>Feature sequence001 <1 933 gene locus_tag LOCUS_00010 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229303.1:trypsin-like peptidase domain-containing protein 2230 1052 gene locus_tag LOCUS_00020 2230 1052 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_00020 2336 3745 gene locus_tag LOCUS_00030 gene zwf 2336 3745 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_00030 4384 6717 gene locus_tag LOCUS_00040 4384 6717 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026895.1 protein_id gnl|my_center|LOCUS_00040 6830 7312 gene locus_tag LOCUS_00050 6830 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7335 9713 gene locus_tag LOCUS_00060 7335 9713 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028834.1 protein_id gnl|my_center|LOCUS_00060 9958 9755 gene locus_tag LOCUS_00070 9958 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10177 11229 gene locus_tag LOCUS_00080 10177 11229 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146919646.1 protein_id gnl|my_center|LOCUS_00080 11253 11894 gene locus_tag LOCUS_00090 11253 11894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 >Feature sequence002 1104 508 gene locus_tag LOCUS_00100 1104 508 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058038.1 protein_id gnl|my_center|LOCUS_00100 1161 2789 gene locus_tag LOCUS_00110 1161 2789 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_00110 4313 2832 gene locus_tag LOCUS_00120 4313 2832 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_00120 4195 4497 gene locus_tag LOCUS_00130 4195 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 4452 4982 gene locus_tag LOCUS_00140 4452 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 5374 5021 gene locus_tag LOCUS_00150 5374 5021 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898051.1 protein_id gnl|my_center|LOCUS_00150 5903 5445 gene locus_tag LOCUS_00160 5903 5445 CDS product DUF6314 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855167.1 protein_id gnl|my_center|LOCUS_00160 6195 5947 gene locus_tag LOCUS_00170 6195 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 6136 6642 gene locus_tag LOCUS_00180 6136 6642 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 protein_id gnl|my_center|LOCUS_00180 6752 8197 gene locus_tag LOCUS_00190 6752 8197 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_00190 8202 8366 gene locus_tag LOCUS_00200 8202 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 8440 9300 gene locus_tag LOCUS_00210 8440 9300 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085225034.1 protein_id gnl|my_center|LOCUS_00210 >Feature sequence003 538 197 gene locus_tag LOCUS_00220 gene bldG 538 197 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_00220 1243 623 gene locus_tag LOCUS_00230 1243 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 1873 1349 gene locus_tag LOCUS_00240 1873 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 2529 1870 gene locus_tag LOCUS_00250 2529 1870 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730363.1 protein_id gnl|my_center|LOCUS_00250 4287 2587 gene locus_tag LOCUS_00260 4287 2587 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545979.1 protein_id gnl|my_center|LOCUS_00260 6001 4358 gene locus_tag LOCUS_00270 6001 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 8345 6012 gene locus_tag LOCUS_00280 8345 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 9529 8393 gene locus_tag LOCUS_00290 9529 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 <10471 9526 gene locus_tag LOCUS_00300 <10471 9526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742066.1:MoxR family ATPase >Feature sequence004 492 4121 gene locus_tag LOCUS_00310 492 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 4103 4795 gene locus_tag LOCUS_00320 4103 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 4830 6644 gene locus_tag LOCUS_00330 4830 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 7737 6676 gene locus_tag LOCUS_00340 7737 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 8804 7734 gene locus_tag LOCUS_00350 8804 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 9516 9025 gene locus_tag LOCUS_00360 9516 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 >Feature sequence005 1754 1035 gene locus_tag LOCUS_00370 1754 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 3941 1764 gene locus_tag LOCUS_00380 3941 1764 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530142.1 protein_id gnl|my_center|LOCUS_00380 4039 5235 gene locus_tag LOCUS_00390 4039 5235 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_00390 6843 5263 gene locus_tag LOCUS_00400 6843 5263 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 protein_id gnl|my_center|LOCUS_00400 7629 6886 gene locus_tag LOCUS_00410 7629 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 8465 7752 gene locus_tag LOCUS_00420 8465 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 10012 8489 gene locus_tag LOCUS_00430 10012 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 >Feature sequence006 1166 1669 gene locus_tag LOCUS_00440 1166 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 2045 1698 gene locus_tag LOCUS_00450 2045 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 2869 2192 gene locus_tag LOCUS_00460 2869 2192 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549931.1 protein_id gnl|my_center|LOCUS_00460 3072 4259 gene locus_tag LOCUS_00470 3072 4259 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416075.1 protein_id gnl|my_center|LOCUS_00470 4256 5251 gene locus_tag LOCUS_00480 4256 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 5266 6183 gene locus_tag LOCUS_00490 5266 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 6416 6547 gene locus_tag LOCUS_00500 6416 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 7234 6599 gene locus_tag LOCUS_00510 7234 6599 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819086.1 protein_id gnl|my_center|LOCUS_00510 7974 7279 gene locus_tag LOCUS_00520 7974 7279 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705261.1 protein_id gnl|my_center|LOCUS_00520 9155 7974 gene locus_tag LOCUS_00530 9155 7974 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223752.1 protein_id gnl|my_center|LOCUS_00530 <10257 9309 gene locus_tag LOCUS_00540 <10257 9309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167441295.1:4-hydroxybenzoate 3-monooxygenase >Feature sequence007 291 61 gene locus_tag LOCUS_00550 gene secG 291 61 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_00550 1201 422 gene locus_tag LOCUS_00560 gene tpiA 1201 422 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057795.1 protein_id gnl|my_center|LOCUS_00560 2355 1201 gene locus_tag LOCUS_00570 2355 1201 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_00570 3392 2358 gene locus_tag LOCUS_00580 gene gap 3392 2358 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_00580 4356 3457 gene locus_tag LOCUS_00590 4356 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 5201 4353 gene locus_tag LOCUS_00600 gene rapZ 5201 4353 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_00600 5928 5194 gene locus_tag LOCUS_00610 5928 5194 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919712.1 protein_id gnl|my_center|LOCUS_00610 6849 5974 gene locus_tag LOCUS_00620 6849 5974 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_00620 8823 6859 gene locus_tag LOCUS_00630 gene uvrC 8823 6859 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907800.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence008 1509 1315 gene locus_tag LOCUS_00640 1509 1315 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285998.1 protein_id gnl|my_center|LOCUS_00640 1721 1924 gene locus_tag LOCUS_00650 1721 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 1979 2335 gene locus_tag LOCUS_00660 1979 2335 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978264.1 protein_id gnl|my_center|LOCUS_00660 2344 2514 gene locus_tag LOCUS_00670 2344 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 4130 2589 gene locus_tag LOCUS_00680 4130 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 4891 4415 gene locus_tag LOCUS_00690 4891 4415 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978655.1 protein_id gnl|my_center|LOCUS_00690 5773 5051 gene locus_tag LOCUS_00700 5773 5051 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227040.1 protein_id gnl|my_center|LOCUS_00700 6105 8303 gene locus_tag LOCUS_00710 6105 8303 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_00710 8463 9728 gene locus_tag LOCUS_00720 8463 9728 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200855.1 protein_id gnl|my_center|LOCUS_00720 >Feature sequence009 <1 1484 gene locus_tag LOCUS_00730 <1 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027192.1:SpoIIE family protein phosphatase 1784 3085 gene locus_tag LOCUS_00740 1784 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 3141 3614 gene locus_tag LOCUS_00750 3141 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 4989 3592 gene locus_tag LOCUS_00760 4989 3592 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211039795.1 protein_id gnl|my_center|LOCUS_00760 5135 6565 gene locus_tag LOCUS_00770 5135 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029003.1 protein_id gnl|my_center|LOCUS_00770 6562 7137 gene locus_tag LOCUS_00780 6562 7137 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028998.1 protein_id gnl|my_center|LOCUS_00780 7768 7229 gene locus_tag LOCUS_00790 7768 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 8132 8692 gene locus_tag LOCUS_00800 8132 8692 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236074025.1 protein_id gnl|my_center|LOCUS_00800 8689 8955 gene locus_tag LOCUS_00810 8689 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 >Feature sequence010 1901 633 gene locus_tag LOCUS_00820 gene alr 1901 633 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_00820 3297 1894 gene locus_tag LOCUS_00830 3297 1894 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403284.1 protein_id gnl|my_center|LOCUS_00830 3761 3294 gene locus_tag LOCUS_00840 3761 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 7246 3758 gene locus_tag LOCUS_00850 7246 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 7312 8022 gene locus_tag LOCUS_00860 7312 8022 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059191192.1 protein_id gnl|my_center|LOCUS_00860 >Feature sequence011 1459 782 gene locus_tag LOCUS_00870 1459 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 5079 1441 gene locus_tag LOCUS_00880 5079 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 6815 5076 gene locus_tag LOCUS_00890 6815 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258135.1 protein_id gnl|my_center|LOCUS_00890 7104 6922 gene locus_tag LOCUS_00900 7104 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 8389 7562 gene locus_tag LOCUS_00910 8389 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 9149 9074 gene locus_tag LOCUS_t00010 9149 9074 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 <1 829 gene locus_tag LOCUS_00920 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920840.1:ATP-dependent sacrificial sulfur transferase LarE 826 1065 gene locus_tag LOCUS_00930 826 1065 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545388.1 protein_id gnl|my_center|LOCUS_00930 1031 1546 gene locus_tag LOCUS_00940 1031 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 3065 1497 gene locus_tag LOCUS_00950 3065 1497 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225021.1 protein_id gnl|my_center|LOCUS_00950 3791 3075 gene locus_tag LOCUS_00960 3791 3075 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730856.1 protein_id gnl|my_center|LOCUS_00960 4130 3879 gene locus_tag LOCUS_00970 4130 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 4246 5568 gene locus_tag LOCUS_00980 4246 5568 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030612.1 protein_id gnl|my_center|LOCUS_00980 5591 6274 gene locus_tag LOCUS_00990 5591 6274 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206301.1 protein_id gnl|my_center|LOCUS_00990 6282 6887 gene locus_tag LOCUS_01000 6282 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 7372 6893 gene locus_tag LOCUS_01010 7372 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 8247 7372 gene locus_tag LOCUS_01020 gene parJ 8247 7372 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_01020 >Feature sequence013 1583 396 gene locus_tag LOCUS_01030 gene rodA 1583 396 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_01030 3525 1597 gene locus_tag LOCUS_01040 gene mrdA 3525 1597 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_01040 4091 3522 gene locus_tag LOCUS_01050 4091 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 4927 4088 gene locus_tag LOCUS_01060 4927 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 5988 4948 gene locus_tag LOCUS_01070 5988 4948 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_01070 6662 6252 gene locus_tag LOCUS_01080 gene ndk 6662 6252 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723912.1 protein_id gnl|my_center|LOCUS_01080 8143 6821 gene locus_tag LOCUS_01090 8143 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 <8739 8170 gene locus_tag LOCUS_01100 <8739 8170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003412634.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence014 <1 563 gene locus_tag LOCUS_01110 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228608.1:ABC transporter permease 674 1468 gene locus_tag LOCUS_01120 674 1468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538206.1 protein_id gnl|my_center|LOCUS_01120 1465 2259 gene locus_tag LOCUS_01130 gene fabG 1465 2259 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_01130 2274 3134 gene locus_tag LOCUS_01140 2274 3134 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729776.1 protein_id gnl|my_center|LOCUS_01140 3131 4165 gene locus_tag LOCUS_01150 3131 4165 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_01150 4162 5205 gene locus_tag LOCUS_01160 4162 5205 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_01160 5202 7553 gene locus_tag LOCUS_01170 5202 7553 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_01170 7550 8251 gene locus_tag LOCUS_01180 gene pepE 7550 8251 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027213.1 protein_id gnl|my_center|LOCUS_01180 >Feature sequence015 <1 997 gene locus_tag LOCUS_01190 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110588.1:fatty acid--CoA ligase 1998 994 gene locus_tag LOCUS_01200 1998 994 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531489.1 protein_id gnl|my_center|LOCUS_01200 3359 2088 gene locus_tag LOCUS_01210 3359 2088 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080787.1 protein_id gnl|my_center|LOCUS_01210 3494 4636 gene locus_tag LOCUS_01220 3494 4636 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_01220 4722 5486 gene locus_tag LOCUS_01230 4722 5486 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_01230 5554 6192 gene locus_tag LOCUS_01240 5554 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 6223 7419 gene locus_tag LOCUS_01250 gene marP 6223 7419 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731101.1 protein_id gnl|my_center|LOCUS_01250 >Feature sequence016 <1 1521 gene locus_tag LOCUS_01260 <1 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259019.1:AAA family ATPase 3634 1499 gene locus_tag LOCUS_01270 3634 1499 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_01270 3718 3924 gene locus_tag LOCUS_01280 3718 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 4867 3935 gene locus_tag LOCUS_01290 4867 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 4954 6003 gene locus_tag LOCUS_01300 4954 6003 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224840.1 protein_id gnl|my_center|LOCUS_01300 6334 6014 gene locus_tag LOCUS_01310 6334 6014 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 protein_id gnl|my_center|LOCUS_01310 6361 6594 gene locus_tag LOCUS_01320 6361 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 8028 6583 gene locus_tag LOCUS_01330 8028 6583 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730410.1 protein_id gnl|my_center|LOCUS_01330 >Feature sequence017 <1 1861 gene locus_tag LOCUS_01340 <1 1861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_101589575.1:CoA transferase 1858 2481 gene locus_tag LOCUS_01350 1858 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 2478 2930 gene locus_tag LOCUS_01360 2478 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 3705 2950 gene locus_tag LOCUS_01370 3705 2950 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965770.1 protein_id gnl|my_center|LOCUS_01370 3860 6265 gene locus_tag LOCUS_01380 3860 6265 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_01380 6266 7279 gene locus_tag LOCUS_01390 6266 7279 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_01390 >Feature sequence018 1296 2012 gene locus_tag LOCUS_01400 gene aat 1296 2012 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_01400 2994 2041 gene locus_tag LOCUS_01410 2994 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 2993 3727 gene locus_tag LOCUS_01420 2993 3727 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228584.1 protein_id gnl|my_center|LOCUS_01420 3759 5183 gene locus_tag LOCUS_01430 3759 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 5199 6476 gene locus_tag LOCUS_01440 5199 6476 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 protein_id gnl|my_center|LOCUS_01440 6473 7996 gene locus_tag LOCUS_01450 6473 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 >Feature sequence019 344 850 gene locus_tag LOCUS_01460 344 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 991 4056 gene locus_tag LOCUS_01470 991 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 4318 5844 gene locus_tag LOCUS_01480 4318 5844 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028880.1 protein_id gnl|my_center|LOCUS_01480 6054 7094 gene locus_tag LOCUS_01490 gene rsgA 6054 7094 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_01490 >Feature sequence020 245 1399 gene locus_tag LOCUS_01500 245 1399 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_01500 1414 3003 gene locus_tag LOCUS_01510 1414 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 3006 4016 gene locus_tag LOCUS_01520 3006 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 5461 4049 gene locus_tag LOCUS_01530 5461 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 5684 6577 gene locus_tag LOCUS_01540 5684 6577 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731585.1 protein_id gnl|my_center|LOCUS_01540 <8137 6641 gene locus_tag LOCUS_01550 <8137 6641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972923.1:aconitate hydratase AcnA >Feature sequence021 1706 2857 gene locus_tag LOCUS_01560 1706 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 2874 3455 gene locus_tag LOCUS_01570 2874 3455 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031285.1 protein_id gnl|my_center|LOCUS_01570 4322 3474 gene locus_tag LOCUS_01580 gene map 4322 3474 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_01580 4816 4415 gene locus_tag LOCUS_01590 gene mce 4816 4415 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_01590 5687 4821 gene locus_tag LOCUS_01600 5687 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 6094 5855 gene locus_tag LOCUS_01610 6094 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 5994 7178 gene locus_tag LOCUS_01620 5994 7178 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_01620 >Feature sequence022 32 247 gene locus_tag LOCUS_01630 32 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 244 1233 gene locus_tag LOCUS_01640 244 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 1230 2600 gene locus_tag LOCUS_01650 1230 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 5249 3963 gene locus_tag LOCUS_01660 5249 3963 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406347.1 protein_id gnl|my_center|LOCUS_01660 7712 5361 gene locus_tag LOCUS_01670 7712 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 >Feature sequence023 1299 511 gene locus_tag LOCUS_01680 1299 511 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030081.1 protein_id gnl|my_center|LOCUS_01680 1335 1730 gene locus_tag LOCUS_01690 1335 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 protein_id gnl|my_center|LOCUS_01690 2990 1863 gene locus_tag LOCUS_01700 2990 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 4123 3158 gene locus_tag LOCUS_01710 4123 3158 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969365.1 protein_id gnl|my_center|LOCUS_01710 4194 6305 gene locus_tag LOCUS_01720 4194 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 6337 6783 gene locus_tag LOCUS_01730 6337 6783 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403693.1 protein_id gnl|my_center|LOCUS_01730 >Feature sequence024 1601 207 gene locus_tag LOCUS_01740 1601 207 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973791.1 protein_id gnl|my_center|LOCUS_01740 1754 3196 gene locus_tag LOCUS_01750 1754 3196 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_01750 3233 4705 gene locus_tag LOCUS_01760 3233 4705 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_01760 4702 5658 gene locus_tag LOCUS_01770 4702 5658 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338663.1 protein_id gnl|my_center|LOCUS_01770 5655 6833 gene locus_tag LOCUS_01780 5655 6833 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_01780 6835 7035 gene locus_tag LOCUS_01790 6835 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 >Feature sequence025 1131 250 gene locus_tag LOCUS_01800 1131 250 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_01800 1237 1812 gene locus_tag LOCUS_01810 1237 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 1817 2482 gene locus_tag LOCUS_01820 1817 2482 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_01820 3245 2499 gene locus_tag LOCUS_01830 3245 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01830 3425 5032 gene locus_tag LOCUS_01840 gene lnt 3425 5032 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226566.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01840 5067 6338 gene locus_tag LOCUS_01850 5067 6338 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_01850 6338 7057 gene locus_tag LOCUS_01860 6338 7057 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence026 <1 960 gene locus_tag LOCUS_01870 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029750.1:2-oxoacid:ferredoxin oxidoreductase subunit beta 2450 1236 gene locus_tag LOCUS_01880 2450 1236 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_01880 2508 3269 gene locus_tag LOCUS_01890 2508 3269 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258662.1 protein_id gnl|my_center|LOCUS_01890 3291 3830 gene locus_tag LOCUS_01900 3291 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 3853 4707 gene locus_tag LOCUS_01910 gene tlyA 3853 4707 CDS product 16S/23S rRNA (cytidine-2'-O)-methyltransferase TlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408382.1 protein_id gnl|my_center|LOCUS_01910 4711 5661 gene locus_tag LOCUS_01920 4711 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 5667 7352 gene locus_tag LOCUS_01930 gene recN 5667 7352 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence027 1153 257 gene locus_tag LOCUS_01940 1153 257 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749566.1 protein_id gnl|my_center|LOCUS_01940 1665 1135 gene locus_tag LOCUS_01950 1665 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 2429 1821 gene locus_tag LOCUS_01960 2429 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 2326 2553 gene locus_tag LOCUS_01970 2326 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 2821 5496 gene locus_tag LOCUS_01980 gene aceE 2821 5496 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110416.1 protein_id gnl|my_center|LOCUS_01980 5915 7006 gene locus_tag LOCUS_01990 5915 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 7043 7531 gene locus_tag LOCUS_02000 7043 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 >Feature sequence028 293 727 gene locus_tag LOCUS_02010 293 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112674.1 protein_id gnl|my_center|LOCUS_02010 724 1395 gene locus_tag LOCUS_02020 724 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 2702 1905 gene locus_tag LOCUS_02030 2702 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 3489 2839 gene locus_tag LOCUS_02040 3489 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 3979 3482 gene locus_tag LOCUS_02050 3979 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 4855 4406 gene locus_tag LOCUS_02060 4855 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 5158 6276 gene locus_tag LOCUS_02070 5158 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 6276 6611 gene locus_tag LOCUS_02080 6276 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 7591 7019 gene locus_tag LOCUS_02090 7591 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 >Feature sequence029 1274 336 gene locus_tag LOCUS_02100 1274 336 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_02100 1316 1747 gene locus_tag LOCUS_02110 1316 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 2665 1712 gene locus_tag LOCUS_02120 2665 1712 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080707694.1 protein_id gnl|my_center|LOCUS_02120 2683 4530 gene locus_tag LOCUS_02130 gene malQ 2683 4530 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408795.1 protein_id gnl|my_center|LOCUS_02130 4540 5622 gene locus_tag LOCUS_02140 4540 5622 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742235.1 protein_id gnl|my_center|LOCUS_02140 5619 6164 gene locus_tag LOCUS_02150 5619 6164 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225897.1 protein_id gnl|my_center|LOCUS_02150 7161 6181 gene locus_tag LOCUS_02160 7161 6181 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 protein_id gnl|my_center|LOCUS_02160 <7821 7227 gene locus_tag LOCUS_02170 <7821 7227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932902.1:geranylgeranyl reductase family protein >Feature sequence030 1269 208 gene locus_tag LOCUS_02180 1269 208 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931024.1 protein_id gnl|my_center|LOCUS_02180 1446 2453 gene locus_tag LOCUS_02190 1446 2453 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_02190 2626 2811 gene locus_tag LOCUS_02200 2626 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 2808 3461 gene locus_tag LOCUS_02210 2808 3461 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124522.1 protein_id gnl|my_center|LOCUS_02210 3458 4459 gene locus_tag LOCUS_02220 3458 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 4627 4989 gene locus_tag LOCUS_02230 4627 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02230 5093 4905 gene locus_tag LOCUS_02240 5093 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 6091 5267 gene locus_tag LOCUS_02250 6091 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 6296 6499 gene locus_tag LOCUS_02260 6296 6499 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_02260 >Feature sequence031 251 790 gene locus_tag LOCUS_02270 251 790 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728126.1 protein_id gnl|my_center|LOCUS_02270 2356 845 gene locus_tag LOCUS_02280 2356 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 2502 4010 gene locus_tag LOCUS_02290 2502 4010 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_02290 5018 4077 gene locus_tag LOCUS_02300 5018 4077 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977140.1 protein_id gnl|my_center|LOCUS_02300 5256 6206 gene locus_tag LOCUS_02310 5256 6206 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090797.1 protein_id gnl|my_center|LOCUS_02310 6936 6253 gene locus_tag LOCUS_02320 gene queC 6936 6253 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_02320 7364 6954 gene locus_tag LOCUS_02330 7364 6954 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_02330 >Feature sequence032 <1 1231 gene locus_tag LOCUS_02340 <1 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226334.1:NAD(P)/FAD-dependent oxidoreductase 1678 1253 gene locus_tag LOCUS_02350 1678 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 1931 1788 gene locus_tag LOCUS_02360 1931 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 2630 1941 gene locus_tag LOCUS_02370 2630 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896963.1 protein_id gnl|my_center|LOCUS_02370 2779 3453 gene locus_tag LOCUS_02380 2779 3453 CDS product evbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135362122.1 protein_id gnl|my_center|LOCUS_02380 4304 3459 gene locus_tag LOCUS_02390 4304 3459 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728195.1 protein_id gnl|my_center|LOCUS_02390 6635 4518 gene locus_tag LOCUS_02400 6635 4518 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259371.1 protein_id gnl|my_center|LOCUS_02400 7194 6724 gene locus_tag LOCUS_02410 7194 6724 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803676.1 protein_id gnl|my_center|LOCUS_02410 >Feature sequence033 2409 826 gene locus_tag LOCUS_02420 2409 826 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_02420 3729 2545 gene locus_tag LOCUS_02430 gene moeB 3729 2545 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_02430 3732 4349 gene locus_tag LOCUS_02440 3732 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 5128 4364 gene locus_tag LOCUS_02450 5128 4364 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_02450 5216 5833 gene locus_tag LOCUS_02460 5216 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 5885 6754 gene locus_tag LOCUS_02470 5885 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7421 6744 gene locus_tag LOCUS_02480 gene ndgR 7421 6744 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence034 195 494 gene locus_tag LOCUS_02490 195 494 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224533.1 protein_id gnl|my_center|LOCUS_02490 1721 540 gene locus_tag LOCUS_02500 1721 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 2735 1758 gene locus_tag LOCUS_02510 gene egtD 2735 1758 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731156.1 protein_id gnl|my_center|LOCUS_02510 4022 2766 gene locus_tag LOCUS_02520 gene egtB 4022 2766 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_02520 4535 4131 gene locus_tag LOCUS_02530 4535 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 7316 4614 gene locus_tag LOCUS_02540 7316 4614 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_02540 >Feature sequence035 1271 1867 gene locus_tag LOCUS_02550 gene nadD 1271 1867 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_02550 1864 2115 gene locus_tag LOCUS_02560 1864 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 2138 2539 gene locus_tag LOCUS_02570 gene rsfS 2138 2539 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172029.1 protein_id gnl|my_center|LOCUS_02570 3224 2547 gene locus_tag LOCUS_02580 3224 2547 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140026.1 protein_id gnl|my_center|LOCUS_02580 4729 3221 gene locus_tag LOCUS_02590 4729 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 5127 4726 gene locus_tag LOCUS_02600 5127 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 5279 5581 gene locus_tag LOCUS_02610 5279 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 5776 5534 gene locus_tag LOCUS_02620 5776 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 <7544 5903 gene locus_tag LOCUS_02630 <7544 5903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116848736.1:DUF4157 domain-containing protein >Feature sequence036 781 311 gene locus_tag LOCUS_02640 781 311 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226612.1 protein_id gnl|my_center|LOCUS_02640 1650 778 gene locus_tag LOCUS_02650 1650 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 2102 1647 gene locus_tag LOCUS_02660 2102 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 2935 2102 gene locus_tag LOCUS_02670 2935 2102 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730139.1 protein_id gnl|my_center|LOCUS_02670 3044 3685 gene locus_tag LOCUS_02680 3044 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 4648 3845 gene locus_tag LOCUS_02690 4648 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 5027 6055 gene locus_tag LOCUS_02700 5027 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 6497 6153 gene locus_tag LOCUS_02710 6497 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 <7496 6575 gene locus_tag LOCUS_02720 <7496 6575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005089385.1:acyl-CoA dehydrogenase >Feature sequence037 498 1190 gene locus_tag LOCUS_02730 498 1190 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949117.1 protein_id gnl|my_center|LOCUS_02730 1187 1432 gene locus_tag LOCUS_02740 1187 1432 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225378.1 protein_id gnl|my_center|LOCUS_02740 1768 1454 gene locus_tag LOCUS_02750 1768 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2909 1761 gene locus_tag LOCUS_02760 2909 1761 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_02760 4599 3148 gene locus_tag LOCUS_02770 4599 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 4598 4744 gene locus_tag LOCUS_02780 4598 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 5760 4879 gene locus_tag LOCUS_02790 gene purU 5760 4879 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881184.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence038 1294 152 gene locus_tag LOCUS_02800 1294 152 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_02800 2403 1291 gene locus_tag LOCUS_02810 gene queG 2403 1291 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829814.1 protein_id gnl|my_center|LOCUS_02810 3347 2400 gene locus_tag LOCUS_02820 gene sepH 3347 2400 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092707.1 protein_id gnl|my_center|LOCUS_02820 3632 3432 gene locus_tag LOCUS_02830 3632 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 5116 3704 gene locus_tag LOCUS_02840 5116 3704 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_02840 5173 5451 gene locus_tag LOCUS_02850 5173 5451 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_02850 6630 5488 gene locus_tag LOCUS_02860 gene trpD 6630 5488 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_02860 6919 6656 gene locus_tag LOCUS_02870 6919 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 >Feature sequence039 409 137 gene locus_tag LOCUS_02880 409 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 437 1513 gene locus_tag LOCUS_02890 gene argC 437 1513 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459299.1 protein_id gnl|my_center|LOCUS_02890 1510 2379 gene locus_tag LOCUS_02900 gene argB 1510 2379 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_02900 2376 3356 gene locus_tag LOCUS_02910 2376 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02910 3334 3525 gene locus_tag LOCUS_02920 3334 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02920 3522 4409 gene locus_tag LOCUS_02930 gene argF 3522 4409 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257452.1 protein_id gnl|my_center|LOCUS_02930 4406 4873 gene locus_tag LOCUS_02940 4406 4873 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_02940 4907 6301 gene locus_tag LOCUS_02950 gene argH 4907 6301 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776175.1 protein_id gnl|my_center|LOCUS_02950 6391 6912 gene locus_tag LOCUS_02960 6391 6912 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037459.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02960 >Feature sequence040 <1 890 gene locus_tag LOCUS_02970 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460890.1:leucine--tRNA ligase 926 1420 gene locus_tag LOCUS_02980 926 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2330 1440 gene locus_tag LOCUS_02990 2330 1440 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728558.1 protein_id gnl|my_center|LOCUS_02990 3483 2476 gene locus_tag LOCUS_03000 3483 2476 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_03000 3625 4359 gene locus_tag LOCUS_03010 3625 4359 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_03010 4392 5231 gene locus_tag LOCUS_03020 gene folP 4392 5231 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776664.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03020 5228 6235 gene locus_tag LOCUS_03030 5228 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 6245 7015 gene locus_tag LOCUS_03040 6245 7015 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057760.1 protein_id gnl|my_center|LOCUS_03040 >Feature sequence041 1961 240 gene locus_tag LOCUS_03050 1961 240 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895080.1 protein_id gnl|my_center|LOCUS_03050 2319 1954 gene locus_tag LOCUS_03060 2319 1954 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977596.1 protein_id gnl|my_center|LOCUS_03060 2618 2316 gene locus_tag LOCUS_03070 2618 2316 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729214.1 protein_id gnl|my_center|LOCUS_03070 2905 3831 gene locus_tag LOCUS_03080 gene puuE 2905 3831 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_03080 4582 3878 gene locus_tag LOCUS_03090 4582 3878 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_03090 4881 6233 gene locus_tag LOCUS_03100 4881 6233 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113338.1 protein_id gnl|my_center|LOCUS_03100 5001 5010 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6958 6344 gene locus_tag LOCUS_03110 6958 6344 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968813.1 protein_id gnl|my_center|LOCUS_03110 >Feature sequence042 1425 598 gene locus_tag LOCUS_03120 1425 598 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_03120 1643 5347 gene locus_tag LOCUS_03130 1643 5347 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227688.1 protein_id gnl|my_center|LOCUS_03130 6657 5344 gene locus_tag LOCUS_03140 6657 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 <7342 6650 gene locus_tag LOCUS_03150 <7342 6650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000010351.1:cytochrome c biogenesis protein CcdA >Feature sequence043 1832 1257 gene locus_tag LOCUS_03160 1832 1257 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927167.1 protein_id gnl|my_center|LOCUS_03160 3070 1829 gene locus_tag LOCUS_03170 3070 1829 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026916.1 protein_id gnl|my_center|LOCUS_03170 6537 3067 gene locus_tag LOCUS_03180 6537 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 <7341 6539 gene locus_tag LOCUS_03190 <7341 6539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030729.1:LuxR family transcriptional regulator >Feature sequence044 96 338 gene locus_tag LOCUS_03200 96 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 407 1753 gene locus_tag LOCUS_03210 gene uxaC 407 1753 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777068.1 protein_id gnl|my_center|LOCUS_03210 1750 3123 gene locus_tag LOCUS_03220 1750 3123 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777067.1 protein_id gnl|my_center|LOCUS_03220 3558 3154 gene locus_tag LOCUS_03230 3558 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4346 5764 gene locus_tag LOCUS_03240 4346 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 6294 5899 gene locus_tag LOCUS_03250 6294 5899 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030058.1 protein_id gnl|my_center|LOCUS_03250 6463 6894 gene locus_tag LOCUS_03260 6463 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 7340 6912 gene locus_tag LOCUS_03270 7340 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence045 30 380 gene locus_tag LOCUS_03280 30 380 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_03280 1243 401 gene locus_tag LOCUS_03290 1243 401 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224592.1 protein_id gnl|my_center|LOCUS_03290 2139 1240 gene locus_tag LOCUS_03300 2139 1240 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392447.1 protein_id gnl|my_center|LOCUS_03300 2914 2183 gene locus_tag LOCUS_03310 2914 2183 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484635.1 protein_id gnl|my_center|LOCUS_03310 4692 2911 gene locus_tag LOCUS_03320 4692 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 5757 4837 gene locus_tag LOCUS_03330 gene ligD 5757 4837 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227028.1 protein_id gnl|my_center|LOCUS_03330 <7310 5775 gene locus_tag LOCUS_03340 <7310 5775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141168.1:glucosidase >Feature sequence046 <1 751 gene locus_tag LOCUS_03350 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726751.1:monoacylglycerol lipase 748 1542 gene locus_tag LOCUS_03360 748 1542 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123301.1 protein_id gnl|my_center|LOCUS_03360 1704 2963 gene locus_tag LOCUS_03370 1704 2963 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810182.1 protein_id gnl|my_center|LOCUS_03370 3649 3041 gene locus_tag LOCUS_03380 3649 3041 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226387.1 protein_id gnl|my_center|LOCUS_03380 4797 3646 gene locus_tag LOCUS_03390 4797 3646 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091312173.1 protein_id gnl|my_center|LOCUS_03390 5545 4814 gene locus_tag LOCUS_03400 5545 4814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228377.1 protein_id gnl|my_center|LOCUS_03400 6441 5542 gene locus_tag LOCUS_03410 6441 5542 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 protein_id gnl|my_center|LOCUS_03410 6649 6575 gene locus_tag LOCUS_t00020 6649 6575 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence047 1615 617 gene locus_tag LOCUS_03420 1615 617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_03420 2497 1703 gene locus_tag LOCUS_03430 gene fetB 2497 1703 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_03430 3240 2497 gene locus_tag LOCUS_03440 3240 2497 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405169.1 protein_id gnl|my_center|LOCUS_03440 3448 4236 gene locus_tag LOCUS_03450 3448 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 5184 4249 gene locus_tag LOCUS_03460 5184 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5268 5344 gene locus_tag LOCUS_t00030 5268 5344 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 <7263 5361 gene locus_tag LOCUS_03470 <7263 5361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036738.1:FUSC family protein >Feature sequence048 1515 43 gene locus_tag LOCUS_03480 gene tcuA 1515 43 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228705.1 protein_id gnl|my_center|LOCUS_03480 2338 1568 gene locus_tag LOCUS_03490 2338 1568 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865121.1 protein_id gnl|my_center|LOCUS_03490 3714 2335 gene locus_tag LOCUS_03500 3714 2335 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810930.1 protein_id gnl|my_center|LOCUS_03500 4592 3711 gene locus_tag LOCUS_03510 4592 3711 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814441.1 protein_id gnl|my_center|LOCUS_03510 5540 4692 gene locus_tag LOCUS_03520 5540 4692 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047906135.1 protein_id gnl|my_center|LOCUS_03520 6691 5612 gene locus_tag LOCUS_03530 6691 5612 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383769.1 protein_id gnl|my_center|LOCUS_03530 <7204 6688 gene locus_tag LOCUS_03540 <7204 6688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528380.1:sugar ABC transporter ATP-binding protein >Feature sequence049 1471 716 gene locus_tag LOCUS_03550 1471 716 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_03550 2346 1489 gene locus_tag LOCUS_03560 2346 1489 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_03560 2809 2336 gene locus_tag LOCUS_03570 2809 2336 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_03570 4041 2806 gene locus_tag LOCUS_03580 4041 2806 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_03580 4615 4124 gene locus_tag LOCUS_03590 4615 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 4754 6115 gene locus_tag LOCUS_03600 4754 6115 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765672.1 protein_id gnl|my_center|LOCUS_03600 6310 6954 gene locus_tag LOCUS_03610 6310 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 >Feature sequence050 1152 1889 gene locus_tag LOCUS_03620 1152 1889 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_03620 2086 2760 gene locus_tag LOCUS_03630 2086 2760 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776125.1 protein_id gnl|my_center|LOCUS_03630 2757 4190 gene locus_tag LOCUS_03640 2757 4190 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226774.1 protein_id gnl|my_center|LOCUS_03640 4237 4878 gene locus_tag LOCUS_03650 4237 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 4964 5278 gene locus_tag LOCUS_03660 4964 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 5290 6225 gene locus_tag LOCUS_03670 5290 6225 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227736.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence051 143 1597 gene locus_tag LOCUS_03680 143 1597 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 protein_id gnl|my_center|LOCUS_03680 1700 3814 gene locus_tag LOCUS_03690 gene recG 1700 3814 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_03690 4145 3975 gene locus_tag LOCUS_03700 4145 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 4170 4727 gene locus_tag LOCUS_03710 gene rsmD 4170 4727 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_03710 4724 5221 gene locus_tag LOCUS_03720 gene coaD 4724 5221 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_03720 5218 5793 gene locus_tag LOCUS_03730 5218 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 5847 6422 gene locus_tag LOCUS_03740 5847 6422 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284376.1 protein_id gnl|my_center|LOCUS_03740 6644 6823 gene locus_tag LOCUS_03750 gene rpmF 6644 6823 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813398.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence052 453 851 gene locus_tag LOCUS_03760 453 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 1677 910 gene locus_tag LOCUS_03770 1677 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 2300 1674 gene locus_tag LOCUS_03780 2300 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 2524 2297 gene locus_tag LOCUS_03790 2524 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 3859 2615 gene locus_tag LOCUS_03800 gene ltrA 3859 2615 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024495.1 protein_id gnl|my_center|LOCUS_03800 6275 7018 gene locus_tag LOCUS_03810 6275 7018 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222750.1 protein_id gnl|my_center|LOCUS_03810 >Feature sequence053 1729 320 gene locus_tag LOCUS_03820 1729 320 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 protein_id gnl|my_center|LOCUS_03820 3231 1885 gene locus_tag LOCUS_03830 3231 1885 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026898.1 protein_id gnl|my_center|LOCUS_03830 3684 3268 gene locus_tag LOCUS_03840 3684 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4072 3764 gene locus_tag LOCUS_03850 4072 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 4842 4156 gene locus_tag LOCUS_03860 4842 4156 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862048.1 protein_id gnl|my_center|LOCUS_03860 5332 4895 gene locus_tag LOCUS_03870 5332 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 5286 5891 gene locus_tag LOCUS_03880 5286 5891 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776667.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03880 5893 6849 gene locus_tag LOCUS_03890 5893 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence054 480 884 gene locus_tag LOCUS_03900 480 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 2640 1243 gene locus_tag LOCUS_03910 2640 1243 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730024.1 protein_id gnl|my_center|LOCUS_03910 4394 2637 gene locus_tag LOCUS_03920 4394 2637 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089295.1 protein_id gnl|my_center|LOCUS_03920 4524 6758 gene locus_tag LOCUS_03930 4524 6758 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027382.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence055 4 2601 gene locus_tag LOCUS_03940 gene carB 4 2601 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_03940 2598 3608 gene locus_tag LOCUS_03950 2598 3608 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_03950 3595 4302 gene locus_tag LOCUS_03960 gene pyrF 3595 4302 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_03960 4473 4787 gene locus_tag LOCUS_03970 gene mihF 4473 4787 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_03970 4802 5353 gene locus_tag LOCUS_03980 gene gmk 4802 5353 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055909.1 protein_id gnl|my_center|LOCUS_03980 5407 5703 gene locus_tag LOCUS_03990 5407 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence056 3272 1599 gene locus_tag LOCUS_04000 3272 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 1614 1688 gene locus_tag LOCUS_t00040 1614 1688 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3493 3269 gene locus_tag LOCUS_04010 3493 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4042 3815 gene locus_tag LOCUS_04020 4042 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 4243 4767 gene locus_tag LOCUS_04030 4243 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 5195 5120 gene locus_tag LOCUS_t00050 5195 5120 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5382 5654 gene locus_tag LOCUS_04040 5382 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence057 856 2940 gene locus_tag LOCUS_04050 856 2940 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582471.1 protein_id gnl|my_center|LOCUS_04050 5008 2930 gene locus_tag LOCUS_04060 gene glgX 5008 2930 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_04060 6026 5079 gene locus_tag LOCUS_04070 6026 5079 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262388.1 protein_id gnl|my_center|LOCUS_04070 <6816 6159 gene locus_tag LOCUS_04080 <6816 6159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003900979.1:exodeoxyribonuclease V subunit alpha >Feature sequence058 131 568 gene locus_tag LOCUS_04090 131 568 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230207.1 protein_id gnl|my_center|LOCUS_04090 1082 2479 gene locus_tag LOCUS_04100 1082 2479 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 protein_id gnl|my_center|LOCUS_04100 3635 2469 gene locus_tag LOCUS_04110 3635 2469 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484591.1 protein_id gnl|my_center|LOCUS_04110 3753 4454 gene locus_tag LOCUS_04120 3753 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222725.1 protein_id gnl|my_center|LOCUS_04120 4451 6094 gene locus_tag LOCUS_04130 4451 6094 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285994.1 protein_id gnl|my_center|LOCUS_04130 <6798 6097 gene locus_tag LOCUS_04140 <6798 6097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161270029.1:bifunctional glycosyltransferase 87/phosphatase PAP2 family protein >Feature sequence059 30 2273 gene locus_tag LOCUS_04150 30 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2297 2872 gene locus_tag LOCUS_04160 gene tmk 2297 2872 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140680.1 protein_id gnl|my_center|LOCUS_04160 3036 3974 gene locus_tag LOCUS_04170 3036 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 3971 5128 gene locus_tag LOCUS_04180 3971 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 5889 5278 gene locus_tag LOCUS_04190 5889 5278 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811973.1 protein_id gnl|my_center|LOCUS_04190 <6733 5889 gene locus_tag LOCUS_04200 <6733 5889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228114.1:flotillin family protein >Feature sequence060 <1 514 gene locus_tag LOCUS_04210 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776415.1:1,4-dihydroxy-2-naphthoate polyprenyltransferase 1353 586 gene locus_tag LOCUS_04220 gene menH 1353 586 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810064.1 protein_id gnl|my_center|LOCUS_04220 1368 3122 gene locus_tag LOCUS_04230 gene menD 1368 3122 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229050.1 protein_id gnl|my_center|LOCUS_04230 4386 3136 gene locus_tag LOCUS_04240 4386 3136 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_04240 5036 4383 gene locus_tag LOCUS_04250 gene ubiE 5036 4383 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_04250 5524 5069 gene locus_tag LOCUS_04260 5524 5069 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_04260 5942 5592 gene locus_tag LOCUS_04270 5942 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 <6644 5942 gene locus_tag LOCUS_04280 <6644 5942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013363517.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN >Feature sequence061 1423 41 gene locus_tag LOCUS_04290 1423 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2016 3107 gene locus_tag LOCUS_04300 2016 3107 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977086.1 protein_id gnl|my_center|LOCUS_04300 3329 4564 gene locus_tag LOCUS_04310 3329 4564 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230812.1 protein_id gnl|my_center|LOCUS_04310 4655 5608 gene locus_tag LOCUS_04320 4655 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 <6642 5643 gene locus_tag LOCUS_04330 <6642 5643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877518.1:acyl-CoA synthetase >Feature sequence062 4912 3773 gene locus_tag LOCUS_04340 4912 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 6357 4909 gene locus_tag LOCUS_04350 6357 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence063 1788 430 gene locus_tag LOCUS_04360 gene murD 1788 430 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_04360 2813 1785 gene locus_tag LOCUS_04370 gene mraY 2813 1785 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228040.1 protein_id gnl|my_center|LOCUS_04370 4249 2810 gene locus_tag LOCUS_04380 4249 2810 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_04380 4926 4444 gene locus_tag LOCUS_04390 4926 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 <6606 5439 gene locus_tag LOCUS_04400 <6606 5439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392354.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH >Feature sequence064 1259 648 gene locus_tag LOCUS_04410 1259 648 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381223.1 protein_id gnl|my_center|LOCUS_04410 3413 1269 gene locus_tag LOCUS_04420 3413 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 3749 4273 gene locus_tag LOCUS_04430 3749 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 5524 4349 gene locus_tag LOCUS_04440 5524 4349 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_04440 <6580 5673 gene locus_tag LOCUS_04450 <6580 5673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533213.1:catalase >Feature sequence065 3486 3118 gene locus_tag LOCUS_04460 3486 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3588 4265 gene locus_tag LOCUS_04470 3588 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 4258 5025 gene locus_tag LOCUS_04480 4258 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 6345 6175 gene locus_tag LOCUS_04490 6345 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence066 569 186 gene locus_tag LOCUS_04500 569 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 1147 713 gene locus_tag LOCUS_04510 1147 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 1238 1753 gene locus_tag LOCUS_04520 1238 1753 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092502.1 protein_id gnl|my_center|LOCUS_04520 2168 1776 gene locus_tag LOCUS_04530 2168 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2929 2183 gene locus_tag LOCUS_04540 2929 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 4215 3115 gene locus_tag LOCUS_04550 4215 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 5397 4255 gene locus_tag LOCUS_04560 gene hemW 5397 4255 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285807.1 protein_id gnl|my_center|LOCUS_04560 6304 5573 gene locus_tag LOCUS_04570 6304 5573 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence067 1 819 gene locus_tag LOCUS_04580 1 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 870 2630 gene locus_tag LOCUS_04590 870 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 3397 5064 gene locus_tag LOCUS_04600 3397 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence068 69 563 gene locus_tag LOCUS_04610 69 563 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859290.1 protein_id gnl|my_center|LOCUS_04610 2802 589 gene locus_tag LOCUS_04620 2802 589 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190250928.1 protein_id gnl|my_center|LOCUS_04620 3071 2799 gene locus_tag LOCUS_04630 3071 2799 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704966.1 protein_id gnl|my_center|LOCUS_04630 3436 3068 gene locus_tag LOCUS_04640 3436 3068 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704967.1 protein_id gnl|my_center|LOCUS_04640 4506 3454 gene locus_tag LOCUS_04650 4506 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 5623 4535 gene locus_tag LOCUS_04660 5623 4535 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266626.1 protein_id gnl|my_center|LOCUS_04660 6138 5620 gene locus_tag LOCUS_04670 gene cheD 6138 5620 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704960.1 protein_id gnl|my_center|LOCUS_04670 >Feature sequence069 762 562 gene locus_tag LOCUS_04680 762 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 1052 816 gene locus_tag LOCUS_04690 1052 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 1303 1049 gene locus_tag LOCUS_04700 1303 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 1614 1300 gene locus_tag LOCUS_04710 1614 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 2254 1628 gene locus_tag LOCUS_04720 2254 1628 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402203.1 protein_id gnl|my_center|LOCUS_04720 2303 2692 gene locus_tag LOCUS_04730 2303 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 2772 4790 gene locus_tag LOCUS_04740 gene tkt 2772 4790 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_04740 4787 5896 gene locus_tag LOCUS_04750 gene tal 4787 5896 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence070 923 1426 gene locus_tag LOCUS_04760 923 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1786 1454 gene locus_tag LOCUS_04770 1786 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2442 1831 gene locus_tag LOCUS_04780 gene pdxH 2442 1831 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_04780 3002 2451 gene locus_tag LOCUS_04790 3002 2451 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731335.1 protein_id gnl|my_center|LOCUS_04790 5193 3049 gene locus_tag LOCUS_04800 5193 3049 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223681.1 protein_id gnl|my_center|LOCUS_04800 <6422 5276 gene locus_tag LOCUS_04810 <6422 5276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224513.1:protoporphyrinogen oxidase >Feature sequence071 106 831 gene locus_tag LOCUS_04820 106 831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_04820 821 2179 gene locus_tag LOCUS_04830 821 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 1341 1350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2295 2840 gene locus_tag LOCUS_04840 2295 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 2837 4888 gene locus_tag LOCUS_04850 2837 4888 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_04850 4993 5514 gene locus_tag LOCUS_04860 4993 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 >Feature sequence072 574 266 gene locus_tag LOCUS_04870 574 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 729 1706 gene locus_tag LOCUS_04880 729 1706 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222573.1 protein_id gnl|my_center|LOCUS_04880 1761 2705 gene locus_tag LOCUS_04890 1761 2705 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_04890 2785 3543 gene locus_tag LOCUS_04900 2785 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 3540 4364 gene locus_tag LOCUS_04910 3540 4364 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015601.1 protein_id gnl|my_center|LOCUS_04910 4361 5374 gene locus_tag LOCUS_04920 4361 5374 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849145.1 protein_id gnl|my_center|LOCUS_04920 5750 5415 gene locus_tag LOCUS_04930 5750 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence073 508 2427 gene locus_tag LOCUS_04940 508 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 3585 2431 gene locus_tag LOCUS_04950 3585 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 4746 3640 gene locus_tag LOCUS_04960 4746 3640 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222919.1 protein_id gnl|my_center|LOCUS_04960 4784 5227 gene locus_tag LOCUS_04970 4784 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 5901 5197 gene locus_tag LOCUS_04980 5901 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence074 720 1529 gene locus_tag LOCUS_04990 720 1529 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977032.1 protein_id gnl|my_center|LOCUS_04990 2044 1586 gene locus_tag LOCUS_05000 2044 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 2097 2540 gene locus_tag LOCUS_05010 2097 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 2670 3038 gene locus_tag LOCUS_05020 2670 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3142 4191 gene locus_tag LOCUS_05030 3142 4191 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_05030 4300 6210 gene locus_tag LOCUS_05040 4300 6210 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence075 934 224 gene locus_tag LOCUS_05050 934 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05050 1503 1273 gene locus_tag LOCUS_05060 1503 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2854 1613 gene locus_tag LOCUS_05070 2854 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05070 4081 2987 gene locus_tag LOCUS_05080 4081 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05080 5322 4078 gene locus_tag LOCUS_05090 5322 4078 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189955127.1 protein_id gnl|my_center|LOCUS_05090 5681 5289 gene locus_tag LOCUS_05100 5681 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 5938 5768 gene locus_tag LOCUS_05110 5938 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence076 516 1286 gene locus_tag LOCUS_05120 516 1286 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221295.1 protein_id gnl|my_center|LOCUS_05120 1318 2595 gene locus_tag LOCUS_05130 1318 2595 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979702.1 protein_id gnl|my_center|LOCUS_05130 3601 2567 gene locus_tag LOCUS_05140 3601 2567 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013798.1 protein_id gnl|my_center|LOCUS_05140 3697 4722 gene locus_tag LOCUS_05150 3697 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 4726 5613 gene locus_tag LOCUS_05160 gene dapA 4726 5613 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286879.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence077 952 1974 gene locus_tag LOCUS_05170 952 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 4151 2019 gene locus_tag LOCUS_05180 4151 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 4222 4530 gene locus_tag LOCUS_05190 4222 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 4530 5624 gene locus_tag LOCUS_05200 4530 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence078 1498 851 gene locus_tag LOCUS_05210 1498 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3940 1610 gene locus_tag LOCUS_05220 3940 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 3933 4751 gene locus_tag LOCUS_05230 3933 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 4757 5536 gene locus_tag LOCUS_05240 4757 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 >Feature sequence079 213 803 gene locus_tag LOCUS_05250 213 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 816 825 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 900 1343 gene locus_tag LOCUS_05260 900 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 1343 1621 gene locus_tag LOCUS_05270 1343 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1754 2074 gene locus_tag LOCUS_05280 1754 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2074 2859 gene locus_tag LOCUS_05290 2074 2859 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_05290 2856 3680 gene locus_tag LOCUS_05300 2856 3680 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_05300 3677 4171 gene locus_tag LOCUS_05310 3677 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 4198 4716 gene locus_tag LOCUS_05320 4198 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 4723 6126 gene locus_tag LOCUS_05330 gene flgK 4723 6126 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence080 750 619 gene locus_tag LOCUS_05340 750 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 1573 1280 gene locus_tag LOCUS_05350 1573 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 1755 1570 gene locus_tag LOCUS_05360 1755 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 1934 1692 gene locus_tag LOCUS_05370 1934 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 2245 1934 gene locus_tag LOCUS_05380 2245 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 2969 2232 gene locus_tag LOCUS_05390 2969 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 3489 2962 gene locus_tag LOCUS_05400 3489 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 3955 3494 gene locus_tag LOCUS_05410 3955 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 4289 3858 gene locus_tag LOCUS_05420 4289 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 4448 4681 gene locus_tag LOCUS_05430 4448 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 4681 4953 gene locus_tag LOCUS_05440 4681 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 5303 4950 gene locus_tag LOCUS_05450 5303 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 6041 5415 gene locus_tag LOCUS_05460 6041 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence081 2 889 gene locus_tag LOCUS_05470 2 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 886 1290 gene locus_tag LOCUS_05480 886 1290 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_05480 1837 1310 gene locus_tag LOCUS_05490 1837 1310 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027329.1 protein_id gnl|my_center|LOCUS_05490 2820 1843 gene locus_tag LOCUS_05500 2820 1843 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939148.1 protein_id gnl|my_center|LOCUS_05500 3718 2930 gene locus_tag LOCUS_05510 3718 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3632 4699 gene locus_tag LOCUS_05520 3632 4699 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891590.1 protein_id gnl|my_center|LOCUS_05520 4668 5717 gene locus_tag LOCUS_05530 4668 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence082 917 177 gene locus_tag LOCUS_05540 917 177 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411707.1 protein_id gnl|my_center|LOCUS_05540 992 2287 gene locus_tag LOCUS_05550 992 2287 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_05550 2287 2628 gene locus_tag LOCUS_05560 2287 2628 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056967.1 protein_id gnl|my_center|LOCUS_05560 2691 3482 gene locus_tag LOCUS_05570 2691 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3882 3487 gene locus_tag LOCUS_05580 3882 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5104 4010 gene locus_tag LOCUS_05590 5104 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 6076 5153 gene locus_tag LOCUS_05600 6076 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence083 <1 1117 gene locus_tag LOCUS_05610 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein 1233 1892 gene locus_tag LOCUS_05620 1233 1892 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059489.1 protein_id gnl|my_center|LOCUS_05620 1917 2219 gene locus_tag LOCUS_05630 1917 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 2972 3778 gene locus_tag LOCUS_05640 2972 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 4347 4721 gene locus_tag LOCUS_05650 4347 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 4725 5972 gene locus_tag LOCUS_05660 4725 5972 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477091.1 protein_id gnl|my_center|LOCUS_05660 6132 6058 gene locus_tag LOCUS_t00060 6132 6058 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence084 2 385 gene locus_tag LOCUS_05670 2 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 1453 392 gene locus_tag LOCUS_05680 1453 392 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730445.1 protein_id gnl|my_center|LOCUS_05680 1540 2286 gene locus_tag LOCUS_05690 1540 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 3292 2252 gene locus_tag LOCUS_05700 3292 2252 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228718.1 protein_id gnl|my_center|LOCUS_05700 3437 4201 gene locus_tag LOCUS_05710 3437 4201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050980204.1 protein_id gnl|my_center|LOCUS_05710 4198 4908 gene locus_tag LOCUS_05720 4198 4908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456656.1 protein_id gnl|my_center|LOCUS_05720 4913 5809 gene locus_tag LOCUS_05730 4913 5809 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090549.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence085 142 948 gene locus_tag LOCUS_05740 142 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 953 2140 gene locus_tag LOCUS_05750 953 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 2130 2390 gene locus_tag LOCUS_05760 2130 2390 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707833.1 protein_id gnl|my_center|LOCUS_05760 2365 3123 gene locus_tag LOCUS_05770 2365 3123 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707832.1 protein_id gnl|my_center|LOCUS_05770 3127 4482 gene locus_tag LOCUS_05780 3127 4482 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222162.1 protein_id gnl|my_center|LOCUS_05780 4479 5573 gene locus_tag LOCUS_05790 4479 5573 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222163.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence086 <1 708 gene locus_tag LOCUS_05800 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031531.1:ubiquinol-cytochrome c reductase cytochrome b subunit 705 1094 gene locus_tag LOCUS_05810 705 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 1091 1561 gene locus_tag LOCUS_05820 1091 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1554 2105 gene locus_tag LOCUS_05830 1554 2105 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971771.1 protein_id gnl|my_center|LOCUS_05830 3010 2102 gene locus_tag LOCUS_05840 3010 2102 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977616.1 protein_id gnl|my_center|LOCUS_05840 3420 3172 gene locus_tag LOCUS_05850 3420 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 3594 4310 gene locus_tag LOCUS_05860 3594 4310 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005133116.1 protein_id gnl|my_center|LOCUS_05860 5402 4371 gene locus_tag LOCUS_05870 5402 4371 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742152.1 protein_id gnl|my_center|LOCUS_05870 <6122 5486 gene locus_tag LOCUS_05880 <6122 5486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227524.1:cation:proton antiporter >Feature sequence087 2474 1386 gene locus_tag LOCUS_05890 2474 1386 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028949.1 protein_id gnl|my_center|LOCUS_05890 2558 3763 gene locus_tag LOCUS_05900 2558 3763 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941116.1 protein_id gnl|my_center|LOCUS_05900 3809 4744 gene locus_tag LOCUS_05910 3809 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4785 5555 gene locus_tag LOCUS_05920 4785 5555 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230771.1 protein_id gnl|my_center|LOCUS_05920 >Feature sequence088 2290 1439 gene locus_tag LOCUS_05930 gene hpnD 2290 1439 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_05930 3214 2294 gene locus_tag LOCUS_05940 gene hpnC 3214 2294 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_05940 3997 3245 gene locus_tag LOCUS_05950 3997 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 5022 4042 gene locus_tag LOCUS_05960 5022 4042 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_05960 5116 5832 gene locus_tag LOCUS_05970 5116 5832 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908611.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence089 2255 513 gene locus_tag LOCUS_05980 2255 513 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_05980 2929 2261 gene locus_tag LOCUS_05990 2929 2261 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_05990 3348 5666 gene locus_tag LOCUS_06000 gene metE 3348 5666 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027494.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence090 2696 993 gene locus_tag LOCUS_06010 2696 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3632 2742 gene locus_tag LOCUS_06020 3632 2742 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_06020 4972 3608 gene locus_tag LOCUS_06030 4972 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 5414 4965 gene locus_tag LOCUS_06040 gene ruvX 5414 4965 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141132.1 protein_id gnl|my_center|LOCUS_06040 <5988 5411 gene locus_tag LOCUS_06050 <5988 5411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112602.1:alanine--tRNA ligase >Feature sequence091 547 38 gene locus_tag LOCUS_06060 547 38 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403826.1 protein_id gnl|my_center|LOCUS_06060 2502 544 gene locus_tag LOCUS_06070 gene thrS 2502 544 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_06070 3231 2545 gene locus_tag LOCUS_06080 gene npdG 3231 2545 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_06080 3260 3640 gene locus_tag LOCUS_06090 3260 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4209 3637 gene locus_tag LOCUS_06100 4209 3637 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785533.1 protein_id gnl|my_center|LOCUS_06100 4485 4273 gene locus_tag LOCUS_06110 4485 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5530 4400 gene locus_tag LOCUS_06120 5530 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06120 >Feature sequence092 479 120 gene locus_tag LOCUS_06130 479 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 504 1793 gene locus_tag LOCUS_06140 504 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 1823 2725 gene locus_tag LOCUS_06150 1823 2725 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223370.1 protein_id gnl|my_center|LOCUS_06150 4696 2729 gene locus_tag LOCUS_06160 4696 2729 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900995.1 protein_id gnl|my_center|LOCUS_06160 5557 4727 gene locus_tag LOCUS_06170 5557 4727 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413941.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence093 1167 217 gene locus_tag LOCUS_06180 1167 217 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_06180 1377 1225 gene locus_tag LOCUS_06190 1377 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1589 2764 gene locus_tag LOCUS_06200 1589 2764 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224421.1 protein_id gnl|my_center|LOCUS_06200 2765 3622 gene locus_tag LOCUS_06210 2765 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 5184 3772 gene locus_tag LOCUS_06220 5184 3772 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence094 <1 1623 gene locus_tag LOCUS_06230 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193485830.1:RecB family exonuclease 1620 5006 gene locus_tag LOCUS_06240 1620 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5694 5047 gene locus_tag LOCUS_06250 5694 5047 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224283.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence095 3201 574 gene locus_tag LOCUS_06260 3201 574 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257050.1 protein_id gnl|my_center|LOCUS_06260 3724 3278 gene locus_tag LOCUS_06270 3724 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978009.1 protein_id gnl|my_center|LOCUS_06270 3901 4596 gene locus_tag LOCUS_06280 3901 4596 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_06280 <5884 4650 gene locus_tag LOCUS_06290 <5884 4650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028172378.1:acyl-CoA dehydrogenase family protein >Feature sequence096 256 1191 gene locus_tag LOCUS_06300 256 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 2717 1209 gene locus_tag LOCUS_06310 2717 1209 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466576.1 protein_id gnl|my_center|LOCUS_06310 3986 2874 gene locus_tag LOCUS_06320 3986 2874 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092926.1 protein_id gnl|my_center|LOCUS_06320 4031 4186 gene locus_tag LOCUS_06330 4031 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4183 4575 gene locus_tag LOCUS_06340 4183 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4704 5633 gene locus_tag LOCUS_06350 4704 5633 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226288.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence097 651 2069 gene locus_tag LOCUS_06360 651 2069 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_06360 2069 3349 gene locus_tag LOCUS_06370 2069 3349 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_06370 4334 3375 gene locus_tag LOCUS_06380 4334 3375 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_06380 4492 5199 gene locus_tag LOCUS_06390 4492 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence098 768 1901 gene locus_tag LOCUS_06400 768 1901 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_06400 1925 2668 gene locus_tag LOCUS_06410 1925 2668 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06410 2665 2952 gene locus_tag LOCUS_06420 2665 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 2962 4617 gene locus_tag LOCUS_06430 2962 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 4628 5608 gene locus_tag LOCUS_06440 4628 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence099 3505 2393 gene locus_tag LOCUS_06450 3505 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4363 3524 gene locus_tag LOCUS_06460 4363 3524 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729731.1 protein_id gnl|my_center|LOCUS_06460 5178 4402 gene locus_tag LOCUS_06470 5178 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966641.1 protein_id gnl|my_center|LOCUS_06470 <5857 5225 gene locus_tag LOCUS_06480 <5857 5225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189284555.1:D-alanyl-D-alanine carboxypeptidase >Feature sequence100 464 1495 gene locus_tag LOCUS_06490 464 1495 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_06490 2318 1587 gene locus_tag LOCUS_06500 2318 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3652 2435 gene locus_tag LOCUS_06510 3652 2435 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223998.1 protein_id gnl|my_center|LOCUS_06510 3758 4063 gene locus_tag LOCUS_06520 3758 4063 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414042.1 protein_id gnl|my_center|LOCUS_06520 <5853 4106 gene locus_tag LOCUS_06530 <5853 4106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029425.1:ATP-dependent RNA helicase HrpA >Feature sequence101 2 1039 gene locus_tag LOCUS_06540 2 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 1855 1121 gene locus_tag LOCUS_06550 1855 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 2046 1852 gene locus_tag LOCUS_06560 2046 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 1973 2704 gene locus_tag LOCUS_06570 1973 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3831 2701 gene locus_tag LOCUS_06580 gene cysS 3831 2701 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256641.1 protein_id gnl|my_center|LOCUS_06580 4798 3926 gene locus_tag LOCUS_06590 4798 3926 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056709.1 protein_id gnl|my_center|LOCUS_06590 5001 5648 gene locus_tag LOCUS_06600 5001 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 5712 5639 gene locus_tag LOCUS_t00070 5712 5639 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence102 1075 1371 gene locus_tag LOCUS_06610 1075 1371 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_06610 1416 1742 gene locus_tag LOCUS_06620 1416 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 1772 2899 gene locus_tag LOCUS_06630 1772 2899 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015376.1 protein_id gnl|my_center|LOCUS_06630 3665 3060 gene locus_tag LOCUS_06640 3665 3060 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142953.1 protein_id gnl|my_center|LOCUS_06640 4234 3665 gene locus_tag LOCUS_06650 4234 3665 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_06650 4589 4380 gene locus_tag LOCUS_06660 4589 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence103 <1 1306 gene locus_tag LOCUS_06670 <1 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_067284407.1:aldehyde dehydrogenase family protein 1399 2865 gene locus_tag LOCUS_06680 1399 2865 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644775.1 protein_id gnl|my_center|LOCUS_06680 3726 2869 gene locus_tag LOCUS_06690 3726 2869 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_06690 3745 5637 gene locus_tag LOCUS_06700 3745 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence104 1733 924 gene locus_tag LOCUS_06710 1733 924 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727864.1 protein_id gnl|my_center|LOCUS_06710 1732 3321 gene locus_tag LOCUS_06720 1732 3321 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_06720 4178 3384 gene locus_tag LOCUS_06730 4178 3384 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350071.1 protein_id gnl|my_center|LOCUS_06730 4262 5242 gene locus_tag LOCUS_06740 4262 5242 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227738.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence105 1155 628 gene locus_tag LOCUS_06750 1155 628 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_06750 1389 2303 gene locus_tag LOCUS_06760 1389 2303 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 protein_id gnl|my_center|LOCUS_06760 3235 2315 gene locus_tag LOCUS_06770 3235 2315 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143980.1 protein_id gnl|my_center|LOCUS_06770 3378 3452 gene locus_tag LOCUS_t00080 3378 3452 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4274 3513 gene locus_tag LOCUS_06780 4274 3513 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974599.1 protein_id gnl|my_center|LOCUS_06780 4431 4288 gene locus_tag LOCUS_06790 4431 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4920 4507 gene locus_tag LOCUS_06800 4920 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 <5762 5059 gene locus_tag LOCUS_06810 <5762 5059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007055089.1:NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta >Feature sequence106 <1 994 gene locus_tag LOCUS_06820 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031595.1:alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase 991 2679 gene locus_tag LOCUS_06830 gene treS 991 2679 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897929.1 protein_id gnl|my_center|LOCUS_06830 2680 4044 gene locus_tag LOCUS_06840 2680 4044 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224469.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence107 276 2306 gene locus_tag LOCUS_06850 276 2306 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030394.1 protein_id gnl|my_center|LOCUS_06850 2296 3087 gene locus_tag LOCUS_06860 2296 3087 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_06860 3084 3239 gene locus_tag LOCUS_06870 3084 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 3236 4219 gene locus_tag LOCUS_06880 gene galT 3236 4219 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_06880 4216 5376 gene locus_tag LOCUS_06890 gene galK 4216 5376 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence108 252 49 gene locus_tag LOCUS_06900 252 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 718 254 gene locus_tag LOCUS_06910 718 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4605 844 gene locus_tag LOCUS_06920 4605 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence109 <1 597 gene locus_tag LOCUS_06930 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459777.1:transcriptional repressor LexA 1729 671 gene locus_tag LOCUS_06940 gene dapE 1729 671 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222942.1 protein_id gnl|my_center|LOCUS_06940 2562 1738 gene locus_tag LOCUS_06950 2562 1738 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_06950 3830 2670 gene locus_tag LOCUS_06960 3830 2670 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_06960 5095 3827 gene locus_tag LOCUS_06970 gene hflX 5095 3827 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_06970 <5724 5092 gene locus_tag LOCUS_06980 <5724 5092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944873.1:diaminopimelate epimerase >Feature sequence110 837 457 gene locus_tag LOCUS_06990 837 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 1780 842 gene locus_tag LOCUS_07000 1780 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2265 2044 gene locus_tag LOCUS_07010 2265 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2469 3377 gene locus_tag LOCUS_07020 2469 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3550 3804 gene locus_tag LOCUS_07030 3550 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3801 4118 gene locus_tag LOCUS_07040 3801 4118 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409778.1 protein_id gnl|my_center|LOCUS_07040 4987 4481 gene locus_tag LOCUS_07050 4987 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 <5716 5050 gene locus_tag LOCUS_07060 <5716 5050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729348.1:DUF1116 domain-containing protein >Feature sequence111 <1 2944 gene locus_tag LOCUS_07070 <1 2944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028569.1:ABC transporter ATP-binding protein 4868 2925 gene locus_tag LOCUS_07080 4868 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4807 5103 gene locus_tag LOCUS_07090 4807 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 5119 5319 gene locus_tag LOCUS_07100 5119 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 5683 5321 gene locus_tag LOCUS_07110 5683 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence112 <1 3104 gene locus_tag LOCUS_07120 <1 3104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204892.1:DISARM system helicase DrmA 3101 4942 gene locus_tag LOCUS_07130 3101 4942 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_07130 4948 5685 gene locus_tag LOCUS_07140 4948 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence113 <1 2526 gene locus_tag LOCUS_07150 <1 2526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027462.1:glycoside hydrolase family 38 C-terminal domain-containing protein 3049 2555 gene locus_tag LOCUS_07160 gene canA 3049 2555 CDS product beta-carbonic anhydrase CanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406616.1 protein_id gnl|my_center|LOCUS_07160 4260 3046 gene locus_tag LOCUS_07170 4260 3046 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230672.1 protein_id gnl|my_center|LOCUS_07170 5268 4339 gene locus_tag LOCUS_07180 5268 4339 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083359.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence114 1007 216 gene locus_tag LOCUS_07190 1007 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_07190 1108 2673 gene locus_tag LOCUS_07200 1108 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 2670 3539 gene locus_tag LOCUS_07210 2670 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 4345 3512 gene locus_tag LOCUS_07220 4345 3512 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975664.1 protein_id gnl|my_center|LOCUS_07220 <5699 4385 gene locus_tag LOCUS_07230 <5699 4385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089205.1:alpha/beta hydrolase fold domain-containing protein >Feature sequence115 606 55 gene locus_tag LOCUS_07240 gene sufT 606 55 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_07240 1949 603 gene locus_tag LOCUS_07250 gene sufD 1949 603 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_07250 2422 1949 gene locus_tag LOCUS_07260 2422 1949 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537140.1 protein_id gnl|my_center|LOCUS_07260 3222 2437 gene locus_tag LOCUS_07270 gene sufC 3222 2437 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384245.1 protein_id gnl|my_center|LOCUS_07270 4718 3222 gene locus_tag LOCUS_07280 gene sufB 4718 3222 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_07280 4845 5261 gene locus_tag LOCUS_07290 4845 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727264.1 protein_id gnl|my_center|LOCUS_07290 5488 5267 gene locus_tag LOCUS_07300 5488 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence116 899 1405 gene locus_tag LOCUS_07310 899 1405 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079520.1 protein_id gnl|my_center|LOCUS_07310 2174 1392 gene locus_tag LOCUS_07320 gene ygiD 2174 1392 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104467.1 protein_id gnl|my_center|LOCUS_07320 2486 2211 gene locus_tag LOCUS_07330 2486 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2930 2634 gene locus_tag LOCUS_07340 2930 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 2853 3800 gene locus_tag LOCUS_07350 2853 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence117 1713 181 gene locus_tag LOCUS_07360 1713 181 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230917.1 protein_id gnl|my_center|LOCUS_07360 2314 1796 gene locus_tag LOCUS_07370 2314 1796 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229400.1 protein_id gnl|my_center|LOCUS_07370 2417 3808 gene locus_tag LOCUS_07380 2417 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 5070 3805 gene locus_tag LOCUS_07390 5070 3805 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209645502.1 protein_id gnl|my_center|LOCUS_07390 5495 5067 gene locus_tag LOCUS_07400 5495 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence118 1026 634 gene locus_tag LOCUS_07410 1026 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 1628 1023 gene locus_tag LOCUS_07420 1628 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 2317 3210 gene locus_tag LOCUS_07430 2317 3210 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031514.1 protein_id gnl|my_center|LOCUS_07430 3711 3271 gene locus_tag LOCUS_07440 gene mscL 3711 3271 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_07440 4068 3856 gene locus_tag LOCUS_07450 4068 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 4200 5123 gene locus_tag LOCUS_07460 4200 5123 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence119 871 1800 gene locus_tag LOCUS_07470 871 1800 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_07470 1834 2475 gene locus_tag LOCUS_07480 1834 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 2583 3836 gene locus_tag LOCUS_07490 2583 3836 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256015.1 protein_id gnl|my_center|LOCUS_07490 <5619 3882 gene locus_tag LOCUS_07500 <5619 3882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_049744721.1:sugar transferase >Feature sequence120 <1 1891 gene locus_tag LOCUS_07510 <1 1891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:EAL domain-containing protein 2876 1938 gene locus_tag LOCUS_07520 2876 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 3167 5182 gene locus_tag LOCUS_07530 3167 5182 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_07530 5532 5179 gene locus_tag LOCUS_07540 5532 5179 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence121 227 299 gene locus_tag LOCUS_t00090 227 299 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 607 437 gene locus_tag LOCUS_07550 607 437 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_07550 1628 678 gene locus_tag LOCUS_07560 1628 678 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_07560 1737 2045 gene locus_tag LOCUS_07570 1737 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896282.1 protein_id gnl|my_center|LOCUS_07570 2172 2247 gene locus_tag LOCUS_t00100 2172 2247 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2440 3879 gene locus_tag LOCUS_07580 2440 3879 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644775.1 protein_id gnl|my_center|LOCUS_07580 4367 4002 gene locus_tag LOCUS_07590 4367 4002 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145023062.1 protein_id gnl|my_center|LOCUS_07590 4486 5523 gene locus_tag LOCUS_07600 4486 5523 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence122 822 1175 gene locus_tag LOCUS_07610 822 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 1157 2047 gene locus_tag LOCUS_07620 1157 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2172 2759 gene locus_tag LOCUS_07630 2172 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 2762 3601 gene locus_tag LOCUS_07640 2762 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228860.1 protein_id gnl|my_center|LOCUS_07640 3598 4911 gene locus_tag LOCUS_07650 3598 4911 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence123 1811 1011 gene locus_tag LOCUS_07660 1811 1011 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104392.1 protein_id gnl|my_center|LOCUS_07660 2928 1873 gene locus_tag LOCUS_07670 2928 1873 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_07670 3061 3327 gene locus_tag LOCUS_07680 3061 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 3768 3304 gene locus_tag LOCUS_07690 3768 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 4069 4563 gene locus_tag LOCUS_07700 4069 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 4745 5056 gene locus_tag LOCUS_07710 4745 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence124 176 1642 gene locus_tag LOCUS_07720 176 1642 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062753.1 protein_id gnl|my_center|LOCUS_07720 1693 2136 gene locus_tag LOCUS_07730 1693 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 2150 2764 gene locus_tag LOCUS_07740 2150 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 3398 2781 gene locus_tag LOCUS_07750 3398 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence125 1789 1385 gene locus_tag LOCUS_07760 1789 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2013 1723 gene locus_tag LOCUS_07770 2013 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2517 2074 gene locus_tag LOCUS_07780 2517 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2878 2498 gene locus_tag LOCUS_07790 2878 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3693 3031 gene locus_tag LOCUS_07800 3693 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 3895 3707 gene locus_tag LOCUS_07810 3895 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 3923 4699 gene locus_tag LOCUS_07820 3923 4699 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978139.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence126 987 670 gene locus_tag LOCUS_07830 987 670 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409778.1 protein_id gnl|my_center|LOCUS_07830 1334 978 gene locus_tag LOCUS_07840 1334 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1661 2014 gene locus_tag LOCUS_07850 1661 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2178 2882 gene locus_tag LOCUS_07860 2178 2882 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_07860 2879 4135 gene locus_tag LOCUS_07870 2879 4135 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029200.1 protein_id gnl|my_center|LOCUS_07870 4161 4817 gene locus_tag LOCUS_07880 4161 4817 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870668.1 protein_id gnl|my_center|LOCUS_07880 4811 5464 gene locus_tag LOCUS_07890 4811 5464 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230054.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence127 528 2531 gene locus_tag LOCUS_07900 gene pknB 528 2531 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224192.1 protein_id gnl|my_center|LOCUS_07900 3183 2764 gene locus_tag LOCUS_07910 3183 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3368 3643 gene locus_tag LOCUS_07920 gene gatC 3368 3643 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_07920 3640 5130 gene locus_tag LOCUS_07930 gene gatA 3640 5130 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence128 <1 630 gene locus_tag LOCUS_07940 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384229.1:glycoside hydrolase family 3 C-terminal domain-containing protein 661 2265 gene locus_tag LOCUS_07950 661 2265 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_07950 2265 4196 gene locus_tag LOCUS_07960 2265 4196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406602.1 protein_id gnl|my_center|LOCUS_07960 4193 5131 gene locus_tag LOCUS_07970 4193 5131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385051.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence129 3127 1187 gene locus_tag LOCUS_07980 gene mrdA 3127 1187 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_07980 3890 3144 gene locus_tag LOCUS_07990 3890 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 5009 3930 gene locus_tag LOCUS_08000 5009 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 5077 5160 gene locus_tag LOCUS_t00110 5077 5160 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence130 1762 479 gene locus_tag LOCUS_08010 gene serS 1762 479 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_08010 1861 2706 gene locus_tag LOCUS_08020 1861 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 4570 2639 gene locus_tag LOCUS_08030 4570 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 <5416 4647 gene locus_tag LOCUS_08040 <5416 4647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226810.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence131 660 1760 gene locus_tag LOCUS_08050 660 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2270 1818 gene locus_tag LOCUS_08060 2270 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 2629 2270 gene locus_tag LOCUS_08070 2629 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2643 2765 gene locus_tag LOCUS_08080 2643 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 2797 4020 gene locus_tag LOCUS_08090 2797 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 4958 3987 gene locus_tag LOCUS_08100 4958 3987 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626495.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence132 1594 1373 gene locus_tag LOCUS_08110 1594 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 2925 1591 gene locus_tag LOCUS_08120 2925 1591 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230432.1 protein_id gnl|my_center|LOCUS_08120 5272 2948 gene locus_tag LOCUS_08130 5272 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence133 1237 362 gene locus_tag LOCUS_08140 1237 362 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094336.1 protein_id gnl|my_center|LOCUS_08140 2208 1273 gene locus_tag LOCUS_08150 2208 1273 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030715.1 protein_id gnl|my_center|LOCUS_08150 3521 2208 gene locus_tag LOCUS_08160 3521 2208 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831529.1 protein_id gnl|my_center|LOCUS_08160 4395 3535 gene locus_tag LOCUS_08170 gene rfbD 4395 3535 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_08170 <5381 4392 gene locus_tag LOCUS_08180 <5381 4392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222917.1:dTDP-glucose 4,6-dehydratase >Feature sequence134 643 263 gene locus_tag LOCUS_08190 gene rpsM 643 263 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974244.1 protein_id gnl|my_center|LOCUS_08190 842 654 gene locus_tag LOCUS_08200 842 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1643 891 gene locus_tag LOCUS_08210 gene map 1643 891 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_08210 2262 1723 gene locus_tag LOCUS_08220 2262 1723 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977232.1 protein_id gnl|my_center|LOCUS_08220 2933 2286 gene locus_tag LOCUS_08230 2933 2286 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403695.1 protein_id gnl|my_center|LOCUS_08230 3879 2962 gene locus_tag LOCUS_08240 3879 2962 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409707.1 protein_id gnl|my_center|LOCUS_08240 4621 3944 gene locus_tag LOCUS_08250 4621 3944 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_08250 <5367 4621 gene locus_tag LOCUS_08260 <5367 4621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403723.1:preprotein translocase subunit SecY >Feature sequence135 1131 307 gene locus_tag LOCUS_08270 1131 307 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811701.1 protein_id gnl|my_center|LOCUS_08270 1452 2612 gene locus_tag LOCUS_08280 1452 2612 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225183.1 protein_id gnl|my_center|LOCUS_08280 2837 4645 gene locus_tag LOCUS_08290 2837 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence136 477 1655 gene locus_tag LOCUS_08300 477 1655 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 protein_id gnl|my_center|LOCUS_08300 1699 5283 gene locus_tag LOCUS_08310 1699 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence137 735 256 gene locus_tag LOCUS_08320 735 256 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_08320 1037 732 gene locus_tag LOCUS_08330 1037 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 949 1590 gene locus_tag LOCUS_08340 gene crp 949 1590 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908817.1 protein_id gnl|my_center|LOCUS_08340 2703 1627 gene locus_tag LOCUS_08350 gene disA 2703 1627 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_08350 4079 2760 gene locus_tag LOCUS_08360 gene radA 4079 2760 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 protein_id gnl|my_center|LOCUS_08360 <5354 4311 gene locus_tag LOCUS_08370 <5354 4311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975461.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence138 <1 1427 gene locus_tag LOCUS_08380 <1 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141135.1:NAD(P)/FAD-dependent oxidoreductase 1443 2729 gene locus_tag LOCUS_08390 1443 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2726 3322 gene locus_tag LOCUS_08400 2726 3322 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969927.1 protein_id gnl|my_center|LOCUS_08400 4473 3313 gene locus_tag LOCUS_08410 4473 3313 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence139 331 645 gene locus_tag LOCUS_08420 gene sodX 331 645 CDS product nickel-type superoxide dismutase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619530.1 protein_id gnl|my_center|LOCUS_08420 670 1536 gene locus_tag LOCUS_08430 670 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1554 2594 gene locus_tag LOCUS_08440 1554 2594 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_08440 3262 2627 gene locus_tag LOCUS_08450 3262 2627 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921226.1 protein_id gnl|my_center|LOCUS_08450 4338 3259 gene locus_tag LOCUS_08460 4338 3259 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225984036.1 protein_id gnl|my_center|LOCUS_08460 <5342 4386 gene locus_tag LOCUS_08470 <5342 4386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975718.1:Ppx/GppA phosphatase family protein >Feature sequence140 <1 1481 gene locus_tag LOCUS_08480 <1 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943390.1:glycerol kinase GlpK 2303 1518 gene locus_tag LOCUS_08490 2303 1518 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 protein_id gnl|my_center|LOCUS_08490 2321 3322 gene locus_tag LOCUS_08500 2321 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3334 4935 gene locus_tag LOCUS_08510 3334 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 5336 4980 gene locus_tag LOCUS_08520 5336 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence141 147 905 gene locus_tag LOCUS_08530 147 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 905 1105 gene locus_tag LOCUS_08540 905 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 1666 1118 gene locus_tag LOCUS_08550 1666 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545718.1 protein_id gnl|my_center|LOCUS_08550 3154 1817 gene locus_tag LOCUS_08560 3154 1817 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 protein_id gnl|my_center|LOCUS_08560 3185 4873 gene locus_tag LOCUS_08570 3185 4873 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225847.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence142 1967 393 gene locus_tag LOCUS_08580 1967 393 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228959.1 protein_id gnl|my_center|LOCUS_08580 3602 2073 gene locus_tag LOCUS_08590 3602 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 4786 3635 gene locus_tag LOCUS_08600 4786 3635 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_08600 <5325 4773 gene locus_tag LOCUS_08610 <5325 4773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228679.1:enoyl-CoA hydratase-related protein >Feature sequence143 161 1012 gene locus_tag LOCUS_08620 161 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1012 2394 gene locus_tag LOCUS_08630 1012 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 2487 5177 gene locus_tag LOCUS_08640 2487 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence144 106 33 gene locus_tag LOCUS_t00120 106 33 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 314 601 gene locus_tag LOCUS_08650 314 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 986 633 gene locus_tag LOCUS_08660 986 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1147 2271 gene locus_tag LOCUS_08670 1147 2271 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226510.1 protein_id gnl|my_center|LOCUS_08670 4285 2273 gene locus_tag LOCUS_08680 4285 2273 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226676.1 protein_id gnl|my_center|LOCUS_08680 4486 5163 gene locus_tag LOCUS_08690 4486 5163 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226677.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence145 851 3253 gene locus_tag LOCUS_08700 851 3253 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388279.1 protein_id gnl|my_center|LOCUS_08700 3256 3687 gene locus_tag LOCUS_08710 3256 3687 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence146 <1 606 gene locus_tag LOCUS_08720 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974351.1:response regulator transcription factor 1085 591 gene locus_tag LOCUS_08730 1085 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2521 1082 gene locus_tag LOCUS_08740 2521 1082 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728446.1 protein_id gnl|my_center|LOCUS_08740 3585 2524 gene locus_tag LOCUS_08750 3585 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 3757 5007 gene locus_tag LOCUS_08760 3757 5007 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence147 1721 516 gene locus_tag LOCUS_08770 1721 516 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816106.1 protein_id gnl|my_center|LOCUS_08770 1609 1863 gene locus_tag LOCUS_08780 1609 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 4500 2071 gene locus_tag LOCUS_08790 4500 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 2175 2080 gene locus_tag LOCUS_t00130 2175 2080 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <5208 4497 gene locus_tag LOCUS_08800 <5208 4497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031393.1:NAD-dependent succinate-semialdehyde dehydrogenase >Feature sequence148 2180 1338 gene locus_tag LOCUS_08810 2180 1338 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_08810 3154 2183 gene locus_tag LOCUS_08820 3154 2183 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401253.1 protein_id gnl|my_center|LOCUS_08820 4643 3228 gene locus_tag LOCUS_08830 4643 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 <5193 4671 gene locus_tag LOCUS_08840 <5193 4671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226355.1:LacI family DNA-binding transcriptional regulator >Feature sequence149 1944 214 gene locus_tag LOCUS_08850 1944 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2621 1956 gene locus_tag LOCUS_08860 2621 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 4081 2618 gene locus_tag LOCUS_08870 4081 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence150 1432 458 gene locus_tag LOCUS_08880 1432 458 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_08880 1876 1547 gene locus_tag LOCUS_08890 1876 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2449 1976 gene locus_tag LOCUS_08900 2449 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 3063 2539 gene locus_tag LOCUS_08910 3063 2539 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946710.1 protein_id gnl|my_center|LOCUS_08910 3425 3060 gene locus_tag LOCUS_08920 3425 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3805 3425 gene locus_tag LOCUS_08930 3805 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4669 4289 gene locus_tag LOCUS_08940 4669 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence151 4518 1753 gene locus_tag LOCUS_08950 4518 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 <5179 4526 gene locus_tag LOCUS_08960 <5179 4526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973773.1:PDZ domain-containing protein >Feature sequence152 375 617 gene locus_tag LOCUS_08970 375 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 641 1066 gene locus_tag LOCUS_08980 641 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1080 1229 gene locus_tag LOCUS_08990 1080 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1241 2545 gene locus_tag LOCUS_09000 1241 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2542 2790 gene locus_tag LOCUS_09010 2542 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2853 2862 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3117 2893 gene locus_tag LOCUS_09020 3117 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3445 3197 gene locus_tag LOCUS_09030 3445 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3729 3442 gene locus_tag LOCUS_09040 3729 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 3980 3729 gene locus_tag LOCUS_09050 3980 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 4819 3977 gene locus_tag LOCUS_09060 4819 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence153 <1 758 gene locus_tag LOCUS_09070 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228778.1:PIG-L family deacetylase 763 1491 gene locus_tag LOCUS_09080 763 1491 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223717.1 protein_id gnl|my_center|LOCUS_09080 2604 1504 gene locus_tag LOCUS_09090 2604 1504 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_09090 3854 2688 gene locus_tag LOCUS_09100 3854 2688 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_09100 5003 4038 gene locus_tag LOCUS_09110 5003 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224142.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence154 972 1247 gene locus_tag LOCUS_09120 972 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2506 1301 gene locus_tag LOCUS_09130 2506 1301 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901000.1 protein_id gnl|my_center|LOCUS_09130 2595 3065 gene locus_tag LOCUS_09140 2595 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229818.1 protein_id gnl|my_center|LOCUS_09140 3608 3099 gene locus_tag LOCUS_09150 3608 3099 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228878.1 protein_id gnl|my_center|LOCUS_09150 4875 3616 gene locus_tag LOCUS_09160 4875 3616 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence155 1236 13 gene locus_tag LOCUS_09170 1236 13 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908414.1 protein_id gnl|my_center|LOCUS_09170 2495 1356 gene locus_tag LOCUS_09180 gene dxr 2495 1356 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_09180 4783 2558 gene locus_tag LOCUS_09190 4783 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 5129 4794 gene locus_tag LOCUS_09200 5129 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence156 <1 763 gene locus_tag LOCUS_09210 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027491.1:isocitrate lyase 899 1699 gene locus_tag LOCUS_09220 899 1699 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_09220 2115 1765 gene locus_tag LOCUS_09230 2115 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3032 2112 gene locus_tag LOCUS_09240 3032 2112 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_09240 4788 3265 gene locus_tag LOCUS_09250 4788 3265 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence157 113 718 gene locus_tag LOCUS_09260 113 718 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_09260 709 1863 gene locus_tag LOCUS_09270 gene dusB 709 1863 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_09270 1889 2671 gene locus_tag LOCUS_09280 1889 2671 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068926.1 protein_id gnl|my_center|LOCUS_09280 2681 3373 gene locus_tag LOCUS_09290 2681 3373 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_09290 4549 3407 gene locus_tag LOCUS_09300 4549 3407 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223896.1 protein_id gnl|my_center|LOCUS_09300 <5094 4543 gene locus_tag LOCUS_09310 <5094 4543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804761.1:NUDIX domain-containing protein >Feature sequence158 463 1890 gene locus_tag LOCUS_09320 463 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2690 1887 gene locus_tag LOCUS_09330 gene nudC 2690 1887 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_09330 3177 2719 gene locus_tag LOCUS_09340 3177 2719 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225292.1 protein_id gnl|my_center|LOCUS_09340 4000 3170 gene locus_tag LOCUS_09350 4000 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 4103 4960 gene locus_tag LOCUS_09360 4103 4960 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027614.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence159 1805 744 gene locus_tag LOCUS_09370 gene thrC 1805 744 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880238.1 protein_id gnl|my_center|LOCUS_09370 3103 1802 gene locus_tag LOCUS_09380 3103 1802 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_09380 4520 3201 gene locus_tag LOCUS_09390 gene lysA 4520 3201 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_09390 4898 4521 gene locus_tag LOCUS_09400 4898 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 4980 5054 gene locus_tag LOCUS_t00140 4980 5054 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence160 1776 1225 gene locus_tag LOCUS_09410 1776 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 3048 1783 gene locus_tag LOCUS_09420 3048 1783 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594983.1 protein_id gnl|my_center|LOCUS_09420 3670 3059 gene locus_tag LOCUS_09430 gene pgsA 3670 3059 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_09430 4959 3670 gene locus_tag LOCUS_09440 gene rimO 4959 3670 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392588.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence161 449 1765 gene locus_tag LOCUS_09450 449 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09450 4049 1866 gene locus_tag LOCUS_09460 4049 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 <5064 4054 gene locus_tag LOCUS_09470 <5064 4054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030881.1:phosphatidylglycerol lysyltransferase domain-containing protein >Feature sequence162 1237 1869 gene locus_tag LOCUS_09480 1237 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1884 2702 gene locus_tag LOCUS_09490 1884 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3523 2699 gene locus_tag LOCUS_09500 3523 2699 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_09500 3560 4639 gene locus_tag LOCUS_09510 gene prfA 3560 4639 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227645.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence163 1 534 gene locus_tag LOCUS_09520 1 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 897 556 gene locus_tag LOCUS_09530 897 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1108 1320 gene locus_tag LOCUS_09540 1108 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 2630 1239 gene locus_tag LOCUS_09550 2630 1239 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_09550 2966 2640 gene locus_tag LOCUS_09560 2966 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3148 4347 gene locus_tag LOCUS_09570 3148 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09570 <4997 4378 gene locus_tag LOCUS_09580 <4997 4378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533090.1:intradiol ring-cleavage dioxygenase >Feature sequence164 815 126 gene locus_tag LOCUS_09590 815 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1981 812 gene locus_tag LOCUS_09600 1981 812 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877954.1 protein_id gnl|my_center|LOCUS_09600 2423 1875 gene locus_tag LOCUS_09610 2423 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2596 4059 gene locus_tag LOCUS_09620 2596 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4826 4056 gene locus_tag LOCUS_09630 4826 4056 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229561.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence165 1019 333 gene locus_tag LOCUS_09640 1019 333 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832113.1 protein_id gnl|my_center|LOCUS_09640 2859 1234 gene locus_tag LOCUS_09650 gene groL 2859 1234 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_09650 3284 3009 gene locus_tag LOCUS_09660 3284 3009 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_09660 4534 3287 gene locus_tag LOCUS_09670 gene thrC 4534 3287 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142060.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence166 566 1942 gene locus_tag LOCUS_09680 566 1942 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_09680 1939 2649 gene locus_tag LOCUS_09690 gene gpmA 1939 2649 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807430.1 protein_id gnl|my_center|LOCUS_09690 2723 4126 gene locus_tag LOCUS_09700 2723 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 4126 4803 gene locus_tag LOCUS_09710 4126 4803 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140026.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence167 650 2005 gene locus_tag LOCUS_09720 650 2005 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401544.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence168 2 463 gene locus_tag LOCUS_09730 2 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 589 1137 gene locus_tag LOCUS_09740 589 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1222 1584 gene locus_tag LOCUS_09750 1222 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3982 1748 gene locus_tag LOCUS_09760 3982 1748 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259371.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence169 1173 181 gene locus_tag LOCUS_09770 1173 181 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229059.1 protein_id gnl|my_center|LOCUS_09770 1727 1170 gene locus_tag LOCUS_09780 1727 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1878 2231 gene locus_tag LOCUS_09790 1878 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2480 2941 gene locus_tag LOCUS_09800 2480 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2925 4148 gene locus_tag LOCUS_09810 2925 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence170 285 97 gene locus_tag LOCUS_09820 285 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 661 236 gene locus_tag LOCUS_09830 661 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1230 658 gene locus_tag LOCUS_09840 1230 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1556 1212 gene locus_tag LOCUS_09850 1556 1212 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_09850 1621 2640 gene locus_tag LOCUS_09860 1621 2640 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223936.1 protein_id gnl|my_center|LOCUS_09860 2637 3434 gene locus_tag LOCUS_09870 2637 3434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_09870 3502 3900 gene locus_tag LOCUS_09880 3502 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 3893 4714 gene locus_tag LOCUS_09890 3893 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence171 1094 1600 gene locus_tag LOCUS_09900 1094 1600 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227282.1 protein_id gnl|my_center|LOCUS_09900 2130 1675 gene locus_tag LOCUS_09910 2130 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2574 2134 gene locus_tag LOCUS_09920 2574 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3090 2608 gene locus_tag LOCUS_09930 3090 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3268 4770 gene locus_tag LOCUS_09940 3268 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence172 <1 768 gene locus_tag LOCUS_09950 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814223.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase 765 1646 gene locus_tag LOCUS_09960 765 1646 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417751.1 protein_id gnl|my_center|LOCUS_09960 1745 2254 gene locus_tag LOCUS_09970 1745 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4511 2331 gene locus_tag LOCUS_09980 4511 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence173 3180 1432 gene locus_tag LOCUS_09990 3180 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 4184 3177 gene locus_tag LOCUS_10000 4184 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence174 85 2454 gene locus_tag LOCUS_10010 85 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2501 3307 gene locus_tag LOCUS_10020 2501 3307 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225296.1 protein_id gnl|my_center|LOCUS_10020 3460 3894 gene locus_tag LOCUS_10030 3460 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 <4913 3902 gene locus_tag LOCUS_10040 <4913 3902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976340.1:ABC transporter ATP-binding protein >Feature sequence175 1267 197 gene locus_tag LOCUS_10050 1267 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1469 1903 gene locus_tag LOCUS_10060 1469 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2512 2012 gene locus_tag LOCUS_10070 2512 2012 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_10070 2754 2509 gene locus_tag LOCUS_10080 2754 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3516 2884 gene locus_tag LOCUS_10090 3516 2884 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599821.1 protein_id gnl|my_center|LOCUS_10090 4470 3589 gene locus_tag LOCUS_10100 4470 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence176 584 2134 gene locus_tag LOCUS_10110 584 2134 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083814.1 protein_id gnl|my_center|LOCUS_10110 2286 4211 gene locus_tag LOCUS_10120 2286 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence177 388 1065 gene locus_tag LOCUS_10130 388 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1078 1854 gene locus_tag LOCUS_10140 1078 1854 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_10140 2362 1823 gene locus_tag LOCUS_10150 2362 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2380 3075 gene locus_tag LOCUS_10160 2380 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 3072 4268 gene locus_tag LOCUS_10170 3072 4268 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence178 1585 965 gene locus_tag LOCUS_10180 1585 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3676 1592 gene locus_tag LOCUS_10190 3676 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 3852 4136 gene locus_tag LOCUS_10200 3852 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence179 648 1457 gene locus_tag LOCUS_10210 648 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1556 2482 gene locus_tag LOCUS_10220 1556 2482 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222562.1 protein_id gnl|my_center|LOCUS_10220 3849 2689 gene locus_tag LOCUS_10230 3849 2689 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526892.1 protein_id gnl|my_center|LOCUS_10230 4637 3855 gene locus_tag LOCUS_10240 4637 3855 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence180 3143 432 gene locus_tag LOCUS_10250 3143 432 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_10250 3958 3143 gene locus_tag LOCUS_10260 gene tatC 3958 3143 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410764.1 protein_id gnl|my_center|LOCUS_10260 4415 4050 gene locus_tag LOCUS_10270 4415 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 4613 4443 gene locus_tag LOCUS_10280 4613 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence181 1256 813 gene locus_tag LOCUS_10290 1256 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1384 2100 gene locus_tag LOCUS_10300 1384 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2106 3407 gene locus_tag LOCUS_10310 2106 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 4124 3465 gene locus_tag LOCUS_10320 gene nucS 4124 3465 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730195.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence182 42 2300 gene locus_tag LOCUS_10330 42 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence183 <1 1049 gene locus_tag LOCUS_10340 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877924.1:long-chain fatty acid--CoA ligase 2537 1062 gene locus_tag LOCUS_10350 2537 1062 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_10350 3689 2613 gene locus_tag LOCUS_10360 3689 2613 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_10360 <4787 3710 gene locus_tag LOCUS_10370 <4787 3710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921111.1:lipoyl synthase >Feature sequence184 1507 2916 gene locus_tag LOCUS_10380 gene dnaA 1507 2916 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950320.1 protein_id gnl|my_center|LOCUS_10380 3160 4266 gene locus_tag LOCUS_10390 gene dnaN 3160 4266 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence185 154 627 gene locus_tag LOCUS_10400 154 627 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227870.1 protein_id gnl|my_center|LOCUS_10400 660 1646 gene locus_tag LOCUS_10410 gene ribD 660 1646 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704561.1 protein_id gnl|my_center|LOCUS_10410 1654 2280 gene locus_tag LOCUS_10420 1654 2280 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_10420 2283 3500 gene locus_tag LOCUS_10430 2283 3500 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_10430 3497 3982 gene locus_tag LOCUS_10440 gene ribE 3497 3982 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258065.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence186 3627 1000 gene locus_tag LOCUS_10450 gene ppdK 3627 1000 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_10450 <4768 3646 gene locus_tag LOCUS_10460 <4768 3646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013399500.1:glycine--tRNA ligase >Feature sequence187 1950 307 gene locus_tag LOCUS_10470 1950 307 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528457.1 protein_id gnl|my_center|LOCUS_10470 2620 1952 gene locus_tag LOCUS_10480 2620 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4008 2608 gene locus_tag LOCUS_10490 4008 2608 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_10490 4403 4008 gene locus_tag LOCUS_10500 4403 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 4765 4400 gene locus_tag LOCUS_10510 4765 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence188 <1 2163 gene locus_tag LOCUS_10520 <1 2163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926174.1:CoA transferase 3323 2187 gene locus_tag LOCUS_10530 3323 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence189 442 1062 gene locus_tag LOCUS_10540 gene scpB 442 1062 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_10540 1059 1841 gene locus_tag LOCUS_10550 1059 1841 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_10550 1838 2917 gene locus_tag LOCUS_10560 1838 2917 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_10560 2925 4214 gene locus_tag LOCUS_10570 gene aroA 2925 4214 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence190 366 49 gene locus_tag LOCUS_10580 366 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1010 1378 gene locus_tag LOCUS_10590 1010 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1431 3242 gene locus_tag LOCUS_10600 1431 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3239 3778 gene locus_tag LOCUS_10610 3239 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4135 3842 gene locus_tag LOCUS_10620 4135 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence191 561 337 gene locus_tag LOCUS_10630 561 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 565 1077 gene locus_tag LOCUS_10640 565 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1570 1085 gene locus_tag LOCUS_10650 1570 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1629 2066 gene locus_tag LOCUS_10660 1629 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415930.1 protein_id gnl|my_center|LOCUS_10660 2373 1960 gene locus_tag LOCUS_10670 2373 1960 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776272.1 protein_id gnl|my_center|LOCUS_10670 2290 3918 gene locus_tag LOCUS_10680 2290 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3938 4525 gene locus_tag LOCUS_10690 3938 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence192 2486 141 gene locus_tag LOCUS_10700 2486 141 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_10700 3019 2546 gene locus_tag LOCUS_10710 3019 2546 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_10710 <4725 3064 gene locus_tag LOCUS_10720 <4725 3064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227069.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence193 <1 1079 gene locus_tag LOCUS_10730 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728507.1:polyribonucleotide nucleotidyltransferase 1120 2346 gene locus_tag LOCUS_10740 1120 2346 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_10740 2393 3163 gene locus_tag LOCUS_10750 gene dapB 2393 3163 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804662.1 protein_id gnl|my_center|LOCUS_10750 3296 4147 gene locus_tag LOCUS_10760 gene dapA 3296 4147 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence194 517 1410 gene locus_tag LOCUS_10770 517 1410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976385.1 protein_id gnl|my_center|LOCUS_10770 1410 2270 gene locus_tag LOCUS_10780 1410 2270 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222533.1 protein_id gnl|my_center|LOCUS_10780 2281 3861 gene locus_tag LOCUS_10790 2281 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence195 1834 1169 gene locus_tag LOCUS_10800 1834 1169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027531.1 protein_id gnl|my_center|LOCUS_10800 1886 1895 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2255 3439 gene locus_tag LOCUS_10810 2255 3439 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_10810 4272 3460 gene locus_tag LOCUS_10820 4272 3460 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969990.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence196 254 796 gene locus_tag LOCUS_10830 254 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 793 1362 gene locus_tag LOCUS_10840 793 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1536 2645 gene locus_tag LOCUS_10850 1536 2645 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_10850 3235 2867 gene locus_tag LOCUS_10860 3235 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3672 3232 gene locus_tag LOCUS_10870 3672 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 3920 4390 gene locus_tag LOCUS_10880 3920 4390 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222376.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence197 403 1857 gene locus_tag LOCUS_10890 403 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3220 1928 gene locus_tag LOCUS_10900 3220 1928 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_10900 4020 4511 gene locus_tag LOCUS_10910 4020 4511 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence198 1406 270 gene locus_tag LOCUS_10920 1406 270 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 protein_id gnl|my_center|LOCUS_10920 1562 3124 gene locus_tag LOCUS_10930 1562 3124 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142816.1 protein_id gnl|my_center|LOCUS_10930 4313 3144 gene locus_tag LOCUS_10940 4313 3144 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810258.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence199 65 541 gene locus_tag LOCUS_10950 65 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 560 835 gene locus_tag LOCUS_10960 560 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 957 1871 gene locus_tag LOCUS_10970 957 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1950 3059 gene locus_tag LOCUS_10980 1950 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 4673 3072 gene locus_tag LOCUS_10990 4673 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence200 1210 2022 gene locus_tag LOCUS_11000 1210 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 2053 3360 gene locus_tag LOCUS_11010 2053 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3803 4441 gene locus_tag LOCUS_11020 3803 4441 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081822.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence201 82 801 gene locus_tag LOCUS_11030 82 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1287 835 gene locus_tag LOCUS_11040 1287 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1670 1284 gene locus_tag LOCUS_11050 1670 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4016 2394 gene locus_tag LOCUS_11060 4016 2394 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142311.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence202 488 48 gene locus_tag LOCUS_11070 488 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2647 485 gene locus_tag LOCUS_11080 2647 485 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056904.1 protein_id gnl|my_center|LOCUS_11080 2986 2717 gene locus_tag LOCUS_11090 2986 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 <4673 2999 gene locus_tag LOCUS_11100 <4673 2999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731169.1:2-isopropylmalate synthase >Feature sequence203 1515 676 gene locus_tag LOCUS_11110 1515 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3145 1691 gene locus_tag LOCUS_11120 3145 1691 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256452.1 protein_id gnl|my_center|LOCUS_11120 3427 3266 gene locus_tag LOCUS_11130 3427 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4037 3585 gene locus_tag LOCUS_11140 4037 3585 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226058.1 protein_id gnl|my_center|LOCUS_11140 4060 4533 gene locus_tag LOCUS_11150 4060 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence204 1417 743 gene locus_tag LOCUS_11160 gene narJ 1417 743 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026934.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11160 3030 1414 gene locus_tag LOCUS_11170 gene narH 3030 1414 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487116.1 protein_id gnl|my_center|LOCUS_11170 4633 3065 gene locus_tag LOCUS_11180 4633 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence205 499 332 gene locus_tag LOCUS_11190 499 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 601 2364 gene locus_tag LOCUS_11200 601 2364 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_11200 2396 2953 gene locus_tag LOCUS_11210 2396 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3011 3802 gene locus_tag LOCUS_11220 3011 3802 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869459.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence206 140 676 gene locus_tag LOCUS_11230 140 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 657 1628 gene locus_tag LOCUS_11240 657 1628 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 protein_id gnl|my_center|LOCUS_11240 1857 2888 gene locus_tag LOCUS_11250 1857 2888 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227931.1 protein_id gnl|my_center|LOCUS_11250 2967 3914 gene locus_tag LOCUS_11260 2967 3914 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227932.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence207 619 125 gene locus_tag LOCUS_11270 619 125 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224858.1 protein_id gnl|my_center|LOCUS_11270 3015 631 gene locus_tag LOCUS_11280 3015 631 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224857.1 protein_id gnl|my_center|LOCUS_11280 3318 3121 gene locus_tag LOCUS_11290 3318 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3311 3475 gene locus_tag LOCUS_11300 3311 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 4459 3899 gene locus_tag LOCUS_11310 4459 3899 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence208 1593 1006 gene locus_tag LOCUS_11320 1593 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2474 1740 gene locus_tag LOCUS_11330 2474 1740 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_11330 2878 2471 gene locus_tag LOCUS_11340 2878 2471 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 protein_id gnl|my_center|LOCUS_11340 2940 3539 gene locus_tag LOCUS_11350 2940 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 3536 4300 gene locus_tag LOCUS_11360 3536 4300 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence209 3413 9 gene locus_tag LOCUS_11370 3413 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3995 3672 gene locus_tag LOCUS_11380 3995 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 4576 3992 gene locus_tag LOCUS_11390 4576 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence210 497 1729 gene locus_tag LOCUS_11400 497 1729 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730652.1 protein_id gnl|my_center|LOCUS_11400 1731 3206 gene locus_tag LOCUS_11410 1731 3206 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404742.1 protein_id gnl|my_center|LOCUS_11410 3200 4153 gene locus_tag LOCUS_11420 3200 4153 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897017.1 protein_id gnl|my_center|LOCUS_11420 4413 4586 gene locus_tag LOCUS_11430 4413 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence211 930 634 gene locus_tag LOCUS_11440 930 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1523 1843 gene locus_tag LOCUS_11450 1523 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2080 3195 gene locus_tag LOCUS_11460 2080 3195 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027750.1 protein_id gnl|my_center|LOCUS_11460 3213 3911 gene locus_tag LOCUS_11470 3213 3911 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 protein_id gnl|my_center|LOCUS_11470 3917 4516 gene locus_tag LOCUS_11480 3917 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence212 1986 1912 gene locus_tag LOCUS_t00150 1986 1912 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2137 3234 gene locus_tag LOCUS_11490 2137 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3393 4583 gene locus_tag LOCUS_11500 3393 4583 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence213 2 193 gene locus_tag LOCUS_11510 2 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 583 416 gene locus_tag LOCUS_11520 583 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11520 1265 1675 gene locus_tag LOCUS_11530 1265 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1602 1865 gene locus_tag LOCUS_11540 1602 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2562 2176 gene locus_tag LOCUS_11550 2562 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3050 2559 gene locus_tag LOCUS_11560 3050 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 3074 4015 gene locus_tag LOCUS_11570 3074 4015 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190793.1 protein_id gnl|my_center|LOCUS_11570 4392 4066 gene locus_tag LOCUS_11580 4392 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence214 1101 385 gene locus_tag LOCUS_11590 1101 385 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528551.1 protein_id gnl|my_center|LOCUS_11590 1613 1203 gene locus_tag LOCUS_11600 1613 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2341 1610 gene locus_tag LOCUS_11610 2341 1610 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_11610 2479 3387 gene locus_tag LOCUS_11620 gene hpaD 2479 3387 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085751.1 protein_id gnl|my_center|LOCUS_11620 3387 4298 gene locus_tag LOCUS_11630 3387 4298 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence215 1136 711 gene locus_tag LOCUS_11640 1136 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1311 3014 gene locus_tag LOCUS_11650 1311 3014 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229346.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence216 2034 1000 gene locus_tag LOCUS_11660 2034 1000 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878041.1 protein_id gnl|my_center|LOCUS_11660 2138 3271 gene locus_tag LOCUS_11670 2138 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038521.1 protein_id gnl|my_center|LOCUS_11670 4504 3284 gene locus_tag LOCUS_11680 4504 3284 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence217 750 136 gene locus_tag LOCUS_11690 750 136 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_11690 1649 750 gene locus_tag LOCUS_11700 1649 750 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222442.1 protein_id gnl|my_center|LOCUS_11700 2653 1685 gene locus_tag LOCUS_11710 2653 1685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_11710 3613 2663 gene locus_tag LOCUS_11720 3613 2663 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_11720 <4567 3610 gene locus_tag LOCUS_11730 <4567 3610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003892059.1:dipeptide ABC transporter ATP-binding protein >Feature sequence218 209 30 gene locus_tag LOCUS_11740 gene rpmD 209 30 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_11740 759 211 gene locus_tag LOCUS_11750 gene rpsE 759 211 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892859.1 protein_id gnl|my_center|LOCUS_11750 1127 759 gene locus_tag LOCUS_11760 gene rplR 1127 759 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143899.1 protein_id gnl|my_center|LOCUS_11760 1666 1127 gene locus_tag LOCUS_11770 gene rplF 1666 1127 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222612.1 protein_id gnl|my_center|LOCUS_11770 2093 1689 gene locus_tag LOCUS_11780 gene rpsH 2093 1689 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_11780 2292 2107 gene locus_tag LOCUS_11790 2292 2107 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_11790 2883 2308 gene locus_tag LOCUS_11800 gene rplE 2883 2308 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_11800 3200 2883 gene locus_tag LOCUS_11810 gene rplX 3200 2883 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707762.1 protein_id gnl|my_center|LOCUS_11810 3571 3203 gene locus_tag LOCUS_11820 gene rplN 3571 3203 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_11820 3921 3568 gene locus_tag LOCUS_11830 gene rpsQ 3921 3568 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222609.1 protein_id gnl|my_center|LOCUS_11830 4142 3921 gene locus_tag LOCUS_11840 4142 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence219 766 3366 gene locus_tag LOCUS_11850 766 3366 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225440415.1 protein_id gnl|my_center|LOCUS_11850 4235 3354 gene locus_tag LOCUS_11860 4235 3354 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224200.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence220 <1 969 gene locus_tag LOCUS_11870 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229396.1:AMP-binding protein 1048 2643 gene locus_tag LOCUS_11880 1048 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2640 3395 gene locus_tag LOCUS_11890 2640 3395 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_11890 <4549 3462 gene locus_tag LOCUS_11900 <4549 3462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228765.1:TrpB-like pyridoxal phosphate-dependent enzyme 3475 3484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence221 1265 288 gene locus_tag LOCUS_11910 1265 288 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 protein_id gnl|my_center|LOCUS_11910 2090 1272 gene locus_tag LOCUS_11920 2090 1272 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_11920 2743 2114 gene locus_tag LOCUS_11930 2743 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3924 2740 gene locus_tag LOCUS_11940 3924 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence222 1117 506 gene locus_tag LOCUS_11950 1117 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 2636 1470 gene locus_tag LOCUS_11960 2636 1470 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229302.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11960 3045 4355 gene locus_tag LOCUS_11970 3045 4355 CDS product IS1380-like element ISMsm10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731432.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence223 469 1125 gene locus_tag LOCUS_11980 469 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1165 1632 gene locus_tag LOCUS_11990 1165 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1629 2054 gene locus_tag LOCUS_12000 1629 2054 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_12000 3724 2084 gene locus_tag LOCUS_12010 3724 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence224 1274 108 gene locus_tag LOCUS_12020 1274 108 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_12020 1925 1287 gene locus_tag LOCUS_12030 1925 1287 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 protein_id gnl|my_center|LOCUS_12030 2178 3113 gene locus_tag LOCUS_12040 2178 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4483 3089 gene locus_tag LOCUS_12050 4483 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence225 2470 1130 gene locus_tag LOCUS_12060 2470 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190104869.1 protein_id gnl|my_center|LOCUS_12060 3462 2533 gene locus_tag LOCUS_12070 3462 2533 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229059.1 protein_id gnl|my_center|LOCUS_12070 4304 3528 gene locus_tag LOCUS_12080 4304 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence226 456 163 gene locus_tag LOCUS_12090 456 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1346 543 gene locus_tag LOCUS_12100 1346 543 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028784.1 protein_id gnl|my_center|LOCUS_12100 2361 1411 gene locus_tag LOCUS_12110 2361 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2479 3180 gene locus_tag LOCUS_12120 2479 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 3282 4493 gene locus_tag LOCUS_12130 3282 4493 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879900.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence227 422 1120 gene locus_tag LOCUS_12140 422 1120 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226228.1 protein_id gnl|my_center|LOCUS_12140 1701 1240 gene locus_tag LOCUS_12150 1701 1240 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027346.1 protein_id gnl|my_center|LOCUS_12150 2839 1769 gene locus_tag LOCUS_12160 2839 1769 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776255.1 protein_id gnl|my_center|LOCUS_12160 3764 3012 gene locus_tag LOCUS_12170 gene narI 3764 3012 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026935.1 protein_id gnl|my_center|LOCUS_12170 4396 3761 gene locus_tag LOCUS_12180 4396 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence228 1708 80 gene locus_tag LOCUS_12190 1708 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1764 2759 gene locus_tag LOCUS_12200 1764 2759 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728135.1 protein_id gnl|my_center|LOCUS_12200 3208 2756 gene locus_tag LOCUS_12210 gene bcp 3208 2756 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257872.1 protein_id gnl|my_center|LOCUS_12210 4374 3208 gene locus_tag LOCUS_12220 gene fabF 4374 3208 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227920.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence229 797 1738 gene locus_tag LOCUS_12230 797 1738 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877923.1 protein_id gnl|my_center|LOCUS_12230 1776 2255 gene locus_tag LOCUS_12240 1776 2255 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731373.1 protein_id gnl|my_center|LOCUS_12240 2454 3905 gene locus_tag LOCUS_12250 2454 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence230 22 98 gene locus_tag LOCUS_t00160 22 98 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1680 55 gene locus_tag LOCUS_12260 1680 55 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_12260 2829 1930 gene locus_tag LOCUS_12270 2829 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3751 2819 gene locus_tag LOCUS_12280 3751 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 3906 4460 gene locus_tag LOCUS_12290 3906 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence231 <1 522 gene locus_tag LOCUS_12300 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031630.1:NAD(P)/FAD-dependent oxidoreductase 1011 634 gene locus_tag LOCUS_12310 1011 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1388 975 gene locus_tag LOCUS_12320 1388 975 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227043.1 protein_id gnl|my_center|LOCUS_12320 1841 2719 gene locus_tag LOCUS_12330 1841 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3355 2819 gene locus_tag LOCUS_12340 3355 2819 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226138.1 protein_id gnl|my_center|LOCUS_12340 <4460 3433 gene locus_tag LOCUS_12350 <4460 3433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161270193.1:RNA polymerase sigma factor SigF >Feature sequence232 2179 752 gene locus_tag LOCUS_12360 2179 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 4176 2254 gene locus_tag LOCUS_12370 gene shc 4176 2254 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence233 3246 757 gene locus_tag LOCUS_12380 3246 757 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_12380 <4448 3328 gene locus_tag LOCUS_12390 <4448 3328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000823075.1:ribonuclease J >Feature sequence234 1811 669 gene locus_tag LOCUS_12400 gene rsmB 1811 669 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256916.1 protein_id gnl|my_center|LOCUS_12400 2514 1795 gene locus_tag LOCUS_12410 gene fmt 2514 1795 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338559.1 protein_id gnl|my_center|LOCUS_12410 3150 2650 gene locus_tag LOCUS_12420 gene def 3150 2650 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_12420 3177 3773 gene locus_tag LOCUS_12430 3177 3773 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_12430 3770 4294 gene locus_tag LOCUS_12440 3770 4294 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence235 1132 2 gene locus_tag LOCUS_12450 1132 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1338 1129 gene locus_tag LOCUS_12460 1338 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1814 1335 gene locus_tag LOCUS_12470 1814 1335 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258625.1 protein_id gnl|my_center|LOCUS_12470 3445 1823 gene locus_tag LOCUS_12480 3445 1823 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728265.1 protein_id gnl|my_center|LOCUS_12480 <4434 3482 gene locus_tag LOCUS_12490 <4434 3482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893633.1:hydrogenase >Feature sequence236 <1 1138 gene locus_tag LOCUS_12500 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085689.1:cytochrome P450 1224 1718 gene locus_tag LOCUS_12510 gene tadA 1224 1718 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391574.1 protein_id gnl|my_center|LOCUS_12510 2004 1783 gene locus_tag LOCUS_12520 2004 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 2070 2501 gene locus_tag LOCUS_12530 2070 2501 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030058.1 protein_id gnl|my_center|LOCUS_12530 3226 2675 gene locus_tag LOCUS_12540 3226 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3536 4330 gene locus_tag LOCUS_12550 3536 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence237 <1 1094 gene locus_tag LOCUS_12560 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021204.1:glycosyltransferase family 4 protein 1091 2320 gene locus_tag LOCUS_12570 1091 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2952 2356 gene locus_tag LOCUS_12580 2952 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4133 2949 gene locus_tag LOCUS_12590 4133 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence238 78 926 gene locus_tag LOCUS_12600 78 926 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_12600 978 1142 gene locus_tag LOCUS_12610 978 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1147 2154 gene locus_tag LOCUS_12620 1147 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2211 3329 gene locus_tag LOCUS_12630 2211 3329 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_12630 3329 3730 gene locus_tag LOCUS_12640 3329 3730 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence239 2 547 gene locus_tag LOCUS_12650 2 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1578 577 gene locus_tag LOCUS_12660 1578 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1829 2326 gene locus_tag LOCUS_12670 1829 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2385 3191 gene locus_tag LOCUS_12680 2385 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence240 <1 962 gene locus_tag LOCUS_12690 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229661.1:carboxyl transferase domain-containing protein 968 1771 gene locus_tag LOCUS_12700 968 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12700 1787 2968 gene locus_tag LOCUS_12710 1787 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12710 2971 4110 gene locus_tag LOCUS_12720 2971 4110 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896109.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence241 2 436 gene locus_tag LOCUS_12730 2 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 388 744 gene locus_tag LOCUS_12740 388 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 2186 795 gene locus_tag LOCUS_12750 2186 795 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 protein_id gnl|my_center|LOCUS_12750 3191 2193 gene locus_tag LOCUS_12760 3191 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 <4418 3188 gene locus_tag LOCUS_12770 <4418 3188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185221.1:oxidoreductase >Feature sequence242 1491 3740 gene locus_tag LOCUS_12780 gene lon 1491 3740 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729178.1 protein_id gnl|my_center|LOCUS_12780 3913 4407 gene locus_tag LOCUS_12790 3913 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence243 45 812 gene locus_tag LOCUS_12800 45 812 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_12800 925 1764 gene locus_tag LOCUS_12810 925 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1789 2775 gene locus_tag LOCUS_12820 1789 2775 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_12820 2971 3324 gene locus_tag LOCUS_12830 2971 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 3351 4373 gene locus_tag LOCUS_12840 3351 4373 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence244 985 50 gene locus_tag LOCUS_12850 985 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1734 1270 gene locus_tag LOCUS_12860 1734 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2024 1737 gene locus_tag LOCUS_12870 2024 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 2485 2021 gene locus_tag LOCUS_12880 2485 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 3364 2864 gene locus_tag LOCUS_12890 3364 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 3260 3475 gene locus_tag LOCUS_12900 3260 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence245 1020 751 gene locus_tag LOCUS_12910 1020 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1249 1088 gene locus_tag LOCUS_12920 1249 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1461 1273 gene locus_tag LOCUS_12930 1461 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 2265 1615 gene locus_tag LOCUS_12940 2265 1615 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230338.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence246 1054 458 gene locus_tag LOCUS_12950 1054 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1383 1051 gene locus_tag LOCUS_12960 1383 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 2102 1500 gene locus_tag LOCUS_12970 2102 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2382 2191 gene locus_tag LOCUS_12980 2382 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2891 2523 gene locus_tag LOCUS_12990 2891 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 3287 3084 gene locus_tag LOCUS_13000 3287 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3571 3422 gene locus_tag LOCUS_13010 3571 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence247 <1 1210 gene locus_tag LOCUS_13020 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030467.1:vitamin B12-dependent ribonucleotide reductase 2130 1417 gene locus_tag LOCUS_13030 2130 1417 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067924.1 protein_id gnl|my_center|LOCUS_13030 2777 2121 gene locus_tag LOCUS_13040 2777 2121 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_13040 4252 2765 gene locus_tag LOCUS_13050 4252 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence248 <1 2558 gene locus_tag LOCUS_13060 <1 2558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109508967.1:ATP-dependent helicase 2589 3857 gene locus_tag LOCUS_13070 2589 3857 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213919.1 protein_id gnl|my_center|LOCUS_13070 3883 4320 gene locus_tag LOCUS_13080 3883 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence249 3 1373 gene locus_tag LOCUS_13090 3 1373 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_13090 1373 2605 gene locus_tag LOCUS_13100 1373 2605 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_13100 2796 4034 gene locus_tag LOCUS_13110 2796 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence250 1157 12 gene locus_tag LOCUS_13120 1157 12 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222922.1 protein_id gnl|my_center|LOCUS_13120 1141 2337 gene locus_tag LOCUS_13130 1141 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 3434 2307 gene locus_tag LOCUS_13140 3434 2307 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222919.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence251 313 104 gene locus_tag LOCUS_13150 313 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 872 339 gene locus_tag LOCUS_13160 872 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1403 1092 gene locus_tag LOCUS_13170 1403 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 3033 1588 gene locus_tag LOCUS_13180 3033 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 4205 3030 gene locus_tag LOCUS_13190 4205 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence252 598 248 gene locus_tag LOCUS_13200 598 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2090 942 gene locus_tag LOCUS_13210 2090 942 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228338.1 protein_id gnl|my_center|LOCUS_13210 2255 3865 gene locus_tag LOCUS_13220 2255 3865 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_13220 3920 4276 gene locus_tag LOCUS_13230 3920 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence253 347 132 gene locus_tag LOCUS_13240 347 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1459 347 gene locus_tag LOCUS_13250 1459 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2018 1788 gene locus_tag LOCUS_13260 2018 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2197 2015 gene locus_tag LOCUS_13270 2197 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2832 2230 gene locus_tag LOCUS_13280 2832 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 3220 2816 gene locus_tag LOCUS_13290 3220 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence254 349 1602 gene locus_tag LOCUS_13300 349 1602 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028461.1 protein_id gnl|my_center|LOCUS_13300 1656 3080 gene locus_tag LOCUS_13310 gene proS 1656 3080 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 protein_id gnl|my_center|LOCUS_13310 3241 3849 gene locus_tag LOCUS_13320 3241 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence255 227 1747 gene locus_tag LOCUS_13330 227 1747 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080866.1 protein_id gnl|my_center|LOCUS_13330 1744 2334 gene locus_tag LOCUS_13340 1744 2334 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_13340 2331 3434 gene locus_tag LOCUS_13350 2331 3434 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942506.1 protein_id gnl|my_center|LOCUS_13350 3431 4177 gene locus_tag LOCUS_13360 3431 4177 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546413.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence256 478 487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1696 2136 gene locus_tag LOCUS_13370 1696 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 3134 2154 gene locus_tag LOCUS_13380 3134 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 3190 3468 gene locus_tag LOCUS_13390 3190 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 <4335 3546 gene locus_tag LOCUS_13400 <4335 3546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889226.1:acetate kinase >Feature sequence257 517 1182 gene locus_tag LOCUS_13410 gene pgl 517 1182 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838435.1 protein_id gnl|my_center|LOCUS_13410 1185 2225 gene locus_tag LOCUS_13420 1185 2225 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_13420 2222 4243 gene locus_tag LOCUS_13430 2222 4243 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence258 999 394 gene locus_tag LOCUS_13440 999 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1204 1773 gene locus_tag LOCUS_13450 gene pyrR 1204 1773 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172875.1 protein_id gnl|my_center|LOCUS_13450 1770 2891 gene locus_tag LOCUS_13460 1770 2891 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_13460 2902 4179 gene locus_tag LOCUS_13470 2902 4179 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805076.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence259 1632 319 gene locus_tag LOCUS_13480 1632 319 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926605.1 protein_id gnl|my_center|LOCUS_13480 4044 1741 gene locus_tag LOCUS_13490 4044 1741 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence260 412 2358 gene locus_tag LOCUS_13500 412 2358 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728654.1 protein_id gnl|my_center|LOCUS_13500 2366 3586 gene locus_tag LOCUS_13510 2366 3586 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728241.1 protein_id gnl|my_center|LOCUS_13510 3583 4227 gene locus_tag LOCUS_13520 3583 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence261 1889 798 gene locus_tag LOCUS_13530 1889 798 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_13530 2659 1886 gene locus_tag LOCUS_13540 2659 1886 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_13540 3138 2731 gene locus_tag LOCUS_13550 gene rplT 3138 2731 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559056.1 protein_id gnl|my_center|LOCUS_13550 3401 3207 gene locus_tag LOCUS_13560 gene rpmI 3401 3207 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_13560 4017 3454 gene locus_tag LOCUS_13570 4017 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13570 >Feature sequence262 <1 1554 gene locus_tag LOCUS_13580 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005082328.1:MFS transporter 2419 1634 gene locus_tag LOCUS_13590 2419 1634 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283913.1 protein_id gnl|my_center|LOCUS_13590 3110 2424 gene locus_tag LOCUS_13600 3110 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 3205 3864 gene locus_tag LOCUS_13610 3205 3864 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014086.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence263 >Feature sequence264 1424 582 gene locus_tag LOCUS_13620 1424 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1562 2011 gene locus_tag LOCUS_13630 1562 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1996 3360 gene locus_tag LOCUS_13640 1996 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence265 1193 666 gene locus_tag LOCUS_13650 1193 666 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_13650 1254 2090 gene locus_tag LOCUS_13660 1254 2090 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226659.1 protein_id gnl|my_center|LOCUS_13660 2259 2849 gene locus_tag LOCUS_13670 2259 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2919 3374 gene locus_tag LOCUS_13680 2919 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 <4295 3607 gene locus_tag LOCUS_13690 <4295 3607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003417929.1:3-hydroxyacyl-thioester dehydratase HtdY >Feature sequence266 180 653 gene locus_tag LOCUS_13700 180 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1493 681 gene locus_tag LOCUS_13710 1493 681 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804288.1 protein_id gnl|my_center|LOCUS_13710 2044 1490 gene locus_tag LOCUS_13720 gene mug 2044 1490 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_13720 2167 3393 gene locus_tag LOCUS_13730 2167 3393 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_13730 <4293 3407 gene locus_tag LOCUS_13740 <4293 3407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222886.1:hydroxymethylglutaryl-CoA lyase >Feature sequence267 2944 1535 gene locus_tag LOCUS_13750 2944 1535 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence268 <1 514 gene locus_tag LOCUS_13760 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943893.1:bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase 502 1764 gene locus_tag LOCUS_13770 gene hemA 502 1764 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_13770 1773 2690 gene locus_tag LOCUS_13780 gene hemC 1773 2690 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208189.1 protein_id gnl|my_center|LOCUS_13780 2687 4171 gene locus_tag LOCUS_13790 gene cobA 2687 4171 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence269 1902 901 gene locus_tag LOCUS_13800 1902 901 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_13800 1965 2579 gene locus_tag LOCUS_13810 1965 2579 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615057.1 protein_id gnl|my_center|LOCUS_13810 2623 3399 gene locus_tag LOCUS_13820 2623 3399 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225350.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence270 243 1559 gene locus_tag LOCUS_13830 243 1559 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267877.1 protein_id gnl|my_center|LOCUS_13830 1556 1864 gene locus_tag LOCUS_13840 1556 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401137.1 protein_id gnl|my_center|LOCUS_13840 1861 2895 gene locus_tag LOCUS_13850 1861 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 2892 3833 gene locus_tag LOCUS_13860 2892 3833 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040692.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence271 1380 244 gene locus_tag LOCUS_13870 1380 244 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876725.1 protein_id gnl|my_center|LOCUS_13870 2525 1377 gene locus_tag LOCUS_13880 2525 1377 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_13880 3281 2526 gene locus_tag LOCUS_13890 3281 2526 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_13890 <4234 3341 gene locus_tag LOCUS_13900 <4234 3341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720512.1:ABC transporter permease subunit >Feature sequence272 <1 1062 gene locus_tag LOCUS_13910 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027451.1:cyclic Di-GMP phosphodiesterase RmdA 1432 1046 gene locus_tag LOCUS_13920 1432 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1727 2851 gene locus_tag LOCUS_13930 1727 2851 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141066.1 protein_id gnl|my_center|LOCUS_13930 2927 3883 gene locus_tag LOCUS_13940 2927 3883 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence273 853 59 gene locus_tag LOCUS_13950 853 59 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062378.1 protein_id gnl|my_center|LOCUS_13950 1036 1989 gene locus_tag LOCUS_13960 1036 1989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229683.1 protein_id gnl|my_center|LOCUS_13960 1986 2771 gene locus_tag LOCUS_13970 1986 2771 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229684.1 protein_id gnl|my_center|LOCUS_13970 3858 2854 gene locus_tag LOCUS_13980 gene selD 3858 2854 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence274 606 193 gene locus_tag LOCUS_13990 606 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1182 667 gene locus_tag LOCUS_14000 1182 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1485 1198 gene locus_tag LOCUS_14010 1485 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1744 2700 gene locus_tag LOCUS_14020 1744 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3151 2810 gene locus_tag LOCUS_14030 3151 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 3036 4106 gene locus_tag LOCUS_14040 3036 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence275 2522 1812 gene locus_tag LOCUS_14050 2522 1812 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_14050 3047 2778 gene locus_tag LOCUS_14060 3047 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3440 3192 gene locus_tag LOCUS_14070 3440 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence276 1509 382 gene locus_tag LOCUS_14080 1509 382 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877839.1 protein_id gnl|my_center|LOCUS_14080 2175 2381 gene locus_tag LOCUS_14090 2175 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2509 2691 gene locus_tag LOCUS_14100 2509 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3584 2688 gene locus_tag LOCUS_14110 3584 2688 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235433858.1 protein_id gnl|my_center|LOCUS_14110 3649 4074 gene locus_tag LOCUS_14120 3649 4074 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086620.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence277 882 1661 gene locus_tag LOCUS_14130 882 1661 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972217.1 protein_id gnl|my_center|LOCUS_14130 1689 2471 gene locus_tag LOCUS_14140 1689 2471 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 protein_id gnl|my_center|LOCUS_14140 <4183 2546 gene locus_tag LOCUS_14150 <4183 2546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026926.1:pyruvate, phosphate dikinase >Feature sequence278 <1 614 gene locus_tag LOCUS_14160 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085734.1:crotonase/enoyl-CoA hydratase family protein 618 1391 gene locus_tag LOCUS_14170 618 1391 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_14170 2440 1439 gene locus_tag LOCUS_14180 2440 1439 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726805.1 protein_id gnl|my_center|LOCUS_14180 2644 3045 gene locus_tag LOCUS_14190 2644 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3092 4012 gene locus_tag LOCUS_14200 3092 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence279 576 22 gene locus_tag LOCUS_14210 576 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1793 579 gene locus_tag LOCUS_14220 1793 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2764 1865 gene locus_tag LOCUS_14230 2764 1865 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_14230 <4173 2761 gene locus_tag LOCUS_14240 <4173 2761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000414123.1:3-oxoacid CoA-transferase >Feature sequence280 25 552 gene locus_tag LOCUS_14250 25 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 458 862 gene locus_tag LOCUS_14260 458 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 849 1370 gene locus_tag LOCUS_14270 849 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1313 1612 gene locus_tag LOCUS_14280 1313 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1802 2143 gene locus_tag LOCUS_14290 1802 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 2764 3605 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcagcggctgaggacgtcctcggccgtgggttgaaac 3658 3879 gene locus_tag LOCUS_14300 3658 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence281 2 352 gene locus_tag LOCUS_14310 2 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 2890 392 gene locus_tag LOCUS_14320 2890 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 3969 3022 gene locus_tag LOCUS_14330 3969 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence282 1678 677 gene locus_tag LOCUS_14340 1678 677 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845576.1 protein_id gnl|my_center|LOCUS_14340 <4158 1807 gene locus_tag LOCUS_14350 <4158 1807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259235.1:S8 family peptidase >Feature sequence283 1631 1170 gene locus_tag LOCUS_14360 1631 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228771.1 protein_id gnl|my_center|LOCUS_14360 1976 2365 gene locus_tag LOCUS_14370 1976 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 2709 2509 gene locus_tag LOCUS_14380 2709 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2765 3109 gene locus_tag LOCUS_14390 2765 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 <4140 3455 gene locus_tag LOCUS_14400 <4140 3455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005092227.1:SDR family oxidoreductase >Feature sequence284 661 2049 gene locus_tag LOCUS_14410 661 2049 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_14410 2299 2838 gene locus_tag LOCUS_14420 2299 2838 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208128.1 protein_id gnl|my_center|LOCUS_14420 3213 3599 gene locus_tag LOCUS_14430 3213 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence285 2553 1498 gene locus_tag LOCUS_14440 gene dmpG 2553 1498 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112330.1 protein_id gnl|my_center|LOCUS_14440 3512 2550 gene locus_tag LOCUS_14450 3512 2550 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098525.1 protein_id gnl|my_center|LOCUS_14450 <4136 3512 gene locus_tag LOCUS_14460 <4136 3512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000160712.1:2-keto-4-pentenoate hydratase >Feature sequence286 1347 385 gene locus_tag LOCUS_14470 1347 385 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098525.1 protein_id gnl|my_center|LOCUS_14470 2205 1351 gene locus_tag LOCUS_14480 gene mhpD 2205 1351 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160712.1 protein_id gnl|my_center|LOCUS_14480 2652 2918 gene locus_tag LOCUS_14490 2652 2918 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_14490 2954 3259 gene locus_tag LOCUS_14500 2954 3259 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_14500 3334 3681 gene locus_tag LOCUS_14510 3334 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence287 1784 465 gene locus_tag LOCUS_14520 gene galA 1784 465 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080136.1 protein_id gnl|my_center|LOCUS_14520 1953 3107 gene locus_tag LOCUS_14530 1953 3107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_14530 3841 3644 gene locus_tag LOCUS_14540 3841 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence288 979 722 gene locus_tag LOCUS_14550 979 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1287 976 gene locus_tag LOCUS_14560 1287 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1790 1302 gene locus_tag LOCUS_14570 1790 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2586 2885 gene locus_tag LOCUS_14580 2586 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2896 3414 gene locus_tag LOCUS_14590 2896 3414 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_14590 3723 3370 gene locus_tag LOCUS_14600 3723 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence289 57 386 gene locus_tag LOCUS_14610 gene rplU 57 386 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 protein_id gnl|my_center|LOCUS_14610 389 643 gene locus_tag LOCUS_14620 gene rpmA 389 643 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859304.1 protein_id gnl|my_center|LOCUS_14620 670 1917 gene locus_tag LOCUS_14630 gene obgE 670 1917 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_14630 1953 3050 gene locus_tag LOCUS_14640 gene proB 1953 3050 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285288.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence290 326 2215 gene locus_tag LOCUS_14650 gene acnB 326 2215 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087875.1 protein_id gnl|my_center|LOCUS_14650 2739 3107 gene locus_tag LOCUS_14660 2739 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083563.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence291 279 288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1354 317 gene locus_tag LOCUS_14670 1354 317 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 protein_id gnl|my_center|LOCUS_14670 1311 1574 gene locus_tag LOCUS_14680 1311 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2467 1748 gene locus_tag LOCUS_14690 2467 1748 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223789.1 protein_id gnl|my_center|LOCUS_14690 <4095 2464 gene locus_tag LOCUS_14700 <4095 2464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257930.1:ATP-binding protein >Feature sequence292 <1 1023 gene locus_tag LOCUS_14710 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083425.1:EAL domain-containing protein 1648 1097 gene locus_tag LOCUS_14720 1648 1097 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804317.1 protein_id gnl|my_center|LOCUS_14720 1834 2028 gene locus_tag LOCUS_14730 1834 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2509 2057 gene locus_tag LOCUS_14740 2509 2057 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920478.1 protein_id gnl|my_center|LOCUS_14740 2628 3539 gene locus_tag LOCUS_14750 2628 3539 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence293 <1 532 gene locus_tag LOCUS_14760 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368641.1:ParA family partition ATPase 529 831 gene locus_tag LOCUS_14770 529 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 890 2104 gene locus_tag LOCUS_14780 890 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 3165 3821 gene locus_tag LOCUS_14790 3165 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence294 3236 3066 gene locus_tag LOCUS_14800 3236 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 3174 3620 gene locus_tag LOCUS_14810 3174 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 3617 3871 gene locus_tag LOCUS_14820 3617 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence295 779 75 gene locus_tag LOCUS_14830 779 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 2069 864 gene locus_tag LOCUS_14840 2069 864 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074275.1 protein_id gnl|my_center|LOCUS_14840 2158 2910 gene locus_tag LOCUS_14850 2158 2910 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971473.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence296 540 728 gene locus_tag LOCUS_14860 540 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1543 773 gene locus_tag LOCUS_14870 1543 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1931 2653 gene locus_tag LOCUS_14880 1931 2653 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074041.1 protein_id gnl|my_center|LOCUS_14880 2650 3969 gene locus_tag LOCUS_14890 2650 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence297 400 1533 gene locus_tag LOCUS_14900 400 1533 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_14900 1536 3653 gene locus_tag LOCUS_14910 1536 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence298 868 296 gene locus_tag LOCUS_14920 868 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 753 2363 gene locus_tag LOCUS_14930 753 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 2461 3003 gene locus_tag LOCUS_14940 2461 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence299 2143 1202 gene locus_tag LOCUS_14950 2143 1202 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222418.1 protein_id gnl|my_center|LOCUS_14950 3236 2151 gene locus_tag LOCUS_14960 3236 2151 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_14960 3936 3253 gene locus_tag LOCUS_14970 3936 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence300 <1 2248 gene locus_tag LOCUS_14980 <1 2248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459454.1:tripartite tricarboxylate transporter permease 2267 3739 gene locus_tag LOCUS_14990 2267 3739 CDS product LM6179_1298 family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732434.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence301 2895 925 gene locus_tag LOCUS_15000 2895 925 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_15000 3749 2955 gene locus_tag LOCUS_15010 3749 2955 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence302 1654 731 gene locus_tag LOCUS_15020 1654 731 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082256.1 protein_id gnl|my_center|LOCUS_15020 898 907 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2970 1693 gene locus_tag LOCUS_15030 2970 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 <4030 3237 gene locus_tag LOCUS_15040 <4030 3237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090620.1:amidase >Feature sequence303 929 2131 gene locus_tag LOCUS_15050 929 2131 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_15050 2521 2147 gene locus_tag LOCUS_15060 2521 2147 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866702.1 protein_id gnl|my_center|LOCUS_15060 2614 3489 gene locus_tag LOCUS_15070 2614 3489 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971512.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence304 3071 522 gene locus_tag LOCUS_15080 3071 522 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_15080 3541 3119 gene locus_tag LOCUS_15090 3541 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence305 413 3 gene locus_tag LOCUS_15100 413 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1417 410 gene locus_tag LOCUS_15110 gene porB 1417 410 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_15110 2595 1426 gene locus_tag LOCUS_15120 gene porA 2595 1426 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_15120 3169 2588 gene locus_tag LOCUS_15130 3169 2588 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_15130 3951 3313 gene locus_tag LOCUS_15140 3951 3313 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228697.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence306 1313 2914 gene locus_tag LOCUS_15150 1313 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2960 3613 gene locus_tag LOCUS_15160 2960 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence307 18 1814 gene locus_tag LOCUS_15170 18 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 3084 1912 gene locus_tag LOCUS_15180 3084 1912 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228930.1 protein_id gnl|my_center|LOCUS_15180 3969 3202 gene locus_tag LOCUS_15190 3969 3202 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895059.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence308 1140 361 gene locus_tag LOCUS_15200 1140 361 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_15200 1910 1326 gene locus_tag LOCUS_15210 1910 1326 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031516.1 protein_id gnl|my_center|LOCUS_15210 2033 2272 gene locus_tag LOCUS_15220 2033 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 2999 2346 gene locus_tag LOCUS_15230 2999 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence309 705 1589 gene locus_tag LOCUS_15240 705 1589 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_15240 1573 2565 gene locus_tag LOCUS_15250 1573 2565 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064389.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15250 >Feature sequence310 863 1747 gene locus_tag LOCUS_15260 863 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3052 1796 gene locus_tag LOCUS_15270 3052 1796 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence311 <1 504 gene locus_tag LOCUS_15280 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113893.1:MFS transporter 2046 568 gene locus_tag LOCUS_15290 2046 568 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975611.1 protein_id gnl|my_center|LOCUS_15290 2165 2746 gene locus_tag LOCUS_15300 2165 2746 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400591.1 protein_id gnl|my_center|LOCUS_15300 2835 3644 gene locus_tag LOCUS_15310 2835 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 4002 3697 gene locus_tag LOCUS_15320 4002 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence312 2674 1982 gene locus_tag LOCUS_15330 2674 1982 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729897.1 protein_id gnl|my_center|LOCUS_15330 3017 2790 gene locus_tag LOCUS_15340 3017 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3443 3207 gene locus_tag LOCUS_15350 3443 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 <3994 3436 gene locus_tag LOCUS_15360 <3994 3436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001097733.1:group II intron reverse transcriptase/maturase >Feature sequence313 331 59 gene locus_tag LOCUS_15370 331 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 802 1107 gene locus_tag LOCUS_15380 802 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1280 1981 gene locus_tag LOCUS_15390 1280 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1978 3522 gene locus_tag LOCUS_15400 1978 3522 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_15400 3988 3782 gene locus_tag LOCUS_15410 3988 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence314 1505 426 gene locus_tag LOCUS_15420 1505 426 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028341.1 protein_id gnl|my_center|LOCUS_15420 2662 1502 gene locus_tag LOCUS_15430 2662 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3657 2659 gene locus_tag LOCUS_15440 3657 2659 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418967.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence315 529 1800 gene locus_tag LOCUS_15450 529 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1964 2815 gene locus_tag LOCUS_15460 1964 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence316 2215 1547 gene locus_tag LOCUS_15470 2215 1547 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228182.1 protein_id gnl|my_center|LOCUS_15470 2346 3779 gene locus_tag LOCUS_15480 2346 3779 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228923.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence317 <1 562 gene locus_tag LOCUS_15490 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407466.1:heme A synthase 559 870 gene locus_tag LOCUS_15500 gene clpS 559 870 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229464.1 protein_id gnl|my_center|LOCUS_15500 843 1343 gene locus_tag LOCUS_15510 843 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1348 1758 gene locus_tag LOCUS_15520 1348 1758 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_15520 1765 2655 gene locus_tag LOCUS_15530 1765 2655 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_15530 2652 3914 gene locus_tag LOCUS_15540 2652 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence318 3608 2625 gene locus_tag LOCUS_15550 3608 2625 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729074.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence319 1298 864 gene locus_tag LOCUS_15560 1298 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2483 1530 gene locus_tag LOCUS_15570 2483 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2846 2505 gene locus_tag LOCUS_15580 2846 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 2963 3325 gene locus_tag LOCUS_15590 2963 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 <3958 3349 gene locus_tag LOCUS_15600 <3958 3349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087559.1:zinc-binding dehydrogenase >Feature sequence320 1096 275 gene locus_tag LOCUS_15610 1096 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1258 2016 gene locus_tag LOCUS_15620 gene nthB 1258 2016 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087268.1 protein_id gnl|my_center|LOCUS_15620 2006 2641 gene locus_tag LOCUS_15630 gene nthA 2006 2641 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174055.1 protein_id gnl|my_center|LOCUS_15630 2691 3011 gene locus_tag LOCUS_15640 2691 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 3101 3820 gene locus_tag LOCUS_15650 3101 3820 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223869.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence321 <1 1413 gene locus_tag LOCUS_15660 <1 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227294.1:cytochrome ubiquinol oxidase subunit I 1457 2590 gene locus_tag LOCUS_15670 gene cydB 1457 2590 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence322 1281 2519 gene locus_tag LOCUS_15680 gene fabF 1281 2519 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057708.1 protein_id gnl|my_center|LOCUS_15680 3039 2497 gene locus_tag LOCUS_15690 3039 2497 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225758.1 protein_id gnl|my_center|LOCUS_15690 3467 3036 gene locus_tag LOCUS_15700 gene fabZ 3467 3036 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391761.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence323 1828 476 gene locus_tag LOCUS_15710 1828 476 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_15710 2474 2097 gene locus_tag LOCUS_15720 2474 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2986 3144 gene locus_tag LOCUS_15730 2986 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence324 2086 236 gene locus_tag LOCUS_15740 2086 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3851 2256 gene locus_tag LOCUS_15750 3851 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence325 915 193 gene locus_tag LOCUS_15760 915 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1691 912 gene locus_tag LOCUS_15770 1691 912 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_15770 3725 1755 gene locus_tag LOCUS_15780 3725 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence326 3759 1747 gene locus_tag LOCUS_15790 3759 1747 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence327 359 985 gene locus_tag LOCUS_15800 gene rpsD 359 985 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_15800 996 1937 gene locus_tag LOCUS_15810 996 1937 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_15810 1940 2320 gene locus_tag LOCUS_15820 1940 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2373 3161 gene locus_tag LOCUS_15830 gene truA 2373 3161 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_15830 <3926 3154 gene locus_tag LOCUS_15840 <3926 3154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_070936216.1:threonine ammonia-lyase >Feature sequence328 <1 1769 gene locus_tag LOCUS_15850 <1 1769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338317.1:primosomal protein N' 1815 2306 gene locus_tag LOCUS_15860 gene queF 1815 2306 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187118.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence329 <1 1502 gene locus_tag LOCUS_15870 <1 1502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257128.1:thioredoxin domain-containing protein 1515 2177 gene locus_tag LOCUS_15880 1515 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3036 2365 gene locus_tag LOCUS_15890 3036 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 <3924 3116 gene locus_tag LOCUS_15900 <3924 3116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004137938.1:DNA polymerase III subunit alpha >Feature sequence330 931 188 gene locus_tag LOCUS_15910 931 188 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061144.1 protein_id gnl|my_center|LOCUS_15910 2775 928 gene locus_tag LOCUS_15920 gene cysC 2775 928 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224712.1 protein_id gnl|my_center|LOCUS_15920 3686 2775 gene locus_tag LOCUS_15930 gene cysD 3686 2775 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466878.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence331 3206 2388 gene locus_tag LOCUS_15940 3206 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 <3910 3274 gene locus_tag LOCUS_15950 <3910 3274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225958334.1:excinuclease ABC subunit UvrB >Feature sequence332 1154 807 gene locus_tag LOCUS_15960 1154 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1811 1314 gene locus_tag LOCUS_15970 1811 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3607 1808 gene locus_tag LOCUS_15980 3607 1808 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence333 25 1398 gene locus_tag LOCUS_15990 25 1398 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903979.1 protein_id gnl|my_center|LOCUS_15990 2604 1702 gene locus_tag LOCUS_16000 2604 1702 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414409.1 protein_id gnl|my_center|LOCUS_16000 3497 2604 gene locus_tag LOCUS_16010 3497 2604 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414414.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence334 277 1566 gene locus_tag LOCUS_16020 277 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2048 2713 gene locus_tag LOCUS_16030 2048 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence335 1250 2611 gene locus_tag LOCUS_16040 1250 2611 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816824.1 protein_id gnl|my_center|LOCUS_16040 2589 3032 gene locus_tag LOCUS_16050 2589 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence336 1083 883 gene locus_tag LOCUS_16060 1083 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 3832 1157 gene locus_tag LOCUS_16070 gene aceE 3832 1157 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908453.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence337 1353 499 gene locus_tag LOCUS_16080 1353 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1635 3467 gene locus_tag LOCUS_16090 1635 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence338 1822 302 gene locus_tag LOCUS_16100 gene glpK 1822 302 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence339 <1 875 gene locus_tag LOCUS_16110 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940879.1:radical SAM protein 928 1644 gene locus_tag LOCUS_16120 928 1644 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228766.1 protein_id gnl|my_center|LOCUS_16120 2600 1629 gene locus_tag LOCUS_16130 2600 1629 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 protein_id gnl|my_center|LOCUS_16130 3531 2680 gene locus_tag LOCUS_16140 3531 2680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118099.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence340 1607 1251 gene locus_tag LOCUS_16150 1607 1251 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250172.1 protein_id gnl|my_center|LOCUS_16150 2359 1604 gene locus_tag LOCUS_16160 2359 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2612 2373 gene locus_tag LOCUS_16170 2612 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2953 2609 gene locus_tag LOCUS_16180 2953 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3207 2956 gene locus_tag LOCUS_16190 3207 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 3821 3204 gene locus_tag LOCUS_16200 3821 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence341 <1 886 gene locus_tag LOCUS_16210 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400917.1:acyl-CoA dehydrogenase family protein 1325 912 gene locus_tag LOCUS_16220 1325 912 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467030.1 protein_id gnl|my_center|LOCUS_16220 2371 1325 gene locus_tag LOCUS_16230 2371 1325 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_16230 2874 2653 gene locus_tag LOCUS_16240 2874 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 <3870 2871 gene locus_tag LOCUS_16250 <3870 2871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296290.1:amidohydrolase family protein >Feature sequence342 22 741 gene locus_tag LOCUS_16260 22 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1349 825 gene locus_tag LOCUS_16270 1349 825 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065297.1 protein_id gnl|my_center|LOCUS_16270 1628 2959 gene locus_tag LOCUS_16280 1628 2959 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_16280 2989 3549 gene locus_tag LOCUS_16290 2989 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence343 412 1689 gene locus_tag LOCUS_16300 412 1689 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_16300 2974 1703 gene locus_tag LOCUS_16310 gene hemL 2974 1703 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222429.1 protein_id gnl|my_center|LOCUS_16310 <3862 2967 gene locus_tag LOCUS_16320 <3862 2967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727312.1:porphobilinogen synthase >Feature sequence344 <1 607 gene locus_tag LOCUS_16330 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941118.1:response regulator transcription factor 664 1317 gene locus_tag LOCUS_16340 664 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1391 2383 gene locus_tag LOCUS_16350 1391 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2736 2951 gene locus_tag LOCUS_16360 2736 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 3275 3487 gene locus_tag LOCUS_16370 3275 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence345 <1 2676 gene locus_tag LOCUS_16380 <1 2676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169337322.1:IPT/TIG domain-containing protein >Feature sequence346 559 11 gene locus_tag LOCUS_16390 559 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1104 565 gene locus_tag LOCUS_16400 1104 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1598 1104 gene locus_tag LOCUS_16410 1598 1104 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257683.1 protein_id gnl|my_center|LOCUS_16410 2764 1598 gene locus_tag LOCUS_16420 2764 1598 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257682.1 protein_id gnl|my_center|LOCUS_16420 3229 2897 gene locus_tag LOCUS_16430 3229 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 3654 3226 gene locus_tag LOCUS_16440 3654 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence347 436 74 gene locus_tag LOCUS_16450 436 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2547 433 gene locus_tag LOCUS_16460 2547 433 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967414.1 protein_id gnl|my_center|LOCUS_16460 3283 2816 gene locus_tag LOCUS_16470 3283 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16470 3732 3451 gene locus_tag LOCUS_16480 3732 3451 CDS product DUF5372 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086024521.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence348 2787 16 gene locus_tag LOCUS_16490 gene mobF 2787 16 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296243.1 protein_id gnl|my_center|LOCUS_16490 3464 2787 gene locus_tag LOCUS_16500 3464 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence349 225 1487 gene locus_tag LOCUS_16510 225 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1725 1880 gene locus_tag LOCUS_16520 1725 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2781 3299 gene locus_tag LOCUS_16530 2781 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 3330 3638 gene locus_tag LOCUS_16540 3330 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence350 1244 1020 gene locus_tag LOCUS_16550 1244 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1198 1704 gene locus_tag LOCUS_16560 1198 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1781 2335 gene locus_tag LOCUS_16570 1781 2335 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316410.1 protein_id gnl|my_center|LOCUS_16570 2332 3012 gene locus_tag LOCUS_16580 2332 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 <3846 3123 gene locus_tag LOCUS_16590 <3846 3123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940822.1:type IV pilus twitching motility protein PilT >Feature sequence351 1979 225 gene locus_tag LOCUS_16600 1979 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028289.1 protein_id gnl|my_center|LOCUS_16600 2061 2813 gene locus_tag LOCUS_16610 2061 2813 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_16610 3556 2810 gene locus_tag LOCUS_16620 3556 2810 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892101.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence352 121 420 gene locus_tag LOCUS_16630 121 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 577 1071 gene locus_tag LOCUS_16640 577 1071 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967412.1 protein_id gnl|my_center|LOCUS_16640 1064 1408 gene locus_tag LOCUS_16650 1064 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1426 3489 gene locus_tag LOCUS_16660 1426 3489 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967414.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence353 826 20 gene locus_tag LOCUS_16670 826 20 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_16670 2116 1034 gene locus_tag LOCUS_16680 2116 1034 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 protein_id gnl|my_center|LOCUS_16680 3798 2509 gene locus_tag LOCUS_16690 3798 2509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence354 92 994 gene locus_tag LOCUS_16700 gene rmd 92 994 CDS product GDP-6-deoxy-D-mannose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114107.1 protein_id gnl|my_center|LOCUS_16700 1558 1070 gene locus_tag LOCUS_16710 1558 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence355 552 175 gene locus_tag LOCUS_16720 552 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 674 1351 gene locus_tag LOCUS_16730 674 1351 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028987.1 protein_id gnl|my_center|LOCUS_16730 3037 1355 gene locus_tag LOCUS_16740 3037 1355 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929967.1 protein_id gnl|my_center|LOCUS_16740 3190 3624 gene locus_tag LOCUS_16750 3190 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence356 353 147 gene locus_tag LOCUS_16760 353 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1243 350 gene locus_tag LOCUS_16770 1243 350 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933138.1 protein_id gnl|my_center|LOCUS_16770 1808 1353 gene locus_tag LOCUS_16780 1808 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3267 1981 gene locus_tag LOCUS_16790 3267 1981 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence357 495 1760 gene locus_tag LOCUS_16800 495 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 3143 2019 gene locus_tag LOCUS_16810 3143 2019 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191120.1 protein_id gnl|my_center|LOCUS_16810 3341 3649 gene locus_tag LOCUS_16820 3341 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence358 537 809 gene locus_tag LOCUS_16830 537 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1052 1822 gene locus_tag LOCUS_16840 1052 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1845 2015 gene locus_tag LOCUS_16850 1845 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2158 3111 gene locus_tag LOCUS_16860 2158 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 3472 3714 gene locus_tag LOCUS_16870 3472 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence359 2 229 gene locus_tag LOCUS_16880 2 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 226 1605 gene locus_tag LOCUS_16890 226 1605 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_16890 1613 2134 gene locus_tag LOCUS_16900 1613 2134 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_16900 2154 2807 gene locus_tag LOCUS_16910 gene msrA 2154 2807 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_16910 3645 2830 gene locus_tag LOCUS_16920 3645 2830 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence360 910 20 gene locus_tag LOCUS_16930 910 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1569 907 gene locus_tag LOCUS_16940 1569 907 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_16940 2260 1571 gene locus_tag LOCUS_16950 2260 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2374 2532 gene locus_tag LOCUS_16960 2374 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence361 1568 2020 gene locus_tag LOCUS_16970 1568 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence362 48 248 gene locus_tag LOCUS_16980 48 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 985 900 gene locus_tag LOCUS_t00170 985 900 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1072 1839 gene locus_tag LOCUS_16990 1072 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2901 1915 gene locus_tag LOCUS_17000 gene pheA 2901 1915 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence363 <1 1491 gene locus_tag LOCUS_17010 <1 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035214669.1:efflux RND transporter periplasmic adaptor subunit 1385 2344 gene locus_tag LOCUS_17020 1385 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2341 3570 gene locus_tag LOCUS_17030 2341 3570 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence364 215 48 gene locus_tag LOCUS_17040 215 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 893 255 gene locus_tag LOCUS_17050 893 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2328 901 gene locus_tag LOCUS_17060 gene ahcY 2328 901 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_17060 2477 3187 gene locus_tag LOCUS_17070 2477 3187 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_17070 <3762 3213 gene locus_tag LOCUS_17080 <3762 3213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090523.1:acyl-CoA dehydrogenase >Feature sequence365 141 1703 gene locus_tag LOCUS_17090 141 1703 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 protein_id gnl|my_center|LOCUS_17090 1854 2285 gene locus_tag LOCUS_17100 1854 2285 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_17100 3212 2412 gene locus_tag LOCUS_17110 3212 2412 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265741.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence366 <1 1133 gene locus_tag LOCUS_17120 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029308.1:LysR family transcriptional regulator 1143 1658 gene locus_tag LOCUS_17130 1143 1658 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_17130 2026 3387 gene locus_tag LOCUS_17140 2026 3387 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728889.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence367 415 984 gene locus_tag LOCUS_17150 415 984 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229466.1 protein_id gnl|my_center|LOCUS_17150 1678 1019 gene locus_tag LOCUS_17160 1678 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1957 2499 gene locus_tag LOCUS_17170 1957 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3652 2585 gene locus_tag LOCUS_17180 3652 2585 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence368 490 3240 gene locus_tag LOCUS_17190 gene ppc 490 3240 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 protein_id gnl|my_center|LOCUS_17190 3321 3539 gene locus_tag LOCUS_17200 3321 3539 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085690.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence369 2129 654 gene locus_tag LOCUS_17210 2129 654 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222455.1 protein_id gnl|my_center|LOCUS_17210 2674 2126 gene locus_tag LOCUS_17220 2674 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 3219 2671 gene locus_tag LOCUS_17230 3219 2671 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_17230 <3756 3247 gene locus_tag LOCUS_17240 <3756 3247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941006.1:NADH-quinone oxidoreductase subunit A >Feature sequence370 3452 918 gene locus_tag LOCUS_17250 3452 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence371 113 1591 gene locus_tag LOCUS_17260 113 1591 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112031.1 protein_id gnl|my_center|LOCUS_17260 <3743 1613 gene locus_tag LOCUS_17270 <3743 1613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812288.1:CoA transferase >Feature sequence372 2 196 gene locus_tag LOCUS_17280 2 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 239 493 gene locus_tag LOCUS_17290 239 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1219 575 gene locus_tag LOCUS_17300 1219 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2115 1150 gene locus_tag LOCUS_17310 2115 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1265 1274 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3326 3556 gene locus_tag LOCUS_17320 3326 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence373 <1 1063 gene locus_tag LOCUS_17330 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545429.1:ATP-dependent zinc metalloprotease FtsH 2480 1128 gene locus_tag LOCUS_17340 2480 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence374 <1 1263 gene locus_tag LOCUS_17350 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227243.1:PEP/pyruvate-binding domain-containing protein 2601 1282 gene locus_tag LOCUS_17360 2601 1282 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_17360 <3735 2706 gene locus_tag LOCUS_17370 <3735 2706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193487479.1:amidohydrolase family protein >Feature sequence375 1088 714 gene locus_tag LOCUS_17380 1088 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1489 1088 gene locus_tag LOCUS_17390 1489 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2123 1713 gene locus_tag LOCUS_17400 2123 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2625 2128 gene locus_tag LOCUS_17410 2625 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3734 2622 gene locus_tag LOCUS_17420 3734 2622 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence376 1177 758 gene locus_tag LOCUS_17430 1177 758 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_17430 1425 1177 gene locus_tag LOCUS_17440 1425 1177 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766946.1 protein_id gnl|my_center|LOCUS_17440 2392 1886 gene locus_tag LOCUS_17450 2392 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2452 2739 gene locus_tag LOCUS_17460 2452 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2772 3311 gene locus_tag LOCUS_17470 2772 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence377 3430 293 gene locus_tag LOCUS_17480 3430 293 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence378 1171 335 gene locus_tag LOCUS_17490 1171 335 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113951.1 protein_id gnl|my_center|LOCUS_17490 2175 1198 gene locus_tag LOCUS_17500 2175 1198 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_17500 3343 2258 gene locus_tag LOCUS_17510 gene menE 3343 2258 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081439373.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence379 41 1348 gene locus_tag LOCUS_17520 41 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2254 1499 gene locus_tag LOCUS_17530 2254 1499 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731411.1 protein_id gnl|my_center|LOCUS_17530 <3723 2299 gene locus_tag LOCUS_17540 <3723 2299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524967.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence380 <1 806 gene locus_tag LOCUS_17550 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022605.1:arylsulfatase 1271 903 gene locus_tag LOCUS_17560 1271 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1358 2053 gene locus_tag LOCUS_17570 1358 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 3246 2062 gene locus_tag LOCUS_17580 3246 2062 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027921.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence381 965 1792 gene locus_tag LOCUS_17590 965 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence382 291 1025 gene locus_tag LOCUS_17600 291 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1073 1978 gene locus_tag LOCUS_17610 gene pdxS 1073 1978 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_17610 2245 2883 gene locus_tag LOCUS_17620 gene pdxT 2245 2883 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 protein_id gnl|my_center|LOCUS_17620 2981 3673 gene locus_tag LOCUS_17630 2981 3673 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894318.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence383 <1 1043 gene locus_tag LOCUS_17640 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030872463.1:amidophosphoribosyltransferase 1036 2109 gene locus_tag LOCUS_17650 gene purM 1036 2109 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_17650 2419 2619 gene locus_tag LOCUS_17660 gene bldC 2419 2619 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence384 2443 740 gene locus_tag LOCUS_17670 2443 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence385 <1 566 gene locus_tag LOCUS_17680 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071831595.1:glucosyl-3-phosphoglycerate synthase 1561 575 gene locus_tag LOCUS_17690 1561 575 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_17690 1660 3018 gene locus_tag LOCUS_17700 1660 3018 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_17700 <3687 3044 gene locus_tag LOCUS_17710 <3687 3044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029558.1:trehalose-phosphatase >Feature sequence386 <1 618 gene locus_tag LOCUS_17720 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808221.1:cyclase family protein 594 1469 gene locus_tag LOCUS_17730 594 1469 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230919.1 protein_id gnl|my_center|LOCUS_17730 2347 1505 gene locus_tag LOCUS_17740 gene phaZ 2347 1505 CDS product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228251.1 protein_id gnl|my_center|LOCUS_17740 <3687 2334 gene locus_tag LOCUS_17750 <3687 2334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095864.1:class II poly(R)-hydroxyalkanoic acid synthase >Feature sequence387 987 376 gene locus_tag LOCUS_17760 987 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1242 991 gene locus_tag LOCUS_17770 1242 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1448 1239 gene locus_tag LOCUS_17780 1448 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1939 1457 gene locus_tag LOCUS_17790 1939 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2091 1936 gene locus_tag LOCUS_17800 2091 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 2579 2103 gene locus_tag LOCUS_17810 2579 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2905 2576 gene locus_tag LOCUS_17820 2905 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3346 3050 gene locus_tag LOCUS_17830 3346 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence388 <1 852 gene locus_tag LOCUS_17840 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987033.1:flagellar motor switch protein FliM 853 1194 gene locus_tag LOCUS_17850 853 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1253 1678 gene locus_tag LOCUS_17860 1253 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1675 2385 gene locus_tag LOCUS_17870 1675 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2382 2654 gene locus_tag LOCUS_17880 gene fliQ 2382 2654 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_17880 2669 3436 gene locus_tag LOCUS_17890 gene fliR 2669 3436 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence389 1512 2006 gene locus_tag LOCUS_17900 1512 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 <3674 2038 gene locus_tag LOCUS_17910 <3674 2038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086840716.1:protein meaA >Feature sequence390 <1 2271 gene locus_tag LOCUS_17920 <1 2271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099096086.1:CoA transferase 2292 3161 gene locus_tag LOCUS_17930 gene rutD 2292 3161 CDS product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537959.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence391 1088 699 gene locus_tag LOCUS_17940 1088 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1725 1429 gene locus_tag LOCUS_17950 1725 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3420 1981 gene locus_tag LOCUS_17960 3420 1981 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031600.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence392 <1 766 gene locus_tag LOCUS_17970 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222554.1:3-dehydroquinate synthase family protein 763 1218 gene locus_tag LOCUS_17980 gene aroQ 763 1218 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531359.1 protein_id gnl|my_center|LOCUS_17980 2029 1265 gene locus_tag LOCUS_17990 2029 1265 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226289.1 protein_id gnl|my_center|LOCUS_17990 2070 3170 gene locus_tag LOCUS_18000 2070 3170 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence393 511 1593 gene locus_tag LOCUS_18010 511 1593 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189457038.1 protein_id gnl|my_center|LOCUS_18010 1608 2066 gene locus_tag LOCUS_18020 1608 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2063 2818 gene locus_tag LOCUS_18030 2063 2818 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_18030 2815 3279 gene locus_tag LOCUS_18040 2815 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence394 1528 2742 gene locus_tag LOCUS_18050 1528 2742 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407371.1 protein_id gnl|my_center|LOCUS_18050 <3660 2785 gene locus_tag LOCUS_18060 <3660 2785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010908989.1:dihydroxy-acid dehydratase >Feature sequence395 <1 549 gene locus_tag LOCUS_18070 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814301.1:response regulator transcription factor 921 559 gene locus_tag LOCUS_18080 921 559 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_18080 2465 918 gene locus_tag LOCUS_18090 2465 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2862 2512 gene locus_tag LOCUS_18100 2862 2512 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_18100 3605 2925 gene locus_tag LOCUS_18110 3605 2925 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413588.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence396 2554 2102 gene locus_tag LOCUS_18120 2554 2102 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_18120 <3649 2557 gene locus_tag LOCUS_18130 <3649 2557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230872.1:molecular chaperone DnaJ >Feature sequence397 <1 857 gene locus_tag LOCUS_18140 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582702.1:ABC transporter ATP-binding protein 854 1600 gene locus_tag LOCUS_18150 854 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1976 2674 gene locus_tag LOCUS_18160 1976 2674 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906339.1 protein_id gnl|my_center|LOCUS_18160 2671 3021 gene locus_tag LOCUS_18170 2671 3021 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence398 910 221 gene locus_tag LOCUS_18180 910 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1702 1289 gene locus_tag LOCUS_18190 1702 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1973 1713 gene locus_tag LOCUS_18200 1973 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 <3640 1989 gene locus_tag LOCUS_18210 <3640 1989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_097383638.1:Ti-type conjugative transfer relaxase TraA >Feature sequence399 <1 3121 gene locus_tag LOCUS_18220 <1 3121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975050.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 3637 3140 gene locus_tag LOCUS_18230 3637 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence400 <1 648 gene locus_tag LOCUS_18240 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000986921.1:conjugative transfer relaxase/helicase TraI 560 569 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 570 3254 gene locus_tag LOCUS_18250 570 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence401 >Feature sequence402 862 2115 gene locus_tag LOCUS_18260 gene hisS 862 2115 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_18260 2149 2496 gene locus_tag LOCUS_18270 2149 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2496 2726 gene locus_tag LOCUS_18280 2496 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence403 1201 686 gene locus_tag LOCUS_18290 1201 686 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223498.1 protein_id gnl|my_center|LOCUS_18290 2041 1235 gene locus_tag LOCUS_18300 2041 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18300 2833 2060 gene locus_tag LOCUS_18310 2833 2060 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence404 819 634 gene locus_tag LOCUS_18320 819 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1452 919 gene locus_tag LOCUS_18330 1452 919 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110163.1 protein_id gnl|my_center|LOCUS_18330 1582 2610 gene locus_tag LOCUS_18340 1582 2610 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_18340 2607 3299 gene locus_tag LOCUS_18350 2607 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 3442 3518 gene locus_tag LOCUS_t00180 3442 3518 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence405 908 327 gene locus_tag LOCUS_18360 gene sigR 908 327 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_18360 1079 2068 gene locus_tag LOCUS_18370 1079 2068 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061547.1 protein_id gnl|my_center|LOCUS_18370 2127 2912 gene locus_tag LOCUS_18380 2127 2912 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226558.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence406 <3618 192 gene locus_tag LOCUS_18390 <3618 192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147933.1:DEAD/DEAH box helicase >Feature sequence407 751 413 gene locus_tag LOCUS_18400 751 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 907 1257 gene locus_tag LOCUS_18410 907 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 3452 1266 gene locus_tag LOCUS_18420 3452 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence408 1293 400 gene locus_tag LOCUS_18430 1293 400 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731346.1 protein_id gnl|my_center|LOCUS_18430 1421 3010 gene locus_tag LOCUS_18440 1421 3010 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_18440 <3600 3022 gene locus_tag LOCUS_18450 <3600 3022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001988952.1:CmcI family methyltransferase >Feature sequence409 214 621 gene locus_tag LOCUS_18460 214 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 640 2286 gene locus_tag LOCUS_18470 640 2286 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131168715.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence410 1170 4 gene locus_tag LOCUS_18480 1170 4 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228946.1 protein_id gnl|my_center|LOCUS_18480 1301 2314 gene locus_tag LOCUS_18490 gene gap 1301 2314 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_18490 2375 3376 gene locus_tag LOCUS_18500 2375 3376 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence411 <1 625 gene locus_tag LOCUS_18510 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230735.1:ABC transporter ATP-binding protein 622 1464 gene locus_tag LOCUS_18520 622 1464 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230734.1 protein_id gnl|my_center|LOCUS_18520 1491 3161 gene locus_tag LOCUS_18530 1491 3161 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730149.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence412 1641 871 gene locus_tag LOCUS_18540 1641 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 <3591 1661 gene locus_tag LOCUS_18550 <3591 1661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227547.1:formate dehydrogenase >Feature sequence413 1206 214 gene locus_tag LOCUS_18560 1206 214 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_18560 1205 1444 gene locus_tag LOCUS_18570 1205 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2993 1551 gene locus_tag LOCUS_18580 2993 1551 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_18580 3229 2990 gene locus_tag LOCUS_18590 3229 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence414 1050 142 gene locus_tag LOCUS_18600 1050 142 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 protein_id gnl|my_center|LOCUS_18600 1223 3523 gene locus_tag LOCUS_18610 1223 3523 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence415 707 243 gene locus_tag LOCUS_18620 707 243 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742154.1 protein_id gnl|my_center|LOCUS_18620 717 1073 gene locus_tag LOCUS_18630 717 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2545 1049 gene locus_tag LOCUS_18640 2545 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 3342 2542 gene locus_tag LOCUS_18650 3342 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18650 >Feature sequence416 567 860 gene locus_tag LOCUS_18660 567 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 853 1815 gene locus_tag LOCUS_18670 853 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1950 2426 gene locus_tag LOCUS_18680 1950 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2429 2884 gene locus_tag LOCUS_18690 2429 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence417 1431 658 gene locus_tag LOCUS_18700 1431 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1747 3459 gene locus_tag LOCUS_18710 1747 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence418 213 1370 gene locus_tag LOCUS_18720 gene thiH 213 1370 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704008.1 protein_id gnl|my_center|LOCUS_18720 1355 1513 gene locus_tag LOCUS_18730 1355 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1498 1788 gene locus_tag LOCUS_18740 gene mftB 1498 1788 CDS product mycofactocin biosynthesis chaperone MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077617.1 protein_id gnl|my_center|LOCUS_18740 1778 2899 gene locus_tag LOCUS_18750 gene mftC 1778 2899 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403490.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence419 1177 26 gene locus_tag LOCUS_18760 1177 26 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764768.1 protein_id gnl|my_center|LOCUS_18760 2100 1174 gene locus_tag LOCUS_18770 2100 1174 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_18770 3308 2097 gene locus_tag LOCUS_18780 3308 2097 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence420 1576 521 gene locus_tag LOCUS_18790 1576 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2649 1474 gene locus_tag LOCUS_18800 2649 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2753 3100 gene locus_tag LOCUS_18810 2753 3100 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence421 1772 468 gene locus_tag LOCUS_18820 gene yjiB 1772 468 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_18820 3387 2008 gene locus_tag LOCUS_18830 3387 2008 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence422 446 2254 gene locus_tag LOCUS_18840 446 2254 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_18840 2274 3305 gene locus_tag LOCUS_18850 2274 3305 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence423 <1 925 gene locus_tag LOCUS_18860 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804187.1:McrBC 5-methylcytosine restriction system component <3510 972 gene locus_tag LOCUS_18870 <3510 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296243.1:MobF family relaxase >Feature sequence424 <1 1291 gene locus_tag LOCUS_18880 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036278.1:glycoside hydrolase family 15 protein 1288 1635 gene locus_tag LOCUS_18890 1288 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 1717 2862 gene locus_tag LOCUS_18900 1717 2862 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742152.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence425 1320 2252 gene locus_tag LOCUS_18910 1320 2252 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_18910 2294 3040 gene locus_tag LOCUS_18920 2294 3040 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015010.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence426 748 89 gene locus_tag LOCUS_18930 748 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2604 745 gene locus_tag LOCUS_18940 gene dnaK 2604 745 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_18940 2725 3468 gene locus_tag LOCUS_18950 gene gpmA 2725 3468 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037842.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence427 2551 1475 gene locus_tag LOCUS_18960 gene hypE 2551 1475 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_18960 <3483 2544 gene locus_tag LOCUS_18970 <3483 2544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258618.1:hydrogenase formation protein HypD >Feature sequence428 1801 434 gene locus_tag LOCUS_18980 1801 434 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_18980 3152 1833 gene locus_tag LOCUS_18990 gene lysA 3152 1833 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence429 804 412 gene locus_tag LOCUS_19000 804 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1695 808 gene locus_tag LOCUS_19010 1695 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2402 2749 gene locus_tag LOCUS_19020 2402 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2746 2997 gene locus_tag LOCUS_19030 2746 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence430 472 14 gene locus_tag LOCUS_19040 472 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1281 469 gene locus_tag LOCUS_19050 1281 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2165 1539 gene locus_tag LOCUS_19060 2165 1539 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082833.1 protein_id gnl|my_center|LOCUS_19060 2333 3205 gene locus_tag LOCUS_19070 2333 3205 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056709.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence431 418 239 gene locus_tag LOCUS_19080 418 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2173 440 gene locus_tag LOCUS_19090 2173 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2276 2205 gene locus_tag LOCUS_t00190 2276 2205 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2575 2501 gene locus_tag LOCUS_t00200 2575 2501 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence432 <1 993 gene locus_tag LOCUS_19100 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945874.1:HDOD domain-containing protein 1519 1007 gene locus_tag LOCUS_19110 1519 1007 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225543.1 protein_id gnl|my_center|LOCUS_19110 2920 1535 gene locus_tag LOCUS_19120 2920 1535 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence433 1293 619 gene locus_tag LOCUS_19130 1293 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 3303 1366 gene locus_tag LOCUS_19140 3303 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence434 <1 523 gene locus_tag LOCUS_19150 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726768.1:IS1380-like element ISMsm3 family transposase 535 1650 gene locus_tag LOCUS_19160 gene xerD 535 1650 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_19160 1640 1948 gene locus_tag LOCUS_19170 1640 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence435 1667 387 gene locus_tag LOCUS_19180 1667 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 1763 2731 gene locus_tag LOCUS_19190 1763 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2901 3149 gene locus_tag LOCUS_19200 2901 3149 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228157.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence436 <1 2176 gene locus_tag LOCUS_19210 <1 2176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704960.1:flagellar filament capping protein FliD 2190 2597 gene locus_tag LOCUS_19220 2190 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2594 2869 gene locus_tag LOCUS_19230 2594 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 <3431 2876 gene locus_tag LOCUS_19240 <3431 2876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230571.1:methyltransferase domain-containing protein >Feature sequence437 82 975 gene locus_tag LOCUS_19250 82 975 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_19250 1796 972 gene locus_tag LOCUS_19260 1796 972 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033687802.1 protein_id gnl|my_center|LOCUS_19260 2304 1789 gene locus_tag LOCUS_19270 2304 1789 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223567.1 protein_id gnl|my_center|LOCUS_19270 2358 2834 gene locus_tag LOCUS_19280 2358 2834 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224396.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence438 <1 516 gene locus_tag LOCUS_19290 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211285741.1:IS3 family transposase 513 1496 gene locus_tag LOCUS_19300 513 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1496 3322 gene locus_tag LOCUS_19310 1496 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence439 782 321 gene locus_tag LOCUS_19320 782 321 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931873.1 protein_id gnl|my_center|LOCUS_19320 892 1806 gene locus_tag LOCUS_19330 892 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence440 <1 1073 gene locus_tag LOCUS_19340 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205459.1:chloride channel protein 1849 1043 gene locus_tag LOCUS_19350 gene phnF 1849 1043 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104081.1 protein_id gnl|my_center|LOCUS_19350 2199 1972 gene locus_tag LOCUS_19360 2199 1972 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182462.1 protein_id gnl|my_center|LOCUS_19360 2688 2230 gene locus_tag LOCUS_19370 2688 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence441 772 35 gene locus_tag LOCUS_19380 gene trmD 772 35 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223852.1 protein_id gnl|my_center|LOCUS_19380 1239 769 gene locus_tag LOCUS_19390 gene rimM 1239 769 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 protein_id gnl|my_center|LOCUS_19390 1577 1257 gene locus_tag LOCUS_19400 1577 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 1846 1574 gene locus_tag LOCUS_19410 gene rpsP 1846 1574 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 protein_id gnl|my_center|LOCUS_19410 3255 1888 gene locus_tag LOCUS_19420 gene ffh 3255 1888 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414748.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence442 395 105 gene locus_tag LOCUS_19430 395 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 327 875 gene locus_tag LOCUS_19440 327 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 1849 971 gene locus_tag LOCUS_19450 1849 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2906 2019 gene locus_tag LOCUS_19460 2906 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence443 337 1443 gene locus_tag LOCUS_19470 337 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1508 2356 gene locus_tag LOCUS_19480 1508 2356 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083715.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence444 614 228 gene locus_tag LOCUS_19490 614 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1206 598 gene locus_tag LOCUS_19500 gene rpoE 1206 598 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_19500 1472 1308 gene locus_tag LOCUS_19510 gene rpmG 1472 1308 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_19510 1529 1538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1635 1562 gene locus_tag LOCUS_t00210 1635 1562 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1675 2253 gene locus_tag LOCUS_19520 1675 2253 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887825.1 protein_id gnl|my_center|LOCUS_19520 3255 2272 gene locus_tag LOCUS_19530 3255 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence445 387 1145 gene locus_tag LOCUS_19540 387 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 1153 2037 gene locus_tag LOCUS_19550 1153 2037 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083569.1 protein_id gnl|my_center|LOCUS_19550 2696 2100 gene locus_tag LOCUS_19560 2696 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence446 1314 1751 gene locus_tag LOCUS_19570 1314 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 1952 2338 gene locus_tag LOCUS_19580 1952 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_19580 2335 3348 gene locus_tag LOCUS_19590 2335 3348 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164689163.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence447 475 83 gene locus_tag LOCUS_19600 475 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 812 468 gene locus_tag LOCUS_19610 812 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1471 809 gene locus_tag LOCUS_19620 1471 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 1809 1501 gene locus_tag LOCUS_19630 1809 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2027 1809 gene locus_tag LOCUS_19640 2027 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2236 2024 gene locus_tag LOCUS_19650 2236 2024 CDS product BldC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081896.1 protein_id gnl|my_center|LOCUS_19650 2640 2239 gene locus_tag LOCUS_19660 2640 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2990 2643 gene locus_tag LOCUS_19670 2990 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 3196 2987 gene locus_tag LOCUS_19680 3196 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence448 1970 1155 gene locus_tag LOCUS_19690 1970 1155 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110556.1 protein_id gnl|my_center|LOCUS_19690 3217 1985 gene locus_tag LOCUS_19700 3217 1985 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227132.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence449 752 261 gene locus_tag LOCUS_19710 752 261 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401867.1 protein_id gnl|my_center|LOCUS_19710 1631 753 gene locus_tag LOCUS_19720 1631 753 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_19720 1798 2763 gene locus_tag LOCUS_19730 1798 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence450 348 806 gene locus_tag LOCUS_19740 348 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 835 1317 gene locus_tag LOCUS_19750 835 1317 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_19750 2013 1354 gene locus_tag LOCUS_19760 2013 1354 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_19760 2856 2023 gene locus_tag LOCUS_19770 2856 2023 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265741.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence451 1378 1058 gene locus_tag LOCUS_19780 1378 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1450 1914 gene locus_tag LOCUS_19790 1450 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1925 2509 gene locus_tag LOCUS_19800 1925 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2466 2897 gene locus_tag LOCUS_19810 2466 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence452 2413 1619 gene locus_tag LOCUS_19820 2413 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence453 317 1399 gene locus_tag LOCUS_19830 317 1399 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088347.1 protein_id gnl|my_center|LOCUS_19830 1365 3278 gene locus_tag LOCUS_19840 1365 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence454 984 118 gene locus_tag LOCUS_19850 984 118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222208.1 protein_id gnl|my_center|LOCUS_19850 1799 981 gene locus_tag LOCUS_19860 1799 981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199877.1 protein_id gnl|my_center|LOCUS_19860 3097 1811 gene locus_tag LOCUS_19870 3097 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence455 <3356 376 gene locus_tag LOCUS_19880 <3356 376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein >Feature sequence456 1355 588 gene locus_tag LOCUS_19890 1355 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1972 1346 gene locus_tag LOCUS_19900 1972 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2775 1924 gene locus_tag LOCUS_19910 2775 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19910 3089 2772 gene locus_tag LOCUS_19920 3089 2772 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088407.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence457 286 639 gene locus_tag LOCUS_19930 286 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1013 1258 gene locus_tag LOCUS_19940 1013 1258 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094330.1 protein_id gnl|my_center|LOCUS_19940 1324 2118 gene locus_tag LOCUS_19950 1324 2118 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531349.1 protein_id gnl|my_center|LOCUS_19950 2127 3038 gene locus_tag LOCUS_19960 2127 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence458 2390 336 gene locus_tag LOCUS_19970 2390 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 3082 2765 gene locus_tag LOCUS_19980 3082 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence459 294 668 gene locus_tag LOCUS_19990 294 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 752 1861 gene locus_tag LOCUS_20000 752 1861 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225700.1 protein_id gnl|my_center|LOCUS_20000 1879 3333 gene locus_tag LOCUS_20010 1879 3333 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083665.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence460 <3345 601 gene locus_tag LOCUS_20020 <3345 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486025.1:SpoIIE family protein phosphatase >Feature sequence461 1861 248 gene locus_tag LOCUS_20030 gene murJ 1861 248 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224759.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence462 <1 1061 gene locus_tag LOCUS_20040 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027992.1:metallopeptidase TldD-related protein 2588 1065 gene locus_tag LOCUS_20050 2588 1065 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_20050 3256 2585 gene locus_tag LOCUS_20060 3256 2585 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089979.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence463 1063 410 gene locus_tag LOCUS_20070 1063 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 1147 2169 gene locus_tag LOCUS_20080 gene hrcA 1147 2169 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence464 171 1958 gene locus_tag LOCUS_20090 171 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2018 2194 gene locus_tag LOCUS_20100 2018 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2209 2952 gene locus_tag LOCUS_20110 2209 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence465 427 1278 gene locus_tag LOCUS_20120 427 1278 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_20120 2246 1284 gene locus_tag LOCUS_20130 2246 1284 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031568.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence466 >Feature sequence467 384 1247 gene locus_tag LOCUS_20140 384 1247 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_20140 2495 1341 gene locus_tag LOCUS_20150 2495 1341 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206912.1 protein_id gnl|my_center|LOCUS_20150 <3308 2513 gene locus_tag LOCUS_20160 <3308 2513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029224.1:penicillin-binding transpeptidase domain-containing protein >Feature sequence468 954 169 gene locus_tag LOCUS_20170 954 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 1436 1068 gene locus_tag LOCUS_20180 1436 1068 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971445.1 protein_id gnl|my_center|LOCUS_20180 1499 1957 gene locus_tag LOCUS_20190 1499 1957 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971444.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence469 <1 1231 gene locus_tag LOCUS_20200 <1 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001051291.1:dihydrolipoyl dehydrogenase 1224 2708 gene locus_tag LOCUS_20210 gene sucB 1224 2708 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775679.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence470 174 590 gene locus_tag LOCUS_20220 174 590 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911071.1 protein_id gnl|my_center|LOCUS_20220 709 1026 gene locus_tag LOCUS_20230 709 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1442 963 gene locus_tag LOCUS_20240 1442 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 1978 1412 gene locus_tag LOCUS_20250 1978 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 1984 1993 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2301 2226 gene locus_tag LOCUS_t00220 2301 2226 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2396 3130 gene locus_tag LOCUS_20260 2396 3130 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence471 <1 502 gene locus_tag LOCUS_20270 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942202.1:PAS domain S-box protein note possible pseudo, frameshifted 427 942 gene locus_tag LOCUS_20280 427 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20280 1674 958 gene locus_tag LOCUS_20290 1674 958 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_20290 2847 1759 gene locus_tag LOCUS_20300 2847 1759 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226295.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence472 <1 1050 gene locus_tag LOCUS_20310 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975861.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase 1059 1838 gene locus_tag LOCUS_20320 1059 1838 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_20320 1864 2844 gene locus_tag LOCUS_20330 1864 2844 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524248.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence473 873 463 gene locus_tag LOCUS_20340 873 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20340 904 1110 gene locus_tag LOCUS_20350 904 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 1254 1072 gene locus_tag LOCUS_20360 1254 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 1842 1333 gene locus_tag LOCUS_20370 1842 1333 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225219.1 protein_id gnl|my_center|LOCUS_20370 2404 1850 gene locus_tag LOCUS_20380 2404 1850 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 protein_id gnl|my_center|LOCUS_20380 2847 2464 gene locus_tag LOCUS_20390 2847 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818687.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence474 <1 558 gene locus_tag LOCUS_20400 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229838.1:cystathionine gamma-synthase 1796 579 gene locus_tag LOCUS_20410 gene serA 1796 579 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054393.1 protein_id gnl|my_center|LOCUS_20410 1964 3091 gene locus_tag LOCUS_20420 1964 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence475 469 888 gene locus_tag LOCUS_20430 469 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 885 1796 gene locus_tag LOCUS_20440 885 1796 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112994.1 protein_id gnl|my_center|LOCUS_20440 1817 2776 gene locus_tag LOCUS_20450 1817 2776 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103129516.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence476 1522 650 gene locus_tag LOCUS_20460 1522 650 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_20460 2670 1510 gene locus_tag LOCUS_20470 2670 1510 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918484.1 protein_id gnl|my_center|LOCUS_20470 3040 2663 gene locus_tag LOCUS_20480 3040 2663 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007600538.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence477 173 1114 gene locus_tag LOCUS_20490 173 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1111 2025 gene locus_tag LOCUS_20500 1111 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2092 2394 gene locus_tag LOCUS_20510 2092 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2445 2792 gene locus_tag LOCUS_20520 2445 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence478 <1 687 gene locus_tag LOCUS_20530 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000948295.1:NADH dehydrogenase subunit 5 684 1700 gene locus_tag LOCUS_20540 684 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20540 1480 1489 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1717 3180 gene locus_tag LOCUS_20550 1717 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20550 >Feature sequence479 1307 1879 gene locus_tag LOCUS_20560 1307 1879 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_20560 3233 1944 gene locus_tag LOCUS_20570 3233 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence480 2242 824 gene locus_tag LOCUS_20580 2242 824 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_20580 3046 2303 gene locus_tag LOCUS_20590 3046 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence481 493 1482 gene locus_tag LOCUS_20600 493 1482 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728130.1 protein_id gnl|my_center|LOCUS_20600 1479 1844 gene locus_tag LOCUS_20610 1479 1844 CDS product DUF6285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229263.1 protein_id gnl|my_center|LOCUS_20610 1897 3090 gene locus_tag LOCUS_20620 1897 3090 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence482 <1 743 gene locus_tag LOCUS_20630 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226378.1:sugar ABC transporter ATP-binding protein 740 1828 gene locus_tag LOCUS_20640 740 1828 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_20640 >Feature sequence483 1535 1071 gene locus_tag LOCUS_20650 1535 1071 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_20650 2684 1542 gene locus_tag LOCUS_20660 2684 1542 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414559.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence484 1598 462 gene locus_tag LOCUS_20670 1598 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2890 1604 gene locus_tag LOCUS_20680 2890 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 3176 2898 gene locus_tag LOCUS_20690 3176 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence485 484 1314 gene locus_tag LOCUS_20700 484 1314 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228906.1 protein_id gnl|my_center|LOCUS_20700 1343 2461 gene locus_tag LOCUS_20710 1343 2461 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812102.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence486 676 2094 gene locus_tag LOCUS_20720 676 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2730 2984 gene locus_tag LOCUS_20730 2730 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence487 93 884 gene locus_tag LOCUS_20740 93 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 1951 899 gene locus_tag LOCUS_20750 1951 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 3076 1988 gene locus_tag LOCUS_20760 3076 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence488 312 2003 gene locus_tag LOCUS_20770 312 2003 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_20770 2000 3088 gene locus_tag LOCUS_20780 2000 3088 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920373.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence489 <1 872 gene locus_tag LOCUS_20790 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460393.1:translation initiation factor IF-2 888 1184 gene locus_tag LOCUS_20800 888 1184 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075541644.1 protein_id gnl|my_center|LOCUS_20800 1184 1582 gene locus_tag LOCUS_20810 1184 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1530 2477 gene locus_tag LOCUS_20820 gene truB 1530 2477 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence490 149 1741 gene locus_tag LOCUS_20830 149 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2198 1752 gene locus_tag LOCUS_20840 2198 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2176 2388 gene locus_tag LOCUS_20850 2176 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2454 2795 gene locus_tag LOCUS_20860 2454 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence491 129 524 gene locus_tag LOCUS_20870 129 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 524 2056 gene locus_tag LOCUS_20880 524 2056 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_20880 2131 2616 gene locus_tag LOCUS_20890 2131 2616 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226079.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence492 973 374 gene locus_tag LOCUS_20900 gene hisH 973 374 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_20900 1569 970 gene locus_tag LOCUS_20910 gene hisB 1569 970 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_20910 2624 1566 gene locus_tag LOCUS_20920 2624 1566 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_20920 <3208 2621 gene locus_tag LOCUS_20930 <3208 2621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546313.1:histidinol dehydrogenase >Feature sequence493 569 1315 gene locus_tag LOCUS_20940 gene larB 569 1315 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_20940 1315 2532 gene locus_tag LOCUS_20950 gene larC 1315 2532 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence494 1265 183 gene locus_tag LOCUS_20960 1265 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1389 2240 gene locus_tag LOCUS_20970 1389 2240 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064413.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence495 <1 554 gene locus_tag LOCUS_20980 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003414201.1:ExeA family protein 826 608 gene locus_tag LOCUS_20990 826 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20990 2170 1346 gene locus_tag LOCUS_21000 2170 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2418 2427 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2434 2736 gene locus_tag LOCUS_21010 2434 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence496 3 2063 gene locus_tag LOCUS_21020 3 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2195 1992 gene locus_tag LOCUS_21030 2195 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2962 2330 gene locus_tag LOCUS_21040 2962 2330 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence497 2357 699 gene locus_tag LOCUS_21050 2357 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence498 3 251 gene locus_tag LOCUS_21060 3 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 315 1124 gene locus_tag LOCUS_21070 315 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 1125 1589 gene locus_tag LOCUS_21080 1125 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1586 2110 gene locus_tag LOCUS_21090 1586 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence499 848 651 gene locus_tag LOCUS_21100 848 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2366 867 gene locus_tag LOCUS_21110 gene dop 2366 867 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_21110 <3170 2438 gene locus_tag LOCUS_21120 <3170 2438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005086527.1:proteasome ATPase >Feature sequence500 1065 1844 gene locus_tag LOCUS_21130 1065 1844 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_21130 1860 2132 gene locus_tag LOCUS_21140 1860 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 2198 2770 gene locus_tag LOCUS_21150 2198 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence501 1230 1562 gene locus_tag LOCUS_21160 1230 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21160 1550 2362 gene locus_tag LOCUS_21170 1550 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21170 2410 3111 gene locus_tag LOCUS_21180 2410 3111 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225671.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence502 753 85 gene locus_tag LOCUS_21190 753 85 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060771.1 protein_id gnl|my_center|LOCUS_21190 977 2161 gene locus_tag LOCUS_21200 977 2161 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_21200 2181 2924 gene locus_tag LOCUS_21210 2181 2924 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896559.1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence503 1746 595 gene locus_tag LOCUS_21220 1746 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 <3164 1821 gene locus_tag LOCUS_21230 <3164 1821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197702410.1:LCP family protein >Feature sequence504 1746 223 gene locus_tag LOCUS_21240 gene atpA 1746 223 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896330.1 protein_id gnl|my_center|LOCUS_21240 2660 1746 gene locus_tag LOCUS_21250 2660 1746 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence505 677 183 gene locus_tag LOCUS_21260 677 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 744 2663 gene locus_tag LOCUS_21270 744 2663 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_21270 1759 1857 gene locus_tag LOCUS_t00230 1759 1857 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence506 17 1234 gene locus_tag LOCUS_21280 17 1234 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_21280 1713 1231 gene locus_tag LOCUS_21290 1713 1231 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225543.1 protein_id gnl|my_center|LOCUS_21290 3113 1728 gene locus_tag LOCUS_21300 3113 1728 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence507 933 2525 gene locus_tag LOCUS_21310 933 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence508 1095 709 gene locus_tag LOCUS_21320 1095 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 1330 2691 gene locus_tag LOCUS_21330 1330 2691 CDS product IS256-like element ISRba9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120088.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence509 <1 1518 gene locus_tag LOCUS_21340 <1 1518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256452.1:potassium/proton antiporter 1746 2372 gene locus_tag LOCUS_21350 1746 2372 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence510 39 551 gene locus_tag LOCUS_21360 39 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2113 695 gene locus_tag LOCUS_21370 gene mftF 2113 695 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727662.1 protein_id gnl|my_center|LOCUS_21370 2976 2176 gene locus_tag LOCUS_21380 2976 2176 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081811.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence511 >Feature sequence512 150 890 gene locus_tag LOCUS_21390 150 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 1369 1656 gene locus_tag LOCUS_21400 1369 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 1592 1804 gene locus_tag LOCUS_21410 1592 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 1893 2252 gene locus_tag LOCUS_21420 1893 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence513 214 627 gene locus_tag LOCUS_21430 214 627 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_21430 643 652 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1165 884 gene locus_tag LOCUS_21440 1165 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 1632 1162 gene locus_tag LOCUS_21450 1632 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1622 2353 gene locus_tag LOCUS_21460 1622 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 3047 2505 gene locus_tag LOCUS_21470 3047 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence514 1137 388 gene locus_tag LOCUS_21480 1137 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 1412 1134 gene locus_tag LOCUS_21490 1412 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2056 1451 gene locus_tag LOCUS_21500 2056 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2334 2053 gene locus_tag LOCUS_21510 2334 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2748 2338 gene locus_tag LOCUS_21520 2748 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence515 504 106 gene locus_tag LOCUS_21530 504 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 488 727 gene locus_tag LOCUS_21540 488 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1213 854 gene locus_tag LOCUS_21550 1213 854 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971278.1 protein_id gnl|my_center|LOCUS_21550 3080 1266 gene locus_tag LOCUS_21560 3080 1266 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence516 2153 189 gene locus_tag LOCUS_21570 2153 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2954 2178 gene locus_tag LOCUS_21580 2954 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21580 >Feature sequence517 2503 1496 gene locus_tag LOCUS_21590 2503 1496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306915.1 protein_id gnl|my_center|LOCUS_21590 <3132 2500 gene locus_tag LOCUS_21600 <3132 2500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230097.1:ABC transporter ATP-binding protein >Feature sequence518 209 619 gene locus_tag LOCUS_21610 209 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1071 625 gene locus_tag LOCUS_21620 1071 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 1418 1263 gene locus_tag LOCUS_21630 1418 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 1555 2271 gene locus_tag LOCUS_21640 1555 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 <3132 2237 gene locus_tag LOCUS_21650 <3132 2237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030872986.1:FHA domain-containing protein >Feature sequence519 3126 2557 gene locus_tag LOCUS_21660 3126 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence520 3080 711 gene locus_tag LOCUS_21670 3080 711 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence521 841 287 gene locus_tag LOCUS_21680 841 287 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_21680 1701 871 gene locus_tag LOCUS_21690 1701 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 1907 3025 gene locus_tag LOCUS_21700 1907 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence522 1638 2237 gene locus_tag LOCUS_21710 1638 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978012.1 protein_id gnl|my_center|LOCUS_21710 2400 2813 gene locus_tag LOCUS_21720 2400 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence523 542 261 gene locus_tag LOCUS_21730 542 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1372 548 gene locus_tag LOCUS_21740 1372 548 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_21740 1390 2769 gene locus_tag LOCUS_21750 1390 2769 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730277.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence524 27 362 gene locus_tag LOCUS_21760 27 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 431 694 gene locus_tag LOCUS_21770 431 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 1849 1007 gene locus_tag LOCUS_21780 1849 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence525 1493 918 gene locus_tag LOCUS_21790 1493 918 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 protein_id gnl|my_center|LOCUS_21790 2307 1618 gene locus_tag LOCUS_21800 2307 1618 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224827.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence526 101 1273 gene locus_tag LOCUS_21810 101 1273 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_21810 1612 1911 gene locus_tag LOCUS_21820 1612 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1987 2469 gene locus_tag LOCUS_21830 1987 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2726 2463 gene locus_tag LOCUS_21840 2726 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence527 1121 348 gene locus_tag LOCUS_21850 1121 348 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 protein_id gnl|my_center|LOCUS_21850 2315 1125 gene locus_tag LOCUS_21860 2315 1125 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_21860 <3093 2312 gene locus_tag LOCUS_21870 <3093 2312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528562.1:hydantoinase B/oxoprolinase family protein >Feature sequence528 932 297 gene locus_tag LOCUS_21880 932 297 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929759.1 protein_id gnl|my_center|LOCUS_21880 2784 1177 gene locus_tag LOCUS_21890 2784 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3092 2808 gene locus_tag LOCUS_21900 3092 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence529 <3086 577 gene locus_tag LOCUS_21910 <3086 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028772.1:transcription-repair coupling factor >Feature sequence530 353 2518 gene locus_tag LOCUS_21920 353 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence531 1583 576 gene locus_tag LOCUS_21930 1583 576 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_21930 2068 1580 gene locus_tag LOCUS_21940 2068 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2503 2898 gene locus_tag LOCUS_21950 2503 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence532 85 783 gene locus_tag LOCUS_21960 85 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 780 1652 gene locus_tag LOCUS_21970 780 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 1658 2212 gene locus_tag LOCUS_21980 1658 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence533 16 999 gene locus_tag LOCUS_21990 16 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1035 2795 gene locus_tag LOCUS_22000 1035 2795 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083689.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence534 981 463 gene locus_tag LOCUS_22010 981 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 1764 991 gene locus_tag LOCUS_22020 1764 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 2617 1796 gene locus_tag LOCUS_22030 2617 1796 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083016.1 protein_id gnl|my_center|LOCUS_22030 3034 2621 gene locus_tag LOCUS_22040 3034 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence535 682 1839 gene locus_tag LOCUS_22050 682 1839 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963566.1 protein_id gnl|my_center|LOCUS_22050 1875 2177 gene locus_tag LOCUS_22060 1875 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2745 2278 gene locus_tag LOCUS_22070 2745 2278 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence536 1438 62 gene locus_tag LOCUS_22080 1438 62 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_22080 <3075 1561 gene locus_tag LOCUS_22090 <3075 1561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226258.1:glycerol-3-phosphate dehydrogenase >Feature sequence537 283 1905 gene locus_tag LOCUS_22100 283 1905 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031630.1 protein_id gnl|my_center|LOCUS_22100 2236 1970 gene locus_tag LOCUS_22110 2236 1970 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978083.1 protein_id gnl|my_center|LOCUS_22110 2626 2246 gene locus_tag LOCUS_22120 2626 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 3003 2590 gene locus_tag LOCUS_22130 3003 2590 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227043.1 protein_id gnl|my_center|LOCUS_22130 >Feature sequence538 26 2281 gene locus_tag LOCUS_22140 26 2281 CDS product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950373.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence539 274 570 gene locus_tag LOCUS_22150 274 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 905 1606 gene locus_tag LOCUS_22160 gene cobA 905 1606 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903739.1 protein_id gnl|my_center|LOCUS_22160 1866 1510 gene locus_tag LOCUS_22170 1866 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1983 2279 gene locus_tag LOCUS_22180 1983 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence540 2238 1162 gene locus_tag LOCUS_22190 2238 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 <3065 2339 gene locus_tag LOCUS_22200 <3065 2339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939773.1:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence541 187 852 gene locus_tag LOCUS_22210 187 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence542 <1 2204 gene locus_tag LOCUS_22220 <1 2204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_097383638.1:Ti-type conjugative transfer relaxase TraA >Feature sequence543 1482 22 gene locus_tag LOCUS_22230 1482 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2265 1627 gene locus_tag LOCUS_22240 2265 1627 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027620.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence544 104 847 gene locus_tag LOCUS_22250 104 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 1862 855 gene locus_tag LOCUS_22260 1862 855 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640662.1 protein_id gnl|my_center|LOCUS_22260 <3047 1867 gene locus_tag LOCUS_22270 <3047 1867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036462762.1:TIGR01777 family oxidoreductase >Feature sequence545 2041 1103 gene locus_tag LOCUS_22280 2041 1103 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931162.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence546 <1 978 gene locus_tag LOCUS_22290 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003854992.1:magnesium transporter 975 2300 gene locus_tag LOCUS_22300 975 2300 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence547 150 668 gene locus_tag LOCUS_22310 150 668 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_22310 1407 703 gene locus_tag LOCUS_22320 1407 703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227935.1 protein_id gnl|my_center|LOCUS_22320 2227 1397 gene locus_tag LOCUS_22330 2227 1397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227934.1 protein_id gnl|my_center|LOCUS_22330 2577 2224 gene locus_tag LOCUS_22340 2577 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence548 >Feature sequence549 744 406 gene locus_tag LOCUS_22350 744 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 812 1996 gene locus_tag LOCUS_22360 812 1996 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877954.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence550 5 964 gene locus_tag LOCUS_22370 5 964 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_22370 974 1150 gene locus_tag LOCUS_22380 974 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1642 1178 gene locus_tag LOCUS_22390 1642 1178 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061809.1 protein_id gnl|my_center|LOCUS_22390 2524 1652 gene locus_tag LOCUS_22400 2524 1652 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222502.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence551 79 363 gene locus_tag LOCUS_22410 79 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 649 1050 gene locus_tag LOCUS_22420 649 1050 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975124.1 protein_id gnl|my_center|LOCUS_22420 1281 2042 gene locus_tag LOCUS_22430 1281 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence552 >Feature sequence553 <1 796 gene locus_tag LOCUS_22440 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005092699.1:GTP 3',8-cyclase MoaA 899 1486 gene locus_tag LOCUS_22450 gene moaC 899 1486 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_22450 1525 1707 gene locus_tag LOCUS_22460 1525 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1741 2379 gene locus_tag LOCUS_22470 1741 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence554 337 2937 gene locus_tag LOCUS_22480 337 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence555 1024 2658 gene locus_tag LOCUS_22490 gene ligD 1024 2658 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226036.1 protein_id gnl|my_center|LOCUS_22490 3019 2696 gene locus_tag LOCUS_22500 3019 2696 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877671.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence556 601 972 gene locus_tag LOCUS_22510 601 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1214 1609 gene locus_tag LOCUS_22520 1214 1609 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093074.1 protein_id gnl|my_center|LOCUS_22520 1764 2264 gene locus_tag LOCUS_22530 1764 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 <3015 2418 gene locus_tag LOCUS_22540 <3015 2418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_096580277.1:DUF4157 domain-containing protein >Feature sequence557 705 917 gene locus_tag LOCUS_22550 705 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2460 1042 gene locus_tag LOCUS_22560 gene zwf 2460 1042 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence558 >Feature sequence559 13 1305 gene locus_tag LOCUS_22570 13 1305 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123282.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence560 2292 1354 gene locus_tag LOCUS_22580 2292 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2571 2930 gene locus_tag LOCUS_22590 2571 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence561 <1 697 gene locus_tag LOCUS_22600 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918834.1:ribokinase 932 1969 gene locus_tag LOCUS_22610 932 1969 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877566.1 protein_id gnl|my_center|LOCUS_22610 2615 1986 gene locus_tag LOCUS_22620 2615 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence562 615 154 gene locus_tag LOCUS_22630 615 154 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_22630 982 617 gene locus_tag LOCUS_22640 gene rpsF 982 617 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_22640 2164 1247 gene locus_tag LOCUS_22650 gene panB 2164 1247 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080134253.1 protein_id gnl|my_center|LOCUS_22650 2446 2769 gene locus_tag LOCUS_22660 2446 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence563 1062 316 gene locus_tag LOCUS_22670 1062 316 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900518.1 protein_id gnl|my_center|LOCUS_22670 1964 1113 gene locus_tag LOCUS_22680 1964 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 <3000 1961 gene locus_tag LOCUS_22690 <3000 1961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189955129.1:site-specific integrase >Feature sequence564 170 487 gene locus_tag LOCUS_22700 170 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 488 2920 gene locus_tag LOCUS_22710 488 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence565 >Feature sequence566 1731 628 gene locus_tag LOCUS_22720 gene ugpC 1731 628 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_22720 2569 1751 gene locus_tag LOCUS_22730 2569 1751 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459730.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence567 675 304 gene locus_tag LOCUS_22740 675 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 1949 672 gene locus_tag LOCUS_22750 1949 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2358 2179 gene locus_tag LOCUS_22760 2358 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence568 1825 374 gene locus_tag LOCUS_22770 1825 374 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_22770 2361 1957 gene locus_tag LOCUS_22780 2361 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 <2990 2405 gene locus_tag LOCUS_22790 <2990 2405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002723841.1:ABC transporter permease subunit >Feature sequence569 <1 1596 gene locus_tag LOCUS_22800 <1 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030729.1:LuxR family transcriptional regulator 1651 1938 gene locus_tag LOCUS_22810 1651 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2003 2518 gene locus_tag LOCUS_22820 2003 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence570 42 117 gene locus_tag LOCUS_t00240 42 117 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 533 201 gene locus_tag LOCUS_22830 533 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 1061 687 gene locus_tag LOCUS_22840 1061 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2000 1536 gene locus_tag LOCUS_22850 2000 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2195 2578 gene locus_tag LOCUS_22860 2195 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence571 >Feature sequence572 507 1901 gene locus_tag LOCUS_22870 507 1901 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_22870 1898 2707 gene locus_tag LOCUS_22880 gene hisN 1898 2707 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence573 877 65 gene locus_tag LOCUS_22890 877 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence574 718 2928 gene locus_tag LOCUS_22900 718 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence575 <1 790 gene locus_tag LOCUS_22910 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730410.1:wax ester/triacylglycerol synthase family O-acyltransferase 944 2125 gene locus_tag LOCUS_22920 944 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2313 2143 gene locus_tag LOCUS_22930 2313 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence576 >Feature sequence577 >Feature sequence578 1011 463 gene locus_tag LOCUS_22940 1011 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2068 1175 gene locus_tag LOCUS_22950 gene pcaD 2068 1175 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392054.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence579 1730 537 gene locus_tag LOCUS_22960 1730 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence580 433 128 gene locus_tag LOCUS_22970 433 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 353 598 gene locus_tag LOCUS_22980 353 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2934 661 gene locus_tag LOCUS_22990 2934 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence581 1660 506 gene locus_tag LOCUS_23000 1660 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1812 2879 gene locus_tag LOCUS_23010 1812 2879 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence582 2955 1294 gene locus_tag LOCUS_23020 gene fadD2 2955 1294 CDS product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899884.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence583 2539 1892 gene locus_tag LOCUS_23030 2539 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2448 2837 gene locus_tag LOCUS_23040 2448 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence584 1075 1758 gene locus_tag LOCUS_23050 1075 1758 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence585 <1 1293 gene locus_tag LOCUS_23060 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189742800.1:APC family permease 1338 2201 gene locus_tag LOCUS_23070 1338 2201 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_23070 <2949 2198 gene locus_tag LOCUS_23080 <2949 2198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029384.1:amidohydrolase family protein >Feature sequence586 663 76 gene locus_tag LOCUS_23090 663 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 806 2197 gene locus_tag LOCUS_23100 806 2197 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040324.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence587 <1 687 gene locus_tag LOCUS_23110 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965765.1:OB-fold domain-containing protein 692 1888 gene locus_tag LOCUS_23120 692 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23120 >Feature sequence588 1617 2117 gene locus_tag LOCUS_23130 1617 2117 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230477.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence589 1561 2325 gene locus_tag LOCUS_23140 1561 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 <2936 2289 gene locus_tag LOCUS_23150 <2936 2289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_168715516.1:glycoside hydrolase family 6 protein >Feature sequence590 2 493 gene locus_tag LOCUS_23160 2 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 498 2231 gene locus_tag LOCUS_23170 498 2231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence591 471 1379 gene locus_tag LOCUS_23180 471 1379 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730865.1 protein_id gnl|my_center|LOCUS_23180 1372 1878 gene locus_tag LOCUS_23190 1372 1878 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence592 155 448 gene locus_tag LOCUS_23200 155 448 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922101.1 protein_id gnl|my_center|LOCUS_23200 1192 452 gene locus_tag LOCUS_23210 1192 452 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082969.1 protein_id gnl|my_center|LOCUS_23210 1729 1292 gene locus_tag LOCUS_23220 1729 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 <2930 1757 gene locus_tag LOCUS_23230 <2930 1757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011213919.1:MFS transporter >Feature sequence593 380 138 gene locus_tag LOCUS_23240 380 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 440 688 gene locus_tag LOCUS_23250 440 688 CDS product DUF5372 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086024521.1 protein_id gnl|my_center|LOCUS_23250 877 1353 gene locus_tag LOCUS_23260 877 1353 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967412.1 protein_id gnl|my_center|LOCUS_23260 1337 1603 gene locus_tag LOCUS_23270 1337 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence594 1074 292 gene locus_tag LOCUS_23280 gene thiD 1074 292 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_23280 2032 1082 gene locus_tag LOCUS_23290 gene thiL 2032 1082 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence595 713 201 gene locus_tag LOCUS_23300 713 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 1876 1238 gene locus_tag LOCUS_23310 1876 1238 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_23310 1973 2701 gene locus_tag LOCUS_23320 1973 2701 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286332.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence596 2170 623 gene locus_tag LOCUS_23330 2170 623 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081159250.1 protein_id gnl|my_center|LOCUS_23330 <2908 2188 gene locus_tag LOCUS_23340 <2908 2188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530690.1:sulfatase >Feature sequence597 834 1793 gene locus_tag LOCUS_23350 834 1793 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133851220.1 protein_id gnl|my_center|LOCUS_23350 1790 2656 gene locus_tag LOCUS_23360 1790 2656 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227697.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence598 641 1393 gene locus_tag LOCUS_23370 641 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 1564 1779 gene locus_tag LOCUS_23380 1564 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1810 1980 gene locus_tag LOCUS_23390 1810 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence599 250 20 gene locus_tag LOCUS_23400 250 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 491 820 gene locus_tag LOCUS_23410 491 820 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 protein_id gnl|my_center|LOCUS_23410 817 1296 gene locus_tag LOCUS_23420 817 1296 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899141.1 protein_id gnl|my_center|LOCUS_23420 2137 2613 gene locus_tag LOCUS_23430 2137 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23430 >Feature sequence600 1899 772 gene locus_tag LOCUS_23440 gene pcaD 1899 772 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 protein_id gnl|my_center|LOCUS_23440 2526 1969 gene locus_tag LOCUS_23450 gene pcaG 2526 1969 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728463.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence601 217 954 gene locus_tag LOCUS_23460 217 954 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence602 <2875 802 gene locus_tag LOCUS_23470 <2875 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071257.1:formate dehydrogenase subunit alpha >Feature sequence603 195 974 gene locus_tag LOCUS_23480 195 974 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082737.1 protein_id gnl|my_center|LOCUS_23480 971 2149 gene locus_tag LOCUS_23490 gene trpB 971 2149 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124343.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence604 368 1600 gene locus_tag LOCUS_23500 368 1600 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877816.1 protein_id gnl|my_center|LOCUS_23500 2660 1566 gene locus_tag LOCUS_23510 2660 1566 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence605 277 564 gene locus_tag LOCUS_23520 277 564 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229777.1 protein_id gnl|my_center|LOCUS_23520 616 1527 gene locus_tag LOCUS_23530 gene mca 616 1527 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_23530 1520 1909 gene locus_tag LOCUS_23540 1520 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 1977 2558 gene locus_tag LOCUS_23550 1977 2558 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144340.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence606 785 201 gene locus_tag LOCUS_23560 785 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 867 1202 gene locus_tag LOCUS_23570 867 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2187 1216 gene locus_tag LOCUS_23580 2187 1216 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029094.1 protein_id gnl|my_center|LOCUS_23580 <2871 2184 gene locus_tag LOCUS_23590 <2871 2184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917983.1:glucose 1-dehydrogenase >Feature sequence607 <1 1238 gene locus_tag LOCUS_23600 <1 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_097383638.1:Ti-type conjugative transfer relaxase TraA 1235 2518 gene locus_tag LOCUS_23610 1235 2518 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230432.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence608 >Feature sequence609 <1 516 gene locus_tag LOCUS_23620 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226913.1:thiamine pyrophosphate-binding protein 1239 526 gene locus_tag LOCUS_23630 1239 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226912.1 protein_id gnl|my_center|LOCUS_23630 1615 1319 gene locus_tag LOCUS_23640 gene nrtS 1615 1319 CDS product nitrate/nitrite transporter NrtS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412553.1 protein_id gnl|my_center|LOCUS_23640 2124 1690 gene locus_tag LOCUS_23650 2124 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23650 2427 2128 gene locus_tag LOCUS_23660 2427 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23660 >Feature sequence610 2178 1648 gene locus_tag LOCUS_23670 2178 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23670 >Feature sequence611 1113 682 gene locus_tag LOCUS_23680 1113 682 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_23680 2141 1194 gene locus_tag LOCUS_23690 2141 1194 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563822.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence612 473 637 gene locus_tag LOCUS_23700 473 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1381 1064 gene locus_tag LOCUS_23710 1381 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 1607 1368 gene locus_tag LOCUS_23720 1607 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 1752 2180 gene locus_tag LOCUS_23730 1752 2180 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226058.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence613 >Feature sequence614 1054 92 gene locus_tag LOCUS_23740 1054 92 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_23740 1427 1134 gene locus_tag LOCUS_23750 1427 1134 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_23750 <2857 1424 gene locus_tag LOCUS_23760 <2857 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037460.1:DEAD/DEAH box helicase >Feature sequence615 <2856 1938 gene locus_tag LOCUS_23770 <2856 1938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162139566.1:glycosyltransferase >Feature sequence616 870 616 gene locus_tag LOCUS_23780 870 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 1089 2840 gene locus_tag LOCUS_23790 1089 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence617 2533 494 gene locus_tag LOCUS_23800 2533 494 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742114.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence618 1731 526 gene locus_tag LOCUS_23810 1731 526 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063166.1 protein_id gnl|my_center|LOCUS_23810 <2853 1868 gene locus_tag LOCUS_23820 <2853 1868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257378.1:sugar transferase >Feature sequence619 1068 1577 gene locus_tag LOCUS_23830 1068 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1931 2740 gene locus_tag LOCUS_23840 1931 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence620 <1 1387 gene locus_tag LOCUS_23850 <1 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141135.1:NAD(P)/FAD-dependent oxidoreductase 1406 1714 gene locus_tag LOCUS_23860 1406 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 1870 1601 gene locus_tag LOCUS_23870 1870 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1835 2653 gene locus_tag LOCUS_23880 1835 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence621 1851 2045 gene locus_tag LOCUS_23890 1851 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence622 2333 1416 gene locus_tag LOCUS_23900 2333 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2377 2739 gene locus_tag LOCUS_23910 2377 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence623 2349 1138 gene locus_tag LOCUS_23920 2349 1138 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899285.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence624 >Feature sequence625 49 870 gene locus_tag LOCUS_23930 49 870 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528277.1 protein_id gnl|my_center|LOCUS_23930 1195 899 gene locus_tag LOCUS_23940 1195 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 1970 1269 gene locus_tag LOCUS_23950 1970 1269 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031443.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence626 186 503 gene locus_tag LOCUS_23960 186 503 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810446.1 protein_id gnl|my_center|LOCUS_23960 601 1065 gene locus_tag LOCUS_23970 601 1065 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285273.1 protein_id gnl|my_center|LOCUS_23970 1079 2221 gene locus_tag LOCUS_23980 1079 2221 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225703.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence627 742 344 gene locus_tag LOCUS_23990 742 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 970 1827 gene locus_tag LOCUS_24000 970 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence628 >Feature sequence629 237 1784 gene locus_tag LOCUS_24010 237 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 1950 1729 gene locus_tag LOCUS_24020 1950 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2161 2373 gene locus_tag LOCUS_24030 2161 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 >Feature sequence630 1804 164 gene locus_tag LOCUS_24040 gene pgi 1804 164 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_24040 2519 1875 gene locus_tag LOCUS_24050 2519 1875 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140730.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence631 110 538 gene locus_tag LOCUS_24060 110 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 550 2157 gene locus_tag LOCUS_24070 550 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence632 <1 665 gene locus_tag LOCUS_24080 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193485194.1:SpoIIE family protein phosphatase 782 1234 gene locus_tag LOCUS_24090 782 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 1899 2222 gene locus_tag LOCUS_24100 1899 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 <2809 2229 gene locus_tag LOCUS_24110 <2809 2229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_135794525.1:serine hydrolase >Feature sequence633 959 384 gene locus_tag LOCUS_24120 959 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 1557 904 gene locus_tag LOCUS_24130 1557 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence634 600 337 gene locus_tag LOCUS_24140 600 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 1202 609 gene locus_tag LOCUS_24150 1202 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749536.1 protein_id gnl|my_center|LOCUS_24150 1573 1199 gene locus_tag LOCUS_24160 1573 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 1976 1575 gene locus_tag LOCUS_24170 1976 1575 CDS product DUF4326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076534005.1 protein_id gnl|my_center|LOCUS_24170 2229 1969 gene locus_tag LOCUS_24180 2229 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2407 2243 gene locus_tag LOCUS_24190 2407 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2709 2413 gene locus_tag LOCUS_24200 2709 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence635 1994 750 gene locus_tag LOCUS_24210 1994 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2515 1991 gene locus_tag LOCUS_24220 2515 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence636 1752 1288 gene locus_tag LOCUS_24230 1752 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 2526 2065 gene locus_tag LOCUS_24240 2526 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence637 >Feature sequence638 354 818 gene locus_tag LOCUS_24250 354 818 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225664.1 protein_id gnl|my_center|LOCUS_24250 1196 2452 gene locus_tag LOCUS_24260 gene eno 1196 2452 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031794.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence639 466 915 gene locus_tag LOCUS_24270 466 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 918 2051 gene locus_tag LOCUS_24280 918 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence640 2742 1495 gene locus_tag LOCUS_24290 2742 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence641 1413 40 gene locus_tag LOCUS_24300 1413 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 1659 2603 gene locus_tag LOCUS_24310 1659 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence642 526 1743 gene locus_tag LOCUS_24320 526 1743 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_24320 1830 2138 gene locus_tag LOCUS_24330 1830 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24330 2148 2648 gene locus_tag LOCUS_24340 2148 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24340 >Feature sequence643 1288 50 gene locus_tag LOCUS_24350 1288 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 1815 1378 gene locus_tag LOCUS_24360 1815 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900634.1 protein_id gnl|my_center|LOCUS_24360 2460 1879 gene locus_tag LOCUS_24370 2460 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence644 1520 852 gene locus_tag LOCUS_24380 1520 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2509 1907 gene locus_tag LOCUS_24390 2509 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence645 <1 655 gene locus_tag LOCUS_24400 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225683.1:acyl-CoA dehydrogenase family protein 959 1753 gene locus_tag LOCUS_24410 959 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2412 1762 gene locus_tag LOCUS_24420 gene thiE 2412 1762 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402115.1 protein_id gnl|my_center|LOCUS_24420 2599 2399 gene locus_tag LOCUS_24430 gene thiS 2599 2399 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379876.1 protein_id gnl|my_center|LOCUS_24430 >Feature sequence646 181 1560 gene locus_tag LOCUS_24440 gene hemY 181 1560 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228080.1 protein_id gnl|my_center|LOCUS_24440 2277 1546 gene locus_tag LOCUS_24450 2277 1546 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257033.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence647 1 189 gene locus_tag LOCUS_24460 1 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 988 224 gene locus_tag LOCUS_24470 988 224 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_24470 1764 985 gene locus_tag LOCUS_24480 1764 985 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_24480 <2770 1790 gene locus_tag LOCUS_24490 <2770 1790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228484.1:ATP-binding cassette domain-containing protein >Feature sequence648 438 1205 gene locus_tag LOCUS_24500 438 1205 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 protein_id gnl|my_center|LOCUS_24500 1371 1559 gene locus_tag LOCUS_24510 1371 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1605 2750 gene locus_tag LOCUS_24520 1605 2750 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence649 856 233 gene locus_tag LOCUS_24530 856 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 1594 1178 gene locus_tag LOCUS_24540 1594 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1807 1610 gene locus_tag LOCUS_24550 1807 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2171 1929 gene locus_tag LOCUS_24560 2171 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2584 2222 gene locus_tag LOCUS_24570 2584 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence650 2745 1216 gene locus_tag LOCUS_24580 2745 1216 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056822.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence651 780 1688 gene locus_tag LOCUS_24590 780 1688 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence652 >Feature sequence653 22 906 gene locus_tag LOCUS_24600 22 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847040.1 protein_id gnl|my_center|LOCUS_24600 1074 1598 gene locus_tag LOCUS_24610 1074 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545718.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence654 1827 34 gene locus_tag LOCUS_24620 1827 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence655 268 1077 gene locus_tag LOCUS_24630 268 1077 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_24630 1078 2253 gene locus_tag LOCUS_24640 gene marP 1078 2253 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731101.1 protein_id gnl|my_center|LOCUS_24640 2564 2331 gene locus_tag LOCUS_24650 2564 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence656 167 1441 gene locus_tag LOCUS_24660 167 1441 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 protein_id gnl|my_center|LOCUS_24660 1493 2287 gene locus_tag LOCUS_24670 1493 2287 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029956.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence657 1047 2063 gene locus_tag LOCUS_24680 gene adhP 1047 2063 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258663.1 protein_id gnl|my_center|LOCUS_24680 2249 2614 gene locus_tag LOCUS_24690 2249 2614 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence658 <1 774 gene locus_tag LOCUS_24700 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391596.1:methionine--tRNA ligase 781 1533 gene locus_tag LOCUS_24710 781 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 1488 2375 gene locus_tag LOCUS_24720 gene rsmA 1488 2375 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence659 1284 2627 gene locus_tag LOCUS_24730 gene ltrA 1284 2627 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence660 729 1007 gene locus_tag LOCUS_24740 729 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1142 1435 gene locus_tag LOCUS_24750 1142 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence661 271 2 gene locus_tag LOCUS_24760 271 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1120 1761 gene locus_tag LOCUS_24770 1120 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24770 1767 2663 gene locus_tag LOCUS_24780 1767 2663 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225966.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence662 >Feature sequence663 287 1258 gene locus_tag LOCUS_24790 287 1258 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_24790 2004 1282 gene locus_tag LOCUS_24800 2004 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2200 1997 gene locus_tag LOCUS_24810 2200 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence664 1135 2016 gene locus_tag LOCUS_24820 1135 2016 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787047.1 protein_id gnl|my_center|LOCUS_24820 >Feature sequence665 <1 1770 gene locus_tag LOCUS_24830 <1 1770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545429.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence666 740 462 gene locus_tag LOCUS_24840 740 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 1671 832 gene locus_tag LOCUS_24850 1671 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2123 1641 gene locus_tag LOCUS_24860 2123 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence667 43 2526 gene locus_tag LOCUS_24870 43 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence668 26 107 gene locus_tag LOCUS_t00250 26 107 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1639 680 gene locus_tag LOCUS_24880 1639 680 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_24880 2561 1626 gene locus_tag LOCUS_24890 gene soj 2561 1626 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence669 <1 888 gene locus_tag LOCUS_24900 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730677.1:glycogen debranching N-terminal domain-containing protein 1538 921 gene locus_tag LOCUS_24910 1538 921 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895255.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence670 <1 2351 gene locus_tag LOCUS_24920 <1 2351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005081546.1:[protein-PII] uridylyltransferase 2623 2348 gene locus_tag LOCUS_24930 2623 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence671 233 1036 gene locus_tag LOCUS_24940 233 1036 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230288.1 protein_id gnl|my_center|LOCUS_24940 1639 938 gene locus_tag LOCUS_24950 1639 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2652 1711 gene locus_tag LOCUS_24960 2652 1711 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence672 77 955 gene locus_tag LOCUS_24970 77 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1102 1473 gene locus_tag LOCUS_24980 1102 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2353 1508 gene locus_tag LOCUS_24990 2353 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2377 2386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence673 <1 1051 gene locus_tag LOCUS_25000 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704008.1:2-iminoacetate synthase ThiH 1027 1194 gene locus_tag LOCUS_25010 1027 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 1197 1469 gene locus_tag LOCUS_25020 gene mftB 1197 1469 CDS product mycofactocin biosynthesis chaperone MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077617.1 protein_id gnl|my_center|LOCUS_25020 1459 2580 gene locus_tag LOCUS_25030 gene mftC 1459 2580 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112050.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence674 1773 346 gene locus_tag LOCUS_25040 1773 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2105 1770 gene locus_tag LOCUS_25050 2105 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114273.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence675 1059 556 gene locus_tag LOCUS_25060 1059 556 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940911.1 protein_id gnl|my_center|LOCUS_25060 1317 2123 gene locus_tag LOCUS_25070 1317 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 <2710 2176 gene locus_tag LOCUS_25080 <2710 2176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083760.1:Rieske 2Fe-2S domain-containing protein >Feature sequence676 1367 858 gene locus_tag LOCUS_25090 1367 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence677 2414 606 gene locus_tag LOCUS_25100 2414 606 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence678 1328 399 gene locus_tag LOCUS_25110 1328 399 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_25110 <2703 1325 gene locus_tag LOCUS_25120 <2703 1325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972427.1:MFS transporter >Feature sequence679 365 943 gene locus_tag LOCUS_25130 365 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 1310 987 gene locus_tag LOCUS_25140 1310 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2120 1395 gene locus_tag LOCUS_25150 2120 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence680 338 78 gene locus_tag LOCUS_25160 338 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 514 338 gene locus_tag LOCUS_25170 514 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 1930 638 gene locus_tag LOCUS_25180 1930 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2213 1932 gene locus_tag LOCUS_25190 2213 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence681 135 1622 gene locus_tag LOCUS_25200 135 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1619 1927 gene locus_tag LOCUS_25210 1619 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 1949 2176 gene locus_tag LOCUS_25220 1949 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence682 1233 409 gene locus_tag LOCUS_25230 1233 409 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429025.1 protein_id gnl|my_center|LOCUS_25230 <2699 1237 gene locus_tag LOCUS_25240 <2699 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140637.1:hybrid sensor histidine kinase/response regulator >Feature sequence683 <1 546 gene locus_tag LOCUS_25250 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144635466.1:ABC transporter permease subunit 846 1244 gene locus_tag LOCUS_25260 846 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1282 1452 gene locus_tag LOCUS_25270 1282 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1606 2442 gene locus_tag LOCUS_25280 1606 2442 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence684 678 106 gene locus_tag LOCUS_25290 678 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 1418 1185 gene locus_tag LOCUS_25300 1418 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 1584 2333 gene locus_tag LOCUS_25310 1584 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence685 317 2476 gene locus_tag LOCUS_25320 317 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 >Feature sequence686 >Feature sequence687 <1 525 gene locus_tag LOCUS_25330 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027250.1:MBL fold metallo-hydrolase 572 2116 gene locus_tag LOCUS_25340 gene nrfD 572 2116 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence688 3 398 gene locus_tag LOCUS_25350 3 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 395 1120 gene locus_tag LOCUS_25360 395 1120 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526969.1 protein_id gnl|my_center|LOCUS_25360 1117 1935 gene locus_tag LOCUS_25370 1117 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 <2685 1941 gene locus_tag LOCUS_25380 <2685 1941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390736.1:cobalt-precorrin-6A reductase >Feature sequence689 831 409 gene locus_tag LOCUS_25390 831 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 1397 1062 gene locus_tag LOCUS_25400 1397 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 1366 1878 gene locus_tag LOCUS_25410 1366 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1964 2311 gene locus_tag LOCUS_25420 1964 2311 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975124.1 protein_id gnl|my_center|LOCUS_25420 2472 2675 gene locus_tag LOCUS_25430 2472 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence690 <1 2590 gene locus_tag LOCUS_25440 <1 2590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967361.1:GAF domain-containing protein >Feature sequence691 2 1729 gene locus_tag LOCUS_25450 2 1729 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085656.1 protein_id gnl|my_center|LOCUS_25450 1719 2471 gene locus_tag LOCUS_25460 1719 2471 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226414.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence692 1712 576 gene locus_tag LOCUS_25470 1712 576 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence693 2539 1457 gene locus_tag LOCUS_25480 2539 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence694 1432 1196 gene locus_tag LOCUS_25490 1432 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 1667 2641 gene locus_tag LOCUS_25500 1667 2641 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence695 <1 886 gene locus_tag LOCUS_25510 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230588.1:alpha/beta hydrolase >Feature sequence696 2053 764 gene locus_tag LOCUS_25520 2053 764 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence697 <1 626 gene locus_tag LOCUS_25530 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727958.1:IS21-like element helper ATPase IstB 1623 961 gene locus_tag LOCUS_25540 1623 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2034 2396 gene locus_tag LOCUS_25550 2034 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence698 515 1210 gene locus_tag LOCUS_25560 515 1210 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617102.1 protein_id gnl|my_center|LOCUS_25560 1288 1632 gene locus_tag LOCUS_25570 1288 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 1651 2424 gene locus_tag LOCUS_25580 1651 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence699 54 677 gene locus_tag LOCUS_25590 gene ruvA 54 677 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_25590 689 1732 gene locus_tag LOCUS_25600 gene ruvB 689 1732 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467235.1 protein_id gnl|my_center|LOCUS_25600 >Feature sequence700 <1 661 gene locus_tag LOCUS_25610 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010908020.1:putative lipid II flippase FtsW 658 1788 gene locus_tag LOCUS_25620 gene murG 658 1788 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence701 818 420 gene locus_tag LOCUS_25630 818 420 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227573.1 protein_id gnl|my_center|LOCUS_25630 1868 840 gene locus_tag LOCUS_25640 1868 840 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_25640 <2654 1893 gene locus_tag LOCUS_25650 <2654 1893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467337.1:alcohol dehydrogenase catalytic domain-containing protein >Feature sequence702 172 837 gene locus_tag LOCUS_25660 172 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2028 1240 gene locus_tag LOCUS_25670 2028 1240 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728017.1 protein_id gnl|my_center|LOCUS_25670 <2653 2065 gene locus_tag LOCUS_25680 <2653 2065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229059.1:NlpC/P60 family protein >Feature sequence703 2651 927 gene locus_tag LOCUS_25690 2651 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence704 148 1230 gene locus_tag LOCUS_25700 148 1230 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225281.1 protein_id gnl|my_center|LOCUS_25700 1237 2217 gene locus_tag LOCUS_25710 1237 2217 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence705 378 1721 gene locus_tag LOCUS_25720 378 1721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_25720 2648 1779 gene locus_tag LOCUS_25730 2648 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence706 272 568 gene locus_tag LOCUS_25740 272 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 1827 685 gene locus_tag LOCUS_25750 1827 685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168379.1 protein_id gnl|my_center|LOCUS_25750 2648 1824 gene locus_tag LOCUS_25760 2648 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence707 899 360 gene locus_tag LOCUS_25770 899 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 1243 896 gene locus_tag LOCUS_25780 1243 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 1401 1880 gene locus_tag LOCUS_25790 1401 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 1975 2292 gene locus_tag LOCUS_25800 1975 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence708 762 589 gene locus_tag LOCUS_25810 762 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1001 1381 gene locus_tag LOCUS_25820 1001 1381 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_25820 1794 1327 gene locus_tag LOCUS_25830 1794 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25830 2081 1791 gene locus_tag LOCUS_25840 2081 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25840 >Feature sequence709 1481 471 gene locus_tag LOCUS_25850 1481 471 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261595.1 protein_id gnl|my_center|LOCUS_25850 <2642 1493 gene locus_tag LOCUS_25860 <2642 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029104502.1:glycoside hydrolase family 130 protein >Feature sequence710 752 1390 gene locus_tag LOCUS_25870 752 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 1401 2042 gene locus_tag LOCUS_25880 1401 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2055 2210 gene locus_tag LOCUS_25890 2055 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 2222 2554 gene locus_tag LOCUS_25900 2222 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25900 >Feature sequence711 229 519 gene locus_tag LOCUS_25910 229 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1410 658 gene locus_tag LOCUS_25920 1410 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2299 1412 gene locus_tag LOCUS_25930 2299 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence712 649 1188 gene locus_tag LOCUS_25940 649 1188 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225705.1 protein_id gnl|my_center|LOCUS_25940 1192 2205 gene locus_tag LOCUS_25950 gene ligD 1192 2205 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225998.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence713 <1 549 gene locus_tag LOCUS_25960 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146536093.1:S8 family peptidase >Feature sequence714 >Feature sequence715 1646 90 gene locus_tag LOCUS_25970 gene istA 1646 90 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917171.1 protein_id gnl|my_center|LOCUS_25970 <2625 1898 gene locus_tag LOCUS_25980 <2625 1898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224589.1:alpha/beta hydrolase >Feature sequence716 >Feature sequence717 >Feature sequence718 2548 1058 gene locus_tag LOCUS_25990 2548 1058 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence719 <1 692 gene locus_tag LOCUS_26000 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223021.1:TetR/AcrR family transcriptional regulator 689 1171 gene locus_tag LOCUS_26010 689 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 1663 1181 gene locus_tag LOCUS_26020 1663 1181 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390805.1 protein_id gnl|my_center|LOCUS_26020 1797 2351 gene locus_tag LOCUS_26030 1797 2351 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940338.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence720 1419 766 gene locus_tag LOCUS_26040 1419 766 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226668.1 protein_id gnl|my_center|LOCUS_26040 2473 1421 gene locus_tag LOCUS_26050 2473 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence721 1164 751 gene locus_tag LOCUS_26060 1164 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 789 798 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1295 2458 gene locus_tag LOCUS_26070 1295 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence722 <1 1120 gene locus_tag LOCUS_26080 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728430.1:phosphotransferase >Feature sequence723 1849 554 gene locus_tag LOCUS_26090 1849 554 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975627.1 protein_id gnl|my_center|LOCUS_26090 2598 1846 gene locus_tag LOCUS_26100 2598 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence724 1539 382 gene locus_tag LOCUS_26110 1539 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence725 471 1181 gene locus_tag LOCUS_26120 gene regX 471 1181 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402393.1 protein_id gnl|my_center|LOCUS_26120 1243 2250 gene locus_tag LOCUS_26130 1243 2250 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence726 >Feature sequence727 100 468 gene locus_tag LOCUS_26140 100 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1501 1764 gene locus_tag LOCUS_26150 1501 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2594 1794 gene locus_tag LOCUS_26160 2594 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence728 80 736 gene locus_tag LOCUS_26170 gene tsaB 80 736 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222662.1 protein_id gnl|my_center|LOCUS_26170 733 1314 gene locus_tag LOCUS_26180 733 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1311 2315 gene locus_tag LOCUS_26190 gene tsaD 1311 2315 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence729 1095 556 gene locus_tag LOCUS_26200 1095 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1619 1092 gene locus_tag LOCUS_26210 1619 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 2388 1603 gene locus_tag LOCUS_26220 2388 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence730 1153 227 gene locus_tag LOCUS_26230 1153 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1842 1150 gene locus_tag LOCUS_26240 1842 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence731 201 773 gene locus_tag LOCUS_26250 201 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 766 2010 gene locus_tag LOCUS_26260 766 2010 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228905.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence732 >Feature sequence733 1143 2429 gene locus_tag LOCUS_26270 gene xseA 1143 2429 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776296.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence734 2279 942 gene locus_tag LOCUS_26280 gene nuoF 2279 942 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893427.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence735 549 1070 gene locus_tag LOCUS_26290 549 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2525 1242 gene locus_tag LOCUS_26300 2525 1242 CDS product IS1182-like element ISGvi6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140155.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence736 139 615 gene locus_tag LOCUS_26310 139 615 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036448818.1 protein_id gnl|my_center|LOCUS_26310 612 1847 gene locus_tag LOCUS_26320 612 1847 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189027735.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence737 1495 398 gene locus_tag LOCUS_26330 1495 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1421 2476 gene locus_tag LOCUS_26340 1421 2476 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400489.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence738 892 83 gene locus_tag LOCUS_26350 892 83 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095297.1 protein_id gnl|my_center|LOCUS_26350 2105 987 gene locus_tag LOCUS_26360 2105 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978822.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence739 924 370 gene locus_tag LOCUS_26370 924 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 1444 944 gene locus_tag LOCUS_26380 1444 944 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092308.1 protein_id gnl|my_center|LOCUS_26380 1625 1431 gene locus_tag LOCUS_26390 1625 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 1677 2408 gene locus_tag LOCUS_26400 1677 2408 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence740 408 584 gene locus_tag LOCUS_26410 408 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 1805 720 gene locus_tag LOCUS_26420 1805 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence741 <1 650 gene locus_tag LOCUS_26430 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226763.1:VWA domain-containing protein 740 1453 gene locus_tag LOCUS_26440 740 1453 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_26440 1450 2109 gene locus_tag LOCUS_26450 1450 2109 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence742 <2553 1168 gene locus_tag LOCUS_26460 <2553 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870228.1:helicase-related protein >Feature sequence743 2059 1772 gene locus_tag LOCUS_26470 2059 1772 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504852.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence744 676 1209 gene locus_tag LOCUS_26480 676 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence745 >Feature sequence746 1047 109 gene locus_tag LOCUS_26490 1047 109 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727807.1 protein_id gnl|my_center|LOCUS_26490 1562 1077 gene locus_tag LOCUS_26500 1562 1077 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726705.1 protein_id gnl|my_center|LOCUS_26500 1950 1540 gene locus_tag LOCUS_26510 1950 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 <2547 1947 gene locus_tag LOCUS_26520 <2547 1947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876912.1:coenzyme F420 hydrogenase subunit beta >Feature sequence747 1390 1007 gene locus_tag LOCUS_26530 1390 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 1445 2278 gene locus_tag LOCUS_26540 1445 2278 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730463.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence748 561 1256 gene locus_tag LOCUS_26550 561 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1253 1684 gene locus_tag LOCUS_26560 1253 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence749 >Feature sequence750 1787 714 gene locus_tag LOCUS_26570 1787 714 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence751 2180 210 gene locus_tag LOCUS_26580 2180 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence752 257 481 gene locus_tag LOCUS_26590 257 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 566 1417 gene locus_tag LOCUS_26600 566 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26600 1351 1536 gene locus_tag LOCUS_26610 1351 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence753 <1 925 gene locus_tag LOCUS_26620 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898827.1:ATP-dependent helicase DinG 1758 919 gene locus_tag LOCUS_26630 gene era 1758 919 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460854.1 protein_id gnl|my_center|LOCUS_26630 <2535 1762 gene locus_tag LOCUS_26640 <2535 1762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258059.1:hemolysin family protein >Feature sequence754 >Feature sequence755 659 2302 gene locus_tag LOCUS_26650 659 2302 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056342.1 protein_id gnl|my_center|LOCUS_26650 2200 2209 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2509 2219 gene locus_tag LOCUS_26660 2509 2219 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776066.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence756 <1 918 gene locus_tag LOCUS_26670 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742217.1:class II fructose-bisphosphatase 1799 894 gene locus_tag LOCUS_26680 1799 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence757 1781 414 gene locus_tag LOCUS_26690 1781 414 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_26690 2411 1827 gene locus_tag LOCUS_26700 2411 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence758 1569 1366 gene locus_tag LOCUS_26710 1569 1366 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_26710 <2531 1798 gene locus_tag LOCUS_26720 <2531 1798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028218.1:DUF3105 domain-containing protein >Feature sequence759 51 1127 gene locus_tag LOCUS_26730 51 1127 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 protein_id gnl|my_center|LOCUS_26730 1291 2343 gene locus_tag LOCUS_26740 1291 2343 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970739.1 protein_id gnl|my_center|LOCUS_26740 >Feature sequence760 1709 834 gene locus_tag LOCUS_26750 1709 834 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_26750 <2530 1684 gene locus_tag LOCUS_26760 <2530 1684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029292.1:ParA family protein >Feature sequence761 1 657 gene locus_tag LOCUS_26770 1 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 609 1907 gene locus_tag LOCUS_26780 609 1907 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222135.1 protein_id gnl|my_center|LOCUS_26780 <2530 1910 gene locus_tag LOCUS_26790 <2530 1910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909164.1:HAD hydrolase-like protein >Feature sequence762 1781 903 gene locus_tag LOCUS_26800 1781 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2467 1970 gene locus_tag LOCUS_26810 2467 1970 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413574.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence763 <1 821 gene locus_tag LOCUS_26820 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003411966.1:CbiQ family ECF transporter T component 1311 835 gene locus_tag LOCUS_26830 1311 835 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_26830 2207 1308 gene locus_tag LOCUS_26840 2207 1308 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_26840 >Feature sequence764 362 1738 gene locus_tag LOCUS_26850 362 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 <2526 1654 gene locus_tag LOCUS_26860 <2526 1654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228866.1:HAMP domain-containing sensor histidine kinase >Feature sequence765 1481 315 gene locus_tag LOCUS_26870 1481 315 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877954.1 protein_id gnl|my_center|LOCUS_26870 1747 1481 gene locus_tag LOCUS_26880 1747 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 1964 2296 gene locus_tag LOCUS_26890 1964 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence766 32 526 gene locus_tag LOCUS_26900 32 526 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090577.1 protein_id gnl|my_center|LOCUS_26900 705 1523 gene locus_tag LOCUS_26910 705 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 1584 1781 gene locus_tag LOCUS_26920 1584 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence767 <1 1758 gene locus_tag LOCUS_26930 <1 1758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976193.1:TIGR03960 family B12-binding radical SAM protein >Feature sequence768 1025 108 gene locus_tag LOCUS_26940 1025 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 <2513 1389 gene locus_tag LOCUS_26950 <2513 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000425823.1:amidase family protein >Feature sequence769 340 678 gene locus_tag LOCUS_26960 340 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 679 1581 gene locus_tag LOCUS_26970 679 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 1593 1853 gene locus_tag LOCUS_26980 1593 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 2047 2409 gene locus_tag LOCUS_26990 2047 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence770 499 107 gene locus_tag LOCUS_27000 499 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 2431 503 gene locus_tag LOCUS_27010 2431 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence771 1509 58 gene locus_tag LOCUS_27020 1509 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 2258 1818 gene locus_tag LOCUS_27030 2258 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27030