_tag LOCUS_31820 2731 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 2971 2828 gene locus_tag LOCUS_31830 2971 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 3379 3579 gene locus_tag LOCUS_31840 3379 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 4200 3784 gene locus_tag LOCUS_31850 4200 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31850 4447 4671 gene locus_tag LOCUS_31860 4447 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31860 4677 5246 gene locus_tag LOCUS_31870 4677 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31870 5506 6771 gene locus_tag LOCUS_31880 5506 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 7803 6955 gene locus_tag LOCUS_31890 7803 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31890 7778 8347 gene locus_tag LOCUS_31900 7778 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 8925 8569 gene locus_tag LOCUS_31910 gene tnpB 8925 8569 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084591.1 protein_id gnl|my_center|LOCUS_31910 9131 8922 gene locus_tag LOCUS_31920 9131 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 9156 9428 gene locus_tag LOCUS_31930 9156 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 9534 10442 gene locus_tag LOCUS_31940 9534 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 <13442 10502 gene locus_tag LOCUS_31950 <13442 10502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_150556097.1:autotransporter outer membrane beta-barrel domain-containing protein >Feature sequence148 216 953 gene locus_tag LOCUS_31960 gene phbB 216 953 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_31960 995 1624 gene locus_tag LOCUS_31970 gene ccmA 995 1624 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083298.1 protein_id gnl|my_center|LOCUS_31970 1621 2286 gene locus_tag LOCUS_31980 gene ccmB 1621 2286 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722655.1 protein_id gnl|my_center|LOCUS_31980 2346 3071 gene locus_tag LOCUS_31990 2346 3071 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083300.1 protein_id gnl|my_center|LOCUS_31990 3068 3241 gene locus_tag LOCUS_32000 3068 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 3238 3777 gene locus_tag LOCUS_32010 3238 3777 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 protein_id gnl|my_center|LOCUS_32010 3791 4024 gene locus_tag LOCUS_32020 3791 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 4596 4030 gene locus_tag LOCUS_32030 4596 4030 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921504.1 protein_id gnl|my_center|LOCUS_32030 4772 5308 gene locus_tag LOCUS_32040 4772 5308 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_32040 5897 5292 gene locus_tag LOCUS_32050 5897 5292 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390405.1 protein_id gnl|my_center|LOCUS_32050 6838 5894 gene locus_tag LOCUS_32060 gene ftsY 6838 5894 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083304.1 protein_id gnl|my_center|LOCUS_32060 8088 6835 gene locus_tag LOCUS_32070 gene mtaB 8088 6835 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528840.1 protein_id gnl|my_center|LOCUS_32070 8909 8085 gene locus_tag LOCUS_32080 gene dapF 8909 8085 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388938.1 protein_id gnl|my_center|LOCUS_32080 8984 11035 gene locus_tag LOCUS_32090 8984 11035 CDS product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531200.1 protein_id gnl|my_center|LOCUS_32090 11125 13269 gene locus_tag LOCUS_32100 11125 13269 CDS product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531200.1 protein_id gnl|my_center|LOCUS_32100 >Feature sequence149 1744 995 gene locus_tag LOCUS_32110 gene sufC 1744 995 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171266.1 protein_id gnl|my_center|LOCUS_32110 3198 1744 gene locus_tag LOCUS_32120 gene sufB 3198 1744 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531481.1 protein_id gnl|my_center|LOCUS_32120 4345 3206 gene locus_tag LOCUS_32130 4345 3206 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_32130 4817 4353 gene locus_tag LOCUS_32140 4817 4353 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_32140 5126 5779 gene locus_tag LOCUS_32150 5126 5779 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975625.1 protein_id gnl|my_center|LOCUS_32150 6914 5817 gene locus_tag LOCUS_32160 6914 5817 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389784.1 protein_id gnl|my_center|LOCUS_32160 6963 8225 gene locus_tag LOCUS_32170 gene tyrS 6963 8225 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389785.1 protein_id gnl|my_center|LOCUS_32170 11642 8229 gene locus_tag LOCUS_32180 11642 8229 CDS product AsmA-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 protein_id gnl|my_center|LOCUS_32180 11768 12253 gene locus_tag LOCUS_32190 gene bcp 11768 12253 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975630.1 protein_id gnl|my_center|LOCUS_32190 >Feature sequence150 316 2148 gene locus_tag LOCUS_32200 316 2148 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_32200 2279 3331 gene locus_tag LOCUS_32210 2279 3331 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_32210 4078 3422 gene locus_tag LOCUS_32220 4078 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 7630 4184 gene locus_tag LOCUS_32230 7630 4184 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414323.1 protein_id gnl|my_center|LOCUS_32230 8819 8895 gene locus_tag LOCUS_t00310 8819 8895 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11033 10248 gene locus_tag LOCUS_32240 11033 10248 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992241.1 protein_id gnl|my_center|LOCUS_32240 11379 10993 gene locus_tag LOCUS_32250 11379 10993 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531903.1 protein_id gnl|my_center|LOCUS_32250 11746 11498 gene locus_tag LOCUS_32260 11746 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 12642 11743 gene locus_tag LOCUS_32270 12642 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 >Feature sequence151 630 214 gene locus_tag LOCUS_32280 630 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 1589 630 gene locus_tag LOCUS_32290 1589 630 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498063.1 protein_id gnl|my_center|LOCUS_32290 1848 2078 gene locus_tag LOCUS_32300 1848 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 5816 2121 gene locus_tag LOCUS_32310 5816 2121 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269440.1 protein_id gnl|my_center|LOCUS_32310 6790 5816 gene locus_tag LOCUS_32320 6790 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211095375.1 protein_id gnl|my_center|LOCUS_32320 8375 6951 gene locus_tag LOCUS_32330 8375 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210308580.1 protein_id gnl|my_center|LOCUS_32330 10111 8372 gene locus_tag LOCUS_32340 10111 8372 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942011.1 protein_id gnl|my_center|LOCUS_32340 11490 10108 gene locus_tag LOCUS_32350 11490 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 13050 11740 gene locus_tag LOCUS_32360 13050 11740 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 protein_id gnl|my_center|LOCUS_32360 >Feature sequence152 969 1937 gene locus_tag LOCUS_32370 969 1937 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878166.1 protein_id gnl|my_center|LOCUS_32370 1982 3655 gene locus_tag LOCUS_32380 1982 3655 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_32380 3652 4752 gene locus_tag LOCUS_32390 3652 4752 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_32390 4771 5589 gene locus_tag LOCUS_32400 4771 5589 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_32400 5964 8591 gene locus_tag LOCUS_32410 5964 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 9291 11000 gene locus_tag LOCUS_32420 9291 11000 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_32420 11044 12744 gene locus_tag LOCUS_32430 11044 12744 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence153 1781 387 gene locus_tag LOCUS_32440 gene murD 1781 387 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920413.1 protein_id gnl|my_center|LOCUS_32440 2871 1786 gene locus_tag LOCUS_32450 gene mraY 2871 1786 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_32450 4255 2876 gene locus_tag LOCUS_32460 gene murF 4255 2876 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 protein_id gnl|my_center|LOCUS_32460 5748 4252 gene locus_tag LOCUS_32470 5748 4252 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089347.1 protein_id gnl|my_center|LOCUS_32470 7388 5748 gene locus_tag LOCUS_32480 7388 5748 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089348.1 protein_id gnl|my_center|LOCUS_32480 7800 7390 gene locus_tag LOCUS_32490 7800 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 8713 7793 gene locus_tag LOCUS_32500 gene rsmH 8713 7793 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388713.1 protein_id gnl|my_center|LOCUS_32500 9177 8710 gene locus_tag LOCUS_32510 9177 8710 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920419.1 protein_id gnl|my_center|LOCUS_32510 9534 10766 gene locus_tag LOCUS_32520 9534 10766 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141940.1 protein_id gnl|my_center|LOCUS_32520 11221 11679 gene locus_tag LOCUS_32530 11221 11679 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868975.1 protein_id gnl|my_center|LOCUS_32530 12476 11757 gene locus_tag LOCUS_32540 12476 11757 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089351.1 protein_id gnl|my_center|LOCUS_32540 12785 12489 gene locus_tag LOCUS_32550 12785 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 >Feature sequence154 443 1621 gene locus_tag LOCUS_32560 443 1621 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391834.1 protein_id gnl|my_center|LOCUS_32560 1608 3827 gene locus_tag LOCUS_32570 1608 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 3889 4671 gene locus_tag LOCUS_32580 3889 4671 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459825.1 protein_id gnl|my_center|LOCUS_32580 4671 5264 gene locus_tag LOCUS_32590 4671 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 5268 8690 gene locus_tag LOCUS_32600 5268 8690 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459833.1 protein_id gnl|my_center|LOCUS_32600 8779 9915 gene locus_tag LOCUS_32610 8779 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 9912 11303 gene locus_tag LOCUS_32620 9912 11303 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224018.1 protein_id gnl|my_center|LOCUS_32620 11874 11485 gene locus_tag LOCUS_32630 11874 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 12462 12064 gene locus_tag LOCUS_32640 12462 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32640 12373 12573 gene locus_tag LOCUS_32650 12373 12573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 >Feature sequence155 2198 465 gene locus_tag LOCUS_32660 2198 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 5658 2263 gene locus_tag LOCUS_32670 5658 2263 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090811.1 protein_id gnl|my_center|LOCUS_32670 8264 5658 gene locus_tag LOCUS_32680 8264 5658 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494176.1 protein_id gnl|my_center|LOCUS_32680 10945 8396 gene locus_tag LOCUS_32690 10945 8396 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146536093.1 protein_id gnl|my_center|LOCUS_32690 12015 11029 gene locus_tag LOCUS_32700 12015 11029 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_32700 12104 12397 gene locus_tag LOCUS_32710 12104 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 12584 12916 gene locus_tag LOCUS_32720 12584 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence156 152 670 gene locus_tag LOCUS_32730 152 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 803 2929 gene locus_tag LOCUS_32740 gene nuoG 803 2929 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389436.1 protein_id gnl|my_center|LOCUS_32740 2930 3970 gene locus_tag LOCUS_32750 gene nuoH 2930 3970 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531097.1 protein_id gnl|my_center|LOCUS_32750 3970 4458 gene locus_tag LOCUS_32760 gene nuoI 3970 4458 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707628.1 protein_id gnl|my_center|LOCUS_32760 4492 5100 gene locus_tag LOCUS_32770 4492 5100 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311651.1 protein_id gnl|my_center|LOCUS_32770 5103 5411 gene locus_tag LOCUS_32780 gene nuoK 5103 5411 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 protein_id gnl|my_center|LOCUS_32780 5415 7406 gene locus_tag LOCUS_32790 gene nuoL 5415 7406 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531100.1 protein_id gnl|my_center|LOCUS_32790 7406 8941 gene locus_tag LOCUS_32800 7406 8941 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 protein_id gnl|my_center|LOCUS_32800 8938 9360 gene locus_tag LOCUS_32810 8938 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32810 9364 10377 gene locus_tag LOCUS_32820 9364 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32820 10617 11108 gene locus_tag LOCUS_32830 10617 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 11110 11901 gene locus_tag LOCUS_32840 11110 11901 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389445.1 protein_id gnl|my_center|LOCUS_32840 >Feature sequence157 804 1439 gene locus_tag LOCUS_32850 804 1439 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_32850 1605 2051 gene locus_tag LOCUS_32860 1605 2051 CDS product DUF3429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 protein_id gnl|my_center|LOCUS_32860 2048 3571 gene locus_tag LOCUS_32870 2048 3571 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918532.1 protein_id gnl|my_center|LOCUS_32870 6301 3716 gene locus_tag LOCUS_32880 6301 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 7538 6720 gene locus_tag LOCUS_32890 7538 6720 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811489.1 protein_id gnl|my_center|LOCUS_32890 8657 7557 gene locus_tag LOCUS_32900 8657 7557 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_32900 10327 8654 gene locus_tag LOCUS_32910 10327 8654 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_32910 11340 10372 gene locus_tag LOCUS_32920 11340 10372 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_32920 11423 13033 gene locus_tag LOCUS_32930 11423 13033 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729267.1 protein_id gnl|my_center|LOCUS_32930 >Feature sequence158 3 509 gene locus_tag LOCUS_32940 3 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 1164 1697 gene locus_tag LOCUS_32950 1164 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 5783 1965 gene locus_tag LOCUS_32960 5783 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 6921 7832 gene locus_tag LOCUS_32970 6921 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 7919 11017 gene locus_tag LOCUS_32980 7919 11017 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742338.1 protein_id gnl|my_center|LOCUS_32980 11144 11698 gene locus_tag LOCUS_32990 11144 11698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 11824 12642 gene locus_tag LOCUS_33000 11824 12642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 >Feature sequence159 1600 395 gene locus_tag LOCUS_33010 1600 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026192137.1 protein_id gnl|my_center|LOCUS_33010 2239 3561 gene locus_tag LOCUS_33020 2239 3561 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 protein_id gnl|my_center|LOCUS_33020 4945 3659 gene locus_tag LOCUS_33030 4945 3659 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533330.1 protein_id gnl|my_center|LOCUS_33030 5274 4942 gene locus_tag LOCUS_33040 5274 4942 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533331.1 protein_id gnl|my_center|LOCUS_33040 5835 5506 gene locus_tag LOCUS_33050 5835 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 5916 7211 gene locus_tag LOCUS_33060 5916 7211 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351354.1 protein_id gnl|my_center|LOCUS_33060 8400 7213 gene locus_tag LOCUS_33070 8400 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 9007 8285 gene locus_tag LOCUS_33080 9007 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 11028 9004 gene locus_tag LOCUS_33090 11028 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 11821 11201 gene locus_tag LOCUS_33100 11821 11201 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312796.1 protein_id gnl|my_center|LOCUS_33100 12339 12638 gene locus_tag LOCUS_33110 12339 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 12801 12971 gene locus_tag LOCUS_33120 12801 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence160 2714 345 gene locus_tag LOCUS_33130 2714 345 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085599.1 protein_id gnl|my_center|LOCUS_33130 3092 4345 gene locus_tag LOCUS_33140 3092 4345 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533665.1 protein_id gnl|my_center|LOCUS_33140 6087 4426 gene locus_tag LOCUS_33150 6087 4426 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088981.1 protein_id gnl|my_center|LOCUS_33150 6898 6074 gene locus_tag LOCUS_33160 gene hutG 6898 6074 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918842.1 protein_id gnl|my_center|LOCUS_33160 8132 6888 gene locus_tag LOCUS_33170 gene hutI 8132 6888 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918844.1 protein_id gnl|my_center|LOCUS_33170 8131 9492 gene locus_tag LOCUS_33180 8131 9492 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918845.1 protein_id gnl|my_center|LOCUS_33180 9503 10714 gene locus_tag LOCUS_33190 9503 10714 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294607.1 protein_id gnl|my_center|LOCUS_33190 10718 11497 gene locus_tag LOCUS_33200 10718 11497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720000.1 protein_id gnl|my_center|LOCUS_33200 11500 12369 gene locus_tag LOCUS_33210 11500 12369 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035876.1 protein_id gnl|my_center|LOCUS_33210 12366 12983 gene locus_tag LOCUS_33220 12366 12983 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815887.1 protein_id gnl|my_center|LOCUS_33220 >Feature sequence161 406 1815 gene locus_tag LOCUS_33230 406 1815 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_33230 4499 1845 gene locus_tag LOCUS_33240 gene ndvB 4499 1845 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_33240 5088 4579 gene locus_tag LOCUS_33250 5088 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 5248 5691 gene locus_tag LOCUS_33260 5248 5691 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 protein_id gnl|my_center|LOCUS_33260 5774 6550 gene locus_tag LOCUS_33270 5774 6550 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_33270 6637 7278 gene locus_tag LOCUS_33280 6637 7278 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965344.1 protein_id gnl|my_center|LOCUS_33280 8035 7292 gene locus_tag LOCUS_33290 8035 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 8420 8238 gene locus_tag LOCUS_33300 8420 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 9354 8698 gene locus_tag LOCUS_33310 9354 8698 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_33310 10378 9386 gene locus_tag LOCUS_33320 10378 9386 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_33320 10609 10872 gene locus_tag LOCUS_33330 10609 10872 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921375.1 protein_id gnl|my_center|LOCUS_33330 12240 10897 gene locus_tag LOCUS_33340 12240 10897 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390686.1 protein_id gnl|my_center|LOCUS_33340 <12864 12237 gene locus_tag LOCUS_33350 <12864 12237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257385.1:class I SAM-dependent methyltransferase >Feature sequence162 <1 557 gene locus_tag LOCUS_33360 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918829.1:choline dehydrogenase 934 2235 gene locus_tag LOCUS_33370 934 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 2297 3787 gene locus_tag LOCUS_33380 2297 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 6518 3870 gene locus_tag LOCUS_33390 6518 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 6711 8396 gene locus_tag LOCUS_33400 6711 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 9473 8388 gene locus_tag LOCUS_33410 9473 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 12393 9538 gene locus_tag LOCUS_33420 12393 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 10307 10223 gene locus_tag LOCUS_t00320 10307 10223 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence163 <1 640 gene locus_tag LOCUS_33430 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014330590.1:response regulator transcription factor 637 2139 gene locus_tag LOCUS_33440 637 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 2363 3649 gene locus_tag LOCUS_33450 2363 3649 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928673.1 protein_id gnl|my_center|LOCUS_33450 3646 4971 gene locus_tag LOCUS_33460 3646 4971 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975627.1 protein_id gnl|my_center|LOCUS_33460 4981 6234 gene locus_tag LOCUS_33470 4981 6234 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803855.1 protein_id gnl|my_center|LOCUS_33470 6231 8093 gene locus_tag LOCUS_33480 6231 8093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_33480 8090 8971 gene locus_tag LOCUS_33490 8090 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 9176 9820 gene locus_tag LOCUS_33500 9176 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 11189 9729 gene locus_tag LOCUS_33510 11189 9729 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926880.1 protein_id gnl|my_center|LOCUS_33510 12796 11186 gene locus_tag LOCUS_33520 12796 11186 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337338.1 protein_id gnl|my_center|LOCUS_33520 >Feature sequence164 <1 916 gene locus_tag LOCUS_33530 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089252.1:thymidylate synthase 913 1404 gene locus_tag LOCUS_33540 913 1404 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089251.1 protein_id gnl|my_center|LOCUS_33540 1401 1937 gene locus_tag LOCUS_33550 1401 1937 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919987.1 protein_id gnl|my_center|LOCUS_33550 1967 2881 gene locus_tag LOCUS_33560 1967 2881 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_33560 3126 2920 gene locus_tag LOCUS_33570 3126 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 3088 3387 gene locus_tag LOCUS_33580 3088 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 4643 3546 gene locus_tag LOCUS_33590 4643 3546 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170828.1 protein_id gnl|my_center|LOCUS_33590 5012 6043 gene locus_tag LOCUS_33600 gene hflK 5012 6043 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_33600 6040 6930 gene locus_tag LOCUS_33610 gene hflC 6040 6930 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_33610 7156 8640 gene locus_tag LOCUS_33620 7156 8640 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_33620 9623 8637 gene locus_tag LOCUS_33630 gene dusB 9623 8637 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640316.1 protein_id gnl|my_center|LOCUS_33630 10510 9620 gene locus_tag LOCUS_33640 gene serB 10510 9620 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640406.1 protein_id gnl|my_center|LOCUS_33640 10708 11634 gene locus_tag LOCUS_33650 gene miaA 10708 11634 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089244.1 protein_id gnl|my_center|LOCUS_33650 >Feature sequence165 247 17 gene locus_tag LOCUS_33660 247 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 1151 1429 gene locus_tag LOCUS_33670 1151 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 1747 1586 gene locus_tag LOCUS_33680 1747 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 2113 2940 gene locus_tag LOCUS_33690 gene panB 2113 2940 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086824.1 protein_id gnl|my_center|LOCUS_33690 4857 2944 gene locus_tag LOCUS_33700 gene cysN 4857 2944 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_33700 5765 4857 gene locus_tag LOCUS_33710 gene cysD 5765 4857 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 protein_id gnl|my_center|LOCUS_33710 6911 5871 gene locus_tag LOCUS_33720 6911 5871 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214278.1 protein_id gnl|my_center|LOCUS_33720 7421 6978 gene locus_tag LOCUS_33730 7421 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 7744 7424 gene locus_tag LOCUS_33740 7744 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 8646 8110 gene locus_tag LOCUS_33750 8646 8110 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082987.1 protein_id gnl|my_center|LOCUS_33750 10015 8633 gene locus_tag LOCUS_33760 10015 8633 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 protein_id gnl|my_center|LOCUS_33760 10380 10012 gene locus_tag LOCUS_33770 10380 10012 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704585.1 protein_id gnl|my_center|LOCUS_33770 11015 10380 gene locus_tag LOCUS_33780 11015 10380 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 protein_id gnl|my_center|LOCUS_33780 <12724 11020 gene locus_tag LOCUS_33790 <12724 11020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919640.1:cytochrome o ubiquinol oxidase subunit I >Feature sequence166 <1 946 gene locus_tag LOCUS_33800 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000105162.1:site-specific DNA-methyltransferase 950 3664 gene locus_tag LOCUS_33810 950 3664 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_33810 4032 3757 gene locus_tag LOCUS_33820 4032 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 5011 4046 gene locus_tag LOCUS_33830 5011 4046 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 protein_id gnl|my_center|LOCUS_33830 5755 5294 gene locus_tag LOCUS_33840 5755 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 5969 6304 gene locus_tag LOCUS_33850 5969 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 6311 7021 gene locus_tag LOCUS_33860 6311 7021 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184155626.1 protein_id gnl|my_center|LOCUS_33860 7287 7030 gene locus_tag LOCUS_33870 7287 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 7448 8383 gene locus_tag LOCUS_33880 7448 8383 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011313588.1 protein_id gnl|my_center|LOCUS_33880 8596 8799 gene locus_tag LOCUS_33890 8596 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 8984 10345 gene locus_tag LOCUS_33900 gene repC 8984 10345 CDS product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969720.1 protein_id gnl|my_center|LOCUS_33900 10483 11133 gene locus_tag LOCUS_33910 gene parA 10483 11133 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666923.1 protein_id gnl|my_center|LOCUS_33910 11216 11536 gene locus_tag LOCUS_33920 11216 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 >Feature sequence167 3596 264 gene locus_tag LOCUS_33930 3596 264 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_33930 6467 3600 gene locus_tag LOCUS_33940 6467 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 10071 6475 gene locus_tag LOCUS_33950 10071 6475 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_33950 10950 10072 gene locus_tag LOCUS_33960 10950 10072 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 protein_id gnl|my_center|LOCUS_33960 11185 12381 gene locus_tag LOCUS_33970 11185 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026192137.1 protein_id gnl|my_center|LOCUS_33970 >Feature sequence168 437 1423 gene locus_tag LOCUS_33980 437 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 2518 1817 gene locus_tag LOCUS_33990 2518 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 3296 2922 gene locus_tag LOCUS_34000 3296 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 3504 4208 gene locus_tag LOCUS_34010 3504 4208 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074390.1 protein_id gnl|my_center|LOCUS_34010 4201 4506 gene locus_tag LOCUS_34020 4201 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 4783 4944 gene locus_tag LOCUS_34030 4783 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 6131 5793 gene locus_tag LOCUS_34040 6131 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 6361 6603 gene locus_tag LOCUS_34050 6361 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 7460 6783 gene locus_tag LOCUS_34060 7460 6783 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112313490.1 protein_id gnl|my_center|LOCUS_34060 7751 8320 gene locus_tag LOCUS_34070 7751 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 9924 8890 gene locus_tag LOCUS_34080 9924 8890 CDS product IS110-like element ISCc4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640573.1 protein_id gnl|my_center|LOCUS_34080 10896 10696 gene locus_tag LOCUS_34090 10896 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 11643 11332 gene locus_tag LOCUS_34100 11643 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 <12624 11726 gene locus_tag LOCUS_34110 <12624 11726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967069.1:fatty acid desaturase >Feature sequence169 378 1073 gene locus_tag LOCUS_34120 378 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 1066 1875 gene locus_tag LOCUS_34130 1066 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 2484 2281 gene locus_tag LOCUS_34140 2484 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 2740 2931 gene locus_tag LOCUS_34150 2740 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 3761 4129 gene locus_tag LOCUS_34160 3761 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 4971 4294 gene locus_tag LOCUS_34170 4971 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 5395 6327 gene locus_tag LOCUS_34180 5395 6327 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_34180 7429 6575 gene locus_tag LOCUS_34190 7429 6575 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085604.1 protein_id gnl|my_center|LOCUS_34190 7620 10841 gene locus_tag LOCUS_34200 7620 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 10965 11879 gene locus_tag LOCUS_34210 10965 11879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 >Feature sequence170 842 117 gene locus_tag LOCUS_34220 gene arsH 842 117 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919380.1 protein_id gnl|my_center|LOCUS_34220 1252 842 gene locus_tag LOCUS_34230 gene arsC 1252 842 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085868.1 protein_id gnl|my_center|LOCUS_34230 2283 1252 gene locus_tag LOCUS_34240 gene arsB 2283 1252 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164747183.1 protein_id gnl|my_center|LOCUS_34240 2810 2283 gene locus_tag LOCUS_34250 2810 2283 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 protein_id gnl|my_center|LOCUS_34250 3162 2803 gene locus_tag LOCUS_34260 3162 2803 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971665.1 protein_id gnl|my_center|LOCUS_34260 3986 3390 gene locus_tag LOCUS_34270 3986 3390 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528613.1 protein_id gnl|my_center|LOCUS_34270 4698 3997 gene locus_tag LOCUS_34280 4698 3997 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888239.1 protein_id gnl|my_center|LOCUS_34280 4807 5925 gene locus_tag LOCUS_34290 4807 5925 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035337.1 protein_id gnl|my_center|LOCUS_34290 5919 8468 gene locus_tag LOCUS_34300 5919 8468 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_34300 9035 9865 gene locus_tag LOCUS_34310 9035 9865 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 protein_id gnl|my_center|LOCUS_34310 10363 11034 gene locus_tag LOCUS_34320 10363 11034 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267054.1 protein_id gnl|my_center|LOCUS_34320 >Feature sequence171 138 596 gene locus_tag LOCUS_34330 138 596 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073267.1 protein_id gnl|my_center|LOCUS_34330 665 1102 gene locus_tag LOCUS_34340 gene apaG 665 1102 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533640.1 protein_id gnl|my_center|LOCUS_34340 1197 1841 gene locus_tag LOCUS_34350 gene folE 1197 1841 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202069.1 protein_id gnl|my_center|LOCUS_34350 1844 2989 gene locus_tag LOCUS_34360 gene argE 1844 2989 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534727.1 protein_id gnl|my_center|LOCUS_34360 3295 4236 gene locus_tag LOCUS_34370 gene metA 3295 4236 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972516.1 protein_id gnl|my_center|LOCUS_34370 4605 5867 gene locus_tag LOCUS_34380 4605 5867 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_34380 5864 7975 gene locus_tag LOCUS_34390 5864 7975 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932070.1 protein_id gnl|my_center|LOCUS_34390 9014 8247 gene locus_tag LOCUS_34400 9014 8247 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920920.1 protein_id gnl|my_center|LOCUS_34400 11161 9134 gene locus_tag LOCUS_34410 11161 9134 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090481.1 protein_id gnl|my_center|LOCUS_34410 12054 11365 gene locus_tag LOCUS_34420 12054 11365 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383630.1 protein_id gnl|my_center|LOCUS_34420 12162 12238 gene locus_tag LOCUS_t00330 12162 12238 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence172 1158 493 gene locus_tag LOCUS_34430 1158 493 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967602.1 protein_id gnl|my_center|LOCUS_34430 1760 1248 gene locus_tag LOCUS_34440 1760 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 3562 2237 gene locus_tag LOCUS_34450 3562 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 4067 4651 gene locus_tag LOCUS_34460 4067 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 4757 5083 gene locus_tag LOCUS_34470 4757 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 5080 5787 gene locus_tag LOCUS_34480 5080 5787 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113481.1 protein_id gnl|my_center|LOCUS_34480 5804 6448 gene locus_tag LOCUS_34490 5804 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 6489 6806 gene locus_tag LOCUS_34500 6489 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 7823 6846 gene locus_tag LOCUS_34510 7823 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 8877 9410 gene locus_tag LOCUS_34520 8877 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 12201 9811 gene locus_tag LOCUS_34530 12201 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 >Feature sequence173 252 1319 gene locus_tag LOCUS_34540 252 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 4903 1673 gene locus_tag LOCUS_34550 4903 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 5344 5544 gene locus_tag LOCUS_34560 5344 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 7418 5820 gene locus_tag LOCUS_34570 7418 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 9147 7453 gene locus_tag LOCUS_34580 9147 7453 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 protein_id gnl|my_center|LOCUS_34580 9461 9601 gene locus_tag LOCUS_34590 9461 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 9936 9733 gene locus_tag LOCUS_34600 9936 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 10268 9951 gene locus_tag LOCUS_34610 10268 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 10494 10853 gene locus_tag LOCUS_34620 10494 10853 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668232.1 protein_id gnl|my_center|LOCUS_34620 10846 11733 gene locus_tag LOCUS_34630 10846 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 >Feature sequence174 1594 362 gene locus_tag LOCUS_34640 1594 362 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388051.1 protein_id gnl|my_center|LOCUS_34640 2501 2037 gene locus_tag LOCUS_34650 2501 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 3267 3515 gene locus_tag LOCUS_34660 3267 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 4094 3555 gene locus_tag LOCUS_34670 4094 3555 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727443.1 protein_id gnl|my_center|LOCUS_34670 4432 4653 gene locus_tag LOCUS_34680 4432 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 5307 8099 gene locus_tag LOCUS_34690 5307 8099 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 protein_id gnl|my_center|LOCUS_34690 8232 10361 gene locus_tag LOCUS_34700 8232 10361 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000371.1 protein_id gnl|my_center|LOCUS_34700 10358 10618 gene locus_tag LOCUS_34710 10358 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 11313 11486 gene locus_tag LOCUS_34720 11313 11486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34720 >Feature sequence175 986 27 gene locus_tag LOCUS_34730 gene thiL 986 27 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919238.1 protein_id gnl|my_center|LOCUS_34730 1536 1030 gene locus_tag LOCUS_34740 gene nusB 1536 1030 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087789.1 protein_id gnl|my_center|LOCUS_34740 1988 1533 gene locus_tag LOCUS_34750 1988 1533 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312824.1 protein_id gnl|my_center|LOCUS_34750 3097 1985 gene locus_tag LOCUS_34760 gene ribB 3097 1985 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_34760 3694 3101 gene locus_tag LOCUS_34770 3694 3101 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_34770 4808 3705 gene locus_tag LOCUS_34780 gene ribD 4808 3705 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 protein_id gnl|my_center|LOCUS_34780 5403 4945 gene locus_tag LOCUS_34790 gene nrdR 5403 4945 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919235.1 protein_id gnl|my_center|LOCUS_34790 6718 5414 gene locus_tag LOCUS_34800 6718 5414 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312829.1 protein_id gnl|my_center|LOCUS_34800 7158 7607 gene locus_tag LOCUS_34810 7158 7607 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389582.1 protein_id gnl|my_center|LOCUS_34810 8542 7718 gene locus_tag LOCUS_34820 8542 7718 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 protein_id gnl|my_center|LOCUS_34820 9321 8539 gene locus_tag LOCUS_34830 9321 8539 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_34830 10376 9321 gene locus_tag LOCUS_34840 10376 9321 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 protein_id gnl|my_center|LOCUS_34840 11035 10379 gene locus_tag LOCUS_34850 gene tmk 11035 10379 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919690.1 protein_id gnl|my_center|LOCUS_34850 <12085 11032 gene locus_tag LOCUS_34860 <12085 11032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389394.1:D-alanyl-D-alanine carboxypeptidase family protein >Feature sequence176 211 1383 gene locus_tag LOCUS_34870 211 1383 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918664.1 protein_id gnl|my_center|LOCUS_34870 3176 1662 gene locus_tag LOCUS_34880 3176 1662 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965215.1 protein_id gnl|my_center|LOCUS_34880 3581 3841 gene locus_tag LOCUS_34890 3581 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34890 3846 6251 gene locus_tag LOCUS_34900 gene copA1 3846 6251 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_34900 6255 6674 gene locus_tag LOCUS_34910 gene cueR 6255 6674 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266543.1 protein_id gnl|my_center|LOCUS_34910 7445 8416 gene locus_tag LOCUS_34920 gene cyoA 7445 8416 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832113.1 protein_id gnl|my_center|LOCUS_34920 8418 10394 gene locus_tag LOCUS_34930 gene cyoB 8418 10394 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467158.1 protein_id gnl|my_center|LOCUS_34930 10399 11034 gene locus_tag LOCUS_34940 10399 11034 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061708214.1 protein_id gnl|my_center|LOCUS_34940 11034 11402 gene locus_tag LOCUS_34950 gene cyoD 11034 11402 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061307.1 protein_id gnl|my_center|LOCUS_34950 >Feature sequence177 <1 1861 gene locus_tag LOCUS_34960 <1 1861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338564.1:transglycosylase SLT domain-containing protein 2119 1850 gene locus_tag LOCUS_34970 2119 1850 CDS product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241004.1 protein_id gnl|my_center|LOCUS_34970 2979 2638 gene locus_tag LOCUS_34980 2979 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 4689 3208 gene locus_tag LOCUS_34990 gene gatB 4689 3208 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401529.1 protein_id gnl|my_center|LOCUS_34990 6167 4686 gene locus_tag LOCUS_35000 gene gatA 6167 4686 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087849.1 protein_id gnl|my_center|LOCUS_35000 6640 6164 gene locus_tag LOCUS_35010 6640 6164 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531786.1 protein_id gnl|my_center|LOCUS_35010 6930 6643 gene locus_tag LOCUS_35020 gene gatC 6930 6643 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920296.1 protein_id gnl|my_center|LOCUS_35020 7021 7395 gene locus_tag LOCUS_35030 7021 7395 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800772.1 protein_id gnl|my_center|LOCUS_35030 7526 7993 gene locus_tag LOCUS_35040 gene ruvX 7526 7993 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719835.1 protein_id gnl|my_center|LOCUS_35040 7990 8901 gene locus_tag LOCUS_35050 7990 8901 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240746.1 protein_id gnl|my_center|LOCUS_35050 8945 9907 gene locus_tag LOCUS_35060 8945 9907 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390938.1 protein_id gnl|my_center|LOCUS_35060 9904 11202 gene locus_tag LOCUS_35070 gene pyrC 9904 11202 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920302.1 protein_id gnl|my_center|LOCUS_35070 11202 11822 gene locus_tag LOCUS_35080 gene plsY 11202 11822 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383394.1 protein_id gnl|my_center|LOCUS_35080 >Feature sequence178 383 108 gene locus_tag LOCUS_35090 gene yidD 383 108 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032814320.1 protein_id gnl|my_center|LOCUS_35090 382 693 gene locus_tag LOCUS_35100 382 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 1386 2804 gene locus_tag LOCUS_35110 1386 2804 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175987.1 protein_id gnl|my_center|LOCUS_35110 2807 3574 gene locus_tag LOCUS_35120 2807 3574 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085533.1 protein_id gnl|my_center|LOCUS_35120 3584 4597 gene locus_tag LOCUS_35130 3584 4597 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920048.1 protein_id gnl|my_center|LOCUS_35130 5868 4690 gene locus_tag LOCUS_35140 5868 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391064.1 protein_id gnl|my_center|LOCUS_35140 6246 6322 gene locus_tag LOCUS_t00340 6246 6322 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7807 6758 gene locus_tag LOCUS_35150 7807 6758 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532261.1 protein_id gnl|my_center|LOCUS_35150 8133 8624 gene locus_tag LOCUS_35160 8133 8624 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941703.1 protein_id gnl|my_center|LOCUS_35160 9499 8840 gene locus_tag LOCUS_35170 9499 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 9897 10049 gene locus_tag LOCUS_35180 9897 10049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 10052 10675 gene locus_tag LOCUS_35190 10052 10675 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_35190 11008 11751 gene locus_tag LOCUS_35200 gene zupT 11008 11751 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020444.1 protein_id gnl|my_center|LOCUS_35200 >Feature sequence179 <1 764 gene locus_tag LOCUS_35210 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103910.1:MFS transporter 1066 1662 gene locus_tag LOCUS_35220 1066 1662 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919061.1 protein_id gnl|my_center|LOCUS_35220 1704 2738 gene locus_tag LOCUS_35230 1704 2738 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_35230 2873 4147 gene locus_tag LOCUS_35240 2873 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 7265 4155 gene locus_tag LOCUS_35250 7265 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_35250 7740 8639 gene locus_tag LOCUS_35260 7740 8639 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532086.1 protein_id gnl|my_center|LOCUS_35260 10214 8730 gene locus_tag LOCUS_35270 10214 8730 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_35270 10384 10521 gene locus_tag LOCUS_35280 10384 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 >Feature sequence180 1060 713 gene locus_tag LOCUS_35290 gene tnpB 1060 713 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041414013.1 protein_id gnl|my_center|LOCUS_35290 1443 1057 gene locus_tag LOCUS_35300 1443 1057 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082866.1 protein_id gnl|my_center|LOCUS_35300 2138 2389 gene locus_tag LOCUS_35310 2138 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 2438 3844 gene locus_tag LOCUS_35320 2438 3844 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_35320 4707 4111 gene locus_tag LOCUS_35330 4707 4111 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730986.1 protein_id gnl|my_center|LOCUS_35330 4824 5699 gene locus_tag LOCUS_35340 4824 5699 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245963.1 protein_id gnl|my_center|LOCUS_35340 5850 6716 gene locus_tag LOCUS_35350 5850 6716 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_35350 6763 7074 gene locus_tag LOCUS_35360 6763 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 7093 7962 gene locus_tag LOCUS_35370 7093 7962 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533046.1 protein_id gnl|my_center|LOCUS_35370 7981 8538 gene locus_tag LOCUS_35380 7981 8538 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898046.1 protein_id gnl|my_center|LOCUS_35380 8542 9303 gene locus_tag LOCUS_35390 8542 9303 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203813331.1 protein_id gnl|my_center|LOCUS_35390 9319 9873 gene locus_tag LOCUS_35400 9319 9873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 10045 11031 gene locus_tag LOCUS_35410 gene trxB 10045 11031 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265863.1 protein_id gnl|my_center|LOCUS_35410 10991 11491 gene locus_tag LOCUS_35420 10991 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 >Feature sequence181 26 448 gene locus_tag LOCUS_35430 26 448 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_35430 545 1912 gene locus_tag LOCUS_35440 545 1912 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_35440 1909 2508 gene locus_tag LOCUS_35450 1909 2508 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_35450 3157 2519 gene locus_tag LOCUS_35460 3157 2519 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_35460 3297 4793 gene locus_tag LOCUS_35470 3297 4793 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_35470 4838 6895 gene locus_tag LOCUS_35480 4838 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 7710 6907 gene locus_tag LOCUS_35490 7710 6907 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921271.1 protein_id gnl|my_center|LOCUS_35490 8219 7707 gene locus_tag LOCUS_35500 8219 7707 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067226.1 protein_id gnl|my_center|LOCUS_35500 9315 8233 gene locus_tag LOCUS_35510 9315 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 10796 9474 gene locus_tag LOCUS_35520 10796 9474 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067224.1 protein_id gnl|my_center|LOCUS_35520 <11929 10793 gene locus_tag LOCUS_35530 <11929 10793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083265.1:peptidoglycan DD-metalloendopeptidase family protein >Feature sequence182 2342 255 gene locus_tag LOCUS_35540 2342 255 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_35540 2590 4761 gene locus_tag LOCUS_35550 2590 4761 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918820.1 protein_id gnl|my_center|LOCUS_35550 6012 4828 gene locus_tag LOCUS_35560 6012 4828 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113288.1 protein_id gnl|my_center|LOCUS_35560 6168 6794 gene locus_tag LOCUS_35570 6168 6794 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_35570 7661 6813 gene locus_tag LOCUS_35580 7661 6813 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387901.1 protein_id gnl|my_center|LOCUS_35580 7794 8741 gene locus_tag LOCUS_35590 7794 8741 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038808.1 protein_id gnl|my_center|LOCUS_35590 8876 11008 gene locus_tag LOCUS_35600 8876 11008 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173315.1 protein_id gnl|my_center|LOCUS_35600 >Feature sequence183 <1 869 gene locus_tag LOCUS_35610 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812086.1:sulfatase-like hydrolase/transferase 973 2007 gene locus_tag LOCUS_35620 973 2007 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065005.1 protein_id gnl|my_center|LOCUS_35620 2018 2527 gene locus_tag LOCUS_35630 2018 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 2524 3816 gene locus_tag LOCUS_35640 2524 3816 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_35640 3892 4221 gene locus_tag LOCUS_35650 3892 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 4812 5837 gene locus_tag LOCUS_35660 4812 5837 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206816.1 protein_id gnl|my_center|LOCUS_35660 6727 5858 gene locus_tag LOCUS_35670 gene pcaQ 6727 5858 CDS product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037467939.1 protein_id gnl|my_center|LOCUS_35670 7887 6910 gene locus_tag LOCUS_35680 gene tauD 7887 6910 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095796.1 protein_id gnl|my_center|LOCUS_35680 8474 8875 gene locus_tag LOCUS_35690 8474 8875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 9201 10733 gene locus_tag LOCUS_35700 9201 10733 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 protein_id gnl|my_center|LOCUS_35700 >Feature sequence184 <1 570 gene locus_tag LOCUS_35710 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225700.1:amidohydrolase family protein 651 1853 gene locus_tag LOCUS_35720 651 1853 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_35720 2210 1893 gene locus_tag LOCUS_35730 2210 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 3418 2405 gene locus_tag LOCUS_35740 3418 2405 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088955.1 protein_id gnl|my_center|LOCUS_35740 2933 2942 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3932 3564 gene locus_tag LOCUS_35750 3932 3564 CDS product DUF6285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085729.1 protein_id gnl|my_center|LOCUS_35750 4921 3935 gene locus_tag LOCUS_35760 4921 3935 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085728.1 protein_id gnl|my_center|LOCUS_35760 7041 4954 gene locus_tag LOCUS_35770 gene recG 7041 4954 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531908.1 protein_id gnl|my_center|LOCUS_35770 7521 7820 gene locus_tag LOCUS_35780 7521 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 7824 11294 gene locus_tag LOCUS_35790 gene mfd 7824 11294 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919710.1 protein_id gnl|my_center|LOCUS_35790 >Feature sequence185 1272 727 gene locus_tag LOCUS_35800 1272 727 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087408.1 protein_id gnl|my_center|LOCUS_35800 1657 1436 gene locus_tag LOCUS_35810 1657 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 1943 2824 gene locus_tag LOCUS_35820 1943 2824 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266170.1 protein_id gnl|my_center|LOCUS_35820 3943 3557 gene locus_tag LOCUS_35830 3943 3557 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_35830 4980 4177 gene locus_tag LOCUS_35840 4980 4177 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072492.1 protein_id gnl|my_center|LOCUS_35840 5284 7635 gene locus_tag LOCUS_35850 5284 7635 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_35850 8515 7724 gene locus_tag LOCUS_35860 8515 7724 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115017.1 protein_id gnl|my_center|LOCUS_35860 8970 9314 gene locus_tag LOCUS_35870 8970 9314 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265729.1 protein_id gnl|my_center|LOCUS_35870 9766 11007 gene locus_tag LOCUS_35880 9766 11007 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_35880 >Feature sequence186 267 557 gene locus_tag LOCUS_35890 267 557 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390588.1 protein_id gnl|my_center|LOCUS_35890 567 899 gene locus_tag LOCUS_35900 567 899 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390589.1 protein_id gnl|my_center|LOCUS_35900 940 1140 gene locus_tag LOCUS_35910 940 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 1154 1582 gene locus_tag LOCUS_35920 1154 1582 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887982.1 protein_id gnl|my_center|LOCUS_35920 3022 1868 gene locus_tag LOCUS_35930 3022 1868 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 protein_id gnl|my_center|LOCUS_35930 3149 4144 gene locus_tag LOCUS_35940 3149 4144 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_35940 4141 7572 gene locus_tag LOCUS_35950 4141 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 7569 8456 gene locus_tag LOCUS_35960 7569 8456 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_35960 8472 9131 gene locus_tag LOCUS_35970 8472 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109928.1 protein_id gnl|my_center|LOCUS_35970 9134 11452 gene locus_tag LOCUS_35980 9134 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence187 249 590 gene locus_tag LOCUS_35990 249 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 734 2161 gene locus_tag LOCUS_36000 734 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 2950 2168 gene locus_tag LOCUS_36010 2950 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 4074 2941 gene locus_tag LOCUS_36020 4074 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 4927 4055 gene locus_tag LOCUS_36030 4927 4055 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_36030 5952 4924 gene locus_tag LOCUS_36040 5952 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 7567 6119 gene locus_tag LOCUS_36050 7567 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 8415 7564 gene locus_tag LOCUS_36060 8415 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 10753 8576 gene locus_tag LOCUS_36070 10753 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 11254 11460 gene locus_tag LOCUS_36080 11254 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence188 1684 311 gene locus_tag LOCUS_36090 1684 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 6982 5825 gene locus_tag LOCUS_36100 6982 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 8257 6986 gene locus_tag LOCUS_36110 8257 6986 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_36110 9307 8378 gene locus_tag LOCUS_36120 9307 8378 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970323.1 protein_id gnl|my_center|LOCUS_36120 9906 9304 gene locus_tag LOCUS_36130 9906 9304 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084435184.1 protein_id gnl|my_center|LOCUS_36130 >Feature sequence189 515 799 gene locus_tag LOCUS_36140 515 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 836 2164 gene locus_tag LOCUS_36150 836 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 2364 3383 gene locus_tag LOCUS_36160 2364 3383 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705723.1 protein_id gnl|my_center|LOCUS_36160 3769 3599 gene locus_tag LOCUS_36170 3769 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 4543 3875 gene locus_tag LOCUS_36180 4543 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 4786 4568 gene locus_tag LOCUS_36190 4786 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 5224 4814 gene locus_tag LOCUS_36200 5224 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 5587 5285 gene locus_tag LOCUS_36210 5587 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 6036 5584 gene locus_tag LOCUS_36220 6036 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 6885 6301 gene locus_tag LOCUS_36230 6885 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 7073 8413 gene locus_tag LOCUS_36240 7073 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 8343 9053 gene locus_tag LOCUS_36250 8343 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 9040 9504 gene locus_tag LOCUS_36260 9040 9504 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929175.1 protein_id gnl|my_center|LOCUS_36260 9491 11206 gene locus_tag LOCUS_36270 9491 11206 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_36270 11203 11499 gene locus_tag LOCUS_36280 11203 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 >Feature sequence190 250 426 gene locus_tag LOCUS_36290 250 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 1920 580 gene locus_tag LOCUS_36300 1920 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 2335 3552 gene locus_tag LOCUS_36310 2335 3552 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_36310 5364 4807 gene locus_tag LOCUS_36320 5364 4807 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389900.1 protein_id gnl|my_center|LOCUS_36320 6632 5370 gene locus_tag LOCUS_36330 6632 5370 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182199.1 protein_id gnl|my_center|LOCUS_36330 7891 6629 gene locus_tag LOCUS_36340 7891 6629 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_36340 8079 8387 gene locus_tag LOCUS_36350 8079 8387 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184504.1 protein_id gnl|my_center|LOCUS_36350 8387 9412 gene locus_tag LOCUS_36360 8387 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 9942 9472 gene locus_tag LOCUS_36370 9942 9472 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537487.1 protein_id gnl|my_center|LOCUS_36370 10103 10675 gene locus_tag LOCUS_36380 10103 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 >Feature sequence191 3 1256 gene locus_tag LOCUS_36390 3 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 1584 2990 gene locus_tag LOCUS_36400 1584 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 3155 3604 gene locus_tag LOCUS_36410 3155 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 3604 4770 gene locus_tag LOCUS_36420 3604 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 4763 5509 gene locus_tag LOCUS_36430 4763 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 6991 8163 gene locus_tag LOCUS_36440 6991 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 8166 9974 gene locus_tag LOCUS_36450 gene asnB 8166 9974 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_36450 9952 10101 gene locus_tag LOCUS_36460 9952 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 10336 10998 gene locus_tag LOCUS_36470 10336 10998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 >Feature sequence192 3069 1033 gene locus_tag LOCUS_36480 3069 1033 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679308.1 protein_id gnl|my_center|LOCUS_36480 3290 3084 gene locus_tag LOCUS_36490 3290 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 4163 5617 gene locus_tag LOCUS_36500 4163 5617 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_36500 5843 10162 gene locus_tag LOCUS_36510 5843 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 11402 10920 gene locus_tag LOCUS_36520 11402 10920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 >Feature sequence193 1979 2689 gene locus_tag LOCUS_36530 1979 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 3570 8864 gene locus_tag LOCUS_36540 3570 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 <11429 10238 gene locus_tag LOCUS_36550 <11429 10238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923241.1:ABC transporter ATP-binding protein/permease >Feature sequence194 <1 527 gene locus_tag LOCUS_36560 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883981.1:DEAD/DEAH box helicase 605 3373 gene locus_tag LOCUS_36570 605 3373 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_36570 3375 8000 gene locus_tag LOCUS_36580 3375 8000 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_36580 7972 9969 gene locus_tag LOCUS_36590 7972 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 >Feature sequence195 1014 268 gene locus_tag LOCUS_36600 1014 268 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_36600 1218 2354 gene locus_tag LOCUS_36610 1218 2354 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814691.1 protein_id gnl|my_center|LOCUS_36610 2701 2399 gene locus_tag LOCUS_36620 2701 2399 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083363.1 protein_id gnl|my_center|LOCUS_36620 2777 3124 gene locus_tag LOCUS_36630 2777 3124 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528779.1 protein_id gnl|my_center|LOCUS_36630 3760 3224 gene locus_tag LOCUS_36640 gene thpR 3760 3224 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972484.1 protein_id gnl|my_center|LOCUS_36640 5304 3757 gene locus_tag LOCUS_36650 gene murJ 5304 3757 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088657.1 protein_id gnl|my_center|LOCUS_36650 5981 5304 gene locus_tag LOCUS_36660 5981 5304 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_36660 6019 6723 gene locus_tag LOCUS_36670 6019 6723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470636.1 protein_id gnl|my_center|LOCUS_36670 7078 9603 gene locus_tag LOCUS_36680 7078 9603 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083292.1 protein_id gnl|my_center|LOCUS_36680 9905 10657 gene locus_tag LOCUS_36690 9905 10657 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508710.1 protein_id gnl|my_center|LOCUS_36690 11190 10795 gene locus_tag LOCUS_36700 11190 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 >Feature sequence196 598 176 gene locus_tag LOCUS_36710 598 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 1703 675 gene locus_tag LOCUS_36720 1703 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 5305 2129 gene locus_tag LOCUS_36730 5305 2129 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_36730 5948 5325 gene locus_tag LOCUS_36740 5948 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 6663 5962 gene locus_tag LOCUS_36750 6663 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 8024 6660 gene locus_tag LOCUS_36760 8024 6660 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926902.1 protein_id gnl|my_center|LOCUS_36760 9606 8014 gene locus_tag LOCUS_36770 9606 8014 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_36770 10340 9825 gene locus_tag LOCUS_36780 10340 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 11308 10352 gene locus_tag LOCUS_36790 11308 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 >Feature sequence197 2835 2344 gene locus_tag LOCUS_36800 2835 2344 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919004.1 protein_id gnl|my_center|LOCUS_36800 4495 2822 gene locus_tag LOCUS_36810 4495 2822 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975275.1 protein_id gnl|my_center|LOCUS_36810 4871 4482 gene locus_tag LOCUS_36820 4871 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 5065 6972 gene locus_tag LOCUS_36830 5065 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 6980 8455 gene locus_tag LOCUS_36840 6980 8455 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020056.1 protein_id gnl|my_center|LOCUS_36840 9546 8548 gene locus_tag LOCUS_36850 9546 8548 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_36850 10133 9738 gene locus_tag LOCUS_36860 10133 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 11058 10198 gene locus_tag LOCUS_36870 gene speE 11058 10198 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829972.1 protein_id gnl|my_center|LOCUS_36870 >Feature sequence198 841 323 gene locus_tag LOCUS_36880 841 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 1648 1367 gene locus_tag LOCUS_36890 1648 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 1733 1945 gene locus_tag LOCUS_36900 1733 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 4840 4424 gene locus_tag LOCUS_36910 4840 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 6233 5691 gene locus_tag LOCUS_36920 6233 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 8220 7654 gene locus_tag LOCUS_36930 8220 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 9680 8592 gene locus_tag LOCUS_36940 gene gmd 9680 8592 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169624.1 protein_id gnl|my_center|LOCUS_36940 <11293 9763 gene locus_tag LOCUS_36950 <11293 9763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481418.1:SLBB domain-containing protein >Feature sequence199 911 588 gene locus_tag LOCUS_36960 911 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 1646 1029 gene locus_tag LOCUS_36970 1646 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 1966 1658 gene locus_tag LOCUS_36980 1966 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 2386 2093 gene locus_tag LOCUS_36990 2386 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 2734 3363 gene locus_tag LOCUS_37000 2734 3363 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547672.1 protein_id gnl|my_center|LOCUS_37000 3360 3587 gene locus_tag LOCUS_37010 3360 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 4919 3699 gene locus_tag LOCUS_37020 4919 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 7681 4916 gene locus_tag LOCUS_37030 7681 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 7961 7737 gene locus_tag LOCUS_37040 7961 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 8950 7958 gene locus_tag LOCUS_37050 8950 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 9243 10340 gene locus_tag LOCUS_37060 9243 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 <11284 10528 gene locus_tag LOCUS_37070 <11284 10528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_065538056.1:Fic family protein >Feature sequence200 215 1561 gene locus_tag LOCUS_37080 215 1561 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494221.1 protein_id gnl|my_center|LOCUS_37080 1571 3661 gene locus_tag LOCUS_37090 1571 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 3671 5719 gene locus_tag LOCUS_37100 3671 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 5716 6225 gene locus_tag LOCUS_37110 5716 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087041.1 protein_id gnl|my_center|LOCUS_37110 6611 8728 gene locus_tag LOCUS_37120 6611 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 9171 8983 gene locus_tag LOCUS_37130 9171 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 10162 9413 gene locus_tag LOCUS_37140 10162 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 11227 10268 gene locus_tag LOCUS_37150 11227 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 >Feature sequence201 644 315 gene locus_tag LOCUS_37160 644 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 643 1299 gene locus_tag LOCUS_37170 643 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 2116 1370 gene locus_tag LOCUS_37180 2116 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 2395 2159 gene locus_tag LOCUS_37190 2395 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 3168 4544 gene locus_tag LOCUS_37200 3168 4544 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_37200 4545 5507 gene locus_tag LOCUS_37210 4545 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 6000 6197 gene locus_tag LOCUS_37220 6000 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 6514 6395 gene locus_tag LOCUS_37230 6514 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 6725 7585 gene locus_tag LOCUS_37240 6725 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 8030 7821 gene locus_tag LOCUS_37250 8030 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 8252 8524 gene locus_tag LOCUS_37260 8252 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 8565 9320 gene locus_tag LOCUS_37270 8565 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 9930 9469 gene locus_tag LOCUS_37280 9930 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 10999 10748 gene locus_tag LOCUS_37290 10999 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 >Feature sequence202 454 281 gene locus_tag LOCUS_37300 454 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 757 1755 gene locus_tag LOCUS_37310 757 1755 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_37310 1768 4260 gene locus_tag LOCUS_37320 1768 4260 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 protein_id gnl|my_center|LOCUS_37320 6851 4350 gene locus_tag LOCUS_37330 6851 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 8122 6848 gene locus_tag LOCUS_37340 8122 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 9566 8361 gene locus_tag LOCUS_37350 9566 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 <11234 9577 gene locus_tag LOCUS_37360 <11234 9577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164452817.1:DEAD/DEAH box helicase >Feature sequence203 593 1711 gene locus_tag LOCUS_37370 593 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 1910 3214 gene locus_tag LOCUS_37380 1910 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 4664 3291 gene locus_tag LOCUS_37390 4664 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 7182 4711 gene locus_tag LOCUS_37400 7182 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 7976 7194 gene locus_tag LOCUS_37410 7976 7194 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532723.1 protein_id gnl|my_center|LOCUS_37410 8929 8060 gene locus_tag LOCUS_37420 8929 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 8948 9244 gene locus_tag LOCUS_37430 8948 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 11074 9311 gene locus_tag LOCUS_37440 11074 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 >Feature sequence204 1 2334 gene locus_tag LOCUS_37450 1 2334 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104585991.1 protein_id gnl|my_center|LOCUS_37450 2338 4260 gene locus_tag LOCUS_37460 2338 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 4253 5302 gene locus_tag LOCUS_37470 4253 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 5425 8193 gene locus_tag LOCUS_37480 5425 8193 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870228.1 protein_id gnl|my_center|LOCUS_37480 8190 10196 gene locus_tag LOCUS_37490 gene pglZ 8190 10196 CDS product BREX-3 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870227.1 protein_id gnl|my_center|LOCUS_37490 10196 10951 gene locus_tag LOCUS_37500 10196 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870226.1 protein_id gnl|my_center|LOCUS_37500 >Feature sequence205 1086 175 gene locus_tag LOCUS_37510 1086 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 1997 1827 gene locus_tag LOCUS_37520 1997 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 3203 2007 gene locus_tag LOCUS_37530 3203 2007 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077104.1 protein_id gnl|my_center|LOCUS_37530 6967 3200 gene locus_tag LOCUS_37540 6967 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 9396 7291 gene locus_tag LOCUS_37550 9396 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 9945 9685 gene locus_tag LOCUS_37560 9945 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 >Feature sequence206 1267 164 gene locus_tag LOCUS_37570 1267 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 1468 3084 gene locus_tag LOCUS_37580 1468 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 3198 4322 gene locus_tag LOCUS_37590 3198 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 4454 6400 gene locus_tag LOCUS_37600 4454 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 6637 8160 gene locus_tag LOCUS_37610 6637 8160 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203704.1 protein_id gnl|my_center|LOCUS_37610 8284 9276 gene locus_tag LOCUS_37620 8284 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 >Feature sequence207 252 731 gene locus_tag LOCUS_37630 252 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 1046 2191 gene locus_tag LOCUS_37640 1046 2191 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_37640 2448 4211 gene locus_tag LOCUS_37650 2448 4211 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 protein_id gnl|my_center|LOCUS_37650 4211 8380 gene locus_tag LOCUS_37660 4211 8380 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389851.1 protein_id gnl|my_center|LOCUS_37660 9400 8384 gene locus_tag LOCUS_37670 9400 8384 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919081.1 protein_id gnl|my_center|LOCUS_37670 10367 9411 gene locus_tag LOCUS_37680 10367 9411 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919082.1 protein_id gnl|my_center|LOCUS_37680 11041 10364 gene locus_tag LOCUS_37690 11041 10364 CDS product DUF969 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919083.1 protein_id gnl|my_center|LOCUS_37690 >Feature sequence208 348 10 gene locus_tag LOCUS_37700 348 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 694 410 gene locus_tag LOCUS_37710 694 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 1511 1888 gene locus_tag LOCUS_37720 1511 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37720 1912 2109 gene locus_tag LOCUS_37730 1912 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37730 2392 2135 gene locus_tag LOCUS_37740 2392 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 3226 3801 gene locus_tag LOCUS_37750 3226 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 3831 4586 gene locus_tag LOCUS_37760 3831 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 4592 6223 gene locus_tag LOCUS_37770 4592 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 8038 7574 gene locus_tag LOCUS_37780 8038 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37780 8231 7956 gene locus_tag LOCUS_37790 8231 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37790 8537 8301 gene locus_tag LOCUS_37800 8537 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37800 8864 8616 gene locus_tag LOCUS_37810 8864 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37810 9811 9560 gene locus_tag LOCUS_37820 9811 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37820 >Feature sequence209 385 236 gene locus_tag LOCUS_37830 385 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 344 619 gene locus_tag LOCUS_37840 344 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 862 1086 gene locus_tag LOCUS_37850 862 1086 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_37850 1083 1472 gene locus_tag LOCUS_37860 1083 1472 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_37860 1719 1459 gene locus_tag LOCUS_37870 1719 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 2020 2316 gene locus_tag LOCUS_37880 2020 2316 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969011.1 protein_id gnl|my_center|LOCUS_37880 2325 2633 gene locus_tag LOCUS_37890 2325 2633 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969010.1 protein_id gnl|my_center|LOCUS_37890 2717 2935 gene locus_tag LOCUS_37900 2717 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 2954 3322 gene locus_tag LOCUS_37910 2954 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 3427 4974 gene locus_tag LOCUS_37920 gene istA 3427 4974 CDS product IS21-like element ISRsp2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440448.1 protein_id gnl|my_center|LOCUS_37920 4989 5330 gene locus_tag LOCUS_37930 4989 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 7416 5347 gene locus_tag LOCUS_37940 7416 5347 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173640842.1 protein_id gnl|my_center|LOCUS_37940 7820 8212 gene locus_tag LOCUS_37950 7820 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 10297 8207 gene locus_tag LOCUS_37960 10297 8207 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967414.1 protein_id gnl|my_center|LOCUS_37960 10573 10761 gene locus_tag LOCUS_37970 10573 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 >Feature sequence210 202 1311 gene locus_tag LOCUS_37980 202 1311 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088955.1 protein_id gnl|my_center|LOCUS_37980 1552 1953 gene locus_tag LOCUS_37990 1552 1953 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811632.1 protein_id gnl|my_center|LOCUS_37990 1957 2802 gene locus_tag LOCUS_38000 gene fghA 1957 2802 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088926.1 protein_id gnl|my_center|LOCUS_38000 3043 4053 gene locus_tag LOCUS_38010 3043 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 4337 4552 gene locus_tag LOCUS_38020 4337 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 4799 5161 gene locus_tag LOCUS_38030 4799 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 5247 5816 gene locus_tag LOCUS_38040 5247 5816 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_38040 5999 6223 gene locus_tag LOCUS_38050 gene vapB 5999 6223 CDS product toxin-antitoxin system antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450524.1 protein_id gnl|my_center|LOCUS_38050 6220 6624 gene locus_tag LOCUS_38060 gene vapC 6220 6624 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 protein_id gnl|my_center|LOCUS_38060 7207 6821 gene locus_tag LOCUS_38070 7207 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 7485 7763 gene locus_tag LOCUS_38080 7485 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38080 7799 8656 gene locus_tag LOCUS_38090 7799 8656 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936644.1 protein_id gnl|my_center|LOCUS_38090 9022 8858 gene locus_tag LOCUS_38100 9022 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 9423 9043 gene locus_tag LOCUS_38110 9423 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 10533 9568 gene locus_tag LOCUS_38120 10533 9568 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013420942.1 protein_id gnl|my_center|LOCUS_38120 >Feature sequence211 783 316 gene locus_tag LOCUS_38130 783 316 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_38130 902 1951 gene locus_tag LOCUS_38140 902 1951 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356689.1 protein_id gnl|my_center|LOCUS_38140 1960 2832 gene locus_tag LOCUS_38150 gene aguB 1960 2832 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189258.1 protein_id gnl|my_center|LOCUS_38150 4088 2829 gene locus_tag LOCUS_38160 4088 2829 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252179.1 protein_id gnl|my_center|LOCUS_38160 4981 4073 gene locus_tag LOCUS_38170 4981 4073 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_38170 5815 5171 gene locus_tag LOCUS_38180 5815 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920322.1 protein_id gnl|my_center|LOCUS_38180 5839 6021 gene locus_tag LOCUS_38190 5839 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 6098 6568 gene locus_tag LOCUS_38200 6098 6568 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537642.1 protein_id gnl|my_center|LOCUS_38200 6573 7943 gene locus_tag LOCUS_38210 6573 7943 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_38210 8611 7940 gene locus_tag LOCUS_38220 8611 7940 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919709.1 protein_id gnl|my_center|LOCUS_38220 8690 9442 gene locus_tag LOCUS_38230 8690 9442 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_38230 9509 10627 gene locus_tag LOCUS_38240 9509 10627 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_38240 >Feature sequence212 42 126 gene locus_tag LOCUS_t00350 42 126 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3814 917 gene locus_tag LOCUS_38250 3814 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 7543 3842 gene locus_tag LOCUS_38260 7543 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 8729 7536 gene locus_tag LOCUS_38270 8729 7536 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349496.1 protein_id gnl|my_center|LOCUS_38270 9880 8726 gene locus_tag LOCUS_38280 9880 8726 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939034.1 protein_id gnl|my_center|LOCUS_38280 10536 9919 gene locus_tag LOCUS_38290 10536 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 >Feature sequence213 740 892 gene locus_tag LOCUS_38300 740 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 1252 1022 gene locus_tag LOCUS_38310 1252 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 2272 3717 gene locus_tag LOCUS_38320 2272 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 3926 5176 gene locus_tag LOCUS_38330 3926 5176 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905563.1 protein_id gnl|my_center|LOCUS_38330 5936 6379 gene locus_tag LOCUS_38340 5936 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 6960 7409 gene locus_tag LOCUS_38350 6960 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 7796 7951 gene locus_tag LOCUS_38360 7796 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 9635 10900 gene locus_tag LOCUS_38370 9635 10900 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_38370 >Feature sequence214 3 458 gene locus_tag LOCUS_38380 3 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 468 1871 gene locus_tag LOCUS_38390 468 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 1886 2623 gene locus_tag LOCUS_38400 1886 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 4140 2830 gene locus_tag LOCUS_38410 gene otsA 4140 2830 CDS product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192381.1 protein_id gnl|my_center|LOCUS_38410 7784 7251 gene locus_tag LOCUS_38420 7784 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 10559 10380 gene locus_tag LOCUS_38430 10559 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 >Feature sequence215 687 457 gene locus_tag LOCUS_38440 687 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38440 1079 798 gene locus_tag LOCUS_38450 1079 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 1357 2421 gene locus_tag LOCUS_38460 1357 2421 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_38460 2758 2964 gene locus_tag LOCUS_38470 2758 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 3086 3478 gene locus_tag LOCUS_38480 3086 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 4700 3663 gene locus_tag LOCUS_38490 4700 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 5402 5109 gene locus_tag LOCUS_38500 5402 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 6327 5737 gene locus_tag LOCUS_38510 6327 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 6494 7360 gene locus_tag LOCUS_38520 6494 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 7600 7268 gene locus_tag LOCUS_38530 7600 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 7982 7680 gene locus_tag LOCUS_38540 7982 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 9278 8175 gene locus_tag LOCUS_38550 9278 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 10783 9275 gene locus_tag LOCUS_38560 10783 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 >Feature sequence216 627 103 gene locus_tag LOCUS_38570 627 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 1252 1521 gene locus_tag LOCUS_38580 1252 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 1533 1910 gene locus_tag LOCUS_38590 1533 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 2033 2602 gene locus_tag LOCUS_38600 2033 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 2873 3166 gene locus_tag LOCUS_38610 2873 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 3962 4171 gene locus_tag LOCUS_38620 3962 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 4168 7056 gene locus_tag LOCUS_38630 4168 7056 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_38630 7067 9052 gene locus_tag LOCUS_38640 7067 9052 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_38640 >Feature sequence217 694 95 gene locus_tag LOCUS_38650 694 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 861 1091 gene locus_tag LOCUS_38660 861 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38660 2175 1222 gene locus_tag LOCUS_38670 2175 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 2678 2223 gene locus_tag LOCUS_38680 2678 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 3358 2819 gene locus_tag LOCUS_38690 3358 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 5985 3841 gene locus_tag LOCUS_38700 5985 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 6212 6748 gene locus_tag LOCUS_38710 6212 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 6863 7873 gene locus_tag LOCUS_38720 6863 7873 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347743.1 protein_id gnl|my_center|LOCUS_38720 8032 8604 gene locus_tag LOCUS_38730 8032 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 9196 8645 gene locus_tag LOCUS_38740 9196 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 9615 9241 gene locus_tag LOCUS_38750 9615 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 10493 9846 gene locus_tag LOCUS_38760 10493 9846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 >Feature sequence218 5 97 gene locus_tag LOCUS_t00360 5 97 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 257 487 gene locus_tag LOCUS_38770 257 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 1473 538 gene locus_tag LOCUS_38780 1473 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 2314 1604 gene locus_tag LOCUS_38790 2314 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 3411 3620 gene locus_tag LOCUS_38800 3411 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 3958 4818 gene locus_tag LOCUS_38810 3958 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 5159 5974 gene locus_tag LOCUS_38820 5159 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 7165 6680 gene locus_tag LOCUS_38830 7165 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 8510 7632 gene locus_tag LOCUS_38840 8510 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 8695 8919 gene locus_tag LOCUS_38850 8695 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 10399 9221 gene locus_tag LOCUS_38860 10399 9221 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265555.1 protein_id gnl|my_center|LOCUS_38860 >Feature sequence219 1953 361 gene locus_tag LOCUS_38870 1953 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 2256 1957 gene locus_tag LOCUS_38880 2256 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 3418 3182 gene locus_tag LOCUS_38890 3418 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 3889 3524 gene locus_tag LOCUS_38900 3889 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 4434 4057 gene locus_tag LOCUS_38910 4434 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 5565 4435 gene locus_tag LOCUS_38920 5565 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 6866 5640 gene locus_tag LOCUS_38930 6866 5640 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108247.1 protein_id gnl|my_center|LOCUS_38930 8364 7054 gene locus_tag LOCUS_38940 8364 7054 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 protein_id gnl|my_center|LOCUS_38940 8702 9160 gene locus_tag LOCUS_38950 8702 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 9212 9376 gene locus_tag LOCUS_38960 9212 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 9376 10440 gene locus_tag LOCUS_38970 9376 10440 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_38970 10681 10562 gene locus_tag LOCUS_38980 10681 10562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 >Feature sequence220 357 974 gene locus_tag LOCUS_38990 gene rplD 357 974 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919128.1 protein_id gnl|my_center|LOCUS_38990 971 1258 gene locus_tag LOCUS_39000 971 1258 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440457.1 protein_id gnl|my_center|LOCUS_39000 1260 2099 gene locus_tag LOCUS_39010 gene rplB 1260 2099 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536619.1 protein_id gnl|my_center|LOCUS_39010 2106 2384 gene locus_tag LOCUS_39020 gene rpsS 2106 2384 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507772.1 protein_id gnl|my_center|LOCUS_39020 2387 2869 gene locus_tag LOCUS_39030 gene rplV 2387 2869 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205462.1 protein_id gnl|my_center|LOCUS_39030 2869 3600 gene locus_tag LOCUS_39040 gene rpsC 2869 3600 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088146.1 protein_id gnl|my_center|LOCUS_39040 3618 4031 gene locus_tag LOCUS_39050 gene rplP 3618 4031 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531427.1 protein_id gnl|my_center|LOCUS_39050 4044 4256 gene locus_tag LOCUS_39060 gene rpmC 4044 4256 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722500.1 protein_id gnl|my_center|LOCUS_39060 4281 4523 gene locus_tag LOCUS_39070 gene rpsQ 4281 4523 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313974.1 protein_id gnl|my_center|LOCUS_39070 4549 4917 gene locus_tag LOCUS_39080 gene rplN 4549 4917 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205457.1 protein_id gnl|my_center|LOCUS_39080 4917 5234 gene locus_tag LOCUS_39090 gene rplX 4917 5234 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_39090 5227 5889 gene locus_tag LOCUS_39100 gene rplE 5227 5889 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919139.1 protein_id gnl|my_center|LOCUS_39100 5901 6206 gene locus_tag LOCUS_39110 gene rpsN 5901 6206 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722514.1 protein_id gnl|my_center|LOCUS_39110 6223 6618 gene locus_tag LOCUS_39120 gene rpsH 6223 6618 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722516.1 protein_id gnl|my_center|LOCUS_39120 6641 7174 gene locus_tag LOCUS_39130 gene rplF 6641 7174 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531432.1 protein_id gnl|my_center|LOCUS_39130 7177 7527 gene locus_tag LOCUS_39140 gene rplR 7177 7527 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390422.1 protein_id gnl|my_center|LOCUS_39140 7543 8142 gene locus_tag LOCUS_39150 gene rpsE 7543 8142 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495208.1 protein_id gnl|my_center|LOCUS_39150 8145 8336 gene locus_tag LOCUS_39160 gene rpmD 8145 8336 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385305.1 protein_id gnl|my_center|LOCUS_39160 8393 8950 gene locus_tag LOCUS_39170 gene rplO 8393 8950 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390419.1 protein_id gnl|my_center|LOCUS_39170 9107 10438 gene locus_tag LOCUS_39180 gene secY 9107 10438 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252724.1 protein_id gnl|my_center|LOCUS_39180 >Feature sequence221 794 141 gene locus_tag LOCUS_39190 794 141 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194035.1 protein_id gnl|my_center|LOCUS_39190 2378 816 gene locus_tag LOCUS_39200 2378 816 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522161.1 protein_id gnl|my_center|LOCUS_39200 3594 2611 gene locus_tag LOCUS_39210 3594 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 4552 3707 gene locus_tag LOCUS_39220 gene rfbD 4552 3707 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256315.1 protein_id gnl|my_center|LOCUS_39220 4950 4549 gene locus_tag LOCUS_39230 4950 4549 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303195.1 protein_id gnl|my_center|LOCUS_39230 6038 4938 gene locus_tag LOCUS_39240 gene rfbG 6038 4938 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107729.1 protein_id gnl|my_center|LOCUS_39240 6813 6031 gene locus_tag LOCUS_39250 gene rfbF 6813 6031 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_39250 8974 6815 gene locus_tag LOCUS_39260 8974 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 9827 9033 gene locus_tag LOCUS_39270 9827 9033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194135.1 protein_id gnl|my_center|LOCUS_39270 >Feature sequence222 <1 2264 gene locus_tag LOCUS_39280 <1 2264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206773.1:TonB-dependent receptor 2662 3897 gene locus_tag LOCUS_39290 2662 3897 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918872.1 protein_id gnl|my_center|LOCUS_39290 4083 6104 gene locus_tag LOCUS_39300 4083 6104 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972911.1 protein_id gnl|my_center|LOCUS_39300 6419 6949 gene locus_tag LOCUS_39310 6419 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 6961 7257 gene locus_tag LOCUS_39320 6961 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 7269 7982 gene locus_tag LOCUS_39330 7269 7982 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 protein_id gnl|my_center|LOCUS_39330 8535 8077 gene locus_tag LOCUS_39340 8535 8077 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868975.1 protein_id gnl|my_center|LOCUS_39340 10222 8990 gene locus_tag LOCUS_39350 10222 8990 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141940.1 protein_id gnl|my_center|LOCUS_39350 >Feature sequence223 3342 2740 gene locus_tag LOCUS_39360 3342 2740 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014819602.1 protein_id gnl|my_center|LOCUS_39360 3959 3339 gene locus_tag LOCUS_39370 3959 3339 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228220.1 protein_id gnl|my_center|LOCUS_39370 4828 3956 gene locus_tag LOCUS_39380 4828 3956 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 protein_id gnl|my_center|LOCUS_39380 5596 5045 gene locus_tag LOCUS_39390 5596 5045 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002730154.1 protein_id gnl|my_center|LOCUS_39390 5892 5596 gene locus_tag LOCUS_39400 5892 5596 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068504438.1 protein_id gnl|my_center|LOCUS_39400 9788 5964 gene locus_tag LOCUS_39410 9788 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 10085 9789 gene locus_tag LOCUS_39420 10085 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 10473 10249 gene locus_tag LOCUS_39430 10473 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 >Feature sequence224 <1 854 gene locus_tag LOCUS_39440 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481418.1:SLBB domain-containing protein 851 2407 gene locus_tag LOCUS_39450 gene wzx 851 2407 CDS product O13/O129/O135 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022479.1 protein_id gnl|my_center|LOCUS_39450 3082 4071 gene locus_tag LOCUS_39460 3082 4071 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_39460 5872 6255 gene locus_tag LOCUS_39470 5872 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 6399 7487 gene locus_tag LOCUS_39480 6399 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 8388 7567 gene locus_tag LOCUS_39490 8388 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 9795 8914 gene locus_tag LOCUS_39500 9795 8914 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_39500 >Feature sequence225 549 259 gene locus_tag LOCUS_39510 549 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 2008 968 gene locus_tag LOCUS_39520 gene recA 2008 968 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_39520 2863 2171 gene locus_tag LOCUS_39530 2863 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 5022 2860 gene locus_tag LOCUS_39540 5022 2860 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087039.1 protein_id gnl|my_center|LOCUS_39540 5480 5019 gene locus_tag LOCUS_39550 5480 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 8845 5477 gene locus_tag LOCUS_39560 8845 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 10197 8851 gene locus_tag LOCUS_39570 gene gmtY 10197 8851 CDS product gamma-mobile-trio recombinase GmtY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477115.1 protein_id gnl|my_center|LOCUS_39570 >Feature sequence226 6450 160 gene locus_tag LOCUS_39580 6450 160 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213431.1 protein_id gnl|my_center|LOCUS_39580 9994 6512 gene locus_tag LOCUS_39590 gene yjiT 9994 6512 CDS product protein YjiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191772790.1 protein_id gnl|my_center|LOCUS_39590 10362 10009 gene locus_tag LOCUS_39600 10362 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 >Feature sequence227 70 636 gene locus_tag LOCUS_39610 70 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 626 2224 gene locus_tag LOCUS_39620 626 2224 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537540.1 protein_id gnl|my_center|LOCUS_39620 2221 3396 gene locus_tag LOCUS_39630 2221 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 3531 4028 gene locus_tag LOCUS_39640 3531 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 4039 5013 gene locus_tag LOCUS_39650 4039 5013 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425013.1 protein_id gnl|my_center|LOCUS_39650 5010 5507 gene locus_tag LOCUS_39660 5010 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 5511 7313 gene locus_tag LOCUS_39670 5511 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 8332 8838 gene locus_tag LOCUS_39680 8332 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 8948 9622 gene locus_tag LOCUS_39690 gene carO 8948 9622 CDS product ornithine uptake porin CarO type 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207379.1 protein_id gnl|my_center|LOCUS_39690 9678 9950 gene locus_tag LOCUS_39700 9678 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 >Feature sequence228 419 655 gene locus_tag LOCUS_39710 419 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 934 1152 gene locus_tag LOCUS_39720 934 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 2535 1105 gene locus_tag LOCUS_39730 2535 1105 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626309.1 protein_id gnl|my_center|LOCUS_39730 2882 3349 gene locus_tag LOCUS_39740 2882 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 3524 3865 gene locus_tag LOCUS_39750 gene clpS 3524 3865 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640501.1 protein_id gnl|my_center|LOCUS_39750 3870 6188 gene locus_tag LOCUS_39760 gene clpA 3870 6188 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920326.1 protein_id gnl|my_center|LOCUS_39760 7730 6303 gene locus_tag LOCUS_39770 7730 6303 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528502.1 protein_id gnl|my_center|LOCUS_39770 7729 7899 gene locus_tag LOCUS_39780 7729 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 8245 8631 gene locus_tag LOCUS_39790 8245 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 8955 8632 gene locus_tag LOCUS_39800 8955 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 9382 8966 gene locus_tag LOCUS_39810 9382 8966 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190733.1 protein_id gnl|my_center|LOCUS_39810 <10464 9474 gene locus_tag LOCUS_39820 <10464 9474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087892.1:GNAT family N-acetyltransferase >Feature sequence229 1326 898 gene locus_tag LOCUS_39830 1326 898 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_39830 1807 1361 gene locus_tag LOCUS_39840 1807 1361 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_39840 2807 1857 gene locus_tag LOCUS_39850 2807 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 3515 2871 gene locus_tag LOCUS_39860 3515 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 4345 6261 gene locus_tag LOCUS_39870 4345 6261 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_39870 7129 6281 gene locus_tag LOCUS_39880 7129 6281 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_39880 7503 7138 gene locus_tag LOCUS_39890 7503 7138 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388280.1 protein_id gnl|my_center|LOCUS_39890 8222 7587 gene locus_tag LOCUS_39900 8222 7587 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967810.1 protein_id gnl|my_center|LOCUS_39900 9243 8296 gene locus_tag LOCUS_39910 9243 8296 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_39910 9962 9333 gene locus_tag LOCUS_39920 9962 9333 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084240.1 protein_id gnl|my_center|LOCUS_39920 >Feature sequence230 2592 2254 gene locus_tag LOCUS_39930 2592 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 2856 3410 gene locus_tag LOCUS_39940 2856 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 3420 4310 gene locus_tag LOCUS_39950 3420 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 4307 5011 gene locus_tag LOCUS_39960 4307 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 4986 5420 gene locus_tag LOCUS_39970 4986 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 5777 7249 gene locus_tag LOCUS_39980 5777 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 7234 9558 gene locus_tag LOCUS_39990 7234 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 <10424 9574 gene locus_tag LOCUS_40000 <10424 9574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197969769.1:IS5 family transposase >Feature sequence231 178 675 gene locus_tag LOCUS_40010 178 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 697 870 gene locus_tag LOCUS_40020 697 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 1271 1576 gene locus_tag LOCUS_40030 1271 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 1489 1498 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2279 1869 gene locus_tag LOCUS_40040 2279 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 2550 2272 gene locus_tag LOCUS_40050 2550 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 2841 2566 gene locus_tag LOCUS_40060 2841 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 3510 2875 gene locus_tag LOCUS_40070 3510 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 3808 3503 gene locus_tag LOCUS_40080 3808 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 4109 3801 gene locus_tag LOCUS_40090 4109 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 4329 4102 gene locus_tag LOCUS_40100 4329 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 4718 4326 gene locus_tag LOCUS_40110 4718 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 5301 4711 gene locus_tag LOCUS_40120 5301 4711 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095997467.1 protein_id gnl|my_center|LOCUS_40120 5465 5659 gene locus_tag LOCUS_40130 5465 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 5711 5938 gene locus_tag LOCUS_40140 5711 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 6919 7326 gene locus_tag LOCUS_40150 6919 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 7344 9557 gene locus_tag LOCUS_40160 7344 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 10063 10290 gene locus_tag LOCUS_40170 10063 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 >Feature sequence232 391 1704 gene locus_tag LOCUS_40180 391 1704 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_40180 1925 4243 gene locus_tag LOCUS_40190 1925 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 6049 5585 gene locus_tag LOCUS_40200 6049 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 6486 6058 gene locus_tag LOCUS_40210 6486 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 6895 6503 gene locus_tag LOCUS_40220 6895 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 8280 7399 gene locus_tag LOCUS_40230 8280 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 8974 8420 gene locus_tag LOCUS_40240 8974 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 9487 9206 gene locus_tag LOCUS_40250 9487 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 10032 9781 gene locus_tag LOCUS_40260 10032 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 >Feature sequence233 438 1697 gene locus_tag LOCUS_40270 438 1697 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_40270 1694 2815 gene locus_tag LOCUS_40280 gene glf 1694 2815 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872005.1 protein_id gnl|my_center|LOCUS_40280 3044 4261 gene locus_tag LOCUS_40290 3044 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 4870 6156 gene locus_tag LOCUS_40300 4870 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 6157 6384 gene locus_tag LOCUS_40310 6157 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 6912 7379 gene locus_tag LOCUS_40320 6912 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 8762 9304 gene locus_tag LOCUS_40330 8762 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40330 >Feature sequence234 <1 911 gene locus_tag LOCUS_40340 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957631.1:pyridoxal phosphate-dependent aminotransferase 904 1308 gene locus_tag LOCUS_40350 904 1308 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_40350 1451 1526 gene locus_tag LOCUS_t00370 1451 1526 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1925 2761 gene locus_tag LOCUS_40360 1925 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 2996 2808 gene locus_tag LOCUS_40370 2996 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 3255 3025 gene locus_tag LOCUS_40380 3255 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 3535 3239 gene locus_tag LOCUS_40390 3535 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 4077 3532 gene locus_tag LOCUS_40400 4077 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 5621 4077 gene locus_tag LOCUS_40410 5621 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 5860 5618 gene locus_tag LOCUS_40420 5860 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 6691 5966 gene locus_tag LOCUS_40430 6691 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 8133 6790 gene locus_tag LOCUS_40440 8133 6790 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480579.1 protein_id gnl|my_center|LOCUS_40440 9905 8877 gene locus_tag LOCUS_40450 9905 8877 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_40450 >Feature sequence235 <1 735 gene locus_tag LOCUS_40460 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004538719.1:sugar transferase 1678 815 gene locus_tag LOCUS_40470 1678 815 CDS product N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans,octacis-undecaprenol 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999466.1 protein_id gnl|my_center|LOCUS_40470 1996 3138 gene locus_tag LOCUS_40480 1996 3138 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765279.1 protein_id gnl|my_center|LOCUS_40480 3144 4205 gene locus_tag LOCUS_40490 3144 4205 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_40490 4256 5245 gene locus_tag LOCUS_40500 4256 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 7220 7825 gene locus_tag LOCUS_40510 7220 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 8327 9106 gene locus_tag LOCUS_40520 8327 9106 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780983.1 protein_id gnl|my_center|LOCUS_40520 9668 9850 gene locus_tag LOCUS_40530 9668 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 9798 10103 gene locus_tag LOCUS_40540 9798 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 >Feature sequence236 1382 180 gene locus_tag LOCUS_40550 1382 180 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039746.1 protein_id gnl|my_center|LOCUS_40550 3432 1369 gene locus_tag LOCUS_40560 3432 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 protein_id gnl|my_center|LOCUS_40560 6200 3429 gene locus_tag LOCUS_40570 6200 3429 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048879517.1 protein_id gnl|my_center|LOCUS_40570 8036 6762 gene locus_tag LOCUS_40580 8036 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 8301 9647 gene locus_tag LOCUS_40590 8301 9647 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918075.1 protein_id gnl|my_center|LOCUS_40590 >Feature sequence237 98 379 gene locus_tag LOCUS_40600 98 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 1178 447 gene locus_tag LOCUS_40610 1178 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 2565 2437 gene locus_tag LOCUS_40620 2565 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 3586 2591 gene locus_tag LOCUS_40630 3586 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 4162 4776 gene locus_tag LOCUS_40640 4162 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 5001 7418 gene locus_tag LOCUS_40650 5001 7418 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_40650 9047 7488 gene locus_tag LOCUS_40660 9047 7488 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312152.1 protein_id gnl|my_center|LOCUS_40660 10056 9637 gene locus_tag LOCUS_40670 10056 9637 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 protein_id gnl|my_center|LOCUS_40670 >Feature sequence238 1948 773 gene locus_tag LOCUS_40680 1948 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 3862 2045 gene locus_tag LOCUS_40690 3862 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 5176 3950 gene locus_tag LOCUS_40700 5176 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 5978 5283 gene locus_tag LOCUS_40710 5978 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 6892 5975 gene locus_tag LOCUS_40720 6892 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 8105 6978 gene locus_tag LOCUS_40730 8105 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 9410 8124 gene locus_tag LOCUS_40740 9410 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 8957 8966 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10135 9593 gene locus_tag LOCUS_40750 10135 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 >Feature sequence239 1528 101 gene locus_tag LOCUS_40760 1528 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 3347 2589 gene locus_tag LOCUS_40770 3347 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 4539 4949 gene locus_tag LOCUS_40780 4539 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 4952 6952 gene locus_tag LOCUS_40790 4952 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 6959 9706 gene locus_tag LOCUS_40800 gene mobF 6959 9706 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_40800 10059 10145 gene locus_tag LOCUS_t00380 10059 10145 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence240 1860 1027 gene locus_tag LOCUS_40810 1860 1027 CDS product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097953302.1 protein_id gnl|my_center|LOCUS_40810 2656 2874 gene locus_tag LOCUS_40820 2656 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 3049 3417 gene locus_tag LOCUS_40830 3049 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509401.1 protein_id gnl|my_center|LOCUS_40830 3594 3337 gene locus_tag LOCUS_40840 3594 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 3817 3611 gene locus_tag LOCUS_40850 3817 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 5301 6260 gene locus_tag LOCUS_40860 5301 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 6260 8278 gene locus_tag LOCUS_40870 6260 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 8281 9231 gene locus_tag LOCUS_40880 8281 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 9388 9561 gene locus_tag LOCUS_40890 9388 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 >Feature sequence241 1945 1079 gene locus_tag LOCUS_40900 gene rsmA 1945 1079 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384457.1 protein_id gnl|my_center|LOCUS_40900 2861 1938 gene locus_tag LOCUS_40910 gene pdxA 2861 1938 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532510.1 protein_id gnl|my_center|LOCUS_40910 4320 2899 gene locus_tag LOCUS_40920 4320 2899 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640302.1 protein_id gnl|my_center|LOCUS_40920 6705 4471 gene locus_tag LOCUS_40930 gene lptD 6705 4471 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388193.1 protein_id gnl|my_center|LOCUS_40930 7799 6708 gene locus_tag LOCUS_40940 gene lptG 7799 6708 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720056.1 protein_id gnl|my_center|LOCUS_40940 8926 7796 gene locus_tag LOCUS_40950 gene lptF 8926 7796 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919561.1 protein_id gnl|my_center|LOCUS_40950 >Feature sequence242 777 1379 gene locus_tag LOCUS_40960 777 1379 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_40960 1376 2305 gene locus_tag LOCUS_40970 1376 2305 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_40970 2298 4349 gene locus_tag LOCUS_40980 2298 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 4958 4521 gene locus_tag LOCUS_40990 4958 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 5136 4864 gene locus_tag LOCUS_41000 5136 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 6645 5254 gene locus_tag LOCUS_41010 6645 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 7475 6645 gene locus_tag LOCUS_41020 7475 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 8673 7636 gene locus_tag LOCUS_41030 8673 7636 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210267314.1 protein_id gnl|my_center|LOCUS_41030 9552 8956 gene locus_tag LOCUS_41040 9552 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 >Feature sequence243 493 2184 gene locus_tag LOCUS_41050 493 2184 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 protein_id gnl|my_center|LOCUS_41050 2216 3031 gene locus_tag LOCUS_41060 2216 3031 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434301.1 protein_id gnl|my_center|LOCUS_41060 3043 3384 gene locus_tag LOCUS_41070 3043 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 3413 5116 gene locus_tag LOCUS_41080 3413 5116 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_41080 5537 5346 gene locus_tag LOCUS_41090 5537 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 5612 6283 gene locus_tag LOCUS_41100 5612 6283 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265815.1 protein_id gnl|my_center|LOCUS_41100 6374 8062 gene locus_tag LOCUS_41110 6374 8062 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_41110 9690 8143 gene locus_tag LOCUS_41120 9690 8143 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_41120 10033 9716 gene locus_tag LOCUS_41130 10033 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 >Feature sequence244 2094 505 gene locus_tag LOCUS_41140 2094 505 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085328.1 protein_id gnl|my_center|LOCUS_41140 3159 2101 gene locus_tag LOCUS_41150 gene nadA 3159 2101 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265876.1 protein_id gnl|my_center|LOCUS_41150 3375 4583 gene locus_tag LOCUS_41160 3375 4583 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230672.1 protein_id gnl|my_center|LOCUS_41160 5540 4587 gene locus_tag LOCUS_41170 5540 4587 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175624.1 protein_id gnl|my_center|LOCUS_41170 6064 5540 gene locus_tag LOCUS_41180 6064 5540 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085338.1 protein_id gnl|my_center|LOCUS_41180 6715 6122 gene locus_tag LOCUS_41190 6715 6122 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265716.1 protein_id gnl|my_center|LOCUS_41190 6947 7810 gene locus_tag LOCUS_41200 6947 7810 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_41200 9020 7884 gene locus_tag LOCUS_41210 9020 7884 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 protein_id gnl|my_center|LOCUS_41210 9081 9749 gene locus_tag LOCUS_41220 gene queE 9081 9749 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_41220 >Feature sequence245 272 54 gene locus_tag LOCUS_41230 272 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 663 1175 gene locus_tag LOCUS_41240 663 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 2544 2377 gene locus_tag LOCUS_41250 2544 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 2732 3151 gene locus_tag LOCUS_41260 2732 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 4184 5419 gene locus_tag LOCUS_41270 4184 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 6220 5462 gene locus_tag LOCUS_41280 6220 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390809.1 protein_id gnl|my_center|LOCUS_41280 6817 8985 gene locus_tag LOCUS_41290 6817 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 >Feature sequence246 746 2326 gene locus_tag LOCUS_41300 746 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 2476 3516 gene locus_tag LOCUS_41310 2476 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 3629 3811 gene locus_tag LOCUS_41320 3629 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 4917 3817 gene locus_tag LOCUS_41330 4917 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 6137 4914 gene locus_tag LOCUS_41340 6137 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 7166 6177 gene locus_tag LOCUS_41350 7166 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 7257 8084 gene locus_tag LOCUS_41360 7257 8084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 8084 8797 gene locus_tag LOCUS_41370 8084 8797 CDS product protein mom inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528251.1 protein_id gnl|my_center|LOCUS_41370 8794 9399 gene locus_tag LOCUS_41380 8794 9399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 9416 9832 gene locus_tag LOCUS_41390 9416 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 >Feature sequence247 1310 96 gene locus_tag LOCUS_41400 1310 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 2758 1307 gene locus_tag LOCUS_41410 2758 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 6833 3306 gene locus_tag LOCUS_41420 6833 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 9672 6946 gene locus_tag LOCUS_41430 9672 6946 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928482.1 protein_id gnl|my_center|LOCUS_41430 >Feature sequence248 2127 148 gene locus_tag LOCUS_41440 2127 148 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104238.1 protein_id gnl|my_center|LOCUS_41440 3201 4361 gene locus_tag LOCUS_41450 3201 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 4472 5404 gene locus_tag LOCUS_41460 4472 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 5462 5761 gene locus_tag LOCUS_41470 5462 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 6228 8150 gene locus_tag LOCUS_41480 6228 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 8147 9295 gene locus_tag LOCUS_41490 8147 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 9557 9844 gene locus_tag LOCUS_41500 9557 9844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 >Feature sequence249 2467 554 gene locus_tag LOCUS_41510 gene ftsH 2467 554 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089881.1 protein_id gnl|my_center|LOCUS_41510 3714 2650 gene locus_tag LOCUS_41520 3714 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41520 4462 3740 gene locus_tag LOCUS_41530 4462 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41530 4496 4942 gene locus_tag LOCUS_41540 4496 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 5412 4939 gene locus_tag LOCUS_41550 gene pal 5412 4939 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527588.1 protein_id gnl|my_center|LOCUS_41550 6923 5610 gene locus_tag LOCUS_41560 gene tolB 6923 5610 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388849.1 protein_id gnl|my_center|LOCUS_41560 7882 6965 gene locus_tag LOCUS_41570 7882 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 8291 7851 gene locus_tag LOCUS_41580 gene tolR 8291 7851 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527592.1 protein_id gnl|my_center|LOCUS_41580 9178 8291 gene locus_tag LOCUS_41590 gene tolQ 9178 8291 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388846.1 protein_id gnl|my_center|LOCUS_41590 9765 9301 gene locus_tag LOCUS_41600 gene ybgC 9765 9301 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529144.1 protein_id gnl|my_center|LOCUS_41600 >Feature sequence250 55 130 gene locus_tag LOCUS_t00390 55 130 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 267 926 gene locus_tag LOCUS_41610 267 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 2302 3471 gene locus_tag LOCUS_41620 2302 3471 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994644.1 protein_id gnl|my_center|LOCUS_41620 4412 4876 gene locus_tag LOCUS_41630 4412 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 5476 5243 gene locus_tag LOCUS_41640 5476 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 5424 5723 gene locus_tag LOCUS_41650 5424 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 5993 6157 gene locus_tag LOCUS_41660 5993 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 7647 7841 gene locus_tag LOCUS_41670 7647 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 7843 8016 gene locus_tag LOCUS_41680 7843 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 8234 8923 gene locus_tag LOCUS_41690 8234 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 9660 9064 gene locus_tag LOCUS_41700 9660 9064 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_41700 >Feature sequence251 1057 77 gene locus_tag LOCUS_41710 1057 77 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918510.1 protein_id gnl|my_center|LOCUS_41710 1428 1054 gene locus_tag LOCUS_41720 1428 1054 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640021.1 protein_id gnl|my_center|LOCUS_41720 3037 2336 gene locus_tag LOCUS_41730 3037 2336 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161829.1 protein_id gnl|my_center|LOCUS_41730 3504 3049 gene locus_tag LOCUS_41740 3504 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 3896 3552 gene locus_tag LOCUS_41750 3896 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 4339 3785 gene locus_tag LOCUS_41760 4339 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 5071 4634 gene locus_tag LOCUS_41770 5071 4634 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971206.1 protein_id gnl|my_center|LOCUS_41770 5184 5957 gene locus_tag LOCUS_41780 5184 5957 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103613.1 protein_id gnl|my_center|LOCUS_41780 6295 6732 gene locus_tag LOCUS_41790 6295 6732 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086678640.1 protein_id gnl|my_center|LOCUS_41790 6794 7357 gene locus_tag LOCUS_41800 6794 7357 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228982.1 protein_id gnl|my_center|LOCUS_41800 7359 7688 gene locus_tag LOCUS_41810 7359 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 7669 9087 gene locus_tag LOCUS_41820 7669 9087 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091305175.1 protein_id gnl|my_center|LOCUS_41820 >Feature sequence252 2510 831 gene locus_tag LOCUS_41830 2510 831 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932359.1 protein_id gnl|my_center|LOCUS_41830 4086 2737 gene locus_tag LOCUS_41840 4086 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 4985 4083 gene locus_tag LOCUS_41850 4985 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 6151 4982 gene locus_tag LOCUS_41860 6151 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 7773 6151 gene locus_tag LOCUS_41870 7773 6151 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_41870 8404 7865 gene locus_tag LOCUS_41880 8404 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 8788 9045 gene locus_tag LOCUS_41890 8788 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 9573 9301 gene locus_tag LOCUS_41900 9573 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 >Feature sequence253 337 660 gene locus_tag LOCUS_41910 337 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 1242 703 gene locus_tag LOCUS_41920 1242 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 1607 1242 gene locus_tag LOCUS_41930 1607 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 2555 1719 gene locus_tag LOCUS_41940 2555 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 3289 2552 gene locus_tag LOCUS_41950 3289 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 4666 3500 gene locus_tag LOCUS_41960 4666 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 4877 5140 gene locus_tag LOCUS_41970 4877 5140 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028578677.1 protein_id gnl|my_center|LOCUS_41970 5134 5985 gene locus_tag LOCUS_41980 5134 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41980 6954 6136 gene locus_tag LOCUS_41990 6954 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 8035 7037 gene locus_tag LOCUS_42000 8035 7037 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921367.1 protein_id gnl|my_center|LOCUS_42000 <9728 8095 gene locus_tag LOCUS_42010 <9728 8095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337189.1:Mov34/MPN/PAD-1 family protein >Feature sequence254 343 1158 gene locus_tag LOCUS_42020 gene cysE 343 1158 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383962.1 protein_id gnl|my_center|LOCUS_42020 2064 1204 gene locus_tag LOCUS_42030 2064 1204 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_42030 3357 2338 gene locus_tag LOCUS_42040 3357 2338 CDS product DedA family protein/thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036907.1 protein_id gnl|my_center|LOCUS_42040 6831 3706 gene locus_tag LOCUS_42050 6831 3706 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_42050 8012 6828 gene locus_tag LOCUS_42060 8012 6828 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022471043.1 protein_id gnl|my_center|LOCUS_42060 9504 8002 gene locus_tag LOCUS_42070 9504 8002 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_42070 >Feature sequence255 528 253 gene locus_tag LOCUS_42080 528 253 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969543.1 protein_id gnl|my_center|LOCUS_42080 1639 956 gene locus_tag LOCUS_42090 1639 956 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063629895.1 protein_id gnl|my_center|LOCUS_42090 2104 1781 gene locus_tag LOCUS_42100 2104 1781 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930852.1 protein_id gnl|my_center|LOCUS_42100 2949 2311 gene locus_tag LOCUS_42110 2949 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 3133 3402 gene locus_tag LOCUS_42120 3133 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 3399 4379 gene locus_tag LOCUS_42130 3399 4379 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_42130 5064 4432 gene locus_tag LOCUS_42140 5064 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 7486 5303 gene locus_tag LOCUS_42150 7486 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 8098 9435 gene locus_tag LOCUS_42160 8098 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 >Feature sequence256 193 1083 gene locus_tag LOCUS_42170 gene dapA 193 1083 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389618.1 protein_id gnl|my_center|LOCUS_42170 1083 1556 gene locus_tag LOCUS_42180 gene smpB 1083 1556 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087830.1 protein_id gnl|my_center|LOCUS_42180 1920 2585 gene locus_tag LOCUS_42190 1920 2585 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_42190 3291 2638 gene locus_tag LOCUS_42200 3291 2638 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_42200 3919 3332 gene locus_tag LOCUS_42210 3919 3332 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_42210 4013 4504 gene locus_tag LOCUS_42220 gene folK 4013 4504 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_42220 5142 4501 gene locus_tag LOCUS_42230 5142 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 5175 5690 gene locus_tag LOCUS_42240 5175 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 5690 6091 gene locus_tag LOCUS_42250 5690 6091 CDS product DUF3574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704994.1 protein_id gnl|my_center|LOCUS_42250 6426 6088 gene locus_tag LOCUS_42260 6426 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 6316 6588 gene locus_tag LOCUS_42270 6316 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 6753 8933 gene locus_tag LOCUS_42280 6753 8933 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385014.1 protein_id gnl|my_center|LOCUS_42280 8920 9504 gene locus_tag LOCUS_42290 gene pyrE 8920 9504 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919429.1 protein_id gnl|my_center|LOCUS_42290 >Feature sequence257 6655 5105 gene locus_tag LOCUS_42300 6655 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 8412 6652 gene locus_tag LOCUS_42310 8412 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 8787 9302 gene locus_tag LOCUS_42320 8787 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 >Feature sequence258 20 231 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggcctatccccgcaggcgcgggggaaac 595 299 gene locus_tag LOCUS_42330 gene cas2e 595 299 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027192065.1 protein_id gnl|my_center|LOCUS_42330 1460 567 gene locus_tag LOCUS_42340 gene cas1e 1460 567 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388100.1 protein_id gnl|my_center|LOCUS_42340 2179 1454 gene locus_tag LOCUS_42350 2179 1454 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388099.1 protein_id gnl|my_center|LOCUS_42350 2895 2176 gene locus_tag LOCUS_42360 gene cas5e 2895 2176 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_42360 4096 2897 gene locus_tag LOCUS_42370 gene cas7e 4096 2897 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_42370 4713 4126 gene locus_tag LOCUS_42380 4713 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 6298 4700 gene locus_tag LOCUS_42390 6298 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 8567 6315 gene locus_tag LOCUS_42400 8567 6315 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388093.1 protein_id gnl|my_center|LOCUS_42400 8962 9126 gene locus_tag LOCUS_42410 8962 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 >Feature sequence259 1434 871 gene locus_tag LOCUS_42420 1434 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 1781 2572 gene locus_tag LOCUS_42430 gene fabG 1781 2572 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_42430 2596 3090 gene locus_tag LOCUS_42440 2596 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 3845 3192 gene locus_tag LOCUS_42450 3845 3192 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059489.1 protein_id gnl|my_center|LOCUS_42450 4132 4626 gene locus_tag LOCUS_42460 4132 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 4691 5146 gene locus_tag LOCUS_42470 4691 5146 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893617.1 protein_id gnl|my_center|LOCUS_42470 6131 5250 gene locus_tag LOCUS_42480 6131 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 6534 7922 gene locus_tag LOCUS_42490 6534 7922 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_42490 8116 8586 gene locus_tag LOCUS_42500 8116 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 9341 9036 gene locus_tag LOCUS_42510 9341 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 >Feature sequence260 726 1289 gene locus_tag LOCUS_42520 726 1289 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030926.1 protein_id gnl|my_center|LOCUS_42520 1648 2280 gene locus_tag LOCUS_42530 1648 2280 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170932.1 protein_id gnl|my_center|LOCUS_42530 2293 3819 gene locus_tag LOCUS_42540 2293 3819 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086655.1 protein_id gnl|my_center|LOCUS_42540 4006 5406 gene locus_tag LOCUS_42550 4006 5406 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966276.1 protein_id gnl|my_center|LOCUS_42550 6310 5525 gene locus_tag LOCUS_42560 6310 5525 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966277.1 protein_id gnl|my_center|LOCUS_42560 6694 7785 gene locus_tag LOCUS_42570 6694 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 7859 9142 gene locus_tag LOCUS_42580 7859 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 >Feature sequence261 47 123 gene locus_tag LOCUS_t00400 47 123 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 477 2378 gene locus_tag LOCUS_42590 477 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 2371 3318 gene locus_tag LOCUS_42600 2371 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 3438 3905 gene locus_tag LOCUS_42610 3438 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 3905 4531 gene locus_tag LOCUS_42620 3905 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533245.1 protein_id gnl|my_center|LOCUS_42620 4524 5666 gene locus_tag LOCUS_42630 4524 5666 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533246.1 protein_id gnl|my_center|LOCUS_42630 5663 6319 gene locus_tag LOCUS_42640 5663 6319 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533247.1 protein_id gnl|my_center|LOCUS_42640 6532 6960 gene locus_tag LOCUS_42650 6532 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 6982 8148 gene locus_tag LOCUS_42660 6982 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 8145 8813 gene locus_tag LOCUS_42670 8145 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 >Feature sequence262 11 344 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggggccatccccgcgcgggcgggggaacc 686 393 gene locus_tag LOCUS_42680 gene cas2e 686 393 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388101.1 protein_id gnl|my_center|LOCUS_42680 1572 625 gene locus_tag LOCUS_42690 gene cas1e 1572 625 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388100.1 protein_id gnl|my_center|LOCUS_42690 2296 1577 gene locus_tag LOCUS_42700 2296 1577 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388099.1 protein_id gnl|my_center|LOCUS_42700 2982 2293 gene locus_tag LOCUS_42710 gene cas5e 2982 2293 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_42710 4126 2984 gene locus_tag LOCUS_42720 gene cas7e 4126 2984 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_42720 4683 4123 gene locus_tag LOCUS_42730 4683 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 6235 4667 gene locus_tag LOCUS_42740 6235 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 8824 6272 gene locus_tag LOCUS_42750 8824 6272 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388093.1 protein_id gnl|my_center|LOCUS_42750 9039 9470 gene locus_tag LOCUS_42760 9039 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 >Feature sequence263 343 68 gene locus_tag LOCUS_42770 343 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 227 679 gene locus_tag LOCUS_42780 227 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 1693 731 gene locus_tag LOCUS_42790 1693 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 3575 1683 gene locus_tag LOCUS_42800 3575 1683 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203684.1 protein_id gnl|my_center|LOCUS_42800 4283 4480 gene locus_tag LOCUS_42810 4283 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 5828 4869 gene locus_tag LOCUS_42820 5828 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 5926 7506 gene locus_tag LOCUS_42830 5926 7506 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878821.1 protein_id gnl|my_center|LOCUS_42830 7503 8132 gene locus_tag LOCUS_42840 gene pgsA 7503 8132 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868695.1 protein_id gnl|my_center|LOCUS_42840 8940 8158 gene locus_tag LOCUS_42850 8940 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 >Feature sequence264 236 1159 gene locus_tag LOCUS_42860 236 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 1506 2741 gene locus_tag LOCUS_42870 1506 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 4346 2823 gene locus_tag LOCUS_42880 4346 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 5081 5326 gene locus_tag LOCUS_42890 5081 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 6081 6965 gene locus_tag LOCUS_42900 6081 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 8312 7185 gene locus_tag LOCUS_42910 8312 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 >Feature sequence265 1184 282 gene locus_tag LOCUS_42920 1184 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 1630 1310 gene locus_tag LOCUS_42930 1630 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 5826 4060 gene locus_tag LOCUS_42940 5826 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 7202 5832 gene locus_tag LOCUS_42950 7202 5832 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973828.1 protein_id gnl|my_center|LOCUS_42950 9231 7219 gene locus_tag LOCUS_42960 9231 7219 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_42960 >Feature sequence266 2050 647 gene locus_tag LOCUS_42970 gene oprB 2050 647 CDS product carbohydrate porin OprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003116413.1 protein_id gnl|my_center|LOCUS_42970 2641 2108 gene locus_tag LOCUS_42980 2641 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 3897 2653 gene locus_tag LOCUS_42990 3897 2653 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819167.1 protein_id gnl|my_center|LOCUS_42990 5513 3921 gene locus_tag LOCUS_43000 gene ggt 5513 3921 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808651.1 protein_id gnl|my_center|LOCUS_43000 5967 6374 gene locus_tag LOCUS_43010 5967 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43010 6711 6956 gene locus_tag LOCUS_43020 6711 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 6981 7889 gene locus_tag LOCUS_43030 6981 7889 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089011.1 protein_id gnl|my_center|LOCUS_43030 8789 8298 gene locus_tag LOCUS_43040 8789 8298 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038220.1 protein_id gnl|my_center|LOCUS_43040 9079 8786 gene locus_tag LOCUS_43050 9079 8786 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038219.1 protein_id gnl|my_center|LOCUS_43050 >Feature sequence267 <1 1041 gene locus_tag LOCUS_43060 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167540391.1:IS66 family transposase 1482 1207 gene locus_tag LOCUS_43070 1482 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 3374 1989 gene locus_tag LOCUS_43080 3374 1989 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_43080 5104 3422 gene locus_tag LOCUS_43090 5104 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 5851 5543 gene locus_tag LOCUS_43100 5851 5543 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532486.1 protein_id gnl|my_center|LOCUS_43100 6395 5853 gene locus_tag LOCUS_43110 6395 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918003.1 protein_id gnl|my_center|LOCUS_43110 7817 6651 gene locus_tag LOCUS_43120 7817 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_43120 8374 7814 gene locus_tag LOCUS_43130 8374 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 8567 9235 gene locus_tag LOCUS_43140 8567 9235 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114165.1 protein_id gnl|my_center|LOCUS_43140 >Feature sequence268 2634 799 gene locus_tag LOCUS_43150 2634 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161138665.1 protein_id gnl|my_center|LOCUS_43150 3694 3107 gene locus_tag LOCUS_43160 3694 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 4913 3687 gene locus_tag LOCUS_43170 4913 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 6334 5741 gene locus_tag LOCUS_43180 6334 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 9098 7755 gene locus_tag LOCUS_43190 9098 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 >Feature sequence269 1487 66 gene locus_tag LOCUS_43200 1487 66 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_43200 2823 1507 gene locus_tag LOCUS_43210 2823 1507 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 protein_id gnl|my_center|LOCUS_43210 2713 3015 gene locus_tag LOCUS_43220 2713 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 3415 4245 gene locus_tag LOCUS_43230 3415 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 4835 5809 gene locus_tag LOCUS_43240 4835 5809 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532743.1 protein_id gnl|my_center|LOCUS_43240 6288 6467 gene locus_tag LOCUS_43250 6288 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 6522 6671 gene locus_tag LOCUS_43260 6522 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 6687 6971 gene locus_tag LOCUS_43270 6687 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43270 6987 7811 gene locus_tag LOCUS_43280 6987 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 8145 7882 gene locus_tag LOCUS_43290 8145 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 9148 8222 gene locus_tag LOCUS_43300 9148 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 >Feature sequence270 242 817 gene locus_tag LOCUS_43310 242 817 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026094360.1 protein_id gnl|my_center|LOCUS_43310 814 2760 gene locus_tag LOCUS_43320 814 2760 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_43320 2771 5551 gene locus_tag LOCUS_43330 2771 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 5601 8258 gene locus_tag LOCUS_43340 5601 8258 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484637.1 protein_id gnl|my_center|LOCUS_43340 8270 9205 gene locus_tag LOCUS_43350 8270 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 >Feature sequence271 2192 1530 gene locus_tag LOCUS_43360 2192 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43360 3149 2268 gene locus_tag LOCUS_43370 3149 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43370 5343 3136 gene locus_tag LOCUS_43380 5343 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 6179 5340 gene locus_tag LOCUS_43390 6179 5340 CDS product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097953302.1 protein_id gnl|my_center|LOCUS_43390 6402 6235 gene locus_tag LOCUS_43400 6402 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 6960 7808 gene locus_tag LOCUS_43410 6960 7808 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183806887.1 protein_id gnl|my_center|LOCUS_43410 7856 8410 gene locus_tag LOCUS_43420 7856 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43420 >Feature sequence272 580 185 gene locus_tag LOCUS_43430 580 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43430 1126 611 gene locus_tag LOCUS_43440 1126 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_43440 1432 1130 gene locus_tag LOCUS_43450 1432 1130 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693744.1 protein_id gnl|my_center|LOCUS_43450 2594 2097 gene locus_tag LOCUS_43460 2594 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 3178 2591 gene locus_tag LOCUS_43470 3178 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 4337 5509 gene locus_tag LOCUS_43480 4337 5509 CDS product ISAs1-like element ISSod22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072192.1 protein_id gnl|my_center|LOCUS_43480 5593 5925 gene locus_tag LOCUS_43490 5593 5925 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_43490 5936 6220 gene locus_tag LOCUS_43500 5936 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 6341 7300 gene locus_tag LOCUS_43510 6341 7300 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_43510 7609 9054 gene locus_tag LOCUS_43520 7609 9054 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 protein_id gnl|my_center|LOCUS_43520 >Feature sequence273 147 497 gene locus_tag LOCUS_43530 147 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 754 960 gene locus_tag LOCUS_43540 754 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 944 1276 gene locus_tag LOCUS_43550 944 1276 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 protein_id gnl|my_center|LOCUS_43550 1386 3020 gene locus_tag LOCUS_43560 1386 3020 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_43560 3175 3642 gene locus_tag LOCUS_43570 3175 3642 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976218.1 protein_id gnl|my_center|LOCUS_43570 3639 4139 gene locus_tag LOCUS_43580 3639 4139 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976217.1 protein_id gnl|my_center|LOCUS_43580 4177 4485 gene locus_tag LOCUS_43590 4177 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 4806 5273 gene locus_tag LOCUS_43600 4806 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 5298 6032 gene locus_tag LOCUS_43610 5298 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43610 7438 6410 gene locus_tag LOCUS_43620 7438 6410 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028351643.1 protein_id gnl|my_center|LOCUS_43620 8192 7641 gene locus_tag LOCUS_43630 8192 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 8177 8548 gene locus_tag LOCUS_43640 8177 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 9052 8831 gene locus_tag LOCUS_43650 9052 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 >Feature sequence274 310 1089 gene locus_tag LOCUS_43660 310 1089 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013866.1 protein_id gnl|my_center|LOCUS_43660 1488 1138 gene locus_tag LOCUS_43670 1488 1138 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705113.1 protein_id gnl|my_center|LOCUS_43670 1469 1618 gene locus_tag LOCUS_43680 1469 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 2538 1828 gene locus_tag LOCUS_43690 2538 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 2729 4864 gene locus_tag LOCUS_43700 2729 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 5910 5059 gene locus_tag LOCUS_43710 5910 5059 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 protein_id gnl|my_center|LOCUS_43710 6400 6143 gene locus_tag LOCUS_43720 6400 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 6284 6553 gene locus_tag LOCUS_43730 6284 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43730 7894 7427 gene locus_tag LOCUS_43740 7894 7427 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 protein_id gnl|my_center|LOCUS_43740 8222 7881 gene locus_tag LOCUS_43750 8222 7881 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967099.1 protein_id gnl|my_center|LOCUS_43750 8338 8577 gene locus_tag LOCUS_43760 8338 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 >Feature sequence275 568 230 gene locus_tag LOCUS_43770 568 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 1345 638 gene locus_tag LOCUS_43780 1345 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 3811 2807 gene locus_tag LOCUS_43790 3811 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 5798 3828 gene locus_tag LOCUS_43800 5798 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 6499 5795 gene locus_tag LOCUS_43810 6499 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 6856 7920 gene locus_tag LOCUS_43820 6856 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 8244 7933 gene locus_tag LOCUS_43830 8244 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 8322 8474 gene locus_tag LOCUS_43840 8322 8474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 >Feature sequence276 583 353 gene locus_tag LOCUS_43850 583 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 864 580 gene locus_tag LOCUS_43860 864 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 1502 870 gene locus_tag LOCUS_43870 1502 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 2777 1506 gene locus_tag LOCUS_43880 2777 1506 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_43880 2882 3166 gene locus_tag LOCUS_43890 2882 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 3175 3453 gene locus_tag LOCUS_43900 3175 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 3468 3662 gene locus_tag LOCUS_43910 3468 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43910 3665 3850 gene locus_tag LOCUS_43920 3665 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 3972 4796 gene locus_tag LOCUS_43930 3972 4796 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110374.1 protein_id gnl|my_center|LOCUS_43930 4999 6930 gene locus_tag LOCUS_43940 4999 6930 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_43940 6920 7336 gene locus_tag LOCUS_43950 6920 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 7333 8325 gene locus_tag LOCUS_43960 gene trbB 7333 8325 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533270.1 protein_id gnl|my_center|LOCUS_43960 8312 8638 gene locus_tag LOCUS_43970 8312 8638 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533269.1 protein_id gnl|my_center|LOCUS_43970 8635 8892 gene locus_tag LOCUS_43980 8635 8892 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533268.1 protein_id gnl|my_center|LOCUS_43980 >Feature sequence277 440 2032 gene locus_tag LOCUS_43990 gene ggt 440 2032 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808651.1 protein_id gnl|my_center|LOCUS_43990 2056 3300 gene locus_tag LOCUS_44000 2056 3300 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819167.1 protein_id gnl|my_center|LOCUS_44000 3312 3845 gene locus_tag LOCUS_44010 3312 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 3902 5302 gene locus_tag LOCUS_44020 3902 5302 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266835.1 protein_id gnl|my_center|LOCUS_44020 5514 6659 gene locus_tag LOCUS_44030 5514 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 6663 7307 gene locus_tag LOCUS_44040 6663 7307 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 protein_id gnl|my_center|LOCUS_44040 7746 7934 gene locus_tag LOCUS_44050 7746 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 8723 7896 gene locus_tag LOCUS_44060 8723 7896 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936644.1 protein_id gnl|my_center|LOCUS_44060 9076 8798 gene locus_tag LOCUS_44070 9076 8798 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006452256.1 protein_id gnl|my_center|LOCUS_44070 >Feature sequence278 5753 1044 gene locus_tag LOCUS_44080 5753 1044 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877559.1 protein_id gnl|my_center|LOCUS_44080 7415 6759 gene locus_tag LOCUS_44090 7415 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 8191 7556 gene locus_tag LOCUS_44100 8191 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 <9135 8340 gene locus_tag LOCUS_44110 <9135 8340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196469.1:capsular polysaccharide export inner-membrane protein, BexC/CtrB/KpsE family >Feature sequence279 832 122 gene locus_tag LOCUS_44120 832 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 1308 853 gene locus_tag LOCUS_44130 1308 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 1763 1329 gene locus_tag LOCUS_44140 1763 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 2104 1760 gene locus_tag LOCUS_44150 2104 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 3469 2561 gene locus_tag LOCUS_44160 3469 2561 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367316.1 protein_id gnl|my_center|LOCUS_44160 3596 4609 gene locus_tag LOCUS_44170 3596 4609 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_44170 4631 4768 gene locus_tag LOCUS_44180 4631 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 4999 4865 gene locus_tag LOCUS_44190 4999 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 6379 5339 gene locus_tag LOCUS_44200 6379 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 8741 6489 gene locus_tag LOCUS_44210 8741 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 >Feature sequence280 948 643 gene locus_tag LOCUS_44220 948 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 1811 996 gene locus_tag LOCUS_44230 1811 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 3240 1951 gene locus_tag LOCUS_44240 3240 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 5141 3312 gene locus_tag LOCUS_44250 5141 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 5510 5145 gene locus_tag LOCUS_44260 5510 5145 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140688.1 protein_id gnl|my_center|LOCUS_44260 8296 5837 gene locus_tag LOCUS_44270 8296 5837 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_44270 <9097 8493 gene locus_tag LOCUS_44280 <9097 8493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957722.1:ISAs1-like element ISCbu1 family transposase >Feature sequence281 77 979 gene locus_tag LOCUS_44290 77 979 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391214.1 protein_id gnl|my_center|LOCUS_44290 996 2219 gene locus_tag LOCUS_44300 gene rocD 996 2219 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391213.1 protein_id gnl|my_center|LOCUS_44300 2587 2315 gene locus_tag LOCUS_44310 2587 2315 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918778.1 protein_id gnl|my_center|LOCUS_44310 2908 3666 gene locus_tag LOCUS_44320 2908 3666 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_44320 3882 3667 gene locus_tag LOCUS_44330 3882 3667 CDS product DUF2842 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379956.1 protein_id gnl|my_center|LOCUS_44330 4046 5044 gene locus_tag LOCUS_44340 4046 5044 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087731.1 protein_id gnl|my_center|LOCUS_44340 6297 5017 gene locus_tag LOCUS_44350 6297 5017 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327969.1 protein_id gnl|my_center|LOCUS_44350 7277 6642 gene locus_tag LOCUS_44360 7277 6642 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920499.1 protein_id gnl|my_center|LOCUS_44360 7897 7289 gene locus_tag LOCUS_44370 7897 7289 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640153.1 protein_id gnl|my_center|LOCUS_44370 8409 7894 gene locus_tag LOCUS_44380 8409 7894 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 protein_id gnl|my_center|LOCUS_44380 <9084 8458 gene locus_tag LOCUS_44390 <9084 8458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966315.1:enoyl-CoA hydratase >Feature sequence282 <1 521 gene locus_tag LOCUS_44400 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013466.1:ABC transporter ATP-binding protein 2798 690 gene locus_tag LOCUS_44410 2798 690 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146311717.1 protein_id gnl|my_center|LOCUS_44410 3092 2892 gene locus_tag LOCUS_44420 3092 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 5436 2983 gene locus_tag LOCUS_44430 5436 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 <9051 6041 gene locus_tag LOCUS_44440 <9051 6041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136798312.1:glycosyltransferase >Feature sequence283 2 178 gene locus_tag LOCUS_44450 2 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 1891 1634 gene locus_tag LOCUS_44460 1891 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 2545 2324 gene locus_tag LOCUS_44470 2545 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 2920 2600 gene locus_tag LOCUS_44480 2920 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 3265 3083 gene locus_tag LOCUS_44490 3265 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 3185 3889 gene locus_tag LOCUS_44500 3185 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 5640 5434 gene locus_tag LOCUS_44510 5640 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 5878 7245 gene locus_tag LOCUS_44520 5878 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 7226 8335 gene locus_tag LOCUS_44530 7226 8335 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966194.1 protein_id gnl|my_center|LOCUS_44530 >Feature sequence284 858 1343 gene locus_tag LOCUS_44540 858 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 1485 1736 gene locus_tag LOCUS_44550 1485 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 1658 2614 gene locus_tag LOCUS_44560 1658 2614 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084661.1 protein_id gnl|my_center|LOCUS_44560 3561 2692 gene locus_tag LOCUS_44570 3561 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 4988 3558 gene locus_tag LOCUS_44580 4988 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 5685 6590 gene locus_tag LOCUS_44590 5685 6590 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054418.1 protein_id gnl|my_center|LOCUS_44590 6597 7790 gene locus_tag LOCUS_44600 6597 7790 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138390504.1 protein_id gnl|my_center|LOCUS_44600 8547 8329 gene locus_tag LOCUS_44610 8547 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44610 >Feature sequence285 853 245 gene locus_tag LOCUS_44620 853 245 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_44620 2239 956 gene locus_tag LOCUS_44630 gene rho 2239 956 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266008.1 protein_id gnl|my_center|LOCUS_44630 2903 2463 gene locus_tag LOCUS_44640 gene hemJ 2903 2463 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_44640 3943 2900 gene locus_tag LOCUS_44650 gene hemH 3943 2900 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391364.1 protein_id gnl|my_center|LOCUS_44650 4980 3940 gene locus_tag LOCUS_44660 gene hemE 4980 3940 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391363.1 protein_id gnl|my_center|LOCUS_44660 5285 6109 gene locus_tag LOCUS_44670 5285 6109 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639851.1 protein_id gnl|my_center|LOCUS_44670 6106 6699 gene locus_tag LOCUS_44680 6106 6699 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391361.1 protein_id gnl|my_center|LOCUS_44680 6696 7541 gene locus_tag LOCUS_44690 6696 7541 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391360.1 protein_id gnl|my_center|LOCUS_44690 7538 8131 gene locus_tag LOCUS_44700 gene coaE 7538 8131 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639852.1 protein_id gnl|my_center|LOCUS_44700 8131 8841 gene locus_tag LOCUS_44710 gene dnaQ 8131 8841 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_44710 >Feature sequence286 374 919 gene locus_tag LOCUS_44720 374 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 950 1441 gene locus_tag LOCUS_44730 950 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 1434 3095 gene locus_tag LOCUS_44740 1434 3095 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974229.1 protein_id gnl|my_center|LOCUS_44740 4080 3154 gene locus_tag LOCUS_44750 4080 3154 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011313588.1 protein_id gnl|my_center|LOCUS_44750 4459 5109 gene locus_tag LOCUS_44760 4459 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 5219 5872 gene locus_tag LOCUS_44770 5219 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 6011 8962 gene locus_tag LOCUS_44780 6011 8962 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016452.1 protein_id gnl|my_center|LOCUS_44780 >Feature sequence287 630 103 gene locus_tag LOCUS_44790 630 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 710 1018 gene locus_tag LOCUS_44800 710 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44800 743 752 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1287 1015 gene locus_tag LOCUS_44810 1287 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 1664 1284 gene locus_tag LOCUS_44820 1664 1284 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082826795.1 protein_id gnl|my_center|LOCUS_44820 1745 2992 gene locus_tag LOCUS_44830 1745 2992 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928864.1 protein_id gnl|my_center|LOCUS_44830 5447 3369 gene locus_tag LOCUS_44840 5447 3369 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819543.1 protein_id gnl|my_center|LOCUS_44840 6111 6881 gene locus_tag LOCUS_44850 6111 6881 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111548128.1 protein_id gnl|my_center|LOCUS_44850 6943 7572 gene locus_tag LOCUS_44860 6943 7572 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533316.1 protein_id gnl|my_center|LOCUS_44860 7569 8408 gene locus_tag LOCUS_44870 7569 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 >Feature sequence288 1287 208 gene locus_tag LOCUS_44880 1287 208 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083434.1 protein_id gnl|my_center|LOCUS_44880 3867 1579 gene locus_tag LOCUS_44890 3867 1579 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537646.1 protein_id gnl|my_center|LOCUS_44890 4015 4206 gene locus_tag LOCUS_44900 4015 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 4203 5966 gene locus_tag LOCUS_44910 4203 5966 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417095.1 protein_id gnl|my_center|LOCUS_44910 >Feature sequence289 379 1023 gene locus_tag LOCUS_44920 379 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 1460 1014 gene locus_tag LOCUS_44930 1460 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 1629 2531 gene locus_tag LOCUS_44940 1629 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 3668 2646 gene locus_tag LOCUS_44950 gene rfbN 3668 2646 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_44950 5772 3700 gene locus_tag LOCUS_44960 5772 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 7013 5769 gene locus_tag LOCUS_44970 7013 5769 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_44970 7418 7909 gene locus_tag LOCUS_44980 7418 7909 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_44980 >Feature sequence290 1044 412 gene locus_tag LOCUS_44990 1044 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184364.1 protein_id gnl|my_center|LOCUS_44990 1808 1356 gene locus_tag LOCUS_45000 1808 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45000 3797 2142 gene locus_tag LOCUS_45010 gene ettA 3797 2142 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969764.1 protein_id gnl|my_center|LOCUS_45010 4898 3903 gene locus_tag LOCUS_45020 4898 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 5113 5778 gene locus_tag LOCUS_45030 5113 5778 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_45030 5808 7943 gene locus_tag LOCUS_45040 5808 7943 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 protein_id gnl|my_center|LOCUS_45040 >Feature sequence291 47 1006 gene locus_tag LOCUS_45050 47 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 2331 1045 gene locus_tag LOCUS_45060 2331 1045 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064343.1 protein_id gnl|my_center|LOCUS_45060 3235 2915 gene locus_tag LOCUS_45070 3235 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 4270 3362 gene locus_tag LOCUS_45080 gene galU 4270 3362 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 protein_id gnl|my_center|LOCUS_45080 4440 5891 gene locus_tag LOCUS_45090 4440 5891 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_45090 6133 5939 gene locus_tag LOCUS_45100 6133 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 6676 6191 gene locus_tag LOCUS_45110 6676 6191 CDS product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090150.1 protein_id gnl|my_center|LOCUS_45110 6826 8541 gene locus_tag LOCUS_45120 6826 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 >Feature sequence292 935 2176 gene locus_tag LOCUS_45130 935 2176 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443212.1 protein_id gnl|my_center|LOCUS_45130 2173 2823 gene locus_tag LOCUS_45140 2173 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 2894 3130 gene locus_tag LOCUS_45150 2894 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 3127 3708 gene locus_tag LOCUS_45160 3127 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 3705 5747 gene locus_tag LOCUS_45170 3705 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 5704 6186 gene locus_tag LOCUS_45180 5704 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 6352 6609 gene locus_tag LOCUS_45190 6352 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 6609 7271 gene locus_tag LOCUS_45200 6609 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 8327 7272 gene locus_tag LOCUS_45210 8327 7272 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_45210 8812 8736 gene locus_tag LOCUS_t00410 8812 8736 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence293 701 943 gene locus_tag LOCUS_45220 701 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 943 2265 gene locus_tag LOCUS_45230 943 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 2404 2778 gene locus_tag LOCUS_45240 2404 2778 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640094.1 protein_id gnl|my_center|LOCUS_45240 2754 3161 gene locus_tag LOCUS_45250 2754 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45250 4193 3288 gene locus_tag LOCUS_45260 4193 3288 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038319.1 protein_id gnl|my_center|LOCUS_45260 4312 4734 gene locus_tag LOCUS_45270 4312 4734 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530869.1 protein_id gnl|my_center|LOCUS_45270 4779 5651 gene locus_tag LOCUS_45280 4779 5651 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530870.1 protein_id gnl|my_center|LOCUS_45280 5876 7027 gene locus_tag LOCUS_45290 5876 7027 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168257883.1 protein_id gnl|my_center|LOCUS_45290 7110 7316 gene locus_tag LOCUS_45300 7110 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 7432 8463 gene locus_tag LOCUS_45310 7432 8463 CDS product IS110-like element ISRhru3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388434.1 protein_id gnl|my_center|LOCUS_45310 >Feature sequence294 986 249 gene locus_tag LOCUS_45320 986 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 2411 1095 gene locus_tag LOCUS_45330 2411 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 2785 2946 gene locus_tag LOCUS_45340 2785 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 3605 5047 gene locus_tag LOCUS_45350 3605 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 5467 6450 gene locus_tag LOCUS_45360 5467 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 6460 8040 gene locus_tag LOCUS_45370 6460 8040 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_45370 <8841 8062 gene locus_tag LOCUS_45380 <8841 8062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097850.1:UDP-glucose 6-dehydrogenase >Feature sequence295 3245 1443 gene locus_tag LOCUS_45390 3245 1443 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921779.1 protein_id gnl|my_center|LOCUS_45390 6114 3250 gene locus_tag LOCUS_45400 6114 3250 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_45400 6352 6143 gene locus_tag LOCUS_45410 6352 6143 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263390.1 protein_id gnl|my_center|LOCUS_45410 6753 6469 gene locus_tag LOCUS_45420 6753 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 7388 6729 gene locus_tag LOCUS_45430 gene parA 7388 6729 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202825640.1 protein_id gnl|my_center|LOCUS_45430 8528 7548 gene locus_tag LOCUS_45440 8528 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 >Feature sequence296 500 1129 gene locus_tag LOCUS_45450 500 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 1132 2226 gene locus_tag LOCUS_45460 1132 2226 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535005.1 protein_id gnl|my_center|LOCUS_45460 3062 2829 gene locus_tag LOCUS_45470 3062 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 3696 3181 gene locus_tag LOCUS_45480 3696 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 4512 4111 gene locus_tag LOCUS_45490 gene cadR 4512 4111 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_45490 4595 4957 gene locus_tag LOCUS_45500 4595 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 6227 5334 gene locus_tag LOCUS_45510 6227 5334 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141439.1 protein_id gnl|my_center|LOCUS_45510 6318 7148 gene locus_tag LOCUS_45520 6318 7148 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087073.1 protein_id gnl|my_center|LOCUS_45520 8014 7202 gene locus_tag LOCUS_45530 8014 7202 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 protein_id gnl|my_center|LOCUS_45530 8802 8506 gene locus_tag LOCUS_45540 8802 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 >Feature sequence297 <1 1775 gene locus_tag LOCUS_45550 <1 1775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942486.1:SLBB domain-containing protein 1796 2680 gene locus_tag LOCUS_45560 1796 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 2814 3002 gene locus_tag LOCUS_45570 2814 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 3463 4539 gene locus_tag LOCUS_45580 3463 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 4614 4946 gene locus_tag LOCUS_45590 4614 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 4909 5037 gene locus_tag LOCUS_45600 4909 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 5041 5661 gene locus_tag LOCUS_45610 5041 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45610 7268 7801 gene locus_tag LOCUS_45620 7268 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 >Feature sequence298 276 1334 gene locus_tag LOCUS_45630 276 1334 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939034.1 protein_id gnl|my_center|LOCUS_45630 1327 4323 gene locus_tag LOCUS_45640 1327 4323 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530591.1 protein_id gnl|my_center|LOCUS_45640 4320 6014 gene locus_tag LOCUS_45650 4320 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 6574 6882 gene locus_tag LOCUS_45660 6574 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 6806 7312 gene locus_tag LOCUS_45670 6806 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 7384 7527 gene locus_tag LOCUS_45680 7384 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 >Feature sequence299 128 1741 gene locus_tag LOCUS_45690 128 1741 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040488.1 protein_id gnl|my_center|LOCUS_45690 1872 4151 gene locus_tag LOCUS_45700 1872 4151 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_45700 4187 5077 gene locus_tag LOCUS_45710 4187 5077 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030032.1 protein_id gnl|my_center|LOCUS_45710 5074 5856 gene locus_tag LOCUS_45720 5074 5856 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_45720 5893 7035 gene locus_tag LOCUS_45730 5893 7035 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_45730 7140 7937 gene locus_tag LOCUS_45740 7140 7937 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_45740 <8787 8201 gene locus_tag LOCUS_45750 <8787 8201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000688696.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence300 455 1903 gene locus_tag LOCUS_45760 455 1903 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_45760 2960 4510 gene locus_tag LOCUS_45770 2960 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 4594 5145 gene locus_tag LOCUS_45780 4594 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 5114 5956 gene locus_tag LOCUS_45790 5114 5956 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525092.1 protein_id gnl|my_center|LOCUS_45790 5968 6609 gene locus_tag LOCUS_45800 5968 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 7016 7354 gene locus_tag LOCUS_45810 7016 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 7351 8115 gene locus_tag LOCUS_45820 7351 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 >Feature sequence301 1422 634 gene locus_tag LOCUS_45830 1422 634 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640216.1 protein_id gnl|my_center|LOCUS_45830 3639 1972 gene locus_tag LOCUS_45840 3639 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 4094 5176 gene locus_tag LOCUS_45850 gene nirK 4094 5176 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257443.1 protein_id gnl|my_center|LOCUS_45850 5500 6876 gene locus_tag LOCUS_45860 5500 6876 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244205.1 protein_id gnl|my_center|LOCUS_45860 >Feature sequence302 353 2260 gene locus_tag LOCUS_45870 353 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 2253 3389 gene locus_tag LOCUS_45880 2253 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 3395 5323 gene locus_tag LOCUS_45890 3395 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 5320 6429 gene locus_tag LOCUS_45900 5320 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 6633 7427 gene locus_tag LOCUS_45910 6633 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 7710 7402 gene locus_tag LOCUS_45920 7710 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 7823 8344 gene locus_tag LOCUS_45930 gene ybiA 7823 8344 CDS product N-glycosidase YbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145124.1 protein_id gnl|my_center|LOCUS_45930 >Feature sequence303 1028 3916 gene locus_tag LOCUS_45940 1028 3916 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_45940 3957 7232 gene locus_tag LOCUS_45950 3957 7232 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064385.1 protein_id gnl|my_center|LOCUS_45950 >Feature sequence304 3072 3305 gene locus_tag LOCUS_45960 3072 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 4832 4593 gene locus_tag LOCUS_45970 4832 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 4903 6999 gene locus_tag LOCUS_45980 4903 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 7073 8278 gene locus_tag LOCUS_45990 7073 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 >Feature sequence305 1567 119 gene locus_tag LOCUS_46000 gene ltrA 1567 119 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145832239.1 protein_id gnl|my_center|LOCUS_46000 3036 3380 gene locus_tag LOCUS_46010 3036 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 4731 3460 gene locus_tag LOCUS_46020 4731 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 5285 4728 gene locus_tag LOCUS_46030 5285 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 7133 5700 gene locus_tag LOCUS_46040 7133 5700 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055578.1 protein_id gnl|my_center|LOCUS_46040 8570 7689 gene locus_tag LOCUS_46050 8570 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 >Feature sequence306 191 1876 gene locus_tag LOCUS_46060 191 1876 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384751.1 protein_id gnl|my_center|LOCUS_46060 2950 2246 gene locus_tag LOCUS_46070 2950 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084720.1 protein_id gnl|my_center|LOCUS_46070 6469 2966 gene locus_tag LOCUS_46080 6469 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 7238 6456 gene locus_tag LOCUS_46090 7238 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 <8615 7272 gene locus_tag LOCUS_46100 <8615 7272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544913.1:AAA family ATPase >Feature sequence307 345 500 gene locus_tag LOCUS_46110 345 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 1713 454 gene locus_tag LOCUS_46120 1713 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 3392 1743 gene locus_tag LOCUS_46130 3392 1743 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035719.1 protein_id gnl|my_center|LOCUS_46130 3580 3389 gene locus_tag LOCUS_46140 3580 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 4615 3608 gene locus_tag LOCUS_46150 4615 3608 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262887.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46150 5742 4612 gene locus_tag LOCUS_46160 5742 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 <8581 5834 gene locus_tag LOCUS_46170 <8581 5834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035715.1:type I restriction endonuclease subunit R >Feature sequence308 971 123 gene locus_tag LOCUS_46180 971 123 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836249.1 protein_id gnl|my_center|LOCUS_46180 2467 983 gene locus_tag LOCUS_46190 2467 983 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_46190 2917 2696 gene locus_tag LOCUS_46200 2917 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 3106 2951 gene locus_tag LOCUS_46210 3106 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 4961 3114 gene locus_tag LOCUS_46220 4961 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 4969 5196 gene locus_tag LOCUS_46230 4969 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 5781 5563 gene locus_tag LOCUS_46240 5781 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 5743 6324 gene locus_tag LOCUS_46250 5743 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 7104 6931 gene locus_tag LOCUS_46260 7104 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 7963 7286 gene locus_tag LOCUS_46270 7963 7286 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112313490.1 protein_id gnl|my_center|LOCUS_46270 >Feature sequence309 383 544 gene locus_tag LOCUS_46280 383 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 587 2005 gene locus_tag LOCUS_46290 587 2005 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940630.1 protein_id gnl|my_center|LOCUS_46290 2260 3354 gene locus_tag LOCUS_46300 2260 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 3871 4098 gene locus_tag LOCUS_46310 3871 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 4102 4272 gene locus_tag LOCUS_46320 4102 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 4294 4536 gene locus_tag LOCUS_46330 4294 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 4687 5049 gene locus_tag LOCUS_46340 4687 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 5684 5019 gene locus_tag LOCUS_46350 5684 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 6497 5799 gene locus_tag LOCUS_46360 6497 5799 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184155626.1 protein_id gnl|my_center|LOCUS_46360 6806 6501 gene locus_tag LOCUS_46370 6806 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 7108 7344 gene locus_tag LOCUS_46380 7108 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 >Feature sequence310 163 717 gene locus_tag LOCUS_46390 163 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 698 1678 gene locus_tag LOCUS_46400 698 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 2237 2431 gene locus_tag LOCUS_46410 2237 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 2879 2544 gene locus_tag LOCUS_46420 2879 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 3364 4944 gene locus_tag LOCUS_46430 3364 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 4944 5966 gene locus_tag LOCUS_46440 4944 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 5963 7558 gene locus_tag LOCUS_46450 5963 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 >Feature sequence311 979 830 gene locus_tag LOCUS_46460 979 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 2764 1952 gene locus_tag LOCUS_46470 2764 1952 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920801.1 protein_id gnl|my_center|LOCUS_46470 3351 2719 gene locus_tag LOCUS_46480 3351 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 3550 3338 gene locus_tag LOCUS_46490 3550 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 4587 3721 gene locus_tag LOCUS_46500 4587 3721 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_46500 5090 4731 gene locus_tag LOCUS_46510 5090 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 5721 6086 gene locus_tag LOCUS_46520 5721 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 6207 6548 gene locus_tag LOCUS_46530 6207 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 7160 8149 gene locus_tag LOCUS_46540 7160 8149 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203384.1 protein_id gnl|my_center|LOCUS_46540 >Feature sequence312 379 452 gene locus_tag LOCUS_t00420 379 452 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 615 1847 gene locus_tag LOCUS_46550 615 1847 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_46550 2097 5609 gene locus_tag LOCUS_46560 2097 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 6580 5885 gene locus_tag LOCUS_46570 6580 5885 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920549.1 protein_id gnl|my_center|LOCUS_46570 7552 6599 gene locus_tag LOCUS_46580 7552 6599 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920548.1 protein_id gnl|my_center|LOCUS_46580 >Feature sequence313 1167 2807 gene locus_tag LOCUS_46590 1167 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 2905 4017 gene locus_tag LOCUS_46600 2905 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 4198 5259 gene locus_tag LOCUS_46610 4198 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 6687 5293 gene locus_tag LOCUS_46620 6687 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 >Feature sequence314 1341 553 gene locus_tag LOCUS_46630 1341 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 1570 1451 gene locus_tag LOCUS_46640 1570 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 4123 1781 gene locus_tag LOCUS_46650 4123 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 5510 4173 gene locus_tag LOCUS_46660 5510 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 7033 5681 gene locus_tag LOCUS_46670 7033 5681 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_46670 8250 7189 gene locus_tag LOCUS_46680 gene ugpC 8250 7189 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972797.1 protein_id gnl|my_center|LOCUS_46680 >Feature sequence315 970 719 gene locus_tag LOCUS_46690 970 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 1077 2921 gene locus_tag LOCUS_46700 1077 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 2918 4975 gene locus_tag LOCUS_46710 2918 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 5006 8254 gene locus_tag LOCUS_46720 5006 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 >Feature sequence316 833 474 gene locus_tag LOCUS_46730 833 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 843 1394 gene locus_tag LOCUS_46740 gene def 843 1394 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388799.1 protein_id gnl|my_center|LOCUS_46740 1438 2091 gene locus_tag LOCUS_46750 1438 2091 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921128.1 protein_id gnl|my_center|LOCUS_46750 3138 2056 gene locus_tag LOCUS_46760 3138 2056 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336844.1 protein_id gnl|my_center|LOCUS_46760 3662 3162 gene locus_tag LOCUS_46770 gene purE 3662 3162 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388805.1 protein_id gnl|my_center|LOCUS_46770 3829 4566 gene locus_tag LOCUS_46780 3829 4566 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 protein_id gnl|my_center|LOCUS_46780 4762 4556 gene locus_tag LOCUS_46790 4762 4556 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709331.1 protein_id gnl|my_center|LOCUS_46790 5421 4759 gene locus_tag LOCUS_46800 5421 4759 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923244.1 protein_id gnl|my_center|LOCUS_46800 5537 5710 gene locus_tag LOCUS_46810 5537 5710 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709330.1 protein_id gnl|my_center|LOCUS_46810 6086 7441 gene locus_tag LOCUS_46820 6086 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 8323 7454 gene locus_tag LOCUS_46830 8323 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 >Feature sequence317 1514 543 gene locus_tag LOCUS_46840 1514 543 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462489.1 protein_id gnl|my_center|LOCUS_46840 4322 3126 gene locus_tag LOCUS_46850 4322 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 5803 4328 gene locus_tag LOCUS_46860 5803 4328 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929391.1 protein_id gnl|my_center|LOCUS_46860 7293 6154 gene locus_tag LOCUS_46870 7293 6154 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975137.1 protein_id gnl|my_center|LOCUS_46870 <8366 7511 gene locus_tag LOCUS_46880 <8366 7511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481418.1:SLBB domain-containing protein >Feature sequence318 1629 406 gene locus_tag LOCUS_46890 1629 406 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 protein_id gnl|my_center|LOCUS_46890 3150 2251 gene locus_tag LOCUS_46900 3150 2251 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206875.1 protein_id gnl|my_center|LOCUS_46900 3305 4231 gene locus_tag LOCUS_46910 3305 4231 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089169.1 protein_id gnl|my_center|LOCUS_46910 4818 4273 gene locus_tag LOCUS_46920 4818 4273 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 protein_id gnl|my_center|LOCUS_46920 6179 4818 gene locus_tag LOCUS_46930 6179 4818 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116063.1 protein_id gnl|my_center|LOCUS_46930 7005 6172 gene locus_tag LOCUS_46940 gene hcaB 7005 6172 CDS product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281369.1 protein_id gnl|my_center|LOCUS_46940 8244 7090 gene locus_tag LOCUS_46950 8244 7090 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921526.1 protein_id gnl|my_center|LOCUS_46950 >Feature sequence319 789 571 gene locus_tag LOCUS_46960 789 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 1064 1234 gene locus_tag LOCUS_46970 1064 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 1322 3184 gene locus_tag LOCUS_46980 1322 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 4878 3454 gene locus_tag LOCUS_46990 4878 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 6593 4866 gene locus_tag LOCUS_47000 6593 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 7513 6845 gene locus_tag LOCUS_47010 7513 6845 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391460.1 protein_id gnl|my_center|LOCUS_47010 7627 8001 gene locus_tag LOCUS_47020 7627 8001 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266596.1 protein_id gnl|my_center|LOCUS_47020 >Feature sequence320 <1 1063 gene locus_tag LOCUS_47030 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042440221.1:glucan biosynthesis protein D 1775 1206 gene locus_tag LOCUS_47040 1775 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47040 2400 2152 gene locus_tag LOCUS_47050 2400 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 2915 3472 gene locus_tag LOCUS_47060 2915 3472 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261826.1 protein_id gnl|my_center|LOCUS_47060 6237 3910 gene locus_tag LOCUS_47070 6237 3910 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156899988.1 protein_id gnl|my_center|LOCUS_47070 8192 7308 gene locus_tag LOCUS_47080 8192 7308 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087072.1 protein_id gnl|my_center|LOCUS_47080 >Feature sequence321 287 363 gene locus_tag LOCUS_t00430 287 363 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1605 427 gene locus_tag LOCUS_47090 1605 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 1851 1615 gene locus_tag LOCUS_47100 1851 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 2376 3932 gene locus_tag LOCUS_47110 2376 3932 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059647.1 protein_id gnl|my_center|LOCUS_47110 5409 4609 gene locus_tag LOCUS_47120 5409 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 6473 5406 gene locus_tag LOCUS_47130 6473 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 7615 6509 gene locus_tag LOCUS_47140 gene dndB 7615 6509 CDS product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 protein_id gnl|my_center|LOCUS_47140 >Feature sequence322 431 180 gene locus_tag LOCUS_47150 431 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 533 1102 gene locus_tag LOCUS_47160 533 1102 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112313490.1 protein_id gnl|my_center|LOCUS_47160 1099 1914 gene locus_tag LOCUS_47170 1099 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113597019.1 protein_id gnl|my_center|LOCUS_47170 2885 1938 gene locus_tag LOCUS_47180 2885 1938 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104632.1 protein_id gnl|my_center|LOCUS_47180 3281 2892 gene locus_tag LOCUS_47190 3281 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 4214 3723 gene locus_tag LOCUS_47200 4214 3723 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 protein_id gnl|my_center|LOCUS_47200 5906 4221 gene locus_tag LOCUS_47210 5906 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 7592 5916 gene locus_tag LOCUS_47220 7592 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 <8299 7558 gene locus_tag LOCUS_47230 <8299 7558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876134.1:DNA cytosine methyltransferase >Feature sequence323 432 1544 gene locus_tag LOCUS_47240 432 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 1537 2343 gene locus_tag LOCUS_47250 1537 2343 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194135.1 protein_id gnl|my_center|LOCUS_47250 2409 3110 gene locus_tag LOCUS_47260 2409 3110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194035.1 protein_id gnl|my_center|LOCUS_47260 3186 5117 gene locus_tag LOCUS_47270 3186 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 5154 6461 gene locus_tag LOCUS_47280 5154 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 6662 7594 gene locus_tag LOCUS_47290 gene hldA 6662 7594 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687836.1 protein_id gnl|my_center|LOCUS_47290 >Feature sequence324 1833 1612 gene locus_tag LOCUS_47300 1833 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 2044 2862 gene locus_tag LOCUS_47310 2044 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 3794 2853 gene locus_tag LOCUS_47320 3794 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 4621 3875 gene locus_tag LOCUS_47330 4621 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 5603 5322 gene locus_tag LOCUS_47340 5603 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 6022 6978 gene locus_tag LOCUS_47350 6022 6978 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210267314.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47350 7748 7218 gene locus_tag LOCUS_47360 7748 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 8091 7741 gene locus_tag LOCUS_47370 8091 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 >Feature sequence325 676 2511 gene locus_tag LOCUS_47380 676 2511 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962335.1 protein_id gnl|my_center|LOCUS_47380 2527 3099 gene locus_tag LOCUS_47390 2527 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 3147 3467 gene locus_tag LOCUS_47400 3147 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 5596 3515 gene locus_tag LOCUS_47410 5596 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 3747 3756 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5740 6696 gene locus_tag LOCUS_47420 5740 6696 CDS product viperin family antiviral radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957056.1 protein_id gnl|my_center|LOCUS_47420 7045 6716 gene locus_tag LOCUS_47430 7045 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 7197 7745 gene locus_tag LOCUS_47440 7197 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 >Feature sequence326 412 675 gene locus_tag LOCUS_47450 412 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 1044 1286 gene locus_tag LOCUS_47460 1044 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 1276 1422 gene locus_tag LOCUS_47470 1276 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 1698 2561 gene locus_tag LOCUS_47480 1698 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 2551 2826 gene locus_tag LOCUS_47490 2551 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 2896 3612 gene locus_tag LOCUS_47500 2896 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 3609 4268 gene locus_tag LOCUS_47510 3609 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 4500 4300 gene locus_tag LOCUS_47520 4500 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 4806 5756 gene locus_tag LOCUS_47530 4806 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 5924 6139 gene locus_tag LOCUS_47540 5924 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 6460 7317 gene locus_tag LOCUS_47550 6460 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 7657 7466 gene locus_tag LOCUS_47560 7657 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 >Feature sequence327 175 41 gene locus_tag LOCUS_47570 175 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 326 604 gene locus_tag LOCUS_47580 326 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 601 1044 gene locus_tag LOCUS_47590 601 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 1041 1607 gene locus_tag LOCUS_47600 1041 1607 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_47600 1822 1968 gene locus_tag LOCUS_47610 1822 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 2167 1946 gene locus_tag LOCUS_47620 2167 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47620 3052 2258 gene locus_tag LOCUS_47630 3052 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 3102 4004 gene locus_tag LOCUS_47640 3102 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 4526 4074 gene locus_tag LOCUS_47650 4526 4074 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_47650 5239 4523 gene locus_tag LOCUS_47660 gene chaC 5239 4523 CDS product glutathione-specific gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917802.1 protein_id gnl|my_center|LOCUS_47660 6776 5232 gene locus_tag LOCUS_47670 6776 5232 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 protein_id gnl|my_center|LOCUS_47670 7487 6870 gene locus_tag LOCUS_47680 7487 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 7966 7580 gene locus_tag LOCUS_47690 7966 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 >Feature sequence328 <1 1152 gene locus_tag LOCUS_47700 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120163.1:phosphoketolase family protein 1195 2379 gene locus_tag LOCUS_47710 1195 2379 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_47710 3178 2459 gene locus_tag LOCUS_47720 3178 2459 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112308.1 protein_id gnl|my_center|LOCUS_47720 3799 3182 gene locus_tag LOCUS_47730 3799 3182 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112306.1 protein_id gnl|my_center|LOCUS_47730 3997 4290 gene locus_tag LOCUS_47740 3997 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 4379 5041 gene locus_tag LOCUS_47750 4379 5041 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085558.1 protein_id gnl|my_center|LOCUS_47750 5046 5915 gene locus_tag LOCUS_47760 5046 5915 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399088.1 protein_id gnl|my_center|LOCUS_47760 6334 7527 gene locus_tag LOCUS_47770 6334 7527 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_47770 8157 7666 gene locus_tag LOCUS_47780 8157 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 >Feature sequence329 <1 586 gene locus_tag LOCUS_47790 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064421.1:carbon-nitrogen hydrolase family protein 674 1006 gene locus_tag LOCUS_47800 674 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 1010 1891 gene locus_tag LOCUS_47810 1010 1891 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_47810 1983 2735 gene locus_tag LOCUS_47820 1983 2735 CDS product DUF1134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265661.1 protein_id gnl|my_center|LOCUS_47820 3877 2786 gene locus_tag LOCUS_47830 gene secF 3877 2786 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087502.1 protein_id gnl|my_center|LOCUS_47830 6729 3928 gene locus_tag LOCUS_47840 6729 3928 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038744192.1 protein_id gnl|my_center|LOCUS_47840 7713 6814 gene locus_tag LOCUS_47850 7713 6814 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 protein_id gnl|my_center|LOCUS_47850 >Feature sequence330 31 1410 gene locus_tag LOCUS_47860 31 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 1407 2369 gene locus_tag LOCUS_47870 1407 2369 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529355.1 protein_id gnl|my_center|LOCUS_47870 2422 3411 gene locus_tag LOCUS_47880 2422 3411 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387970.1 protein_id gnl|my_center|LOCUS_47880 3593 3354 gene locus_tag LOCUS_47890 3593 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 3693 4649 gene locus_tag LOCUS_47900 3693 4649 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310357.1 protein_id gnl|my_center|LOCUS_47900 5684 4653 gene locus_tag LOCUS_47910 5684 4653 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114965.1 protein_id gnl|my_center|LOCUS_47910 6836 5685 gene locus_tag LOCUS_47920 6836 5685 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920927.1 protein_id gnl|my_center|LOCUS_47920 <8162 7053 gene locus_tag LOCUS_47930 <8162 7053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003533499.1:preprotein translocase subunit SecA >Feature sequence331 598 419 gene locus_tag LOCUS_47940 598 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 2860 1877 gene locus_tag LOCUS_47950 2860 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 4726 2864 gene locus_tag LOCUS_47960 4726 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 5445 4723 gene locus_tag LOCUS_47970 5445 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 6262 6930 gene locus_tag LOCUS_47980 6262 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 7415 7065 gene locus_tag LOCUS_47990 7415 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 7499 7723 gene locus_tag LOCUS_48000 7499 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 >Feature sequence332 690 301 gene locus_tag LOCUS_48010 690 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 1465 1794 gene locus_tag LOCUS_48020 1465 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 1857 6626 gene locus_tag LOCUS_48030 1857 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 6623 8020 gene locus_tag LOCUS_48040 6623 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 >Feature sequence333 <1 1129 gene locus_tag LOCUS_48050 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974226.1:Ti-type conjugative transfer relaxase TraA 1126 1731 gene locus_tag LOCUS_48060 1126 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 2206 3627 gene locus_tag LOCUS_48070 2206 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 4613 3945 gene locus_tag LOCUS_48080 4613 3945 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947331.1 protein_id gnl|my_center|LOCUS_48080 5146 4610 gene locus_tag LOCUS_48090 5146 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 5844 6104 gene locus_tag LOCUS_48100 5844 6104 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770970.1 protein_id gnl|my_center|LOCUS_48100 6575 7213 gene locus_tag LOCUS_48110 6575 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 7218 8048 gene locus_tag LOCUS_48120 7218 8048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086432.1 protein_id gnl|my_center|LOCUS_48120 >Feature sequence334 51 986 gene locus_tag LOCUS_48130 51 986 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528033.1 protein_id gnl|my_center|LOCUS_48130 1784 1008 gene locus_tag LOCUS_48140 1784 1008 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336750.1 protein_id gnl|my_center|LOCUS_48140 2078 2962 gene locus_tag LOCUS_48150 2078 2962 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 protein_id gnl|my_center|LOCUS_48150 2970 5417 gene locus_tag LOCUS_48160 2970 5417 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 protein_id gnl|my_center|LOCUS_48160 5484 6242 gene locus_tag LOCUS_48170 5484 6242 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722444.1 protein_id gnl|my_center|LOCUS_48170 6242 7171 gene locus_tag LOCUS_48180 6242 7171 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336943.1 protein_id gnl|my_center|LOCUS_48180 7240 7584 gene locus_tag LOCUS_48190 7240 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 >Feature sequence335 2160 661 gene locus_tag LOCUS_48200 2160 661 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892896.1 protein_id gnl|my_center|LOCUS_48200 2924 2196 gene locus_tag LOCUS_48210 2924 2196 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_48210 3436 3029 gene locus_tag LOCUS_48220 3436 3029 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528197.1 protein_id gnl|my_center|LOCUS_48220 4805 3417 gene locus_tag LOCUS_48230 4805 3417 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_48230 6101 4899 gene locus_tag LOCUS_48240 6101 4899 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966466.1 protein_id gnl|my_center|LOCUS_48240 6583 6128 gene locus_tag LOCUS_48250 gene mioC 6583 6128 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763724.1 protein_id gnl|my_center|LOCUS_48250 7923 6610 gene locus_tag LOCUS_48260 7923 6610 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_48260 >Feature sequence336 378 962 gene locus_tag LOCUS_48270 378 962 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405517.1 protein_id gnl|my_center|LOCUS_48270 965 1240 gene locus_tag LOCUS_48280 965 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 1246 3006 gene locus_tag LOCUS_48290 1246 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 3003 4760 gene locus_tag LOCUS_48300 3003 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261758.1 protein_id gnl|my_center|LOCUS_48300 5243 4833 gene locus_tag LOCUS_48310 5243 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 6210 5353 gene locus_tag LOCUS_48320 6210 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 6907 6338 gene locus_tag LOCUS_48330 6907 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 7974 7096 gene locus_tag LOCUS_48340 7974 7096 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090536.1 protein_id gnl|my_center|LOCUS_48340 >Feature sequence337 1502 1266 gene locus_tag LOCUS_48350 1502 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 2486 1752 gene locus_tag LOCUS_48360 2486 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974261.1 protein_id gnl|my_center|LOCUS_48360 5515 2483 gene locus_tag LOCUS_48370 5515 2483 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165792415.1 protein_id gnl|my_center|LOCUS_48370 6206 5622 gene locus_tag LOCUS_48380 6206 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 6788 6357 gene locus_tag LOCUS_48390 6788 6357 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387852.1 protein_id gnl|my_center|LOCUS_48390 7034 6792 gene locus_tag LOCUS_48400 7034 6792 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387851.1 protein_id gnl|my_center|LOCUS_48400 7818 7156 gene locus_tag LOCUS_48410 7818 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 >Feature sequence338 <1 657 gene locus_tag LOCUS_48420 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086957.1:ABC-F family ATP-binding cassette domain-containing protein 1034 828 gene locus_tag LOCUS_48430 1034 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 2848 4206 gene locus_tag LOCUS_48440 2848 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 4256 5602 gene locus_tag LOCUS_48450 4256 5602 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003683.1 protein_id gnl|my_center|LOCUS_48450 5613 7841 gene locus_tag LOCUS_48460 5613 7841 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 protein_id gnl|my_center|LOCUS_48460 >Feature sequence339 688 4773 gene locus_tag LOCUS_48470 688 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 4651 4660 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4798 6900 gene locus_tag LOCUS_48480 4798 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 6906 7772 gene locus_tag LOCUS_48490 6906 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 >Feature sequence340 <1 1705 gene locus_tag LOCUS_48500 <1 1705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088158.1:DNA-directed RNA polymerase subunit beta' 3363 3866 gene locus_tag LOCUS_48510 3363 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 4223 4633 gene locus_tag LOCUS_48520 4223 4633 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 protein_id gnl|my_center|LOCUS_48520 4895 5266 gene locus_tag LOCUS_48530 gene rpsL 4895 5266 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004624021.1 protein_id gnl|my_center|LOCUS_48530 5285 5824 gene locus_tag LOCUS_48540 gene rpsG 5285 5824 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008875664.1 protein_id gnl|my_center|LOCUS_48540 5670 5679 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5766 7841 gene locus_tag LOCUS_48550 gene fusA 5766 7841 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390501.1 protein_id gnl|my_center|LOCUS_48550 >Feature sequence341 <1 736 gene locus_tag LOCUS_48560 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083652.1:chromosomal replication initiator protein DnaA 992 2110 gene locus_tag LOCUS_48570 gene dnaN 992 2110 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527877.1 protein_id gnl|my_center|LOCUS_48570 2114 3292 gene locus_tag LOCUS_48580 gene recF 2114 3292 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527878.1 protein_id gnl|my_center|LOCUS_48580 3294 5576 gene locus_tag LOCUS_48590 gene gyrB 3294 5576 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970600.1 protein_id gnl|my_center|LOCUS_48590 5469 5478 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5542 5721 gene locus_tag LOCUS_48600 5542 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48600 6474 6124 gene locus_tag LOCUS_48610 6474 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48610 7082 6744 gene locus_tag LOCUS_48620 7082 6744 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039044.1 protein_id gnl|my_center|LOCUS_48620 7297 7476 gene locus_tag LOCUS_48630 7297 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 >Feature sequence342 5 820 gene locus_tag LOCUS_48640 5 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 817 990 gene locus_tag LOCUS_48650 817 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 3966 3094 gene locus_tag LOCUS_48660 3966 3094 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_48660 5730 4789 gene locus_tag LOCUS_48670 5730 4789 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937401.1 protein_id gnl|my_center|LOCUS_48670 6815 5727 gene locus_tag LOCUS_48680 gene gmd 6815 5727 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167740.1 protein_id gnl|my_center|LOCUS_48680 <7980 6897 gene locus_tag LOCUS_48690 <7980 6897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481418.1:SLBB domain-containing protein >Feature sequence343 1766 348 gene locus_tag LOCUS_48700 gene exoT 1766 348 CDS product succinoglycan biosynthesis transport protein ExoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975911.1 protein_id gnl|my_center|LOCUS_48700 2111 1941 gene locus_tag LOCUS_48710 2111 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 2832 3023 gene locus_tag LOCUS_48720 2832 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 3898 3509 gene locus_tag LOCUS_48730 3898 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 5027 4569 gene locus_tag LOCUS_48740 5027 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 6695 5664 gene locus_tag LOCUS_48750 6695 5664 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_48750 >Feature sequence344 <1 976 gene locus_tag LOCUS_48760 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113728.1:dihydrolipoamide acetyltransferase family protein 979 2364 gene locus_tag LOCUS_48770 gene lpdA 979 2364 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528744.1 protein_id gnl|my_center|LOCUS_48770 2660 2466 gene locus_tag LOCUS_48780 2660 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 2559 3017 gene locus_tag LOCUS_48790 2559 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 4224 3052 gene locus_tag LOCUS_48800 4224 3052 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731042.1 protein_id gnl|my_center|LOCUS_48800 5694 4264 gene locus_tag LOCUS_48810 5694 4264 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086653.1 protein_id gnl|my_center|LOCUS_48810 5764 6798 gene locus_tag LOCUS_48820 5764 6798 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731043.1 protein_id gnl|my_center|LOCUS_48820 <7839 6795 gene locus_tag LOCUS_48830 <7839 6795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088553.1:flagellar biosynthesis protein FlhB >Feature sequence345 560 484 gene locus_tag LOCUS_t00440 560 484 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 814 888 gene locus_tag LOCUS_t00450 814 888 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2881 1496 gene locus_tag LOCUS_48840 2881 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 3344 2865 gene locus_tag LOCUS_48850 3344 2865 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026616817.1 protein_id gnl|my_center|LOCUS_48850 3766 3341 gene locus_tag LOCUS_48860 3766 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 4115 3759 gene locus_tag LOCUS_48870 4115 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 4231 4443 gene locus_tag LOCUS_48880 4231 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 4440 5084 gene locus_tag LOCUS_48890 4440 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 5081 5566 gene locus_tag LOCUS_48900 5081 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 5586 5804 gene locus_tag LOCUS_48910 5586 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 5853 7133 gene locus_tag LOCUS_48920 5853 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 7075 7293 gene locus_tag LOCUS_48930 7075 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 >Feature sequence346 1304 171 gene locus_tag LOCUS_48940 1304 171 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_48940 2550 1366 gene locus_tag LOCUS_48950 2550 1366 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_48950 2933 2643 gene locus_tag LOCUS_48960 2933 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 3007 4437 gene locus_tag LOCUS_48970 3007 4437 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_48970 5782 4466 gene locus_tag LOCUS_48980 5782 4466 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084264.1 protein_id gnl|my_center|LOCUS_48980 6147 6428 gene locus_tag LOCUS_48990 6147 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 6924 6502 gene locus_tag LOCUS_49000 6924 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 7194 6937 gene locus_tag LOCUS_49010 7194 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 7565 7194 gene locus_tag LOCUS_49020 7565 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 >Feature sequence347 1636 461 gene locus_tag LOCUS_49030 1636 461 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965219.1 protein_id gnl|my_center|LOCUS_49030 1779 3410 gene locus_tag LOCUS_49040 1779 3410 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_49040 3428 3853 gene locus_tag LOCUS_49050 3428 3853 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249283.1 protein_id gnl|my_center|LOCUS_49050 5262 4612 gene locus_tag LOCUS_49060 5262 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 5341 7359 gene locus_tag LOCUS_49070 5341 7359 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_49070 >Feature sequence348 258 500 gene locus_tag LOCUS_49080 258 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 1379 534 gene locus_tag LOCUS_49090 1379 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 1439 2557 gene locus_tag LOCUS_49100 1439 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 2573 3628 gene locus_tag LOCUS_49110 2573 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 3711 4064 gene locus_tag LOCUS_49120 3711 4064 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_49120 4079 5998 gene locus_tag LOCUS_49130 4079 5998 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031049.1 protein_id gnl|my_center|LOCUS_49130 7062 6865 gene locus_tag LOCUS_49140 7062 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 7168 7506 gene locus_tag LOCUS_49150 7168 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 >Feature sequence349 150 1076 gene locus_tag LOCUS_49160 150 1076 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 protein_id gnl|my_center|LOCUS_49160 1223 2044 gene locus_tag LOCUS_49170 1223 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 2212 2652 gene locus_tag LOCUS_49180 2212 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 3654 2548 gene locus_tag LOCUS_49190 3654 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 5431 3704 gene locus_tag LOCUS_49200 gene asnB 5431 3704 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_49200 <7731 5565 gene locus_tag LOCUS_49210 <7731 5565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103411.1:glycosyltransferase >Feature sequence350 467 805 gene locus_tag LOCUS_49220 467 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 995 1273 gene locus_tag LOCUS_49230 995 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 2198 1482 gene locus_tag LOCUS_49240 2198 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 3593 4729 gene locus_tag LOCUS_49250 3593 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 4719 5693 gene locus_tag LOCUS_49260 4719 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 6423 6148 gene locus_tag LOCUS_49270 6423 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 7629 6511 gene locus_tag LOCUS_49280 7629 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 >Feature sequence351 <1 799 gene locus_tag LOCUS_49290 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027581.1:DNA alkylation response protein 3082 845 gene locus_tag LOCUS_49300 gene parC 3082 845 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 protein_id gnl|my_center|LOCUS_49300 3961 3224 gene locus_tag LOCUS_49310 gene recO 3961 3224 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722424.1 protein_id gnl|my_center|LOCUS_49310 4891 3962 gene locus_tag LOCUS_49320 gene era 4891 3962 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640271.1 protein_id gnl|my_center|LOCUS_49320 5538 4888 gene locus_tag LOCUS_49330 gene rnc 5538 4888 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919434.1 protein_id gnl|my_center|LOCUS_49330 6481 5573 gene locus_tag LOCUS_49340 gene lepB 6481 5573 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389606.1 protein_id gnl|my_center|LOCUS_49340 6969 6547 gene locus_tag LOCUS_49350 gene acpS 6969 6547 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969020.1 protein_id gnl|my_center|LOCUS_49350 <7686 6966 gene locus_tag LOCUS_49360 <7686 6966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389607.1:pyridoxine 5'-phosphate synthase >Feature sequence352 700 53 gene locus_tag LOCUS_49370 700 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 1154 723 gene locus_tag LOCUS_49380 1154 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 2461 1151 gene locus_tag LOCUS_49390 2461 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 3627 2482 gene locus_tag LOCUS_49400 3627 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 4686 3730 gene locus_tag LOCUS_49410 4686 3730 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024927297.1 protein_id gnl|my_center|LOCUS_49410 5749 6969 gene locus_tag LOCUS_49420 5749 6969 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_49420 7184 7017 gene locus_tag LOCUS_49430 7184 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 >Feature sequence353 440 1174 gene locus_tag LOCUS_49440 440 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 1171 1671 gene locus_tag LOCUS_49450 1171 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089965.1 protein_id gnl|my_center|LOCUS_49450 2259 1849 gene locus_tag LOCUS_49460 2259 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 3440 2256 gene locus_tag LOCUS_49470 3440 2256 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459849.1 protein_id gnl|my_center|LOCUS_49470 3870 3415 gene locus_tag LOCUS_49480 3870 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 4112 4432 gene locus_tag LOCUS_49490 4112 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 4429 5349 gene locus_tag LOCUS_49500 4429 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 5406 5654 gene locus_tag LOCUS_49510 5406 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 5688 5891 gene locus_tag LOCUS_49520 5688 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 6152 7498 gene locus_tag LOCUS_49530 6152 7498 CDS product IS5-like element ISBj5_B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084757.1 protein_id gnl|my_center|LOCUS_49530 >Feature sequence354 1093 764 gene locus_tag LOCUS_49540 1093 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 1869 1438 gene locus_tag LOCUS_49550 1869 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 1976 2500 gene locus_tag LOCUS_49560 1976 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 3050 3328 gene locus_tag LOCUS_49570 3050 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 3325 4611 gene locus_tag LOCUS_49580 3325 4611 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084785.1 protein_id gnl|my_center|LOCUS_49580 5538 4759 gene locus_tag LOCUS_49590 5538 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 7165 5768 gene locus_tag LOCUS_49600 7165 5768 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328309.1 protein_id gnl|my_center|LOCUS_49600 >Feature sequence355 <1 597 gene locus_tag LOCUS_49610 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_153437548.1:Hint domain-containing protein 781 1209 gene locus_tag LOCUS_49620 781 1209 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509013.1 protein_id gnl|my_center|LOCUS_49620 1900 1250 gene locus_tag LOCUS_49630 1900 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 2379 3866 gene locus_tag LOCUS_49640 2379 3866 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149366214.1 protein_id gnl|my_center|LOCUS_49640 4088 3867 gene locus_tag LOCUS_49650 4088 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 4714 4460 gene locus_tag LOCUS_49660 4714 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 5397 4798 gene locus_tag LOCUS_49670 5397 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 7413 5635 gene locus_tag LOCUS_49680 7413 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 >Feature sequence356 733 1386 gene locus_tag LOCUS_49690 733 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 1499 2434 gene locus_tag LOCUS_49700 1499 2434 CDS product WxcM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771390.1 protein_id gnl|my_center|LOCUS_49700 2431 3531 gene locus_tag LOCUS_49710 2431 3531 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_49710 3528 4796 gene locus_tag LOCUS_49720 3528 4796 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036849.1 protein_id gnl|my_center|LOCUS_49720 4813 5961 gene locus_tag LOCUS_49730 4813 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 5943 7124 gene locus_tag LOCUS_49740 5943 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 7553 7182 gene locus_tag LOCUS_49750 7553 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 >Feature sequence357 21 97 gene locus_tag LOCUS_t00460 21 97 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 234 1658 gene locus_tag LOCUS_49760 234 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 1848 3254 gene locus_tag LOCUS_49770 1848 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 3465 3238 gene locus_tag LOCUS_49780 3465 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 3430 3675 gene locus_tag LOCUS_49790 3430 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 5300 3846 gene locus_tag LOCUS_49800 5300 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021016.1 protein_id gnl|my_center|LOCUS_49800 6646 5297 gene locus_tag LOCUS_49810 6646 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 >Feature sequence358 1043 6 gene locus_tag LOCUS_49820 1043 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 2452 1100 gene locus_tag LOCUS_49830 2452 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 6709 2465 gene locus_tag LOCUS_49840 6709 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 >Feature sequence359 100 1182 gene locus_tag LOCUS_49850 gene ltrA 100 1182 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975689.1 protein_id gnl|my_center|LOCUS_49850 2003 1473 gene locus_tag LOCUS_49860 2003 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 3672 4136 gene locus_tag LOCUS_49870 3672 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 5368 4460 gene locus_tag LOCUS_49880 5368 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 6090 5377 gene locus_tag LOCUS_49890 6090 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082894.1 protein_id gnl|my_center|LOCUS_49890 7135 6299 gene locus_tag LOCUS_49900 7135 6299 CDS product IS1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081285673.1 protein_id gnl|my_center|LOCUS_49900 >Feature sequence360 616 344 gene locus_tag LOCUS_49910 616 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 927 1709 gene locus_tag LOCUS_49920 927 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 1793 2185 gene locus_tag LOCUS_49930 1793 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 3547 2732 gene locus_tag LOCUS_49940 3547 2732 CDS product DUF3944 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323695.1 protein_id gnl|my_center|LOCUS_49940 4558 3731 gene locus_tag LOCUS_49950 4558 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 5206 4565 gene locus_tag LOCUS_49960 5206 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 5498 5217 gene locus_tag LOCUS_49970 5498 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 6175 5600 gene locus_tag LOCUS_49980 6175 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 6559 6182 gene locus_tag LOCUS_49990 6559 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 6846 6559 gene locus_tag LOCUS_50000 6846 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 7268 6804 gene locus_tag LOCUS_50010 7268 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 >Feature sequence361 1127 195 gene locus_tag LOCUS_50020 1127 195 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974798.1 protein_id gnl|my_center|LOCUS_50020 2569 1442 gene locus_tag LOCUS_50030 2569 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 2936 3382 gene locus_tag LOCUS_50040 2936 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 4983 3946 gene locus_tag LOCUS_50050 4983 3946 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387740.1 protein_id gnl|my_center|LOCUS_50050 5691 5380 gene locus_tag LOCUS_50060 5691 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 6353 5688 gene locus_tag LOCUS_50070 gene parA 6353 5688 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_50070 >Feature sequence362 1388 2557 gene locus_tag LOCUS_50080 1388 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 4407 2914 gene locus_tag LOCUS_50090 4407 2914 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331281.1 protein_id gnl|my_center|LOCUS_50090 4765 5613 gene locus_tag LOCUS_50100 4765 5613 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313648.1 protein_id gnl|my_center|LOCUS_50100 5670 6770 gene locus_tag LOCUS_50110 5670 6770 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973455.1 protein_id gnl|my_center|LOCUS_50110 >Feature sequence363 1759 107 gene locus_tag LOCUS_50120 1759 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 6824 1752 gene locus_tag LOCUS_50130 6824 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 >Feature sequence364 647 1384 gene locus_tag LOCUS_50140 647 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 5386 2402 gene locus_tag LOCUS_50150 5386 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 6201 5404 gene locus_tag LOCUS_50160 6201 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 7088 6198 gene locus_tag LOCUS_50170 7088 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 >Feature sequence365 867 121 gene locus_tag LOCUS_50180 867 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 1157 864 gene locus_tag LOCUS_50190 1157 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50190 1525 1154 gene locus_tag LOCUS_50200 1525 1154 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640021.1 protein_id gnl|my_center|LOCUS_50200 1674 3080 gene locus_tag LOCUS_50210 1674 3080 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002489776.1 protein_id gnl|my_center|LOCUS_50210 3114 4427 gene locus_tag LOCUS_50220 gene hisD 3114 4427 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969917.1 protein_id gnl|my_center|LOCUS_50220 4431 5192 gene locus_tag LOCUS_50230 4431 5192 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402585.1 protein_id gnl|my_center|LOCUS_50230 5202 6194 gene locus_tag LOCUS_50240 5202 6194 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_50240 6958 6206 gene locus_tag LOCUS_50250 6958 6206 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196014.1 protein_id gnl|my_center|LOCUS_50250 7183 7449 gene locus_tag LOCUS_50260 7183 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 >Feature sequence366 309 734 gene locus_tag LOCUS_50270 309 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 743 2722 gene locus_tag LOCUS_50280 743 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 2923 4101 gene locus_tag LOCUS_50290 2923 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 4253 7003 gene locus_tag LOCUS_50300 gene mobF 4253 7003 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_50300 >Feature sequence367 <1 511 gene locus_tag LOCUS_50310 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151062544.1:IS3 family transposase 582 1142 gene locus_tag LOCUS_50320 582 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 1147 2064 gene locus_tag LOCUS_50330 1147 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 2115 3908 gene locus_tag LOCUS_50340 2115 3908 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023602.1 protein_id gnl|my_center|LOCUS_50340 3941 6979 gene locus_tag LOCUS_50350 3941 6979 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_50350 <7417 6864 gene locus_tag LOCUS_50360 <7417 6864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069456393.1:IS66 family transposase >Feature sequence368 33 701 gene locus_tag LOCUS_50370 33 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 698 1165 gene locus_tag LOCUS_50380 698 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 1188 1349 gene locus_tag LOCUS_50390 1188 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 1887 1360 gene locus_tag LOCUS_50400 1887 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 2625 1972 gene locus_tag LOCUS_50410 2625 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 3007 2765 gene locus_tag LOCUS_50420 3007 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 3913 3134 gene locus_tag LOCUS_50430 3913 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 4315 4106 gene locus_tag LOCUS_50440 4315 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 4553 4798 gene locus_tag LOCUS_50450 4553 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 5483 4857 gene locus_tag LOCUS_50460 5483 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 5930 6190 gene locus_tag LOCUS_50470 5930 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 6147 6290 gene locus_tag LOCUS_50480 6147 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 6391 6807 gene locus_tag LOCUS_50490 6391 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 7095 6862 gene locus_tag LOCUS_50500 7095 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 >Feature sequence369 <1 528 gene locus_tag LOCUS_50510 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258704.1:UDP-glucose/GDP-mannose dehydrogenase family protein 843 658 gene locus_tag LOCUS_50520 843 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 844 1581 gene locus_tag LOCUS_50530 844 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 1762 2217 gene locus_tag LOCUS_50540 1762 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50540 2436 2242 gene locus_tag LOCUS_50550 2436 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 2388 2717 gene locus_tag LOCUS_50560 2388 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50560 2731 3702 gene locus_tag LOCUS_50570 2731 3702 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_50570 <7393 4135 gene locus_tag LOCUS_50580 <7393 4135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946848.1:EAL domain-containing protein >Feature sequence370 41 115 gene locus_tag LOCUS_t00470 41 115 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 886 395 gene locus_tag LOCUS_50590 886 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_50590 1210 920 gene locus_tag LOCUS_50600 1210 920 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855694.1 protein_id gnl|my_center|LOCUS_50600 2073 1258 gene locus_tag LOCUS_50610 2073 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 3172 2066 gene locus_tag LOCUS_50620 3172 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 5484 3169 gene locus_tag LOCUS_50630 5484 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 6659 5502 gene locus_tag LOCUS_50640 6659 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 >Feature sequence371 215 1243 gene locus_tag LOCUS_50650 215 1243 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_50650 1520 1287 gene locus_tag LOCUS_50660 1520 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50660 2737 1538 gene locus_tag LOCUS_50670 2737 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50670 3385 2756 gene locus_tag LOCUS_50680 3385 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 3669 4598 gene locus_tag LOCUS_50690 3669 4598 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942606.1 protein_id gnl|my_center|LOCUS_50690 4771 5652 gene locus_tag LOCUS_50700 4771 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 5699 6589 gene locus_tag LOCUS_50710 5699 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 6978 6754 gene locus_tag LOCUS_50720 6978 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 >Feature sequence372 967 1575 gene locus_tag LOCUS_50730 967 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 1837 1616 gene locus_tag LOCUS_50740 1837 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 2104 3435 gene locus_tag LOCUS_50750 2104 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 3438 3986 gene locus_tag LOCUS_50760 gene cyaB 3438 3986 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869738.1 protein_id gnl|my_center|LOCUS_50760 4486 5832 gene locus_tag LOCUS_50770 4486 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 5985 5722 gene locus_tag LOCUS_50780 5985 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 6135 5989 gene locus_tag LOCUS_50790 6135 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 6301 6699 gene locus_tag LOCUS_50800 6301 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 6882 7157 gene locus_tag LOCUS_50810 6882 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 >Feature sequence373 1185 316 gene locus_tag LOCUS_50820 gene gmd 1185 316 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414986.1 protein_id gnl|my_center|LOCUS_50820 3941 1641 gene locus_tag LOCUS_50830 3941 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 5677 3938 gene locus_tag LOCUS_50840 5677 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 6588 5809 gene locus_tag LOCUS_50850 6588 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 <7324 6590 gene locus_tag LOCUS_50860 <7324 6590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196469.1:capsular polysaccharide export inner-membrane protein, BexC/CtrB/KpsE family >Feature sequence374 291 16 gene locus_tag LOCUS_50870 291 16 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_50870 2896 458 gene locus_tag LOCUS_50880 gene lon 2896 458 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389427.1 protein_id gnl|my_center|LOCUS_50880 4502 3234 gene locus_tag LOCUS_50890 gene clpX 4502 3234 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312723.1 protein_id gnl|my_center|LOCUS_50890 5376 4687 gene locus_tag LOCUS_50900 5376 4687 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720342.1 protein_id gnl|my_center|LOCUS_50900 6948 5563 gene locus_tag LOCUS_50910 gene tig 6948 5563 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087709.1 protein_id gnl|my_center|LOCUS_50910 7142 7058 gene locus_tag LOCUS_t00480 7142 7058 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence375 1952 2530 gene locus_tag LOCUS_50920 1952 2530 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112313490.1 protein_id gnl|my_center|LOCUS_50920 2911 3195 gene locus_tag LOCUS_50930 2911 3195 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_50930 3214 3531 gene locus_tag LOCUS_50940 3214 3531 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034027947.1 protein_id gnl|my_center|LOCUS_50940 4006 3680 gene locus_tag LOCUS_50950 4006 3680 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042073.1 protein_id gnl|my_center|LOCUS_50950 4269 4006 gene locus_tag LOCUS_50960 4269 4006 CDS product MazE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042074.1 protein_id gnl|my_center|LOCUS_50960 4497 5156 gene locus_tag LOCUS_50970 4497 5156 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556051.1 protein_id gnl|my_center|LOCUS_50970 5171 5446 gene locus_tag LOCUS_50980 5171 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 5496 6674 gene locus_tag LOCUS_50990 5496 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 >Feature sequence376 668 1972 gene locus_tag LOCUS_51000 668 1972 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532124.1 protein_id gnl|my_center|LOCUS_51000 1994 2896 gene locus_tag LOCUS_51010 1994 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 4830 3103 gene locus_tag LOCUS_51020 4830 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 5076 5915 gene locus_tag LOCUS_51030 5076 5915 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096902.1 protein_id gnl|my_center|LOCUS_51030 7316 6045 gene locus_tag LOCUS_51040 7316 6045 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_51040 >Feature sequence377 1794 67 gene locus_tag LOCUS_51050 gene araD 1794 67 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083210.1 protein_id gnl|my_center|LOCUS_51050 2804 1878 gene locus_tag LOCUS_51060 2804 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 3820 2801 gene locus_tag LOCUS_51070 3820 2801 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_51070 4992 3817 gene locus_tag LOCUS_51080 4992 3817 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814041.1 protein_id gnl|my_center|LOCUS_51080 5288 5001 gene locus_tag LOCUS_51090 5288 5001 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_51090 6255 5536 gene locus_tag LOCUS_51100 6255 5536 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_51100 >Feature sequence378 235 1491 gene locus_tag LOCUS_51110 235 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 1995 2987 gene locus_tag LOCUS_51120 1995 2987 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186160.1 protein_id gnl|my_center|LOCUS_51120 4403 3180 gene locus_tag LOCUS_51130 4403 3180 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_51130 4810 4400 gene locus_tag LOCUS_51140 4810 4400 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316411.1 protein_id gnl|my_center|LOCUS_51140 5466 4879 gene locus_tag LOCUS_51150 5466 4879 CDS product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388479.1 protein_id gnl|my_center|LOCUS_51150 6041 5463 gene locus_tag LOCUS_51160 6041 5463 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_51160 >Feature sequence379 1586 2128 gene locus_tag LOCUS_51170 1586 2128 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211478017.1 protein_id gnl|my_center|LOCUS_51170 2655 2125 gene locus_tag LOCUS_51180 2655 2125 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_51180 3098 2688 gene locus_tag LOCUS_51190 3098 2688 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327209.1 protein_id gnl|my_center|LOCUS_51190 3202 4392 gene locus_tag LOCUS_51200 3202 4392 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533638.1 protein_id gnl|my_center|LOCUS_51200 4542 5006 gene locus_tag LOCUS_51210 4542 5006 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477208.1 protein_id gnl|my_center|LOCUS_51210 5068 5511 gene locus_tag LOCUS_51220 gene apaG 5068 5511 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533640.1 protein_id gnl|my_center|LOCUS_51220 5615 6259 gene locus_tag LOCUS_51230 gene folE 5615 6259 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388024.1 protein_id gnl|my_center|LOCUS_51230 >Feature sequence380 1261 47 gene locus_tag LOCUS_51240 1261 47 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420380.1 protein_id gnl|my_center|LOCUS_51240 2115 1261 gene locus_tag LOCUS_51250 gene kynA 2115 1261 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810516.1 protein_id gnl|my_center|LOCUS_51250 2260 2817 gene locus_tag LOCUS_51260 2260 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 4039 2954 gene locus_tag LOCUS_51270 4039 2954 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_51270 4888 4166 gene locus_tag LOCUS_51280 4888 4166 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_51280 6114 4888 gene locus_tag LOCUS_51290 6114 4888 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969759.1 protein_id gnl|my_center|LOCUS_51290 6182 7099 gene locus_tag LOCUS_51300 gene tesB 6182 7099 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972544.1 protein_id gnl|my_center|LOCUS_51300 >Feature sequence381 612 830 gene locus_tag LOCUS_51310 612 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 1932 958 gene locus_tag LOCUS_51320 1932 958 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975981.1 protein_id gnl|my_center|LOCUS_51320 2144 2770 gene locus_tag LOCUS_51330 2144 2770 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970025.1 protein_id gnl|my_center|LOCUS_51330 2786 3439 gene locus_tag LOCUS_51340 2786 3439 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970026.1 protein_id gnl|my_center|LOCUS_51340 3436 4386 gene locus_tag LOCUS_51350 3436 4386 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970027.1 protein_id gnl|my_center|LOCUS_51350 4386 5333 gene locus_tag LOCUS_51360 4386 5333 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970028.1 protein_id gnl|my_center|LOCUS_51360 5343 6182 gene locus_tag LOCUS_51370 5343 6182 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_51370 6247 7134 gene locus_tag LOCUS_51380 6247 7134 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066691.1 protein_id gnl|my_center|LOCUS_51380 >Feature sequence382 953 192 gene locus_tag LOCUS_51390 953 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 1345 1680 gene locus_tag LOCUS_51400 1345 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 1694 2014 gene locus_tag LOCUS_51410 1694 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 4298 2535 gene locus_tag LOCUS_51420 4298 2535 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095325.1 protein_id gnl|my_center|LOCUS_51420 4797 4264 gene locus_tag LOCUS_51430 4797 4264 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112313490.1 protein_id gnl|my_center|LOCUS_51430 5505 4891 gene locus_tag LOCUS_51440 5505 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 5738 5502 gene locus_tag LOCUS_51450 5738 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 6252 6070 gene locus_tag LOCUS_51460 6252 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 6336 6965 gene locus_tag LOCUS_51470 6336 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 >Feature sequence383 1625 1341 gene locus_tag LOCUS_51480 1625 1341 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968628.1 protein_id gnl|my_center|LOCUS_51480 2570 2241 gene locus_tag LOCUS_51490 2570 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 2865 2563 gene locus_tag LOCUS_51500 2865 2563 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227701.1 protein_id gnl|my_center|LOCUS_51500 3821 5170 gene locus_tag LOCUS_51510 3821 5170 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_51510 5184 6407 gene locus_tag LOCUS_51520 5184 6407 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_51520 6794 6639 gene locus_tag LOCUS_51530 6794 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 >Feature sequence384 420 1631 gene locus_tag LOCUS_51540 420 1631 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257684.1 protein_id gnl|my_center|LOCUS_51540 1628 2200 gene locus_tag LOCUS_51550 1628 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 2197 3111 gene locus_tag LOCUS_51560 2197 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 3218 3664 gene locus_tag LOCUS_51570 3218 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062537442.1 protein_id gnl|my_center|LOCUS_51570 3661 4422 gene locus_tag LOCUS_51580 3661 4422 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_51580 4435 5190 gene locus_tag LOCUS_51590 4435 5190 CDS product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932365.1 protein_id gnl|my_center|LOCUS_51590 >Feature sequence385 1512 439 gene locus_tag LOCUS_51600 1512 439 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027029.1 protein_id gnl|my_center|LOCUS_51600 2545 1862 gene locus_tag LOCUS_51610 2545 1862 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976175.1 protein_id gnl|my_center|LOCUS_51610 3252 2557 gene locus_tag LOCUS_51620 3252 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 5860 3437 gene locus_tag LOCUS_51630 5860 3437 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_51630 6947 6342 gene locus_tag LOCUS_51640 6947 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 >Feature sequence386 2503 1019 gene locus_tag LOCUS_51650 2503 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 2736 2503 gene locus_tag LOCUS_51660 2736 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 2864 4636 gene locus_tag LOCUS_51670 2864 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 4960 6486 gene locus_tag LOCUS_51680 4960 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 >Feature sequence387 106 30 gene locus_tag LOCUS_t00490 106 30 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 322 167 gene locus_tag LOCUS_51690 322 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 321 2273 gene locus_tag LOCUS_51700 321 2273 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337150.1 protein_id gnl|my_center|LOCUS_51700 3246 2281 gene locus_tag LOCUS_51710 3246 2281 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523004.1 protein_id gnl|my_center|LOCUS_51710 3626 3360 gene locus_tag LOCUS_51720 3626 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 3513 4907 gene locus_tag LOCUS_51730 gene hutH 3513 4907 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389056.1 protein_id gnl|my_center|LOCUS_51730 5072 6013 gene locus_tag LOCUS_51740 gene oppB 5072 6013 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 protein_id gnl|my_center|LOCUS_51740 6013 6948 gene locus_tag LOCUS_51750 6013 6948 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_51750 >Feature sequence388 417 2012 gene locus_tag LOCUS_51760 417 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 2021 2428 gene locus_tag LOCUS_51770 2021 2428 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537487.1 protein_id gnl|my_center|LOCUS_51770 2470 4605 gene locus_tag LOCUS_51780 2470 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 5090 4848 gene locus_tag LOCUS_51790 5090 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 >Feature sequence389 1701 1483 gene locus_tag LOCUS_51800 1701 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 3104 1932 gene locus_tag LOCUS_51810 3104 1932 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124212.1 protein_id gnl|my_center|LOCUS_51810 3486 3229 gene locus_tag LOCUS_51820 3486 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 5844 4705 gene locus_tag LOCUS_51830 5844 4705 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188825379.1 protein_id gnl|my_center|LOCUS_51830 <7054 5954 gene locus_tag LOCUS_51840 <7054 5954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009940936.1:oligosaccharide flippase family protein >Feature sequence390 <1 1164 gene locus_tag LOCUS_51850 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085891.1:thiamine pyrophosphate-requiring protein 2282 1554 gene locus_tag LOCUS_51860 2282 1554 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635457.1 protein_id gnl|my_center|LOCUS_51860 3883 2279 gene locus_tag LOCUS_51870 3883 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478646.1 protein_id gnl|my_center|LOCUS_51870 4265 3891 gene locus_tag LOCUS_51880 4265 3891 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007242046.1 protein_id gnl|my_center|LOCUS_51880 4319 4531 gene locus_tag LOCUS_51890 4319 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 4736 4891 gene locus_tag LOCUS_51900 4736 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 <7017 6457 gene locus_tag LOCUS_51910 <7017 6457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388109.1:NADP-dependent isocitrate dehydrogenase >Feature sequence391 891 331 gene locus_tag LOCUS_51920 891 331 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389354.1 protein_id gnl|my_center|LOCUS_51920 1417 896 gene locus_tag LOCUS_51930 1417 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 1577 2068 gene locus_tag LOCUS_51940 1577 2068 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640219.1 protein_id gnl|my_center|LOCUS_51940 4386 2242 gene locus_tag LOCUS_51950 4386 2242 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087787.1 protein_id gnl|my_center|LOCUS_51950 4991 4554 gene locus_tag LOCUS_51960 4991 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 5994 5035 gene locus_tag LOCUS_51970 gene thiL 5994 5035 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087788.1 protein_id gnl|my_center|LOCUS_51970 6545 6039 gene locus_tag LOCUS_51980 gene nusB 6545 6039 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919237.1 protein_id gnl|my_center|LOCUS_51980 6997 6542 gene locus_tag LOCUS_51990 gene ribH 6997 6542 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529297.1 protein_id gnl|my_center|LOCUS_51990 >Feature sequence392 1819 1082 gene locus_tag LOCUS_52000 1819 1082 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920676.1 protein_id gnl|my_center|LOCUS_52000 2856 1828 gene locus_tag LOCUS_52010 2856 1828 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163719979.1 protein_id gnl|my_center|LOCUS_52010 2919 3569 gene locus_tag LOCUS_52020 2919 3569 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039381.1 protein_id gnl|my_center|LOCUS_52020 3631 3837 gene locus_tag LOCUS_52030 3631 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 4392 4595 gene locus_tag LOCUS_52040 4392 4595 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202520.1 protein_id gnl|my_center|LOCUS_52040 4951 4778 gene locus_tag LOCUS_52050 4951 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 5433 5789 gene locus_tag LOCUS_52060 5433 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 5801 6181 gene locus_tag LOCUS_52070 gene arsC 5801 6181 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389745.1 protein_id gnl|my_center|LOCUS_52070 6178 6381 gene locus_tag LOCUS_52080 6178 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 >Feature sequence393 1530 220 gene locus_tag LOCUS_52090 1530 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 3883 1658 gene locus_tag LOCUS_52100 3883 1658 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_52100 5256 3880 gene locus_tag LOCUS_52110 5256 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 6278 5292 gene locus_tag LOCUS_52120 6278 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 >Feature sequence394 553 113 gene locus_tag LOCUS_52130 553 113 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083588.1 protein_id gnl|my_center|LOCUS_52130 992 576 gene locus_tag LOCUS_52140 992 576 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_52140 1918 989 gene locus_tag LOCUS_52150 1918 989 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523300.1 protein_id gnl|my_center|LOCUS_52150 2945 1941 gene locus_tag LOCUS_52160 2945 1941 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268112.1 protein_id gnl|my_center|LOCUS_52160 3864 3019 gene locus_tag LOCUS_52170 3864 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 4001 4822 gene locus_tag LOCUS_52180 4001 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 5268 6812 gene locus_tag LOCUS_52190 5268 6812 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086915.1 protein_id gnl|my_center|LOCUS_52190 >Feature sequence395 <1 678 gene locus_tag LOCUS_52200 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211951264.1:IS5 family transposase 1403 840 gene locus_tag LOCUS_52210 1403 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 3349 1418 gene locus_tag LOCUS_52220 3349 1418 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_52220 4493 3585 gene locus_tag LOCUS_52230 4493 3585 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967680.1 protein_id gnl|my_center|LOCUS_52230 5476 4490 gene locus_tag LOCUS_52240 5476 4490 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967329.1 protein_id gnl|my_center|LOCUS_52240 6051 5473 gene locus_tag LOCUS_52250 6051 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 6598 6344 gene locus_tag LOCUS_52260 6598 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52260 >Feature sequence396 226 1575 gene locus_tag LOCUS_52270 226 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 3056 1842 gene locus_tag LOCUS_52280 3056 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 3535 3056 gene locus_tag LOCUS_52290 3535 3056 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074940824.1 protein_id gnl|my_center|LOCUS_52290 6923 3525 gene locus_tag LOCUS_52300 6923 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 >Feature sequence397 385 555 gene locus_tag LOCUS_52310 385 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 1387 2664 gene locus_tag LOCUS_52320 1387 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 2657 3358 gene locus_tag LOCUS_52330 2657 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 3355 4392 gene locus_tag LOCUS_52340 3355 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 4402 5631 gene locus_tag LOCUS_52350 4402 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 5788 6645 gene locus_tag LOCUS_52360 5788 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 6605 6835 gene locus_tag LOCUS_52370 6605 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 >Feature sequence398 1427 4204 gene locus_tag LOCUS_52380 1427 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 4422 4901 gene locus_tag LOCUS_52390 4422 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 6459 5062 gene locus_tag LOCUS_52400 gene pncB 6459 5062 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528440.1 protein_id gnl|my_center|LOCUS_52400 >Feature sequence399 1018 1185 gene locus_tag LOCUS_52410 1018 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 1814 2041 gene locus_tag LOCUS_52420 1814 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 4851 5393 gene locus_tag LOCUS_52430 4851 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52430 5412 6167 gene locus_tag LOCUS_52440 5412 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52440 >Feature sequence400 397 813 gene locus_tag LOCUS_52450 397 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 4350 877 gene locus_tag LOCUS_52460 4350 877 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_52460 5616 4351 gene locus_tag LOCUS_52470 5616 4351 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_52470 6381 5707 gene locus_tag LOCUS_52480 6381 5707 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 protein_id gnl|my_center|LOCUS_52480 >Feature sequence401 1837 1043 gene locus_tag LOCUS_52490 1837 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 2745 1933 gene locus_tag LOCUS_52500 2745 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 3630 2899 gene locus_tag LOCUS_52510 3630 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 4135 3632 gene locus_tag LOCUS_52520 4135 3632 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 protein_id gnl|my_center|LOCUS_52520 4338 4535 gene locus_tag LOCUS_52530 4338 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 4613 5689 gene locus_tag LOCUS_52540 4613 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 <6804 5787 gene locus_tag LOCUS_52550 <6804 5787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021009.1:catalase/peroxidase HPI >Feature sequence402 <1 509 gene locus_tag LOCUS_52560 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073078.1:Wzz/FepE/Etk N-terminal domain-containing protein 2383 2823 gene locus_tag LOCUS_52570 2383 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 5156 5362 gene locus_tag LOCUS_52580 5156 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 5260 5562 gene locus_tag LOCUS_52590 5260 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 5635 6084 gene locus_tag LOCUS_52600 5635 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 >Feature sequence403 <1 822 gene locus_tag LOCUS_52610 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113717.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase 819 1991 gene locus_tag LOCUS_52620 819 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 1981 2772 gene locus_tag LOCUS_52630 1981 2772 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194135.1 protein_id gnl|my_center|LOCUS_52630 2775 6407 gene locus_tag LOCUS_52640 2775 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 >Feature sequence404 1000 578 gene locus_tag LOCUS_52650 1000 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 1888 1478 gene locus_tag LOCUS_52660 1888 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 2489 1872 gene locus_tag LOCUS_52670 2489 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 3357 2938 gene locus_tag LOCUS_52680 3357 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252675.1 protein_id gnl|my_center|LOCUS_52680 3605 3357 gene locus_tag LOCUS_52690 3605 3357 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875404.1 protein_id gnl|my_center|LOCUS_52690 4370 5860 gene locus_tag LOCUS_52700 4370 5860 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 protein_id gnl|my_center|LOCUS_52700 <6760 6009 gene locus_tag LOCUS_52710 <6760 6009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965382.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence405 270 437 gene locus_tag LOCUS_52720 270 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 1246 467 gene locus_tag LOCUS_52730 gene rfbF 1246 467 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261038.1 protein_id gnl|my_center|LOCUS_52730 2010 1234 gene locus_tag LOCUS_52740 2010 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 3556 2627 gene locus_tag LOCUS_52750 3556 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 3668 3823 gene locus_tag LOCUS_52760 3668 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 5148 5333 gene locus_tag LOCUS_52770 5148 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 5514 5696 gene locus_tag LOCUS_52780 5514 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 >Feature sequence406 418 1272 gene locus_tag LOCUS_52790 gene sseA 418 1272 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_52790 1269 1799 gene locus_tag LOCUS_52800 1269 1799 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531462.1 protein_id gnl|my_center|LOCUS_52800 1889 3388 gene locus_tag LOCUS_52810 1889 3388 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142259.1 protein_id gnl|my_center|LOCUS_52810 3385 4539 gene locus_tag LOCUS_52820 gene metC 3385 4539 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087217.1 protein_id gnl|my_center|LOCUS_52820 4536 4910 gene locus_tag LOCUS_52830 gene hisI 4536 4910 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403778.1 protein_id gnl|my_center|LOCUS_52830 6360 5053 gene locus_tag LOCUS_52840 6360 5053 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114363.1 protein_id gnl|my_center|LOCUS_52840 >Feature sequence407 441 2087 gene locus_tag LOCUS_52850 441 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 3628 2105 gene locus_tag LOCUS_52860 3628 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 5670 3832 gene locus_tag LOCUS_52870 5670 3832 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974287.1 protein_id gnl|my_center|LOCUS_52870 6154 6579 gene locus_tag LOCUS_52880 6154 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 >Feature sequence408 3 212 gene locus_tag LOCUS_52890 3 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 216 482 gene locus_tag LOCUS_52900 216 482 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785693.1 protein_id gnl|my_center|LOCUS_52900 520 744 gene locus_tag LOCUS_52910 520 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 1080 2195 gene locus_tag LOCUS_52920 1080 2195 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_52920 2195 3136 gene locus_tag LOCUS_52930 2195 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 3341 3192 gene locus_tag LOCUS_52940 3341 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 3282 3497 gene locus_tag LOCUS_52950 3282 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 4638 3484 gene locus_tag LOCUS_52960 4638 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 5142 4642 gene locus_tag LOCUS_52970 5142 4642 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749610.1 protein_id gnl|my_center|LOCUS_52970 5531 5139 gene locus_tag LOCUS_52980 5531 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 6171 5521 gene locus_tag LOCUS_52990 6171 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 6205 6402 gene locus_tag LOCUS_53000 6205 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 >Feature sequence409 1288 554 gene locus_tag LOCUS_53010 1288 554 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086767.1 protein_id gnl|my_center|LOCUS_53010 1657 1463 gene locus_tag LOCUS_53020 1657 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 1568 2464 gene locus_tag LOCUS_53030 1568 2464 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967638.1 protein_id gnl|my_center|LOCUS_53030 5839 2831 gene locus_tag LOCUS_53040 5839 2831 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038833.1 protein_id gnl|my_center|LOCUS_53040 5807 5956 gene locus_tag LOCUS_53050 5807 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 >Feature sequence410 2067 364 gene locus_tag LOCUS_53060 2067 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261758.1 protein_id gnl|my_center|LOCUS_53060 3806 2064 gene locus_tag LOCUS_53070 3806 2064 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261757.1 protein_id gnl|my_center|LOCUS_53070 4725 4231 gene locus_tag LOCUS_53080 4725 4231 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086781.1 protein_id gnl|my_center|LOCUS_53080 5331 4735 gene locus_tag LOCUS_53090 5331 4735 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556052.1 protein_id gnl|my_center|LOCUS_53090 >Feature sequence411 <1 1575 gene locus_tag LOCUS_53100 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891828.1:class I SAM-dependent DNA methyltransferase 1575 4916 gene locus_tag LOCUS_53110 1575 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 5051 6313 gene locus_tag LOCUS_53120 5051 6313 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_53120 >Feature sequence412 419 679 gene locus_tag LOCUS_53130 419 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 2103 1201 gene locus_tag LOCUS_53140 2103 1201 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082969.1 protein_id gnl|my_center|LOCUS_53140 2483 2959 gene locus_tag LOCUS_53150 2483 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 3044 3793 gene locus_tag LOCUS_53160 3044 3793 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172783.1 protein_id gnl|my_center|LOCUS_53160 3787 4482 gene locus_tag LOCUS_53170 gene fabG 3787 4482 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_53170 4494 5267 gene locus_tag LOCUS_53180 4494 5267 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_53180 5314 6252 gene locus_tag LOCUS_53190 gene speB 5314 6252 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112934.1 protein_id gnl|my_center|LOCUS_53190 >Feature sequence413 1 771 gene locus_tag LOCUS_53200 1 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 1174 2784 gene locus_tag LOCUS_53210 1174 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 3475 3921 gene locus_tag LOCUS_53220 3475 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 4056 4283 gene locus_tag LOCUS_53230 4056 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 4993 4355 gene locus_tag LOCUS_53240 4993 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 6517 5225 gene locus_tag LOCUS_53250 6517 5225 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_53250 >Feature sequence414 406 627 gene locus_tag LOCUS_53260 406 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 624 1277 gene locus_tag LOCUS_53270 624 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 1274 1882 gene locus_tag LOCUS_53280 1274 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 1889 5401 gene locus_tag LOCUS_53290 gene brxC 1889 5401 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 protein_id gnl|my_center|LOCUS_53290 >Feature sequence415 1965 412 gene locus_tag LOCUS_53300 1965 412 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073069.1 protein_id gnl|my_center|LOCUS_53300 2021 2296 gene locus_tag LOCUS_53310 2021 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 3498 2659 gene locus_tag LOCUS_53320 3498 2659 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112142.1 protein_id gnl|my_center|LOCUS_53320 4724 3495 gene locus_tag LOCUS_53330 4724 3495 CDS product methyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707820.1 protein_id gnl|my_center|LOCUS_53330 4945 4721 gene locus_tag LOCUS_53340 4945 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 4976 5218 gene locus_tag LOCUS_53350 4976 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 6365 5286 gene locus_tag LOCUS_53360 gene rfbG 6365 5286 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 protein_id gnl|my_center|LOCUS_53360 >Feature sequence416 1339 59 gene locus_tag LOCUS_53370 1339 59 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329028.1 protein_id gnl|my_center|LOCUS_53370 1737 1813 gene locus_tag LOCUS_t00500 1737 1813 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2474 2190 gene locus_tag LOCUS_53380 2474 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 2391 3278 gene locus_tag LOCUS_53390 2391 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 4478 3519 gene locus_tag LOCUS_53400 4478 3519 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865320.1 protein_id gnl|my_center|LOCUS_53400 >Feature sequence417 1646 174 gene locus_tag LOCUS_53410 1646 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 2362 1643 gene locus_tag LOCUS_53420 2362 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 3531 2371 gene locus_tag LOCUS_53430 gene devC 3531 2371 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056491.1 protein_id gnl|my_center|LOCUS_53430 4405 3521 gene locus_tag LOCUS_53440 4405 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 5645 5439 gene locus_tag LOCUS_53450 5645 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 6540 6025 gene locus_tag LOCUS_53460 6540 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 >Feature sequence418 1148 576 gene locus_tag LOCUS_53470 1148 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 1714 1319 gene locus_tag LOCUS_53480 1714 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 2079 1828 gene locus_tag LOCUS_53490 2079 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 4376 3231 gene locus_tag LOCUS_53500 4376 3231 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765279.1 protein_id gnl|my_center|LOCUS_53500 5349 6461 gene locus_tag LOCUS_53510 5349 6461 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_53510 >Feature sequence419 1222 1332 gene locus_tag LOCUS_r00010 1222 1332 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1771 2763 gene locus_tag LOCUS_53520 1771 2763 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943747.1 protein_id gnl|my_center|LOCUS_53520 3038 3709 gene locus_tag LOCUS_53530 3038 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 3718 4716 gene locus_tag LOCUS_53540 3718 4716 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 protein_id gnl|my_center|LOCUS_53540 5600 4917 gene locus_tag LOCUS_53550 5600 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 6351 5881 gene locus_tag LOCUS_53560 6351 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 >Feature sequence420 3 422 gene locus_tag LOCUS_53570 3 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 431 1978 gene locus_tag LOCUS_53580 431 1978 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205993.1 protein_id gnl|my_center|LOCUS_53580 2081 3076 gene locus_tag LOCUS_53590 gene hemB 2081 3076 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 protein_id gnl|my_center|LOCUS_53590 4537 3077 gene locus_tag LOCUS_53600 gene clcA 4537 3077 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393094.1 protein_id gnl|my_center|LOCUS_53600 5599 5027 gene locus_tag LOCUS_53610 5599 5027 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_53610 6477 5596 gene locus_tag LOCUS_53620 6477 5596 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086521.1 protein_id gnl|my_center|LOCUS_53620 >Feature sequence421 <1 511 gene locus_tag LOCUS_53630 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084221.1:ATP-dependent chaperone ClpB 2250 622 gene locus_tag LOCUS_53640 2250 622 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388528.1 protein_id gnl|my_center|LOCUS_53640 3421 2513 gene locus_tag LOCUS_53650 3421 2513 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036544.1 protein_id gnl|my_center|LOCUS_53650 3788 3393 gene locus_tag LOCUS_53660 3788 3393 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944172.1 protein_id gnl|my_center|LOCUS_53660 4215 4511 gene locus_tag LOCUS_53670 gene rpmB 4215 4511 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066777.1 protein_id gnl|my_center|LOCUS_53670 6192 4885 gene locus_tag LOCUS_53680 gene gltA 6192 4885 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531749.1 protein_id gnl|my_center|LOCUS_53680 >Feature sequence422 575 730 gene locus_tag LOCUS_53690 575 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 4104 1498 gene locus_tag LOCUS_53700 4104 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 4340 4164 gene locus_tag LOCUS_53710 4340 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53710 5706 4534 gene locus_tag LOCUS_53720 5706 4534 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 protein_id gnl|my_center|LOCUS_53720 <6557 5850 gene locus_tag LOCUS_53730 <6557 5850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389474.1:lipid-A-disaccharide synthase >Feature sequence423 1334 1705 gene locus_tag LOCUS_53740 1334 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53740 3132 2167 gene locus_tag LOCUS_53750 3132 2167 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056892.1 protein_id gnl|my_center|LOCUS_53750 4100 3135 gene locus_tag LOCUS_53760 4100 3135 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243814.1 protein_id gnl|my_center|LOCUS_53760 4681 4851 gene locus_tag LOCUS_53770 4681 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 5995 5534 gene locus_tag LOCUS_53780 5995 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 6435 6103 gene locus_tag LOCUS_53790 6435 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 >Feature sequence424 1701 388 gene locus_tag LOCUS_53800 1701 388 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208594.1 protein_id gnl|my_center|LOCUS_53800 2558 1698 gene locus_tag LOCUS_53810 gene rfbD 2558 1698 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807150.1 protein_id gnl|my_center|LOCUS_53810 2974 2558 gene locus_tag LOCUS_53820 2974 2558 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303195.1 protein_id gnl|my_center|LOCUS_53820 4083 2971 gene locus_tag LOCUS_53830 gene rfbG 4083 2971 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107729.1 protein_id gnl|my_center|LOCUS_53830 4920 4138 gene locus_tag LOCUS_53840 gene rfbF 4920 4138 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816873.1 protein_id gnl|my_center|LOCUS_53840 5103 4939 gene locus_tag LOCUS_53850 5103 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 >Feature sequence425 2566 893 gene locus_tag LOCUS_53860 2566 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 3342 2644 gene locus_tag LOCUS_53870 3342 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 3530 3342 gene locus_tag LOCUS_53880 3530 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 3742 4737 gene locus_tag LOCUS_53890 3742 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 4994 6169 gene locus_tag LOCUS_53900 4994 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 >Feature sequence426 <1 502 gene locus_tag LOCUS_53910 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918829.1:choline dehydrogenase 2024 885 gene locus_tag LOCUS_53920 2024 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 2156 3067 gene locus_tag LOCUS_53930 2156 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 4123 4926 gene locus_tag LOCUS_53940 4123 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 4939 5589 gene locus_tag LOCUS_53950 4939 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 6312 5611 gene locus_tag LOCUS_53960 6312 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 >Feature sequence427 1425 2564 gene locus_tag LOCUS_53970 1425 2564 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_53970 3412 2501 gene locus_tag LOCUS_53980 3412 2501 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790388.1 protein_id gnl|my_center|LOCUS_53980 4368 3409 gene locus_tag LOCUS_53990 4368 3409 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327253.1 protein_id gnl|my_center|LOCUS_53990 4512 6116 gene locus_tag LOCUS_54000 4512 6116 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074275.1 protein_id gnl|my_center|LOCUS_54000 >Feature sequence428 531 1796 gene locus_tag LOCUS_54010 531 1796 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_54010 1799 2422 gene locus_tag LOCUS_54020 1799 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 2419 5310 gene locus_tag LOCUS_54030 2419 5310 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_54030 >Feature sequence429 2230 74 gene locus_tag LOCUS_54040 2230 74 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967572.1 protein_id gnl|my_center|LOCUS_54040 2229 2399 gene locus_tag LOCUS_54050 2229 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 3917 2472 gene locus_tag LOCUS_54060 gene ntrC 3917 2472 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087260.1 protein_id gnl|my_center|LOCUS_54060 5008 3914 gene locus_tag LOCUS_54070 5008 3914 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_54070 5191 6342 gene locus_tag LOCUS_54080 5191 6342 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_54080 >Feature sequence430 146 268 gene locus_tag LOCUS_54090 146 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 1533 775 gene locus_tag LOCUS_54100 1533 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 1799 1548 gene locus_tag LOCUS_54110 1799 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 2652 1852 gene locus_tag LOCUS_54120 2652 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 3132 2662 gene locus_tag LOCUS_54130 3132 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 3419 3249 gene locus_tag LOCUS_54140 3419 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 3801 3998 gene locus_tag LOCUS_54150 3801 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 4000 4902 gene locus_tag LOCUS_54160 4000 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 >Feature sequence431 785 54 gene locus_tag LOCUS_54170 785 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 988 866 gene locus_tag LOCUS_54180 988 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 1301 1834 gene locus_tag LOCUS_54190 1301 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 2389 2766 gene locus_tag LOCUS_54200 2389 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 2795 3490 gene locus_tag LOCUS_54210 2795 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 3867 4865 gene locus_tag LOCUS_54220 3867 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 5489 6154 gene locus_tag LOCUS_54230 5489 6154 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265678.1 protein_id gnl|my_center|LOCUS_54230 >Feature sequence432 1544 360 gene locus_tag LOCUS_54240 1544 360 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085815.1 protein_id gnl|my_center|LOCUS_54240 3039 1534 gene locus_tag LOCUS_54250 3039 1534 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_54250 3554 3156 gene locus_tag LOCUS_54260 3554 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 4429 3914 gene locus_tag LOCUS_54270 4429 3914 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087107.1 protein_id gnl|my_center|LOCUS_54270 5715 4495 gene locus_tag LOCUS_54280 5715 4495 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088242.1 protein_id gnl|my_center|LOCUS_54280 >Feature sequence433 2203 803 gene locus_tag LOCUS_54290 2203 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 <6296 2216 gene locus_tag LOCUS_54300 <6296 2216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942079.1:tetratricopeptide repeat protein >Feature sequence434 197 508 gene locus_tag LOCUS_54310 197 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 1993 533 gene locus_tag LOCUS_54320 1993 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 2295 2116 gene locus_tag LOCUS_54330 2295 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 3105 2626 gene locus_tag LOCUS_54340 3105 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 3493 4284 gene locus_tag LOCUS_54350 3493 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 4360 5178 gene locus_tag LOCUS_54360 4360 5178 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494146.1 protein_id gnl|my_center|LOCUS_54360 5694 5188 gene locus_tag LOCUS_54370 5694 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 5975 5790 gene locus_tag LOCUS_54380 5975 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 >Feature sequence435 3366 1027 gene locus_tag LOCUS_54390 gene metE 3366 1027 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918370.1 protein_id gnl|my_center|LOCUS_54390 3788 3540 gene locus_tag LOCUS_54400 3788 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 4366 5868 gene locus_tag LOCUS_54410 gene araA 4366 5868 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816285.1 protein_id gnl|my_center|LOCUS_54410 >Feature sequence436 800 985 gene locus_tag LOCUS_54420 800 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 1095 1559 gene locus_tag LOCUS_54430 1095 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 1552 1884 gene locus_tag LOCUS_54440 1552 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 1956 3854 gene locus_tag LOCUS_54450 1956 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 >Feature sequence437 338 496 gene locus_tag LOCUS_54460 338 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 493 1905 gene locus_tag LOCUS_54470 493 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200386714.1 protein_id gnl|my_center|LOCUS_54470 1896 3725 gene locus_tag LOCUS_54480 1896 3725 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095325.1 protein_id gnl|my_center|LOCUS_54480 3725 6010 gene locus_tag LOCUS_54490 3725 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 >Feature sequence438 249 1973 gene locus_tag LOCUS_54500 249 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 2077 3186 gene locus_tag LOCUS_54510 2077 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 3401 3222 gene locus_tag LOCUS_54520 3401 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 4102 3365 gene locus_tag LOCUS_54530 4102 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 4576 4863 gene locus_tag LOCUS_54540 4576 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 4885 5106 gene locus_tag LOCUS_54550 4885 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 >Feature sequence439 939 511 gene locus_tag LOCUS_54560 939 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 1982 987 gene locus_tag LOCUS_54570 1982 987 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640144.1 protein_id gnl|my_center|LOCUS_54570 2789 2025 gene locus_tag LOCUS_54580 2789 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 2958 4490 gene locus_tag LOCUS_54590 2958 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 4516 4992 gene locus_tag LOCUS_54600 4516 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 4989 5576 gene locus_tag LOCUS_54610 4989 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 >Feature sequence440 172 1422 gene locus_tag LOCUS_54620 172 1422 CDS product IS701 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151614010.1 protein_id gnl|my_center|LOCUS_54620 1777 1950 gene locus_tag LOCUS_54630 1777 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54630 2934 1918 gene locus_tag LOCUS_54640 2934 1918 CDS product IS701 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151614010.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54640 3211 3885 gene locus_tag LOCUS_54650 3211 3885 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339150.1 protein_id gnl|my_center|LOCUS_54650 3878 5248 gene locus_tag LOCUS_54660 3878 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 >Feature sequence441 5 1513 gene locus_tag LOCUS_54670 5 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 2469 1849 gene locus_tag LOCUS_54680 2469 1849 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808006.1 protein_id gnl|my_center|LOCUS_54680 2637 4427 gene locus_tag LOCUS_54690 2637 4427 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388194.1 protein_id gnl|my_center|LOCUS_54690 >Feature sequence442 298 561 gene locus_tag LOCUS_54700 298 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 583 777 gene locus_tag LOCUS_54710 583 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 1092 1538 gene locus_tag LOCUS_54720 1092 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 3395 1611 gene locus_tag LOCUS_54730 3395 1611 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_54730 4261 3974 gene locus_tag LOCUS_54740 4261 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 5653 4541 gene locus_tag LOCUS_54750 5653 4541 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035469.1 protein_id gnl|my_center|LOCUS_54750 >Feature sequence443 <1 691 gene locus_tag LOCUS_54760 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028171841.1:SMC-Scp complex subunit ScpB 1880 723 gene locus_tag LOCUS_54770 gene rnd 1880 723 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_54770 2114 3916 gene locus_tag LOCUS_54780 gene aspS 2114 3916 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_54780 4362 4207 gene locus_tag LOCUS_54790 4362 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 5336 4845 gene locus_tag LOCUS_54800 5336 4845 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390991.1 protein_id gnl|my_center|LOCUS_54800 5897 5352 gene locus_tag LOCUS_54810 5897 5352 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532842.1 protein_id gnl|my_center|LOCUS_54810 6161 5934 gene locus_tag LOCUS_54820 6161 5934 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007599451.1 protein_id gnl|my_center|LOCUS_54820 >Feature sequence444 433 134 gene locus_tag LOCUS_54830 433 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 1703 426 gene locus_tag LOCUS_54840 1703 426 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728774.1 protein_id gnl|my_center|LOCUS_54840 2438 1722 gene locus_tag LOCUS_54850 2438 1722 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265528.1 protein_id gnl|my_center|LOCUS_54850 3759 2509 gene locus_tag LOCUS_54860 3759 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 <6179 3826 gene locus_tag LOCUS_54870 <6179 3826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265751.1:TonB-dependent receptor >Feature sequence445 459 214 gene locus_tag LOCUS_54880 459 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 370 1620 gene locus_tag LOCUS_54890 370 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 1622 5566 gene locus_tag LOCUS_54900 1622 5566 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_54900 >Feature sequence446 <1 1335 gene locus_tag LOCUS_54910 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014490278.1:ParB/RepB/Spo0J family partition protein 2077 1832 gene locus_tag LOCUS_54920 2077 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 2186 2707 gene locus_tag LOCUS_54930 2186 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54930 3083 4021 gene locus_tag LOCUS_54940 3083 4021 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 protein_id gnl|my_center|LOCUS_54940 >Feature sequence447 611 2512 gene locus_tag LOCUS_54950 611 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 2905 3483 gene locus_tag LOCUS_54960 2905 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54960 3710 3537 gene locus_tag LOCUS_54970 3710 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 4616 5476 gene locus_tag LOCUS_54980 gene kdsA 4616 5476 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087568.1 protein_id gnl|my_center|LOCUS_54980 5911 5498 gene locus_tag LOCUS_54990 5911 5498 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083819.1 protein_id gnl|my_center|LOCUS_54990 >Feature sequence448 309 989 gene locus_tag LOCUS_55000 309 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 2354 1050 gene locus_tag LOCUS_55010 2354 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 2758 2351 gene locus_tag LOCUS_55020 2758 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 3717 4097 gene locus_tag LOCUS_55030 3717 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 4166 5893 gene locus_tag LOCUS_55040 4166 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 >Feature sequence449 1931 1248 gene locus_tag LOCUS_55050 1931 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 2408 3577 gene locus_tag LOCUS_55060 2408 3577 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084435133.1 protein_id gnl|my_center|LOCUS_55060 3677 5320 gene locus_tag LOCUS_55070 3677 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 5317 6084 gene locus_tag LOCUS_55080 5317 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 >Feature sequence450 2770 458 gene locus_tag LOCUS_55090 2770 458 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086745.1 protein_id gnl|my_center|LOCUS_55090 3553 2780 gene locus_tag LOCUS_55100 3553 2780 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085849.1 protein_id gnl|my_center|LOCUS_55100 5202 3715 gene locus_tag LOCUS_55110 gene glpK 5202 3715 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113887.1 protein_id gnl|my_center|LOCUS_55110 5764 5246 gene locus_tag LOCUS_55120 5764 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 >Feature sequence451 1125 1553 gene locus_tag LOCUS_55130 1125 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 1543 4149 gene locus_tag LOCUS_55140 1543 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 >Feature sequence452 1806 835 gene locus_tag LOCUS_55150 gene gmd 1806 835 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_55150 2021 2239 gene locus_tag LOCUS_55160 2021 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 4443 3493 gene locus_tag LOCUS_55170 4443 3493 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937401.1 protein_id gnl|my_center|LOCUS_55170 5528 4440 gene locus_tag LOCUS_55180 gene gmd 5528 4440 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_55180 >Feature sequence453 516 1880 gene locus_tag LOCUS_55190 516 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 2274 1990 gene locus_tag LOCUS_55200 2274 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 2333 3079 gene locus_tag LOCUS_55210 2333 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 3294 4052 gene locus_tag LOCUS_55220 3294 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 5589 4405 gene locus_tag LOCUS_55230 5589 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 >Feature sequence454 189 488 gene locus_tag LOCUS_55240 189 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042066.1 protein_id gnl|my_center|LOCUS_55240 488 1627 gene locus_tag LOCUS_55250 488 1627 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226992642.1 protein_id gnl|my_center|LOCUS_55250 1608 3266 gene locus_tag LOCUS_55260 1608 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104630.1 protein_id gnl|my_center|LOCUS_55260 3269 5197 gene locus_tag LOCUS_55270 3269 5197 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124433837.1 protein_id gnl|my_center|LOCUS_55270 5194 5667 gene locus_tag LOCUS_55280 5194 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 >Feature sequence455 907 659 gene locus_tag LOCUS_55290 907 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 1026 4241 gene locus_tag LOCUS_55300 1026 4241 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053708.1 protein_id gnl|my_center|LOCUS_55300 4390 4728 gene locus_tag LOCUS_55310 4390 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 4802 5653 gene locus_tag LOCUS_55320 4802 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 >Feature sequence456 859 1080 gene locus_tag LOCUS_55330 859 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 1473 1087 gene locus_tag LOCUS_55340 1473 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 1494 2690 gene locus_tag LOCUS_55350 1494 2690 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089644.1 protein_id gnl|my_center|LOCUS_55350 4197 2761 gene locus_tag LOCUS_55360 4197 2761 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_55360 4890 4207 gene locus_tag LOCUS_55370 4890 4207 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965709.1 protein_id gnl|my_center|LOCUS_55370 <5931 4992 gene locus_tag LOCUS_55380 <5931 4992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014327729.1:Do family serine endopeptidase >Feature sequence457 181 2580 gene locus_tag LOCUS_55390 gene traA 181 2580 CDS product Ti-type conjugative transfer relaxase TraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028385425.1 protein_id gnl|my_center|LOCUS_55390 2999 2607 gene locus_tag LOCUS_55400 2999 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 3582 3052 gene locus_tag LOCUS_55410 3582 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 4145 3942 gene locus_tag LOCUS_55420 4145 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 4759 4334 gene locus_tag LOCUS_55430 4759 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 4971 5543 gene locus_tag LOCUS_55440 4971 5543 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112313490.1 protein_id gnl|my_center|LOCUS_55440 5861 5553 gene locus_tag LOCUS_55450 5861 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 >Feature sequence458 1009 1941 gene locus_tag LOCUS_55460 1009 1941 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087903.1 protein_id gnl|my_center|LOCUS_55460 1938 4214 gene locus_tag LOCUS_55470 1938 4214 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388680.1 protein_id gnl|my_center|LOCUS_55470 4261 5562 gene locus_tag LOCUS_55480 4261 5562 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087901.1 protein_id gnl|my_center|LOCUS_55480 >Feature sequence459 99 3158 gene locus_tag LOCUS_55490 99 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 3333 5267 gene locus_tag LOCUS_55500 3333 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 >Feature sequence460 101 856 gene locus_tag LOCUS_55510 101 856 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258591.1 protein_id gnl|my_center|LOCUS_55510 915 1937 gene locus_tag LOCUS_55520 915 1937 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268112.1 protein_id gnl|my_center|LOCUS_55520 2021 2752 gene locus_tag LOCUS_55530 2021 2752 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_55530 5513 3396 gene locus_tag LOCUS_55540 5513 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 >Feature sequence461 775 987 gene locus_tag LOCUS_55550 775 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 989 5311 gene locus_tag LOCUS_55560 989 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 >Feature sequence462 <1 1125 gene locus_tag LOCUS_55570 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197190.1:AAA family ATPase 1365 3299 gene locus_tag LOCUS_55580 1365 3299 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040060.1 protein_id gnl|my_center|LOCUS_55580 2038 2047 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5691 3400 gene locus_tag LOCUS_55590 5691 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 >Feature sequence463 1303 2004 gene locus_tag LOCUS_55600 gene queC 1303 2004 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 protein_id gnl|my_center|LOCUS_55600 3164 1998 gene locus_tag LOCUS_55610 3164 1998 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089530.1 protein_id gnl|my_center|LOCUS_55610 5057 4731 gene locus_tag LOCUS_55620 5057 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 >Feature sequence464 2 820 gene locus_tag LOCUS_55630 2 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 825 1715 gene locus_tag LOCUS_55640 825 1715 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_55640 1712 2929 gene locus_tag LOCUS_55650 1712 2929 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878526.1 protein_id gnl|my_center|LOCUS_55650 2950 4494 gene locus_tag LOCUS_55660 gene fadD8 2950 4494 CDS product fatty-acid--CoA ligase FadD8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191317023.1 protein_id gnl|my_center|LOCUS_55660 5065 4989 gene locus_tag LOCUS_t00510 5065 4989 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence465 961 221 gene locus_tag LOCUS_55670 961 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 1223 1618 gene locus_tag LOCUS_55680 1223 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 2969 1986 gene locus_tag LOCUS_55690 gene nadE 2969 1986 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976175.1 protein_id gnl|my_center|LOCUS_55690 4912 2966 gene locus_tag LOCUS_55700 gene asnB 4912 2966 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533124.1 protein_id gnl|my_center|LOCUS_55700 5216 4971 gene locus_tag LOCUS_55710 5216 4971 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061274.1 protein_id gnl|my_center|LOCUS_55710 >Feature sequence466 762 1682 gene locus_tag LOCUS_55720 762 1682 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110188582.1 protein_id gnl|my_center|LOCUS_55720 1834 2904 gene locus_tag LOCUS_55730 1834 2904 CDS product DGQHR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105447.1 protein_id gnl|my_center|LOCUS_55730 2915 3763 gene locus_tag LOCUS_55740 2915 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 5421 4015 gene locus_tag LOCUS_55750 5421 4015 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946805.1 protein_id gnl|my_center|LOCUS_55750 >Feature sequence467 <1 545 gene locus_tag LOCUS_55760 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011787328.1:FemAB family PEP-CTERM system-associated protein 756 1412 gene locus_tag LOCUS_55770 756 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55770 1409 1867 gene locus_tag LOCUS_55780 1409 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55780 3975 4421 gene locus_tag LOCUS_55790 3975 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 4460 4888 gene locus_tag LOCUS_55800 4460 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 >Feature sequence468 110 385 gene locus_tag LOCUS_55810 110 385 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_55810 611 441 gene locus_tag LOCUS_55820 611 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 959 1034 gene locus_tag LOCUS_t00520 959 1034 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1218 1745 gene locus_tag LOCUS_55830 1218 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 2621 2697 gene locus_tag LOCUS_t00530 2621 2697 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2926 3291 gene locus_tag LOCUS_55840 2926 3291 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910112.1 protein_id gnl|my_center|LOCUS_55840 3282 3854 gene locus_tag LOCUS_55850 3282 3854 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640371.1 protein_id gnl|my_center|LOCUS_55850 3867 4478 gene locus_tag LOCUS_55860 3867 4478 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531091.1 protein_id gnl|my_center|LOCUS_55860 4475 5674 gene locus_tag LOCUS_55870 4475 5674 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087682.1 protein_id gnl|my_center|LOCUS_55870 >Feature sequence469 239 36 gene locus_tag LOCUS_55880 239 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 653 1675 gene locus_tag LOCUS_55890 653 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 2276 1983 gene locus_tag LOCUS_55900 2276 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 2526 2254 gene locus_tag LOCUS_55910 2526 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 2794 3255 gene locus_tag LOCUS_55920 2794 3255 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_55920 3750 3355 gene locus_tag LOCUS_55930 3750 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 3960 4232 gene locus_tag LOCUS_55940 3960 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 4915 5442 gene locus_tag LOCUS_55950 4915 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 >Feature sequence470 1295 942 gene locus_tag LOCUS_55960 1295 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 1809 3446 gene locus_tag LOCUS_55970 1809 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55970 3408 3417 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4947 5246 gene locus_tag LOCUS_55980 4947 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 >Feature sequence471 <1 697 gene locus_tag LOCUS_55990 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000089603.1:site-specific integrase 744 1499 gene locus_tag LOCUS_56000 744 1499 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929490.1 protein_id gnl|my_center|LOCUS_56000 1492 2220 gene locus_tag LOCUS_56010 1492 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 2189 2635 gene locus_tag LOCUS_56020 2189 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 3354 3142 gene locus_tag LOCUS_56030 3354 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 3744 3478 gene locus_tag LOCUS_56040 3744 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 4219 3728 gene locus_tag LOCUS_56050 4219 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 4542 4216 gene locus_tag LOCUS_56060 4542 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 5178 4543 gene locus_tag LOCUS_56070 5178 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 >Feature sequence472 1707 283 gene locus_tag LOCUS_56080 1707 283 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 protein_id gnl|my_center|LOCUS_56080 3426 1846 gene locus_tag LOCUS_56090 3426 1846 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365322.1 protein_id gnl|my_center|LOCUS_56090 4357 3974 gene locus_tag LOCUS_56100 4357 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 >Feature sequence473 495 64 gene locus_tag LOCUS_56110 495 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56110 2741 630 gene locus_tag LOCUS_56120 2741 630 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_56120 3903 3397 gene locus_tag LOCUS_56130 3903 3397 CDS product cupredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040632.1 protein_id gnl|my_center|LOCUS_56130 4785 3985 gene locus_tag LOCUS_56140 4785 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 >Feature sequence474 40 231 gene locus_tag LOCUS_56150 40 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 544 2031 gene locus_tag LOCUS_56160 544 2031 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263391.1 protein_id gnl|my_center|LOCUS_56160 2028 3554 gene locus_tag LOCUS_56170 2028 3554 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263393.1 protein_id gnl|my_center|LOCUS_56170 3547 4737 gene locus_tag LOCUS_56180 3547 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 >Feature sequence475 1131 172 gene locus_tag LOCUS_56190 1131 172 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103810.1 protein_id gnl|my_center|LOCUS_56190 4017 1357 gene locus_tag LOCUS_56200 4017 1357 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389549.1 protein_id gnl|my_center|LOCUS_56200 4844 4140 gene locus_tag LOCUS_56210 gene popZ 4844 4140 CDS product pole-organizing protein PopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919196.1 protein_id gnl|my_center|LOCUS_56210 <5548 5001 gene locus_tag LOCUS_56220 <5548 5001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969269.1:protein-L-isoaspartate O-methyltransferase >Feature sequence476 2116 737 gene locus_tag LOCUS_56230 2116 737 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 protein_id gnl|my_center|LOCUS_56230 3027 2092 gene locus_tag LOCUS_56240 3027 2092 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974044.1 protein_id gnl|my_center|LOCUS_56240 4382 3024 gene locus_tag LOCUS_56250 4382 3024 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225277.1 protein_id gnl|my_center|LOCUS_56250 4586 4729 gene locus_tag LOCUS_56260 4586 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 >Feature sequence477 88 834 gene locus_tag LOCUS_56270 88 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 831 2963 gene locus_tag LOCUS_56280 831 2963 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918570.1 protein_id gnl|my_center|LOCUS_56280 3379 3287 gene locus_tag LOCUS_t00540 3379 3287 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3879 3553 gene locus_tag LOCUS_56290 3879 3553 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_56290 4604 3879 gene locus_tag LOCUS_56300 4604 3879 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174100.1 protein_id gnl|my_center|LOCUS_56300 >Feature sequence478 261 10 gene locus_tag LOCUS_56310 261 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 1073 309 gene locus_tag LOCUS_56320 1073 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 2721 1090 gene locus_tag LOCUS_56330 2721 1090 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 protein_id gnl|my_center|LOCUS_56330 3054 4373 gene locus_tag LOCUS_56340 3054 4373 CDS product citrate-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170457.1 protein_id gnl|my_center|LOCUS_56340 >Feature sequence479 778 347 gene locus_tag LOCUS_56350 778 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56350 1371 1075 gene locus_tag LOCUS_56360 1371 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 2144 1926 gene locus_tag LOCUS_56370 2144 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56370 2770 2135 gene locus_tag LOCUS_56380 gene parA 2770 2135 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022836937.1 protein_id gnl|my_center|LOCUS_56380 3307 3050 gene locus_tag LOCUS_56390 3307 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 3914 4855 gene locus_tag LOCUS_56400 3914 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 <5471 4956 gene locus_tag LOCUS_56410 <5471 4956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_057443118.1:tyrosine-type recombinase/integrase >Feature sequence480 4109 228 gene locus_tag LOCUS_56420 4109 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 5218 4430 gene locus_tag LOCUS_56430 5218 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56430 >Feature sequence481 220 444 gene locus_tag LOCUS_56440 220 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 466 2163 gene locus_tag LOCUS_56450 466 2163 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 protein_id gnl|my_center|LOCUS_56450 2145 2056 gene locus_tag LOCUS_t00550 2145 2056 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2552 2370 gene locus_tag LOCUS_56460 2552 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 3164 2556 gene locus_tag LOCUS_56470 3164 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_56470 4644 3334 gene locus_tag LOCUS_56480 4644 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56480 >Feature sequence482 1046 630 gene locus_tag LOCUS_56490 1046 630 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313709.1 protein_id gnl|my_center|LOCUS_56490 1316 2929 gene locus_tag LOCUS_56500 1316 2929 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480502.1 protein_id gnl|my_center|LOCUS_56500 3012 4583 gene locus_tag LOCUS_56510 3012 4583 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480502.1 protein_id gnl|my_center|LOCUS_56510 4649 5029 gene locus_tag LOCUS_56520 4649 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 >Feature sequence483 1051 275 gene locus_tag LOCUS_56530 1051 275 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083902.1 protein_id gnl|my_center|LOCUS_56530 1325 2020 gene locus_tag LOCUS_56540 1325 2020 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845178.1 protein_id gnl|my_center|LOCUS_56540 3132 2896 gene locus_tag LOCUS_56550 3132 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 3920 3387 gene locus_tag LOCUS_56560 3920 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 <5378 4703 gene locus_tag LOCUS_56570 <5378 4703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162992354.1:phosphatase PAP2 family protein >Feature sequence484 792 604 gene locus_tag LOCUS_56580 792 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 1549 1325 gene locus_tag LOCUS_56590 1549 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 1822 2082 gene locus_tag LOCUS_56600 1822 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 2082 2492 gene locus_tag LOCUS_56610 2082 2492 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_56610 2548 2817 gene locus_tag LOCUS_56620 2548 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56620 2995 3387 gene locus_tag LOCUS_56630 2995 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 3659 3360 gene locus_tag LOCUS_56640 3659 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 4632 3682 gene locus_tag LOCUS_56650 4632 3682 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633599.1 protein_id gnl|my_center|LOCUS_56650 >Feature sequence485 1193 72 gene locus_tag LOCUS_56660 1193 72 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 protein_id gnl|my_center|LOCUS_56660 1621 1403 gene locus_tag LOCUS_56670 1621 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 1766 1560 gene locus_tag LOCUS_56680 1766 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 1848 3152 gene locus_tag LOCUS_56690 1848 3152 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_56690 3211 4110 gene locus_tag LOCUS_56700 3211 4110 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037942.1 protein_id gnl|my_center|LOCUS_56700 4207 5169 gene locus_tag LOCUS_56710 4207 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 >Feature sequence486 <1 802 gene locus_tag LOCUS_56720 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976046.1:sugar phosphate isomerase/epimerase 805 1683 gene locus_tag LOCUS_56730 805 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 1680 2600 gene locus_tag LOCUS_56740 1680 2600 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_56740 2597 3445 gene locus_tag LOCUS_56750 2597 3445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_56750 3735 3532 gene locus_tag LOCUS_56760 3735 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 3734 4597 gene locus_tag LOCUS_56770 3734 4597 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973995.1 protein_id gnl|my_center|LOCUS_56770 >Feature sequence487 2089 896 gene locus_tag LOCUS_56780 2089 896 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_56780 2783 2169 gene locus_tag LOCUS_56790 2783 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 3615 2785 gene locus_tag LOCUS_56800 3615 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022387.1 protein_id gnl|my_center|LOCUS_56800 4739 3618 gene locus_tag LOCUS_56810 4739 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 <5345 4736 gene locus_tag LOCUS_56820 <5345 4736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201778938.1:class I SAM-dependent DNA methyltransferase >Feature sequence488 2040 613 gene locus_tag LOCUS_56830 gene hpnJ 2040 613 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_56830 3235 2060 gene locus_tag LOCUS_56840 gene hpnI 3235 2060 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197829.1 protein_id gnl|my_center|LOCUS_56840 3647 3414 gene locus_tag LOCUS_56850 3647 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 >Feature sequence489 2269 26 gene locus_tag LOCUS_56860 gene vpsO 2269 26 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_56860 2976 2266 gene locus_tag LOCUS_56870 2976 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 3352 4521 gene locus_tag LOCUS_56880 3352 4521 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_56880 4698 4991 gene locus_tag LOCUS_56890 4698 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 >Feature sequence490 244 627 gene locus_tag LOCUS_56900 244 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 728 2065 gene locus_tag LOCUS_56910 728 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 2331 3464 gene locus_tag LOCUS_56920 2331 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 3461 4384 gene locus_tag LOCUS_56930 3461 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 4592 4410 gene locus_tag LOCUS_56940 4592 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 >Feature sequence491 <1 1777 gene locus_tag LOCUS_56950 <1 1777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265751.1:TonB-dependent receptor 3114 1837 gene locus_tag LOCUS_56960 3114 1837 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086334.1 protein_id gnl|my_center|LOCUS_56960 3213 4412 gene locus_tag LOCUS_56970 3213 4412 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532385.1 protein_id gnl|my_center|LOCUS_56970 4409 5239 gene locus_tag LOCUS_56980 4409 5239 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546285.1 protein_id gnl|my_center|LOCUS_56980 >Feature sequence492 341 54 gene locus_tag LOCUS_56990 341 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 956 1279 gene locus_tag LOCUS_57000 956 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 3730 4476 gene locus_tag LOCUS_57010 3730 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57010 >Feature sequence493 687 445 gene locus_tag LOCUS_57020 687 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 892 1128 gene locus_tag LOCUS_57030 892 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 1239 1499 gene locus_tag LOCUS_57040 1239 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 1496 1909 gene locus_tag LOCUS_57050 1496 1909 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_57050 2642 1977 gene locus_tag LOCUS_57060 2642 1977 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544852.1 protein_id gnl|my_center|LOCUS_57060 2728 3459 gene locus_tag LOCUS_57070 2728 3459 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524793.1 protein_id gnl|my_center|LOCUS_57070 3456 4700 gene locus_tag LOCUS_57080 3456 4700 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190526.1 protein_id gnl|my_center|LOCUS_57080 >Feature sequence494 1018 1164 gene locus_tag LOCUS_57090 1018 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 1758 3113 gene locus_tag LOCUS_57100 1758 3113 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088244.1 protein_id gnl|my_center|LOCUS_57100 <5285 3262 gene locus_tag LOCUS_57110 <5285 3262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921394.1:M1 family metallopeptidase >Feature sequence495 1471 2145 gene locus_tag LOCUS_57120 1471 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 2142 4433 gene locus_tag LOCUS_57130 2142 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 4683 4943 gene locus_tag LOCUS_57140 4683 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 >Feature sequence496 <1 4717 gene locus_tag LOCUS_57150 <1 4717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090812.1:DUF4011 domain-containing protein >Feature sequence497 544 620 gene locus_tag LOCUS_t00560 544 620 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 790 945 gene locus_tag LOCUS_57160 790 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57160 1016 1092 gene locus_tag LOCUS_t00570 1016 1092 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3191 1182 gene locus_tag LOCUS_57170 3191 1182 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 protein_id gnl|my_center|LOCUS_57170 4231 3374 gene locus_tag LOCUS_57180 4231 3374 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_57180 4767 4240 gene locus_tag LOCUS_57190 4767 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57190 >Feature sequence498 573 824 gene locus_tag LOCUS_57200 573 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57200 1210 4476 gene locus_tag LOCUS_57210 1210 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 4616 4978 gene locus_tag LOCUS_57220 4616 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 >Feature sequence499 79 336 gene locus_tag LOCUS_57230 79 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 607 870 gene locus_tag LOCUS_57240 607 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 1570 2733 gene locus_tag LOCUS_57250 1570 2733 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_57250 2735 3868 gene locus_tag LOCUS_57260 2735 3868 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_57260 3870 4823 gene locus_tag LOCUS_57270 3870 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57270 >Feature sequence500 273 1082 gene locus_tag LOCUS_57280 273 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 1473 2579 gene locus_tag LOCUS_57290 1473 2579 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202342.1 protein_id gnl|my_center|LOCUS_57290 2619 3464 gene locus_tag LOCUS_57300 2619 3464 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795870.1 protein_id gnl|my_center|LOCUS_57300 3567 4571 gene locus_tag LOCUS_57310 3567 4571 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349090.1 protein_id gnl|my_center|LOCUS_57310 4555 4983 gene locus_tag LOCUS_57320 4555 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 >Feature sequence501 1012 260 gene locus_tag LOCUS_57330 gene panC 1012 260 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920027.1 protein_id gnl|my_center|LOCUS_57330 1111 4311 gene locus_tag LOCUS_57340 gene putA 1111 4311 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_57340 >Feature sequence502 2730 4796 gene locus_tag LOCUS_57350 2730 4796 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_57350 >Feature sequence503 46 121 gene locus_tag LOCUS_t00580 46 121 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 407 769 gene locus_tag LOCUS_57360 407 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 766 1080 gene locus_tag LOCUS_57370 766 1080 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976332.1 protein_id gnl|my_center|LOCUS_57370 1413 1775 gene locus_tag LOCUS_57380 1413 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 1772 4849 gene locus_tag LOCUS_57390 1772 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 5106 4933 gene locus_tag LOCUS_57400 5106 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 >Feature sequence504 22 98 gene locus_tag LOCUS_t00590 22 98 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 491 868 gene locus_tag LOCUS_57410 491 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 861 1931 gene locus_tag LOCUS_57420 861 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 3422 4723 gene locus_tag LOCUS_57430 3422 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 >Feature sequence505 274 1062 gene locus_tag LOCUS_57440 274 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57440 1037 2572 gene locus_tag LOCUS_57450 1037 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 2569 3123 gene locus_tag LOCUS_57460 2569 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 3688 3185 gene locus_tag LOCUS_57470 3688 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 4922 3846 gene locus_tag LOCUS_57480 4922 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 >Feature sequence506 566 2173 gene locus_tag LOCUS_57490 566 2173 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 protein_id gnl|my_center|LOCUS_57490 2480 2857 gene locus_tag LOCUS_57500 2480 2857 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972404.1 protein_id gnl|my_center|LOCUS_57500 3195 3010 gene locus_tag LOCUS_57510 3195 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 4160 3465 gene locus_tag LOCUS_57520 4160 3465 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529648.1 protein_id gnl|my_center|LOCUS_57520 <5121 4157 gene locus_tag LOCUS_57530 <5121 4157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529647.1:sensor histidine kinase KdpD >Feature sequence507 1353 1114 gene locus_tag LOCUS_57540 1353 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 1704 1480 gene locus_tag LOCUS_57550 1704 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 1607 3571 gene locus_tag LOCUS_57560 1607 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 >Feature sequence508 288 1310 gene locus_tag LOCUS_57570 288 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 2788 1451 gene locus_tag LOCUS_57580 2788 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57580 3793 4749 gene locus_tag LOCUS_57590 3793 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 >Feature sequence509 2230 218 gene locus_tag LOCUS_57600 2230 218 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963667.1 protein_id gnl|my_center|LOCUS_57600 3449 2253 gene locus_tag LOCUS_57610 3449 2253 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037257.1 protein_id gnl|my_center|LOCUS_57610 >Feature sequence510 2080 524 gene locus_tag LOCUS_57620 2080 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181762083.1 protein_id gnl|my_center|LOCUS_57620 4002 2077 gene locus_tag LOCUS_57630 4002 2077 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181762082.1 protein_id gnl|my_center|LOCUS_57630 <4981 4344 gene locus_tag LOCUS_57640 <4981 4344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261607.1:GTPase HflX >Feature sequence511 539 1432 gene locus_tag LOCUS_57650 539 1432 CDS product DUF2806 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279526.1 protein_id gnl|my_center|LOCUS_57650 1473 2102 gene locus_tag LOCUS_57660 1473 2102 CDS product ApaLI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012859081.1 protein_id gnl|my_center|LOCUS_57660 2099 3382 gene locus_tag LOCUS_57670 2099 3382 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256229.1 protein_id gnl|my_center|LOCUS_57670 3451 4638 gene locus_tag LOCUS_57680 3451 4638 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228775.1 protein_id gnl|my_center|LOCUS_57680 >Feature sequence512 328 1176 gene locus_tag LOCUS_57690 328 1176 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266006.1 protein_id gnl|my_center|LOCUS_57690 1173 2249 gene locus_tag LOCUS_57700 1173 2249 CDS product DUF2817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533436.1 protein_id gnl|my_center|LOCUS_57700 2516 2592 gene locus_tag LOCUS_t00600 2516 2592 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3690 3965 gene locus_tag LOCUS_57710 3690 3965 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387805.1 protein_id gnl|my_center|LOCUS_57710 >Feature sequence513 463 83 gene locus_tag LOCUS_57720 463 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 2406 1384 gene locus_tag LOCUS_57730 2406 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 4220 3729 gene locus_tag LOCUS_57740 4220 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 >Feature sequence514 410 105 gene locus_tag LOCUS_57750 410 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 954 424 gene locus_tag LOCUS_57760 954 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 1111 1332 gene locus_tag LOCUS_57770 1111 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 4382 1329 gene locus_tag LOCUS_57780 gene cas9 4382 1329 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_57780 >Feature sequence515 684 821 gene locus_tag LOCUS_57790 684 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 918 2066 gene locus_tag LOCUS_57800 918 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 3575 2355 gene locus_tag LOCUS_57810 3575 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57810 >Feature sequence516 1078 296 gene locus_tag LOCUS_57820 1078 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 2182 1142 gene locus_tag LOCUS_57830 2182 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57830 3497 3616 gene locus_tag LOCUS_57840 3497 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 >Feature sequence517 3711 1030 gene locus_tag LOCUS_57850 3711 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 4103 3867 gene locus_tag LOCUS_57860 4103 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 >Feature sequence518 41 778 gene locus_tag LOCUS_57870 41 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 778 1809 gene locus_tag LOCUS_57880 778 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57880 1809 2138 gene locus_tag LOCUS_57890 1809 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 3584 2178 gene locus_tag LOCUS_57900 3584 2178 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145647357.1 protein_id gnl|my_center|LOCUS_57900 >Feature sequence519 1231 5 gene locus_tag LOCUS_57910 1231 5 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372834.1 protein_id gnl|my_center|LOCUS_57910 2202 1777 gene locus_tag LOCUS_57920 2202 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 2444 2701 gene locus_tag LOCUS_57930 2444 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 2701 3162 gene locus_tag LOCUS_57940 2701 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57940 4577 3297 gene locus_tag LOCUS_57950 4577 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 >Feature sequence520 218 1297 gene locus_tag LOCUS_57960 218 1297 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_57960 1795 1313 gene locus_tag LOCUS_57970 1795 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 3559 1982 gene locus_tag LOCUS_57980 3559 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 4602 3556 gene locus_tag LOCUS_57990 4602 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 >Feature sequence521 557 928 gene locus_tag LOCUS_58000 557 928 CDS product DUF2513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103417.1 protein_id gnl|my_center|LOCUS_58000 925 1887 gene locus_tag LOCUS_58010 925 1887 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_58010 3610 2015 gene locus_tag LOCUS_58020 3610 2015 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_58020 3991 3755 gene locus_tag LOCUS_58030 3991 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 4656 4468 gene locus_tag LOCUS_58040 4656 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58040 >Feature sequence522 547 795 gene locus_tag LOCUS_58050 547 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58050 933 1673 gene locus_tag LOCUS_58060 933 1673 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_58060 3155 2964 gene locus_tag LOCUS_58070 3155 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 4732 3182 gene locus_tag LOCUS_58080 4732 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 >Feature sequence523 104 442 gene locus_tag LOCUS_58090 104 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 2830 1523 gene locus_tag LOCUS_58100 2830 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 <4722 2823 gene locus_tag LOCUS_58110 <4722 2823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044036390.1:DNA (cytosine-5-)-methyltransferase >Feature sequence524 1684 986 gene locus_tag LOCUS_58120 1684 986 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383630.1 protein_id gnl|my_center|LOCUS_58120 1793 1869 gene locus_tag LOCUS_t00610 1793 1869 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2136 2011 gene locus_tag LOCUS_58130 2136 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58130 2502 2846 gene locus_tag LOCUS_58140 2502 2846 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533389.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_58140 2836 4152 gene locus_tag LOCUS_58150 2836 4152 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533388.1 protein_id gnl|my_center|LOCUS_58150 4152 4616 gene locus_tag LOCUS_58160 4152 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58160 >Feature sequence525 3040 344 gene locus_tag LOCUS_58170 3040 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 3222 4139 gene locus_tag LOCUS_58180 3222 4139 CDS product viperin family antiviral radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957056.1 protein_id gnl|my_center|LOCUS_58180 4136 4381 gene locus_tag LOCUS_58190 4136 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 >Feature sequence526 2019 265 gene locus_tag LOCUS_58200 2019 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58200 2985 2221 gene locus_tag LOCUS_58210 2985 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 3323 2988 gene locus_tag LOCUS_58220 3323 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 3755 3576 gene locus_tag LOCUS_58230 3755 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 3897 3736 gene locus_tag LOCUS_58240 3897 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58240 4258 4100 gene locus_tag LOCUS_58250 4258 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 >Feature sequence527 <1 875 gene locus_tag LOCUS_58260 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919447.1:flagellar motor protein MotB 980 1717 gene locus_tag LOCUS_58270 980 1717 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087800.1 protein_id gnl|my_center|LOCUS_58270 3482 1764 gene locus_tag LOCUS_58280 gene metG 3482 1764 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919354.1 protein_id gnl|my_center|LOCUS_58280 3935 3549 gene locus_tag LOCUS_58290 3935 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 4164 4239 gene locus_tag LOCUS_t00620 4164 4239 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence528 2330 318 gene locus_tag LOCUS_58300 2330 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58300 3571 2330 gene locus_tag LOCUS_58310 3571 2330 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103419.1 protein_id gnl|my_center|LOCUS_58310 3941 3561 gene locus_tag LOCUS_58320 3941 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 4155 3931 gene locus_tag LOCUS_58330 4155 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58330 4439 4152 gene locus_tag LOCUS_58340 4439 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 >Feature sequence529 1292 408 gene locus_tag LOCUS_58350 1292 408 CDS product N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans,octacis-undecaprenol 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999466.1 protein_id gnl|my_center|LOCUS_58350 1684 2721 gene locus_tag LOCUS_58360 1684 2721 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194045.1 protein_id gnl|my_center|LOCUS_58360 2715 3299 gene locus_tag LOCUS_58370 gene gmhA2 2715 3299 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857991.1 protein_id gnl|my_center|LOCUS_58370 >Feature sequence530 2658 3965 gene locus_tag LOCUS_58380 2658 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 >Feature sequence531 62 1150 gene locus_tag LOCUS_58390 62 1150 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 protein_id gnl|my_center|LOCUS_58390 1147 2133 gene locus_tag LOCUS_58400 1147 2133 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947988.1 protein_id gnl|my_center|LOCUS_58400 2120 2779 gene locus_tag LOCUS_58410 gene maiA 2120 2779 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_58410 2769 3221 gene locus_tag LOCUS_58420 2769 3221 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_58420 3804 3211 gene locus_tag LOCUS_58430 3804 3211 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_58430 <4591 3801 gene locus_tag LOCUS_58440 <4591 3801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391352.1:LutB/LldF family L-lactate oxidation iron-sulfur protein >Feature sequence532 483 37 gene locus_tag LOCUS_58450 483 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58450 618 1118 gene locus_tag LOCUS_58460 618 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58460 1115 1363 gene locus_tag LOCUS_58470 1115 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58470 1517 1699 gene locus_tag LOCUS_58480 1517 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 >Feature sequence533 3546 442 gene locus_tag LOCUS_58490 3546 442 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038833.1 protein_id gnl|my_center|LOCUS_58490 <4503 3632 gene locus_tag LOCUS_58500 <4503 3632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072754367.1:restriction endonuclease subunit S >Feature sequence534 251 733 gene locus_tag LOCUS_58510 251 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 1546 746 gene locus_tag LOCUS_58520 1546 746 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_58520 2488 1574 gene locus_tag LOCUS_58530 2488 1574 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_58530 2656 3378 gene locus_tag LOCUS_58540 2656 3378 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446421.1 protein_id gnl|my_center|LOCUS_58540 3846 3385 gene locus_tag LOCUS_58550 3846 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 >Feature sequence535 2712 1579 gene locus_tag LOCUS_58560 2712 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58560 3194 2727 gene locus_tag LOCUS_58570 3194 2727 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528500.1 protein_id gnl|my_center|LOCUS_58570 >Feature sequence536 204 470 gene locus_tag LOCUS_58580 204 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58580 464 1393 gene locus_tag LOCUS_58590 464 1393 CDS product IS3-like element ISSme1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145162746.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58590 1472 1906 gene locus_tag LOCUS_58600 1472 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 3663 1933 gene locus_tag LOCUS_58610 3663 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58610 3885 4253 gene locus_tag LOCUS_58620 3885 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 >Feature sequence537 1232 309 gene locus_tag LOCUS_58630 1232 309 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 protein_id gnl|my_center|LOCUS_58630 2694 1681 gene locus_tag LOCUS_58640 2694 1681 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526600.1 protein_id gnl|my_center|LOCUS_58640 3596 2691 gene locus_tag LOCUS_58650 gene kdsA 3596 2691 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087568.1 protein_id gnl|my_center|LOCUS_58650 3902 3597 gene locus_tag LOCUS_58660 3902 3597 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171332.1 protein_id gnl|my_center|LOCUS_58660 3995 3919 gene locus_tag LOCUS_t00630 3995 3919 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence538 <1 1035 gene locus_tag LOCUS_58670 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948400.1:class I SAM-dependent DNA methyltransferase 1032 2222 gene locus_tag LOCUS_58680 1032 2222 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123362.1 protein_id gnl|my_center|LOCUS_58680 2219 3133 gene locus_tag LOCUS_58690 2219 3133 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_58690 3732 3535 gene locus_tag LOCUS_58700 3732 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 4060 4200 gene locus_tag LOCUS_58710 4060 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58710 >Feature sequence539 2468 1158 gene locus_tag LOCUS_58720 2468 1158 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_58720 4056 2653 gene locus_tag LOCUS_58730 4056 2653 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 protein_id gnl|my_center|LOCUS_58730 >Feature sequence540 387 49 gene locus_tag LOCUS_58740 387 49 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008142813.1 protein_id gnl|my_center|LOCUS_58740 1628 408 gene locus_tag LOCUS_58750 gene amt 1628 408 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109815.1 protein_id gnl|my_center|LOCUS_58750 2096 3316 gene locus_tag LOCUS_58760 2096 3316 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088242.1 protein_id gnl|my_center|LOCUS_58760 3667 4005 gene locus_tag LOCUS_58770 3667 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 >Feature sequence541 860 84 gene locus_tag LOCUS_58780 860 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 4155 2044 gene locus_tag LOCUS_58790 4155 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 >Feature sequence542 116 820 gene locus_tag LOCUS_58800 116 820 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074390.1 protein_id gnl|my_center|LOCUS_58800 813 1109 gene locus_tag LOCUS_58810 813 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 1458 1613 gene locus_tag LOCUS_58820 1458 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 2973 4118 gene locus_tag LOCUS_58830 2973 4118 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_58830 >Feature sequence543 553 480 gene locus_tag LOCUS_t00640 553 480 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1135 1605 gene locus_tag LOCUS_58840 1135 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 1673 1843 gene locus_tag LOCUS_58850 1673 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 2583 2161 gene locus_tag LOCUS_58860 2583 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58860 >Feature sequence544 349 1341 gene locus_tag LOCUS_58870 349 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58870 1374 1634 gene locus_tag LOCUS_58880 1374 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 3615 1702 gene locus_tag LOCUS_58890 3615 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 >Feature sequence545 3572 1281 gene locus_tag LOCUS_58900 3572 1281 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113491.1 protein_id gnl|my_center|LOCUS_58900 >Feature sequence546 319 780 gene locus_tag LOCUS_58910 319 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 1369 1536 gene locus_tag LOCUS_58920 1369 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 3093 1729 gene locus_tag LOCUS_58930 3093 1729 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084725968.1 protein_id gnl|my_center|LOCUS_58930 >Feature sequence547 1497 751 gene locus_tag LOCUS_58940 1497 751 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 protein_id gnl|my_center|LOCUS_58940 2366 1497 gene locus_tag LOCUS_58950 2366 1497 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 protein_id gnl|my_center|LOCUS_58950 3394 2423 gene locus_tag LOCUS_58960 3394 2423 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 protein_id gnl|my_center|LOCUS_58960 3791 3408 gene locus_tag LOCUS_58970 3791 3408 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_58970 >Feature sequence548 2 157 gene locus_tag LOCUS_58980 2 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 264 1217 gene locus_tag LOCUS_58990 264 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 2650 2450 gene locus_tag LOCUS_59000 2650 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 >Feature sequence549 1267 389 gene locus_tag LOCUS_59010 1267 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 1568 1260 gene locus_tag LOCUS_59020 1568 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 2220 1507 gene locus_tag LOCUS_59030 2220 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 >Feature sequence550 1223 240 gene locus_tag LOCUS_59040 1223 240 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192895.1 protein_id gnl|my_center|LOCUS_59040 1665 1243 gene locus_tag LOCUS_59050 1665 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 2130 1963 gene locus_tag LOCUS_59060 2130 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 <3803 2942 gene locus_tag LOCUS_59070 <3803 2942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368514.1:Fic family protein >Feature sequence551 900 649 gene locus_tag LOCUS_59080 900 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 1215 994 gene locus_tag LOCUS_59090 1215 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 1545 1345 gene locus_tag LOCUS_59100 1545 1345 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171494.1 protein_id gnl|my_center|LOCUS_59100 2024 2329 gene locus_tag LOCUS_59110 2024 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 3606 3460 gene locus_tag LOCUS_59120 3606 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 >Feature sequence552 230 430 gene locus_tag LOCUS_59130 230 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 1100 876 gene locus_tag LOCUS_59140 1100 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 2295 3194 gene locus_tag LOCUS_59150 2295 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546359.1 protein_id gnl|my_center|LOCUS_59150 >Feature sequence553 918 37 gene locus_tag LOCUS_59160 918 37 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971057.1 protein_id gnl|my_center|LOCUS_59160 2217 1879 gene locus_tag LOCUS_59170 2217 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 >Feature sequence554 <1 2465 gene locus_tag LOCUS_59180 <1 2465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968624.1:DUF1156 domain-containing protein >Feature sequence555 330 1409 gene locus_tag LOCUS_59190 330 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59190 1406 2383 gene locus_tag LOCUS_59200 1406 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59200 2418 3467 gene locus_tag LOCUS_59210 2418 3467 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690326.1 protein_id gnl|my_center|LOCUS_59210 >Feature sequence556 1904 1059 gene locus_tag LOCUS_59220 1904 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 2592 1999 gene locus_tag LOCUS_59230 2592 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 3537 2905 gene locus_tag LOCUS_59240 3537 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59240 >Feature sequence557 357 166 gene locus_tag LOCUS_59250 357 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 840 574 gene locus_tag LOCUS_59260 840 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 1696 1148 gene locus_tag LOCUS_59270 1696 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 3272 1845 gene locus_tag LOCUS_59280 3272 1845 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196385.1 protein_id gnl|my_center|LOCUS_59280 >Feature sequence558 1184 822 gene locus_tag LOCUS_59290 1184 822 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 protein_id gnl|my_center|LOCUS_59290 1976 1530 gene locus_tag LOCUS_59300 1976 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59300 <3361 2501 gene locus_tag LOCUS_59310 <3361 2501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532208.1:aldo/keto reductase family oxidoreductase >Feature sequence559 <1 1818 gene locus_tag LOCUS_59320 <1 1818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390705.1:glycine--tRNA ligase subunit beta >Feature sequence560 216 422 gene locus_tag LOCUS_59330 216 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59330 545 967 gene locus_tag LOCUS_59340 545 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 2014 1181 gene locus_tag LOCUS_59350 2014 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 2272 2024 gene locus_tag LOCUS_59360 2272 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 >Feature sequence561 866 213 gene locus_tag LOCUS_59370 866 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 2730 1036 gene locus_tag LOCUS_59380 2730 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 2941 2717 gene locus_tag LOCUS_59390 2941 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59390 >Feature sequence562 <1 1799 gene locus_tag LOCUS_59400 <1 1799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265961.1:TonB-dependent receptor 2713 2465 gene locus_tag LOCUS_59410 2713 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 >Feature sequence563 934 176 gene locus_tag LOCUS_59420 934 176 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919103.1 protein_id gnl|my_center|LOCUS_59420 1956 940 gene locus_tag LOCUS_59430 gene moaA 1956 940 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642813.1 protein_id gnl|my_center|LOCUS_59430 <3107 1981 gene locus_tag LOCUS_59440 <3107 1981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640181.1:DUF2336 domain-containing protein >Feature sequence564 5 250 gene locus_tag LOCUS_59450 5 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 1416 466 gene locus_tag LOCUS_59460 1416 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 2347 2012 gene locus_tag LOCUS_59470 2347 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59470 >Feature sequence565 481 1065 gene locus_tag LOCUS_59480 481 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 1094 2281 gene locus_tag LOCUS_59490 1094 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 >Feature sequence566 38 781 gene locus_tag LOCUS_59500 38 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 >Feature sequence567 743 465 gene locus_tag LOCUS_59510 743 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59510 1078 1791 gene locus_tag LOCUS_59520 1078 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 >Feature sequence568 748 326 gene locus_tag LOCUS_59530 748 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 1907 933 gene locus_tag LOCUS_59540 1907 933 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_59540 2677 1904 gene locus_tag LOCUS_59550 2677 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 >Feature sequence569 489 220 gene locus_tag LOCUS_59560 489 220 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108222469.1 protein_id gnl|my_center|LOCUS_59560 1095 1358 gene locus_tag LOCUS_59570 1095 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59570 1860 1477 gene locus_tag LOCUS_59580 1860 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_59580 <2673 1900 gene locus_tag LOCUS_59590 <2673 1900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164689163.1:IS3 family transposase note possible pseudo, internal stop codon >Feature sequence570 >Feature sequence571 1645 494 gene locus_tag LOCUS_59600 1645 494 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529858.1 protein_id gnl|my_center|LOCUS_59600 <2608 1758 gene locus_tag LOCUS_59610 <2608 1758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529855.1:GMC family oxidoreductase N-terminal domain-containing protein