>Feature sequence01 723 70 gene locus_tag LOCUS_00010 723 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00010 994 788 gene locus_tag LOCUS_00020 994 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2394 1225 gene locus_tag LOCUS_00030 gene mshA 2394 1225 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402367.1 protein_id gnl|my_center|LOCUS_00030 3047 2553 gene locus_tag LOCUS_00040 3047 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3508 3047 gene locus_tag LOCUS_00050 3508 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3559 3969 gene locus_tag LOCUS_00060 gene sodN 3559 3969 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_00060 4013 4088 gene locus_tag LOCUS_t00010 4013 4088 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4247 4489 gene locus_tag LOCUS_00070 4247 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4639 4929 gene locus_tag LOCUS_00080 4639 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5295 4825 gene locus_tag LOCUS_00090 5295 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 5416 5643 gene locus_tag LOCUS_00100 5416 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 5640 5948 gene locus_tag LOCUS_00110 5640 5948 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403376.1 protein_id gnl|my_center|LOCUS_00110 6320 7774 gene locus_tag LOCUS_00120 gene cobA 6320 7774 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_00120 7786 8763 gene locus_tag LOCUS_00130 gene hemB 7786 8763 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727312.1 protein_id gnl|my_center|LOCUS_00130 8751 10046 gene locus_tag LOCUS_00140 gene hemL 8751 10046 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_00140 11049 10033 gene locus_tag LOCUS_00150 11049 10033 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_00150 11272 12156 gene locus_tag LOCUS_00160 11272 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 13460 12153 gene locus_tag LOCUS_00170 13460 12153 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727437.1 protein_id gnl|my_center|LOCUS_00170 13671 14099 gene locus_tag LOCUS_00180 13671 14099 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_00180 14099 14644 gene locus_tag LOCUS_00190 14099 14644 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061196.1 protein_id gnl|my_center|LOCUS_00190 14641 15078 gene locus_tag LOCUS_00200 14641 15078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 15075 16430 gene locus_tag LOCUS_00210 15075 16430 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222455.1 protein_id gnl|my_center|LOCUS_00210 16452 17051 gene locus_tag LOCUS_00220 16452 17051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 17053 18342 gene locus_tag LOCUS_00230 gene nuoF 17053 18342 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_00230 18335 20887 gene locus_tag LOCUS_00240 18335 20887 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 protein_id gnl|my_center|LOCUS_00240 20880 22070 gene locus_tag LOCUS_00250 gene nuoH 20880 22070 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_00250 22057 22740 gene locus_tag LOCUS_00260 gene nuoI 22057 22740 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327003.1 protein_id gnl|my_center|LOCUS_00260 22737 23288 gene locus_tag LOCUS_00270 22737 23288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 23285 23590 gene locus_tag LOCUS_00280 gene nuoK 23285 23590 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480224.1 protein_id gnl|my_center|LOCUS_00280 23593 25464 gene locus_tag LOCUS_00290 gene nuoL 23593 25464 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406351.1 protein_id gnl|my_center|LOCUS_00290 25476 27002 gene locus_tag LOCUS_00300 25476 27002 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_00300 26999 28543 gene locus_tag LOCUS_00310 26999 28543 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_00310 31413 28540 gene locus_tag LOCUS_00320 31413 28540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 31920 31426 gene locus_tag LOCUS_00330 31920 31426 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222510.1 protein_id gnl|my_center|LOCUS_00330 31947 32032 gene locus_tag LOCUS_t00020 31947 32032 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 32152 33735 gene locus_tag LOCUS_00340 gene mptB 32152 33735 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224695.1 protein_id gnl|my_center|LOCUS_00340 33725 34375 gene locus_tag LOCUS_00350 33725 34375 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227863.1 protein_id gnl|my_center|LOCUS_00350 35013 35087 gene locus_tag LOCUS_t00030 35013 35087 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 35092 35167 gene locus_tag LOCUS_t00040 35092 35167 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 35316 35480 gene locus_tag LOCUS_00360 gene rpmG 35316 35480 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393952.1 protein_id gnl|my_center|LOCUS_00360 35482 36039 gene locus_tag LOCUS_00370 35482 36039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36101 36174 gene locus_tag LOCUS_t00050 36101 36174 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 36394 38088 gene locus_tag LOCUS_00380 gene sdhA 36394 38088 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 protein_id gnl|my_center|LOCUS_00380 38088 38837 gene locus_tag LOCUS_00390 38088 38837 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228693.1 protein_id gnl|my_center|LOCUS_00390 38824 39090 gene locus_tag LOCUS_00400 38824 39090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 39087 39722 gene locus_tag LOCUS_00410 39087 39722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 39772 39984 gene locus_tag LOCUS_00420 39772 39984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 40107 40352 gene locus_tag LOCUS_00430 40107 40352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 40624 40349 gene locus_tag LOCUS_00440 40624 40349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 40523 40840 gene locus_tag LOCUS_00450 40523 40840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 40864 42015 gene locus_tag LOCUS_00460 gene sucC 40864 42015 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974164.1 protein_id gnl|my_center|LOCUS_00460 42012 42896 gene locus_tag LOCUS_00470 gene sucD 42012 42896 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881050.1 protein_id gnl|my_center|LOCUS_00470 43244 42984 gene locus_tag LOCUS_00480 43244 42984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 43230 43550 gene locus_tag LOCUS_00490 43230 43550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 43547 45022 gene locus_tag LOCUS_00500 gene purH 43547 45022 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296378.1 protein_id gnl|my_center|LOCUS_00500 45030 45893 gene locus_tag LOCUS_00510 45030 45893 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_00510 45883 46722 gene locus_tag LOCUS_00520 gene metF 45883 46722 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_00520 46841 48274 gene locus_tag LOCUS_00530 46841 48274 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957528.1 protein_id gnl|my_center|LOCUS_00530 48446 49024 gene locus_tag LOCUS_00540 48446 49024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 49656 49159 gene locus_tag LOCUS_00550 49656 49159 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357579.1 protein_id gnl|my_center|LOCUS_00550 50570 49713 gene locus_tag LOCUS_00560 50570 49713 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729452.1 protein_id gnl|my_center|LOCUS_00560 51780 50557 gene locus_tag LOCUS_00570 51780 50557 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613522.1 protein_id gnl|my_center|LOCUS_00570 53336 51777 gene locus_tag LOCUS_00580 53336 51777 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030683778.1 protein_id gnl|my_center|LOCUS_00580 54322 53333 gene locus_tag LOCUS_00590 54322 53333 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 protein_id gnl|my_center|LOCUS_00590 54369 54614 gene locus_tag LOCUS_00600 54369 54614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 54832 55665 gene locus_tag LOCUS_00610 54832 55665 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255197.1 protein_id gnl|my_center|LOCUS_00610 56040 55792 gene locus_tag LOCUS_00620 56040 55792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 56239 56490 gene locus_tag LOCUS_00630 56239 56490 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014300514.1 protein_id gnl|my_center|LOCUS_00630 56501 57295 gene locus_tag LOCUS_00640 gene ftcD 56501 57295 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_00640 57918 57292 gene locus_tag LOCUS_00650 57918 57292 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_00650 58115 59110 gene locus_tag LOCUS_00660 gene gmd 58115 59110 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_00660 59458 60198 gene locus_tag LOCUS_00670 59458 60198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 60195 60329 gene locus_tag LOCUS_00680 60195 60329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 60326 60793 gene locus_tag LOCUS_00690 60326 60793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 60793 62766 gene locus_tag LOCUS_00700 60793 62766 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_00700 62763 63293 gene locus_tag LOCUS_00710 62763 63293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 63293 64297 gene locus_tag LOCUS_00720 63293 64297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 64300 64911 gene locus_tag LOCUS_00730 64300 64911 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_00730 65638 64916 gene locus_tag LOCUS_00740 65638 64916 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434132.1 protein_id gnl|my_center|LOCUS_00740 65742 66857 gene locus_tag LOCUS_00750 65742 66857 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854996.1 protein_id gnl|my_center|LOCUS_00750 66866 67099 gene locus_tag LOCUS_00760 66866 67099 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 protein_id gnl|my_center|LOCUS_00760 67104 68024 gene locus_tag LOCUS_00770 67104 68024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 68018 69157 gene locus_tag LOCUS_00780 68018 69157 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_00780 69277 70869 gene locus_tag LOCUS_00790 69277 70869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 70917 71783 gene locus_tag LOCUS_00800 70917 71783 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_00800 71790 73217 gene locus_tag LOCUS_00810 71790 73217 CDS product histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907937.1 protein_id gnl|my_center|LOCUS_00810 73289 74047 gene locus_tag LOCUS_00820 73289 74047 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_00820 74057 75028 gene locus_tag LOCUS_00830 74057 75028 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887615.1 protein_id gnl|my_center|LOCUS_00830 75703 75041 gene locus_tag LOCUS_00840 gene bluB 75703 75041 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228822.1 protein_id gnl|my_center|LOCUS_00840 75781 77640 gene locus_tag LOCUS_00850 75781 77640 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_00850 78374 77652 gene locus_tag LOCUS_00860 78374 77652 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_00860 78553 78969 gene locus_tag LOCUS_00870 gene bcp 78553 78969 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412944.1 protein_id gnl|my_center|LOCUS_00870 78999 80165 gene locus_tag LOCUS_00880 78999 80165 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405724.1 protein_id gnl|my_center|LOCUS_00880 80162 80800 gene locus_tag LOCUS_00890 80162 80800 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014086.1 protein_id gnl|my_center|LOCUS_00890 80784 81275 gene locus_tag LOCUS_00900 80784 81275 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110636.1 protein_id gnl|my_center|LOCUS_00900 81236 81952 gene locus_tag LOCUS_00910 81236 81952 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014087.1 protein_id gnl|my_center|LOCUS_00910 82170 82454 gene locus_tag LOCUS_00920 82170 82454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 82477 83094 gene locus_tag LOCUS_00930 82477 83094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 83260 83688 gene locus_tag LOCUS_00940 gene rplK 83260 83688 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546433.1 protein_id gnl|my_center|LOCUS_00940 83706 84431 gene locus_tag LOCUS_00950 gene rplA 83706 84431 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_00950 84592 85119 gene locus_tag LOCUS_00960 gene rplJ 84592 85119 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_00960 85149 85565 gene locus_tag LOCUS_00970 gene rplL 85149 85565 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531413.1 protein_id gnl|my_center|LOCUS_00970 85773 89321 gene locus_tag LOCUS_00980 gene rpoB 85773 89321 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_00980 89322 93167 gene locus_tag LOCUS_00990 89322 93167 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222587.1 protein_id gnl|my_center|LOCUS_00990 93302 93673 gene locus_tag LOCUS_01000 gene rpsL 93302 93673 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_01000 93673 94143 gene locus_tag LOCUS_01010 gene rpsG 93673 94143 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055588.1 protein_id gnl|my_center|LOCUS_01010 94179 96266 gene locus_tag LOCUS_01020 gene fusA 94179 96266 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_01020 96337 97524 gene locus_tag LOCUS_01030 gene tuf 96337 97524 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222603.1 protein_id gnl|my_center|LOCUS_01030 97604 97927 gene locus_tag LOCUS_01040 gene rpsJ 97604 97927 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_01040 98068 98709 gene locus_tag LOCUS_01050 gene rplC 98068 98709 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_01050 98712 99374 gene locus_tag LOCUS_01060 gene rplD 98712 99374 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974266.1 protein_id gnl|my_center|LOCUS_01060 99371 99667 gene locus_tag LOCUS_01070 gene rplW 99371 99667 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814498.1 protein_id gnl|my_center|LOCUS_01070 99811 100512 gene locus_tag LOCUS_01080 gene rplB 99811 100512 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_01080 100515 100796 gene locus_tag LOCUS_01090 gene rpsS 100515 100796 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055647.1 protein_id gnl|my_center|LOCUS_01090 100796 101416 gene locus_tag LOCUS_01100 100796 101416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 101420 102319 gene locus_tag LOCUS_01110 gene rpsC 101420 102319 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080488.1 protein_id gnl|my_center|LOCUS_01110 102322 102759 gene locus_tag LOCUS_01120 gene rplP 102322 102759 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_01120 102756 102965 gene locus_tag LOCUS_01130 102756 102965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 102962 103234 gene locus_tag LOCUS_01140 gene rpsQ 102962 103234 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459100.1 protein_id gnl|my_center|LOCUS_01140 103231 103599 gene locus_tag LOCUS_01150 gene rplN 103231 103599 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_01150 103596 103904 gene locus_tag LOCUS_01160 gene rplX 103596 103904 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_01160 103901 104470 gene locus_tag LOCUS_01170 gene rplE 103901 104470 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222611.1 protein_id gnl|my_center|LOCUS_01170 104471 104656 gene locus_tag LOCUS_01180 104471 104656 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_01180 104666 105076 gene locus_tag LOCUS_01190 gene rpsH 104666 105076 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_01190 105088 105627 gene locus_tag LOCUS_01200 gene rplF 105088 105627 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_01200 105635 105994 gene locus_tag LOCUS_01210 gene rplR 105635 105994 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_01210 105994 106536 gene locus_tag LOCUS_01220 gene rpsE 105994 106536 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854347.1 protein_id gnl|my_center|LOCUS_01220 106529 106729 gene locus_tag LOCUS_01230 106529 106729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 106726 107226 gene locus_tag LOCUS_01240 gene rplO 106726 107226 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055720.1 protein_id gnl|my_center|LOCUS_01240 107248 108543 gene locus_tag LOCUS_01250 gene secY 107248 108543 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222619.1 protein_id gnl|my_center|LOCUS_01250 108544 109230 gene locus_tag LOCUS_01260 108544 109230 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_01260 109223 109963 gene locus_tag LOCUS_01270 gene map 109223 109963 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_01270 110171 110320 gene locus_tag LOCUS_01280 110171 110320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 110480 110857 gene locus_tag LOCUS_01290 gene rpsM 110480 110857 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105472.1 protein_id gnl|my_center|LOCUS_01290 110895 111293 gene locus_tag LOCUS_01300 gene rpsK 110895 111293 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908645.1 protein_id gnl|my_center|LOCUS_01300 111293 111919 gene locus_tag LOCUS_01310 gene rpsD 111293 111919 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583370.1 protein_id gnl|my_center|LOCUS_01310 111959 112897 gene locus_tag LOCUS_01320 111959 112897 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892912.1 protein_id gnl|my_center|LOCUS_01320 112897 113253 gene locus_tag LOCUS_01330 112897 113253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 113261 114094 gene locus_tag LOCUS_01340 gene truA 113261 114094 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854437.1 protein_id gnl|my_center|LOCUS_01340 114123 114584 gene locus_tag LOCUS_01350 gene rplM 114123 114584 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_01350 114603 114995 gene locus_tag LOCUS_01360 gene rpsI 114603 114995 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476332.1 protein_id gnl|my_center|LOCUS_01360 114995 116323 gene locus_tag LOCUS_01370 gene glmM 114995 116323 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_01370 116341 118170 gene locus_tag LOCUS_01380 gene glmS 116341 118170 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_01380 119158 118178 gene locus_tag LOCUS_01390 119158 118178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 119524 120177 gene locus_tag LOCUS_01400 119524 120177 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103336743.1 protein_id gnl|my_center|LOCUS_01400 120307 121914 gene locus_tag LOCUS_01410 120307 121914 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113364.1 protein_id gnl|my_center|LOCUS_01410 122049 123524 gene locus_tag LOCUS_01420 122049 123524 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452504.1 protein_id gnl|my_center|LOCUS_01420 123521 124300 gene locus_tag LOCUS_01430 123521 124300 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230125.1 protein_id gnl|my_center|LOCUS_01430 125899 124796 gene locus_tag LOCUS_01440 125899 124796 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275270.1 protein_id gnl|my_center|LOCUS_01440 126009 126938 gene locus_tag LOCUS_01450 126009 126938 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521379.1 protein_id gnl|my_center|LOCUS_01450 126935 127321 gene locus_tag LOCUS_01460 126935 127321 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_01460 127344 128765 gene locus_tag LOCUS_01470 127344 128765 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969363.1 protein_id gnl|my_center|LOCUS_01470 128762 129877 gene locus_tag LOCUS_01480 128762 129877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 129874 130443 gene locus_tag LOCUS_01490 gene udg 129874 130443 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053779.1 protein_id gnl|my_center|LOCUS_01490 130461 130907 gene locus_tag LOCUS_01500 130461 130907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 130891 131574 gene locus_tag LOCUS_01510 130891 131574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 131571 132095 gene locus_tag LOCUS_01520 gene rimI 131571 132095 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_01520 132088 133101 gene locus_tag LOCUS_01530 gene tsaD 132088 133101 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_01530 133225 133518 gene locus_tag LOCUS_01540 gene groES 133225 133518 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_01540 133519 135165 gene locus_tag LOCUS_01550 gene groL 133519 135165 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_01550 135231 135875 gene locus_tag LOCUS_01560 135231 135875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 136513 135854 gene locus_tag LOCUS_01570 136513 135854 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084146.1 protein_id gnl|my_center|LOCUS_01570 136457 136654 gene locus_tag LOCUS_01580 136457 136654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 137561 137193 gene locus_tag LOCUS_01590 137561 137193 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053642.1 protein_id gnl|my_center|LOCUS_01590 137881 137558 gene locus_tag LOCUS_01600 137881 137558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 138292 137891 gene locus_tag LOCUS_01610 138292 137891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 139221 138292 gene locus_tag LOCUS_01620 139221 138292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 139349 140512 gene locus_tag LOCUS_01630 139349 140512 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_01630 140513 142060 gene locus_tag LOCUS_01640 gene guaA 140513 142060 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_01640 142145 143023 gene locus_tag LOCUS_01650 142145 143023 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207225.1 protein_id gnl|my_center|LOCUS_01650 143147 145288 gene locus_tag LOCUS_01660 gene pcrA 143147 145288 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_01660 146486 145746 gene locus_tag LOCUS_01670 146486 145746 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803754.1 protein_id gnl|my_center|LOCUS_01670 146912 146987 gene locus_tag LOCUS_t00060 146912 146987 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 147002 147352 gene locus_tag LOCUS_01680 147002 147352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 >Feature sequence02 284 652 gene locus_tag LOCUS_01690 284 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 3508 2675 gene locus_tag LOCUS_01700 3508 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 6309 4048 gene locus_tag LOCUS_01710 6309 4048 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_01710 6511 7107 gene locus_tag LOCUS_01720 6511 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 8639 7158 gene locus_tag LOCUS_01730 8639 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 8950 9642 gene locus_tag LOCUS_01740 8950 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 9774 10202 gene locus_tag LOCUS_01750 gene mraZ 9774 10202 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856549.1 protein_id gnl|my_center|LOCUS_01750 10195 11166 gene locus_tag LOCUS_01760 gene rsmH 10195 11166 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939782.1 protein_id gnl|my_center|LOCUS_01760 11159 11602 gene locus_tag LOCUS_01770 11159 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 11592 13412 gene locus_tag LOCUS_01780 gene ftsI 11592 13412 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_01780 13559 15085 gene locus_tag LOCUS_01790 13559 15085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 15082 16119 gene locus_tag LOCUS_01800 gene mraY 15082 16119 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228040.1 protein_id gnl|my_center|LOCUS_01800 16116 17402 gene locus_tag LOCUS_01810 gene murD 16116 17402 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_01810 17399 18505 gene locus_tag LOCUS_01820 gene spoVE 17399 18505 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_01820 18502 19614 gene locus_tag LOCUS_01830 gene murG 18502 19614 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766568.1 protein_id gnl|my_center|LOCUS_01830 19593 20966 gene locus_tag LOCUS_01840 gene murC 19593 20966 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_01840 20963 21898 gene locus_tag LOCUS_01850 gene murB 20963 21898 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056225.1 protein_id gnl|my_center|LOCUS_01850 21898 22635 gene locus_tag LOCUS_01860 21898 22635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 22762 23847 gene locus_tag LOCUS_01870 gene ftsZ 22762 23847 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_01870 23847 24491 gene locus_tag LOCUS_01880 23847 24491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 24482 25132 gene locus_tag LOCUS_01890 24482 25132 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_01890 25176 25700 gene locus_tag LOCUS_01900 25176 25700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 25690 25956 gene locus_tag LOCUS_01910 25690 25956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 25983 26777 gene locus_tag LOCUS_01920 25983 26777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 29990 26796 gene locus_tag LOCUS_01930 gene ileS 29990 26796 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950555.1 protein_id gnl|my_center|LOCUS_01930 30116 30568 gene locus_tag LOCUS_01940 30116 30568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 30595 31017 gene locus_tag LOCUS_01950 30595 31017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01950 31039 31962 gene locus_tag LOCUS_01960 31039 31962 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_01960 32813 31959 gene locus_tag LOCUS_01970 32813 31959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 33200 34270 gene locus_tag LOCUS_01980 33200 34270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 34270 35181 gene locus_tag LOCUS_01990 34270 35181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_01990 35171 35971 gene locus_tag LOCUS_02000 35171 35971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 36201 36019 gene locus_tag LOCUS_02010 36201 36019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 36436 37899 gene locus_tag LOCUS_02020 36436 37899 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229619.1 protein_id gnl|my_center|LOCUS_02020 38066 38563 gene locus_tag LOCUS_02030 38066 38563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 41170 38579 gene locus_tag LOCUS_02040 41170 38579 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_02040 41563 41174 gene locus_tag LOCUS_02050 41563 41174 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_02050 41714 42880 gene locus_tag LOCUS_02060 41714 42880 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161796623.1 protein_id gnl|my_center|LOCUS_02060 42991 43446 gene locus_tag LOCUS_02070 42991 43446 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731234.1 protein_id gnl|my_center|LOCUS_02070 43443 43925 gene locus_tag LOCUS_02080 gene rpiB 43443 43925 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_02080 44227 45072 gene locus_tag LOCUS_02090 44227 45072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 45062 46195 gene locus_tag LOCUS_02100 45062 46195 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035547.1 protein_id gnl|my_center|LOCUS_02100 46328 46600 gene locus_tag LOCUS_02110 46328 46600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 46853 48460 gene locus_tag LOCUS_02120 46853 48460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 48648 49904 gene locus_tag LOCUS_02130 48648 49904 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_02130 50628 49921 gene locus_tag LOCUS_02140 50628 49921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 51197 50976 gene locus_tag LOCUS_02150 51197 50976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 51081 51575 gene locus_tag LOCUS_02160 51081 51575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 51625 53001 gene locus_tag LOCUS_02170 gene xseA 51625 53001 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037447.1 protein_id gnl|my_center|LOCUS_02170 53001 53273 gene locus_tag LOCUS_02180 53001 53273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 53362 53434 gene locus_tag LOCUS_t00070 53362 53434 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 54109 55812 gene locus_tag LOCUS_02190 54109 55812 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226824.1 protein_id gnl|my_center|LOCUS_02190 56319 55801 gene locus_tag LOCUS_02200 56319 55801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 57051 56464 gene locus_tag LOCUS_02210 57051 56464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 58123 57044 gene locus_tag LOCUS_02220 58123 57044 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_02220 58313 59383 gene locus_tag LOCUS_02230 58313 59383 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022231.1 protein_id gnl|my_center|LOCUS_02230 60789 59380 gene locus_tag LOCUS_02240 gene lpdA 60789 59380 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_02240 62027 60792 gene locus_tag LOCUS_02250 gene pdhC 62027 60792 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863430.1 protein_id gnl|my_center|LOCUS_02250 63072 62092 gene locus_tag LOCUS_02260 63072 62092 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943294.1 protein_id gnl|my_center|LOCUS_02260 64142 63072 gene locus_tag LOCUS_02270 gene pdhA 64142 63072 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_02270 64720 64331 gene locus_tag LOCUS_02280 64720 64331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 67666 64736 gene locus_tag LOCUS_02290 gene fdhF 67666 64736 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245240.1 protein_id gnl|my_center|LOCUS_02290 68212 71553 gene locus_tag LOCUS_02300 68212 71553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 71743 71668 gene locus_tag LOCUS_t00080 71743 71668 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 71878 72966 gene locus_tag LOCUS_02310 71878 72966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 72963 73916 gene locus_tag LOCUS_02320 72963 73916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 73988 75022 gene locus_tag LOCUS_02330 73988 75022 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_02330 76529 75249 gene locus_tag LOCUS_02340 76529 75249 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980484.1 protein_id gnl|my_center|LOCUS_02340 79489 76559 gene locus_tag LOCUS_02350 79489 76559 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142749.1 protein_id gnl|my_center|LOCUS_02350 79818 80417 gene locus_tag LOCUS_02360 79818 80417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 80572 82230 gene locus_tag LOCUS_02370 gene pgi 80572 82230 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730607.1 protein_id gnl|my_center|LOCUS_02370 82296 83375 gene locus_tag LOCUS_02380 gene tal 82296 83375 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_02380 84059 83760 gene locus_tag LOCUS_02390 84059 83760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 84255 84641 gene locus_tag LOCUS_02400 84255 84641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 84849 84661 gene locus_tag LOCUS_02410 84849 84661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 84955 86256 gene locus_tag LOCUS_02420 gene hisD 84955 86256 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_02420 86253 87287 gene locus_tag LOCUS_02430 86253 87287 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_02430 87284 87877 gene locus_tag LOCUS_02440 gene hisB 87284 87877 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393530.1 protein_id gnl|my_center|LOCUS_02440 87870 88478 gene locus_tag LOCUS_02450 gene hisH 87870 88478 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404308.1 protein_id gnl|my_center|LOCUS_02450 88475 89227 gene locus_tag LOCUS_02460 gene hisA 88475 89227 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586462.1 protein_id gnl|my_center|LOCUS_02460 89215 89985 gene locus_tag LOCUS_02470 gene hisF 89215 89985 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_02470 89982 90311 gene locus_tag LOCUS_02480 89982 90311 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_02480 90308 90688 gene locus_tag LOCUS_02490 90308 90688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 90675 92126 gene locus_tag LOCUS_02500 90675 92126 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 protein_id gnl|my_center|LOCUS_02500 92898 92083 gene locus_tag LOCUS_02510 92898 92083 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532568.1 protein_id gnl|my_center|LOCUS_02510 94306 92945 gene locus_tag LOCUS_02520 94306 92945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 94982 94299 gene locus_tag LOCUS_02530 gene resD 94982 94299 CDS product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426861.1 protein_id gnl|my_center|LOCUS_02530 96806 95022 gene locus_tag LOCUS_02540 96806 95022 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_02540 96923 97744 gene locus_tag LOCUS_02550 gene trpC 96923 97744 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057938.1 protein_id gnl|my_center|LOCUS_02550 97707 98369 gene locus_tag LOCUS_02560 97707 98369 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082737.1 protein_id gnl|my_center|LOCUS_02560 98366 99535 gene locus_tag LOCUS_02570 gene trpB 98366 99535 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230605.1 protein_id gnl|my_center|LOCUS_02570 99532 100311 gene locus_tag LOCUS_02580 gene trpA 99532 100311 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_02580 100329 101339 gene locus_tag LOCUS_02590 gene gnd 100329 101339 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405880.1 protein_id gnl|my_center|LOCUS_02590 102946 101345 gene locus_tag LOCUS_02600 102946 101345 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296542.1 protein_id gnl|my_center|LOCUS_02600 104265 103057 gene locus_tag LOCUS_02610 gene fabF 104265 103057 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_02610 104504 104262 gene locus_tag LOCUS_02620 gene acpP 104504 104262 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280528.1 protein_id gnl|my_center|LOCUS_02620 105308 104589 gene locus_tag LOCUS_02630 gene fabG 105308 104589 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_02630 106222 105305 gene locus_tag LOCUS_02640 106222 105305 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975025.1 protein_id gnl|my_center|LOCUS_02640 107479 106277 gene locus_tag LOCUS_02650 gene fabD 107479 106277 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_02650 107769 107853 gene locus_tag LOCUS_t00090 107769 107853 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 108538 107915 gene locus_tag LOCUS_02660 108538 107915 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728735.1 protein_id gnl|my_center|LOCUS_02660 108435 108686 gene locus_tag LOCUS_02670 108435 108686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 108735 109346 gene locus_tag LOCUS_02680 108735 109346 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_02680 109536 109327 gene locus_tag LOCUS_02690 109536 109327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 109477 111981 gene locus_tag LOCUS_02700 gene polA 109477 111981 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_02700 112078 113391 gene locus_tag LOCUS_02710 gene rpsA 112078 113391 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950568.1 protein_id gnl|my_center|LOCUS_02710 113397 113999 gene locus_tag LOCUS_02720 113397 113999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 114046 114870 gene locus_tag LOCUS_02730 114046 114870 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_02730 114987 116978 gene locus_tag LOCUS_02740 gene uvrB 114987 116978 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_02740 117079 118431 gene locus_tag LOCUS_02750 117079 118431 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_02750 118548 118982 gene locus_tag LOCUS_02760 118548 118982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 119601 119395 gene locus_tag LOCUS_02770 119601 119395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 >Feature sequence03 2101 1259 gene locus_tag LOCUS_02780 2101 1259 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_02780 3350 2112 gene locus_tag LOCUS_02790 3350 2112 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_02790 4456 3398 gene locus_tag LOCUS_02800 gene proB 4456 3398 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909083.1 protein_id gnl|my_center|LOCUS_02800 5733 4456 gene locus_tag LOCUS_02810 gene obgE 5733 4456 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082646.1 protein_id gnl|my_center|LOCUS_02810 6105 5827 gene locus_tag LOCUS_02820 gene rpmA 6105 5827 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228479.1 protein_id gnl|my_center|LOCUS_02820 6450 6142 gene locus_tag LOCUS_02830 gene rplU 6450 6142 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811712.1 protein_id gnl|my_center|LOCUS_02830 7837 6470 gene locus_tag LOCUS_02840 7837 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02840 10313 8280 gene locus_tag LOCUS_02850 gene mrdA 10313 8280 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_02850 10827 10315 gene locus_tag LOCUS_02860 10827 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 11663 10824 gene locus_tag LOCUS_02870 gene mreC 11663 10824 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_02870 12711 11677 gene locus_tag LOCUS_02880 12711 11677 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_02880 13163 12747 gene locus_tag LOCUS_02890 gene ndk 13163 12747 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256592.1 protein_id gnl|my_center|LOCUS_02890 14495 13206 gene locus_tag LOCUS_02900 14495 13206 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389673.1 protein_id gnl|my_center|LOCUS_02900 15757 14495 gene locus_tag LOCUS_02910 gene clpX 15757 14495 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_02910 16466 15846 gene locus_tag LOCUS_02920 gene clpP 16466 15846 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_02920 17903 16530 gene locus_tag LOCUS_02930 gene tig 17903 16530 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_02930 18318 17950 gene locus_tag LOCUS_02940 18318 17950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 20200 18521 gene locus_tag LOCUS_02950 20200 18521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 20788 20715 gene locus_tag LOCUS_t00100 20788 20715 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 20882 20808 gene locus_tag LOCUS_t00110 20882 20808 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21525 20917 gene locus_tag LOCUS_02960 21525 20917 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_02960 21635 22435 gene locus_tag LOCUS_02970 21635 22435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 22445 23254 gene locus_tag LOCUS_02980 22445 23254 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_02980 23263 23778 gene locus_tag LOCUS_02990 23263 23778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 23819 24178 gene locus_tag LOCUS_03000 23819 24178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 24215 24811 gene locus_tag LOCUS_03010 24215 24811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 26472 24808 gene locus_tag LOCUS_03020 26472 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 27581 26547 gene locus_tag LOCUS_03030 27581 26547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_03030 27690 28790 gene locus_tag LOCUS_03040 27690 28790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 29750 28680 gene locus_tag LOCUS_03050 gene zapE 29750 28680 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485435.1 protein_id gnl|my_center|LOCUS_03050 29981 30634 gene locus_tag LOCUS_03060 29981 30634 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_03060 31997 30636 gene locus_tag LOCUS_03070 31997 30636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 34966 32012 gene locus_tag LOCUS_03080 34966 32012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 35854 34976 gene locus_tag LOCUS_03090 35854 34976 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649925.1 protein_id gnl|my_center|LOCUS_03090 36971 35874 gene locus_tag LOCUS_03100 36971 35874 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_03100 38038 36968 gene locus_tag LOCUS_03110 38038 36968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 39141 38035 gene locus_tag LOCUS_03120 39141 38035 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222919.1 protein_id gnl|my_center|LOCUS_03120 39285 40211 gene locus_tag LOCUS_03130 gene cofD 39285 40211 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_03130 40202 40888 gene locus_tag LOCUS_03140 40202 40888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 41842 40877 gene locus_tag LOCUS_03150 gene galE1 41842 40877 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104180.1 protein_id gnl|my_center|LOCUS_03150 42888 41839 gene locus_tag LOCUS_03160 42888 41839 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417097.1 protein_id gnl|my_center|LOCUS_03160 43552 42905 gene locus_tag LOCUS_03170 43552 42905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 44440 43565 gene locus_tag LOCUS_03180 44440 43565 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893217.1 protein_id gnl|my_center|LOCUS_03180 45309 44431 gene locus_tag LOCUS_03190 gene rfbD 45309 44431 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111926.1 protein_id gnl|my_center|LOCUS_03190 46316 45306 gene locus_tag LOCUS_03200 gene rfbB 46316 45306 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_03200 47412 46345 gene locus_tag LOCUS_03210 47412 46345 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_03210 48607 47471 gene locus_tag LOCUS_03220 48607 47471 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412771.1 protein_id gnl|my_center|LOCUS_03220 49220 48609 gene locus_tag LOCUS_03230 49220 48609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 49441 51234 gene locus_tag LOCUS_03240 49441 51234 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893197.1 protein_id gnl|my_center|LOCUS_03240 51291 52454 gene locus_tag LOCUS_03250 51291 52454 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727819.1 protein_id gnl|my_center|LOCUS_03250 52457 53104 gene locus_tag LOCUS_03260 52457 53104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 53120 54286 gene locus_tag LOCUS_03270 gene moeB 53120 54286 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_03270 54769 54308 gene locus_tag LOCUS_03280 gene dps 54769 54308 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326579.1 protein_id gnl|my_center|LOCUS_03280 54887 56455 gene locus_tag LOCUS_03290 54887 56455 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_03290 57433 56471 gene locus_tag LOCUS_03300 57433 56471 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053875.1 protein_id gnl|my_center|LOCUS_03300 57677 58267 gene locus_tag LOCUS_03310 57677 58267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 59656 58289 gene locus_tag LOCUS_03320 59656 58289 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775677.1 protein_id gnl|my_center|LOCUS_03320 60252 59713 gene locus_tag LOCUS_03330 60252 59713 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_03330 60300 63755 gene locus_tag LOCUS_03340 gene metH 60300 63755 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_03340 63886 65181 gene locus_tag LOCUS_03350 63886 65181 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030387.1 protein_id gnl|my_center|LOCUS_03350 65373 66812 gene locus_tag LOCUS_03360 65373 66812 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205459.1 protein_id gnl|my_center|LOCUS_03360 69273 66847 gene locus_tag LOCUS_03370 gene pheT 69273 66847 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_03370 70337 69270 gene locus_tag LOCUS_03380 gene pheS 70337 69270 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_03380 71032 70364 gene locus_tag LOCUS_03390 71032 70364 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933546.1 protein_id gnl|my_center|LOCUS_03390 71506 71150 gene locus_tag LOCUS_03400 gene rplT 71506 71150 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559056.1 protein_id gnl|my_center|LOCUS_03400 71767 71573 gene locus_tag LOCUS_03410 gene rpmI 71767 71573 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720098.1 protein_id gnl|my_center|LOCUS_03410 72546 71800 gene locus_tag LOCUS_03420 72546 71800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 72530 72820 gene locus_tag LOCUS_03430 72530 72820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 73017 72817 gene locus_tag LOCUS_03440 73017 72817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 73979 73104 gene locus_tag LOCUS_03450 gene hisG 73979 73104 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_03450 74466 73981 gene locus_tag LOCUS_03460 gene ribE 74466 73981 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963913.1 protein_id gnl|my_center|LOCUS_03460 75697 74483 gene locus_tag LOCUS_03470 75697 74483 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407334.1 protein_id gnl|my_center|LOCUS_03470 76292 75714 gene locus_tag LOCUS_03480 76292 75714 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407318.1 protein_id gnl|my_center|LOCUS_03480 77360 76341 gene locus_tag LOCUS_03490 gene ribD 77360 76341 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880032.1 protein_id gnl|my_center|LOCUS_03490 77857 77375 gene locus_tag LOCUS_03500 77857 77375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 78756 77872 gene locus_tag LOCUS_03510 gene fmt 78756 77872 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310212.1 protein_id gnl|my_center|LOCUS_03510 79354 78761 gene locus_tag LOCUS_03520 gene def 79354 78761 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_03520 79302 80240 gene locus_tag LOCUS_03530 gene speB 79302 80240 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_03530 81328 80237 gene locus_tag LOCUS_03540 81328 80237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 83085 81328 gene locus_tag LOCUS_03550 83085 81328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 84957 83185 gene locus_tag LOCUS_03560 84957 83185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 86323 84947 gene locus_tag LOCUS_03570 gene metK 86323 84947 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_03570 87649 86468 gene locus_tag LOCUS_03580 gene coaBC 87649 86468 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392412.1 protein_id gnl|my_center|LOCUS_03580 87899 87672 gene locus_tag LOCUS_03590 gene rpoZ 87899 87672 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_03590 88411 88004 gene locus_tag LOCUS_03600 88411 88004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 88785 88567 gene locus_tag LOCUS_03610 88785 88567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 89636 88959 gene locus_tag LOCUS_03620 gene pyrF 89636 88959 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_03620 90583 89672 gene locus_tag LOCUS_03630 90583 89672 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879959.1 protein_id gnl|my_center|LOCUS_03630 93869 90570 gene locus_tag LOCUS_03640 gene carB 93869 90570 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_03640 95004 93871 gene locus_tag LOCUS_03650 gene carA 95004 93871 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931760.1 protein_id gnl|my_center|LOCUS_03650 96335 95001 gene locus_tag LOCUS_03660 96335 95001 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485025.1 protein_id gnl|my_center|LOCUS_03660 97260 96337 gene locus_tag LOCUS_03670 97260 96337 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_03670 97767 97261 gene locus_tag LOCUS_03680 gene pyrR 97767 97261 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_03680 98845 98063 gene locus_tag LOCUS_03690 98845 98063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 99593 98940 gene locus_tag LOCUS_03700 99593 98940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 101542 99593 gene locus_tag LOCUS_03710 gene ctaD 101542 99593 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057845.1 protein_id gnl|my_center|LOCUS_03710 102471 101554 gene locus_tag LOCUS_03720 102471 101554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 103133 102471 gene locus_tag LOCUS_03730 103133 102471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 103831 103277 gene locus_tag LOCUS_03740 103831 103277 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932702.1 protein_id gnl|my_center|LOCUS_03740 104793 103888 gene locus_tag LOCUS_03750 104793 103888 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_03750 104888 106060 gene locus_tag LOCUS_03760 104888 106060 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082355.1 protein_id gnl|my_center|LOCUS_03760 106092 106658 gene locus_tag LOCUS_03770 gene efp 106092 106658 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_03770 106651 107067 gene locus_tag LOCUS_03780 gene nusB 106651 107067 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722486.1 protein_id gnl|my_center|LOCUS_03780 107735 107076 gene locus_tag LOCUS_03790 107735 107076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 108890 107883 gene locus_tag LOCUS_03800 108890 107883 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_03800 112447 108887 gene locus_tag LOCUS_03810 gene nifJ 112447 108887 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 protein_id gnl|my_center|LOCUS_03810 114072 112447 gene locus_tag LOCUS_03820 114072 112447 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_03820 114492 114322 gene locus_tag LOCUS_03830 114492 114322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 114491 115180 gene locus_tag LOCUS_03840 114491 115180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 116043 115177 gene locus_tag LOCUS_03850 116043 115177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 116125 117606 gene locus_tag LOCUS_03860 116125 117606 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_03860 118269 117679 gene locus_tag LOCUS_03870 118269 117679 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_03870 >Feature sequence04 732 1013 gene locus_tag LOCUS_03880 732 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 1114 2655 gene locus_tag LOCUS_03890 1114 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 2731 3537 gene locus_tag LOCUS_03900 2731 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4515 3571 gene locus_tag LOCUS_03910 4515 3571 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_03910 6218 4545 gene locus_tag LOCUS_03920 gene treS 6218 4545 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973556.1 protein_id gnl|my_center|LOCUS_03920 7003 6224 gene locus_tag LOCUS_03930 7003 6224 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 protein_id gnl|my_center|LOCUS_03930 7965 7000 gene locus_tag LOCUS_03940 gene meaB 7965 7000 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_03940 9231 7966 gene locus_tag LOCUS_03950 gene murA 9231 7966 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 protein_id gnl|my_center|LOCUS_03950 9334 10794 gene locus_tag LOCUS_03960 9334 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 11432 11220 gene locus_tag LOCUS_03970 11432 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 12057 11473 gene locus_tag LOCUS_03980 12057 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 12550 12095 gene locus_tag LOCUS_03990 12550 12095 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225733.1 protein_id gnl|my_center|LOCUS_03990 13956 12565 gene locus_tag LOCUS_04000 13956 12565 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_04000 14025 14966 gene locus_tag LOCUS_04010 14025 14966 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191243275.1 protein_id gnl|my_center|LOCUS_04010 15313 14972 gene locus_tag LOCUS_04020 15313 14972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 16978 15374 gene locus_tag LOCUS_04030 16978 15374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 18640 16979 gene locus_tag LOCUS_04040 18640 16979 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249802.1 protein_id gnl|my_center|LOCUS_04040 18772 19755 gene locus_tag LOCUS_04050 gene glpX 18772 19755 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_04050 20451 19837 gene locus_tag LOCUS_04060 20451 19837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 21624 20743 gene locus_tag LOCUS_04070 21624 20743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 22017 21625 gene locus_tag LOCUS_04080 22017 21625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 23438 22014 gene locus_tag LOCUS_04090 gene atpD 23438 22014 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406701.1 protein_id gnl|my_center|LOCUS_04090 24328 23441 gene locus_tag LOCUS_04100 gene atpG 24328 23441 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_04100 25860 24337 gene locus_tag LOCUS_04110 gene atpA 25860 24337 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406699.1 protein_id gnl|my_center|LOCUS_04110 26503 25868 gene locus_tag LOCUS_04120 26503 25868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 26438 26725 gene locus_tag LOCUS_04130 26438 26725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 27258 26731 gene locus_tag LOCUS_04140 gene atpF 27258 26731 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558554.1 protein_id gnl|my_center|LOCUS_04140 27542 27264 gene locus_tag LOCUS_04150 27542 27264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 28392 27622 gene locus_tag LOCUS_04160 gene atpB 28392 27622 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775944.1 protein_id gnl|my_center|LOCUS_04160 28817 28389 gene locus_tag LOCUS_04170 28817 28389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 29193 28810 gene locus_tag LOCUS_04180 29193 28810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 30456 29332 gene locus_tag LOCUS_04190 30456 29332 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229530.1 protein_id gnl|my_center|LOCUS_04190 31731 30463 gene locus_tag LOCUS_04200 31731 30463 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_04200 33195 32443 gene locus_tag LOCUS_04210 gene prmC 33195 32443 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036071.1 protein_id gnl|my_center|LOCUS_04210 34330 33254 gene locus_tag LOCUS_04220 gene prfA 34330 33254 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_04220 35282 34320 gene locus_tag LOCUS_04230 35282 34320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 35504 35286 gene locus_tag LOCUS_04240 gene rpmE 35504 35286 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229538.1 protein_id gnl|my_center|LOCUS_04240 37273 35621 gene locus_tag LOCUS_04250 37273 35621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 38412 37357 gene locus_tag LOCUS_04260 gene thrC 38412 37357 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865143.1 protein_id gnl|my_center|LOCUS_04260 39702 38422 gene locus_tag LOCUS_04270 39702 38422 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_04270 40987 39710 gene locus_tag LOCUS_04280 gene lysA 40987 39710 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_04280 42596 40989 gene locus_tag LOCUS_04290 gene argS 42596 40989 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938544.1 protein_id gnl|my_center|LOCUS_04290 42741 42813 gene locus_tag LOCUS_t00120 42741 42813 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42961 43467 gene locus_tag LOCUS_04300 42961 43467 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976424.1 protein_id gnl|my_center|LOCUS_04300 43917 43663 gene locus_tag LOCUS_04310 43917 43663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 44419 44078 gene locus_tag LOCUS_04320 44419 44078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 44934 44470 gene locus_tag LOCUS_04330 gene aroQ 44934 44470 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124539.1 protein_id gnl|my_center|LOCUS_04330 45998 44922 gene locus_tag LOCUS_04340 45998 44922 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222554.1 protein_id gnl|my_center|LOCUS_04340 47182 46004 gene locus_tag LOCUS_04350 gene aroC 47182 46004 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_04350 47555 47214 gene locus_tag LOCUS_04360 47555 47214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 48114 47548 gene locus_tag LOCUS_04370 48114 47548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 49823 48111 gene locus_tag LOCUS_04380 49823 48111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 50659 49886 gene locus_tag LOCUS_04390 50659 49886 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226289.1 protein_id gnl|my_center|LOCUS_04390 50828 51316 gene locus_tag LOCUS_04400 50828 51316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 51327 52118 gene locus_tag LOCUS_04410 51327 52118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 52880 52416 gene locus_tag LOCUS_04420 52880 52416 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897002.1 protein_id gnl|my_center|LOCUS_04420 52959 53513 gene locus_tag LOCUS_04430 52959 53513 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_04430 54215 53601 gene locus_tag LOCUS_04440 gene nfuA 54215 53601 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_04440 54275 55492 gene locus_tag LOCUS_04450 54275 55492 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_04450 55505 56824 gene locus_tag LOCUS_04460 55505 56824 CDS product CUAEP/CCAEP-tail radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257877.1 protein_id gnl|my_center|LOCUS_04460 56831 58654 gene locus_tag LOCUS_04470 56831 58654 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462428.1 protein_id gnl|my_center|LOCUS_04470 59372 58644 gene locus_tag LOCUS_04480 59372 58644 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229221.1 protein_id gnl|my_center|LOCUS_04480 60141 59362 gene locus_tag LOCUS_04490 60141 59362 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_04490 60580 60161 gene locus_tag LOCUS_04500 gene fabZ 60580 60161 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966834.1 protein_id gnl|my_center|LOCUS_04500 60838 64593 gene locus_tag LOCUS_04510 60838 64593 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_04510 65318 64590 gene locus_tag LOCUS_04520 65318 64590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 66312 65422 gene locus_tag LOCUS_04530 66312 65422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 66404 68014 gene locus_tag LOCUS_04540 66404 68014 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_04540 68254 69585 gene locus_tag LOCUS_04550 68254 69585 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081989.1 protein_id gnl|my_center|LOCUS_04550 69679 71091 gene locus_tag LOCUS_04560 69679 71091 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978643.1 protein_id gnl|my_center|LOCUS_04560 71217 71912 gene locus_tag LOCUS_04570 71217 71912 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861387.1 protein_id gnl|my_center|LOCUS_04570 72189 73046 gene locus_tag LOCUS_04580 72189 73046 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015459.1 protein_id gnl|my_center|LOCUS_04580 73058 74401 gene locus_tag LOCUS_04590 73058 74401 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_04590 74398 75150 gene locus_tag LOCUS_04600 74398 75150 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420632.1 protein_id gnl|my_center|LOCUS_04600 75465 75283 gene locus_tag LOCUS_04610 75465 75283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 77825 75597 gene locus_tag LOCUS_04620 77825 75597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 77958 78905 gene locus_tag LOCUS_04630 77958 78905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 78830 79942 gene locus_tag LOCUS_04640 78830 79942 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_04640 79939 81012 gene locus_tag LOCUS_04650 79939 81012 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_04650 81009 82136 gene locus_tag LOCUS_04660 81009 82136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 83346 82117 gene locus_tag LOCUS_04670 83346 82117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 84299 83349 gene locus_tag LOCUS_04680 84299 83349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 84928 84299 gene locus_tag LOCUS_04690 84928 84299 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_04690 85019 85103 gene locus_tag LOCUS_t00130 85019 85103 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 85348 85106 gene locus_tag LOCUS_04700 85348 85106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 86158 85598 gene locus_tag LOCUS_04710 gene rdgB 86158 85598 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172548.1 protein_id gnl|my_center|LOCUS_04710 86880 86155 gene locus_tag LOCUS_04720 gene rph 86880 86155 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083501.1 protein_id gnl|my_center|LOCUS_04720 87689 86883 gene locus_tag LOCUS_04730 gene murI 87689 86883 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_04730 88558 87806 gene locus_tag LOCUS_04740 88558 87806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 88876 90024 gene locus_tag LOCUS_04750 88876 90024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 90440 90021 gene locus_tag LOCUS_04760 gene mec 90440 90021 CDS product CysO-cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898830.1 protein_id gnl|my_center|LOCUS_04760 90493 90972 gene locus_tag LOCUS_04770 gene smpB 90493 90972 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907868.1 protein_id gnl|my_center|LOCUS_04770 91002 91351 gene locus_tag LOCUS_tm00010 91002 91351 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 92807 91521 gene locus_tag LOCUS_04780 92807 91521 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980446.1 protein_id gnl|my_center|LOCUS_04780 93298 92819 gene locus_tag LOCUS_04790 93298 92819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 93851 93288 gene locus_tag LOCUS_04800 93851 93288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 94969 96426 gene locus_tag LOCUS_04810 94969 96426 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_04810 96878 97216 gene locus_tag LOCUS_04820 96878 97216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 97221 97970 gene locus_tag LOCUS_04830 97221 97970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 98237 98710 gene locus_tag LOCUS_04840 gene queF 98237 98710 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187118.1 protein_id gnl|my_center|LOCUS_04840 98755 99663 gene locus_tag LOCUS_04850 98755 99663 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814724.1 protein_id gnl|my_center|LOCUS_04850 100161 99646 gene locus_tag LOCUS_04860 100161 99646 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643893.1 protein_id gnl|my_center|LOCUS_04860 101548 100154 gene locus_tag LOCUS_04870 gene argH 101548 100154 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_04870 102738 101545 gene locus_tag LOCUS_04880 gene argG 102738 101545 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358518.1 protein_id gnl|my_center|LOCUS_04880 103284 102820 gene locus_tag LOCUS_04890 103284 102820 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_04890 104197 103277 gene locus_tag LOCUS_04900 gene argF 104197 103277 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545574.1 protein_id gnl|my_center|LOCUS_04900 105351 104194 gene locus_tag LOCUS_04910 105351 104194 CDS product acetylornithine/succinylornithine family transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877594.1 protein_id gnl|my_center|LOCUS_04910 106214 105357 gene locus_tag LOCUS_04920 gene argB 106214 105357 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_04920 107392 106211 gene locus_tag LOCUS_04930 gene argJ 107392 106211 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227837.1 protein_id gnl|my_center|LOCUS_04930 108399 107389 gene locus_tag LOCUS_04940 gene argC 108399 107389 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459299.1 protein_id gnl|my_center|LOCUS_04940 108539 108913 gene locus_tag LOCUS_04950 108539 108913 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098871.1 protein_id gnl|my_center|LOCUS_04950 109134 110615 gene locus_tag LOCUS_04960 109134 110615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 111744 110599 gene locus_tag LOCUS_04970 111744 110599 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_04970 113363 111741 gene locus_tag LOCUS_04980 113363 111741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 114019 113360 gene locus_tag LOCUS_04990 114019 113360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence05 821 3 gene locus_tag LOCUS_05000 821 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1700 927 gene locus_tag LOCUS_05010 gene fabI 1700 927 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_05010 1752 2441 gene locus_tag LOCUS_05020 gene npdG 1752 2441 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878704.1 protein_id gnl|my_center|LOCUS_05020 2441 3553 gene locus_tag LOCUS_05030 gene cysS 2441 3553 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256641.1 protein_id gnl|my_center|LOCUS_05030 3564 5525 gene locus_tag LOCUS_05040 gene thrS 3564 5525 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_05040 5529 6020 gene locus_tag LOCUS_05050 5529 6020 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_05050 7996 6017 gene locus_tag LOCUS_05060 gene fusA 7996 6017 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_05060 8244 8978 gene locus_tag LOCUS_05070 8244 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 9092 9877 gene locus_tag LOCUS_05080 9092 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 9878 10933 gene locus_tag LOCUS_05090 9878 10933 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090090.1 protein_id gnl|my_center|LOCUS_05090 10940 11758 gene locus_tag LOCUS_05100 10940 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 11861 12748 gene locus_tag LOCUS_05110 gene pdxS 11861 12748 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119184.1 protein_id gnl|my_center|LOCUS_05110 12750 13358 gene locus_tag LOCUS_05120 gene pdxT 12750 13358 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_05120 13396 14145 gene locus_tag LOCUS_05130 13396 14145 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_05130 14146 14610 gene locus_tag LOCUS_05140 14146 14610 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888871.1 protein_id gnl|my_center|LOCUS_05140 14738 15220 gene locus_tag LOCUS_05150 gene ruvC 14738 15220 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081287.1 protein_id gnl|my_center|LOCUS_05150 15217 15789 gene locus_tag LOCUS_05160 gene ruvA 15217 15789 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223336.1 protein_id gnl|my_center|LOCUS_05160 15786 16844 gene locus_tag LOCUS_05170 gene ruvB 15786 16844 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093599.1 protein_id gnl|my_center|LOCUS_05170 16976 17215 gene locus_tag LOCUS_05180 16976 17215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_05180 17263 17958 gene locus_tag LOCUS_05190 17263 17958 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528277.1 protein_id gnl|my_center|LOCUS_05190 17965 18204 gene locus_tag LOCUS_05200 17965 18204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 18206 19210 gene locus_tag LOCUS_05210 18206 19210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 19207 20310 gene locus_tag LOCUS_05220 gene pimB 19207 20310 CDS product GDP-mannose-dependent monoacylated alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014943.1 protein_id gnl|my_center|LOCUS_05220 20350 20826 gene locus_tag LOCUS_05230 20350 20826 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_05230 21746 20856 gene locus_tag LOCUS_05240 21746 20856 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192732.1 protein_id gnl|my_center|LOCUS_05240 22271 22714 gene locus_tag LOCUS_05250 22271 22714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 24461 23061 gene locus_tag LOCUS_05260 24461 23061 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898735.1 protein_id gnl|my_center|LOCUS_05260 25375 24458 gene locus_tag LOCUS_05270 25375 24458 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_05270 27767 25809 gene locus_tag LOCUS_05280 gene hyfB 27767 25809 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_05280 28504 27764 gene locus_tag LOCUS_05290 28504 27764 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_05290 30028 28514 gene locus_tag LOCUS_05300 30028 28514 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400663.1 protein_id gnl|my_center|LOCUS_05300 31494 30028 gene locus_tag LOCUS_05310 31494 30028 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181950125.1 protein_id gnl|my_center|LOCUS_05310 32171 31491 gene locus_tag LOCUS_05320 32171 31491 CDS product hydrogenase 4 membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388072.1 protein_id gnl|my_center|LOCUS_05320 33123 32182 gene locus_tag LOCUS_05330 33123 32182 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_05330 34744 36336 gene locus_tag LOCUS_05340 34744 36336 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_05340 36333 37874 gene locus_tag LOCUS_05350 36333 37874 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_05350 38017 39159 gene locus_tag LOCUS_05360 38017 39159 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_05360 40020 39763 gene locus_tag LOCUS_05370 40020 39763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 40702 40166 gene locus_tag LOCUS_05380 40702 40166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 40689 41495 gene locus_tag LOCUS_05390 40689 41495 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110556.1 protein_id gnl|my_center|LOCUS_05390 42067 42468 gene locus_tag LOCUS_05400 42067 42468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 43283 42636 gene locus_tag LOCUS_05410 43283 42636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 43765 43283 gene locus_tag LOCUS_05420 43765 43283 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256136.1 protein_id gnl|my_center|LOCUS_05420 44280 43831 gene locus_tag LOCUS_05430 44280 43831 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880218.1 protein_id gnl|my_center|LOCUS_05430 44722 44282 gene locus_tag LOCUS_05440 44722 44282 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881076.1 protein_id gnl|my_center|LOCUS_05440 45079 44771 gene locus_tag LOCUS_05450 45079 44771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 47243 45081 gene locus_tag LOCUS_05460 47243 45081 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289484.1 protein_id gnl|my_center|LOCUS_05460 48199 47246 gene locus_tag LOCUS_05470 48199 47246 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903590.1 protein_id gnl|my_center|LOCUS_05470 48981 48211 gene locus_tag LOCUS_05480 48981 48211 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903589.1 protein_id gnl|my_center|LOCUS_05480 50287 48998 gene locus_tag LOCUS_05490 50287 48998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 51008 50271 gene locus_tag LOCUS_05500 51008 50271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 52061 51009 gene locus_tag LOCUS_05510 52061 51009 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_05510 53263 52073 gene locus_tag LOCUS_05520 53263 52073 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_05520 53979 53260 gene locus_tag LOCUS_05530 53979 53260 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880210.1 protein_id gnl|my_center|LOCUS_05530 54362 53979 gene locus_tag LOCUS_05540 54362 53979 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877699.1 protein_id gnl|my_center|LOCUS_05540 54714 54478 gene locus_tag LOCUS_05550 gene tusA 54714 54478 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_05550 54901 55548 gene locus_tag LOCUS_05560 54901 55548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 55589 56569 gene locus_tag LOCUS_05570 gene nadA 55589 56569 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224102.1 protein_id gnl|my_center|LOCUS_05570 56566 58083 gene locus_tag LOCUS_05580 56566 58083 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973560.1 protein_id gnl|my_center|LOCUS_05580 58088 58903 gene locus_tag LOCUS_05590 gene nadC 58088 58903 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920753.1 protein_id gnl|my_center|LOCUS_05590 59369 58920 gene locus_tag LOCUS_05600 59369 58920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 60510 59356 gene locus_tag LOCUS_05610 gene rodA 60510 59356 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_05610 60857 60507 gene locus_tag LOCUS_05620 60857 60507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 60984 62102 gene locus_tag LOCUS_05630 60984 62102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 63335 62118 gene locus_tag LOCUS_05640 63335 62118 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583240.1 protein_id gnl|my_center|LOCUS_05640 64422 63319 gene locus_tag LOCUS_05650 64422 63319 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_05650 66134 64419 gene locus_tag LOCUS_05660 66134 64419 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_05660 66969 66154 gene locus_tag LOCUS_05670 66969 66154 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_05670 68003 66966 gene locus_tag LOCUS_05680 68003 66966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 68380 67982 gene locus_tag LOCUS_05690 gene ruvX 68380 67982 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057628.1 protein_id gnl|my_center|LOCUS_05690 70935 68377 gene locus_tag LOCUS_05700 gene alaS 70935 68377 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_05700 71179 70937 gene locus_tag LOCUS_05710 71179 70937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 71538 71176 gene locus_tag LOCUS_05720 71538 71176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 73311 71677 gene locus_tag LOCUS_05730 73311 71677 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527813.1 protein_id gnl|my_center|LOCUS_05730 75657 73498 gene locus_tag LOCUS_05740 75657 73498 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894345.1 protein_id gnl|my_center|LOCUS_05740 76733 75693 gene locus_tag LOCUS_05750 gene secF 76733 75693 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_05750 78227 76734 gene locus_tag LOCUS_05760 78227 76734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 79470 78361 gene locus_tag LOCUS_05770 gene tgt 79470 78361 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967463.1 protein_id gnl|my_center|LOCUS_05770 80486 79467 gene locus_tag LOCUS_05780 gene queA 80486 79467 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173135.1 protein_id gnl|my_center|LOCUS_05780 82004 80514 gene locus_tag LOCUS_05790 82004 80514 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467505.1 protein_id gnl|my_center|LOCUS_05790 83284 82007 gene locus_tag LOCUS_05800 83284 82007 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_05800 83441 84808 gene locus_tag LOCUS_05810 83441 84808 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728155.1 protein_id gnl|my_center|LOCUS_05810 85984 84818 gene locus_tag LOCUS_05820 85984 84818 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938190.1 protein_id gnl|my_center|LOCUS_05820 86650 86381 gene locus_tag LOCUS_05830 86650 86381 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_05830 87255 86647 gene locus_tag LOCUS_05840 87255 86647 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049765998.1 protein_id gnl|my_center|LOCUS_05840 88381 87239 gene locus_tag LOCUS_05850 gene glpC 88381 87239 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098021.1 protein_id gnl|my_center|LOCUS_05850 89494 88382 gene locus_tag LOCUS_05860 gene glpB 89494 88382 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259131.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence06 1653 1279 gene locus_tag LOCUS_05870 1653 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 1994 1659 gene locus_tag LOCUS_05880 1994 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 2973 2080 gene locus_tag LOCUS_05890 2973 2080 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101981.1 protein_id gnl|my_center|LOCUS_05890 3681 3166 gene locus_tag LOCUS_05900 gene aroK 3681 3166 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413021.1 protein_id gnl|my_center|LOCUS_05900 3945 5348 gene locus_tag LOCUS_05910 3945 5348 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230249.1 protein_id gnl|my_center|LOCUS_05910 6112 5345 gene locus_tag LOCUS_05920 6112 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6182 6622 gene locus_tag LOCUS_05930 gene trxC 6182 6622 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889424.1 protein_id gnl|my_center|LOCUS_05930 6619 7470 gene locus_tag LOCUS_05940 gene xerC 6619 7470 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 protein_id gnl|my_center|LOCUS_05940 7467 8249 gene locus_tag LOCUS_05950 gene whiG 7467 8249 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_05950 8432 9151 gene locus_tag LOCUS_05960 gene rpsB 8432 9151 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547837.1 protein_id gnl|my_center|LOCUS_05960 9189 9986 gene locus_tag LOCUS_05970 gene tsf 9189 9986 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804635.1 protein_id gnl|my_center|LOCUS_05970 9991 10719 gene locus_tag LOCUS_05980 gene pyrH 9991 10719 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480220.1 protein_id gnl|my_center|LOCUS_05980 10719 11285 gene locus_tag LOCUS_05990 gene frr 10719 11285 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 protein_id gnl|my_center|LOCUS_05990 11287 12660 gene locus_tag LOCUS_06000 11287 12660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 12677 13831 gene locus_tag LOCUS_06010 12677 13831 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_06010 13824 15113 gene locus_tag LOCUS_06020 13824 15113 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 protein_id gnl|my_center|LOCUS_06020 15127 16359 gene locus_tag LOCUS_06030 gene ispG 15127 16359 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 protein_id gnl|my_center|LOCUS_06030 16409 18133 gene locus_tag LOCUS_06040 16409 18133 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_06040 18240 18737 gene locus_tag LOCUS_06050 gene rimP 18240 18737 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_06050 18724 19749 gene locus_tag LOCUS_06060 gene nusA 18724 19749 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_06060 20246 20094 gene locus_tag LOCUS_06070 20246 20094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 20973 20632 gene locus_tag LOCUS_06080 20973 20632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 20988 22844 gene locus_tag LOCUS_06090 20988 22844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 22849 23205 gene locus_tag LOCUS_06100 22849 23205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 23209 24093 gene locus_tag LOCUS_06110 23209 24093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 24090 25055 gene locus_tag LOCUS_06120 24090 25055 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_06120 25163 25420 gene locus_tag LOCUS_06130 gene rpsO 25163 25420 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052997.1 protein_id gnl|my_center|LOCUS_06130 25461 27809 gene locus_tag LOCUS_06140 25461 27809 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414124.1 protein_id gnl|my_center|LOCUS_06140 27812 28648 gene locus_tag LOCUS_06150 gene dapB 27812 28648 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_06150 28661 29581 gene locus_tag LOCUS_06160 gene dapA 28661 29581 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_06160 29571 31232 gene locus_tag LOCUS_06170 29571 31232 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948911.1 protein_id gnl|my_center|LOCUS_06170 31342 33501 gene locus_tag LOCUS_06180 31342 33501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 33601 34878 gene locus_tag LOCUS_06190 33601 34878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 34875 35750 gene locus_tag LOCUS_06200 gene thrB 34875 35750 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228648.1 protein_id gnl|my_center|LOCUS_06200 35838 36401 gene locus_tag LOCUS_06210 gene pgsA 35838 36401 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837720.1 protein_id gnl|my_center|LOCUS_06210 36404 37669 gene locus_tag LOCUS_06220 36404 37669 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_06220 37763 38806 gene locus_tag LOCUS_06230 gene recA 37763 38806 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057169.1 protein_id gnl|my_center|LOCUS_06230 38816 40303 gene locus_tag LOCUS_06240 gene miaB 38816 40303 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296630.1 protein_id gnl|my_center|LOCUS_06240 40308 41765 gene locus_tag LOCUS_06250 40308 41765 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093851.1 protein_id gnl|my_center|LOCUS_06250 43836 42211 gene locus_tag LOCUS_06260 gene lcfB 43836 42211 CDS product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 protein_id gnl|my_center|LOCUS_06260 45291 46553 gene locus_tag LOCUS_06270 45291 46553 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_06270 46915 50436 gene locus_tag LOCUS_06280 gene cobN 46915 50436 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228832.1 protein_id gnl|my_center|LOCUS_06280 50433 52160 gene locus_tag LOCUS_06290 50433 52160 CDS product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950790.1 protein_id gnl|my_center|LOCUS_06290 52559 52140 gene locus_tag LOCUS_06300 52559 52140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 52787 53719 gene locus_tag LOCUS_06310 gene cysK 52787 53719 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_06310 53721 54362 gene locus_tag LOCUS_06320 53721 54362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 55189 54389 gene locus_tag LOCUS_06330 55189 54389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 55106 55315 gene locus_tag LOCUS_06340 55106 55315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 55553 55404 gene locus_tag LOCUS_06350 55553 55404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 55627 56691 gene locus_tag LOCUS_06360 55627 56691 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807655.1 protein_id gnl|my_center|LOCUS_06360 56765 57643 gene locus_tag LOCUS_06370 56765 57643 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_06370 57636 58625 gene locus_tag LOCUS_06380 57636 58625 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039247.1 protein_id gnl|my_center|LOCUS_06380 58618 59331 gene locus_tag LOCUS_06390 58618 59331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_06390 59312 60037 gene locus_tag LOCUS_06400 59312 60037 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228129.1 protein_id gnl|my_center|LOCUS_06400 60201 60971 gene locus_tag LOCUS_06410 60201 60971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 60968 61186 gene locus_tag LOCUS_06420 60968 61186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 61176 61760 gene locus_tag LOCUS_06430 61176 61760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545718.1 protein_id gnl|my_center|LOCUS_06430 61916 63073 gene locus_tag LOCUS_06440 gene ugpC 61916 63073 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228630.1 protein_id gnl|my_center|LOCUS_06440 63078 64061 gene locus_tag LOCUS_06450 63078 64061 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_06450 64067 64888 gene locus_tag LOCUS_06460 64067 64888 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206346349.1 protein_id gnl|my_center|LOCUS_06460 65044 66408 gene locus_tag LOCUS_06470 65044 66408 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105221568.1 protein_id gnl|my_center|LOCUS_06470 66468 67175 gene locus_tag LOCUS_06480 66468 67175 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258299.1 protein_id gnl|my_center|LOCUS_06480 67176 68594 gene locus_tag LOCUS_06490 67176 68594 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226903.1 protein_id gnl|my_center|LOCUS_06490 68637 70406 gene locus_tag LOCUS_06500 68637 70406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 71290 70403 gene locus_tag LOCUS_06510 71290 70403 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079927.1 protein_id gnl|my_center|LOCUS_06510 71372 71911 gene locus_tag LOCUS_06520 71372 71911 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_06520 72851 71919 gene locus_tag LOCUS_06530 gene hutG 72851 71919 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195673.1 protein_id gnl|my_center|LOCUS_06530 74049 72844 gene locus_tag LOCUS_06540 gene hutI 74049 72844 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337858.1 protein_id gnl|my_center|LOCUS_06540 75727 74033 gene locus_tag LOCUS_06550 75727 74033 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192292.1 protein_id gnl|my_center|LOCUS_06550 76447 75746 gene locus_tag LOCUS_06560 gene hutC 76447 75746 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193766.1 protein_id gnl|my_center|LOCUS_06560 77976 76444 gene locus_tag LOCUS_06570 gene hutH 77976 76444 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192520.1 protein_id gnl|my_center|LOCUS_06570 78187 79125 gene locus_tag LOCUS_06580 78187 79125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 80489 79122 gene locus_tag LOCUS_06590 gene cbpB 80489 79122 CDS product peptide-modifying radical SAM enzyme CbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879693.1 protein_id gnl|my_center|LOCUS_06590 80839 81201 gene locus_tag LOCUS_06600 80839 81201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 81186 81728 gene locus_tag LOCUS_06610 81186 81728 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614581.1 protein_id gnl|my_center|LOCUS_06610 82809 82012 gene locus_tag LOCUS_06620 82809 82012 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144635466.1 protein_id gnl|my_center|LOCUS_06620 83740 82814 gene locus_tag LOCUS_06630 83740 82814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973601.1 protein_id gnl|my_center|LOCUS_06630 84061 83987 gene locus_tag LOCUS_t00140 84061 83987 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 84181 84105 gene locus_tag LOCUS_t00150 84181 84105 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 85296 84250 gene locus_tag LOCUS_06640 85296 84250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence07 1763 210 gene locus_tag LOCUS_06650 1763 210 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229182.1 protein_id gnl|my_center|LOCUS_06650 2569 1766 gene locus_tag LOCUS_06660 2569 1766 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899009.1 protein_id gnl|my_center|LOCUS_06660 4243 2639 gene locus_tag LOCUS_06670 gene ggt 4243 2639 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140682.1 protein_id gnl|my_center|LOCUS_06670 4447 5502 gene locus_tag LOCUS_06680 gene ald 4447 5502 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338437.1 protein_id gnl|my_center|LOCUS_06680 5543 6823 gene locus_tag LOCUS_06690 5543 6823 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_06690 9211 8132 gene locus_tag LOCUS_06700 9211 8132 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_06700 9849 9199 gene locus_tag LOCUS_06710 gene cobC 9849 9199 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_06710 11815 10382 gene locus_tag LOCUS_06720 11815 10382 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_06720 12072 12587 gene locus_tag LOCUS_06730 12072 12587 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111753.1 protein_id gnl|my_center|LOCUS_06730 12689 14050 gene locus_tag LOCUS_06740 12689 14050 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_06740 14094 16244 gene locus_tag LOCUS_06750 14094 16244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 17535 16192 gene locus_tag LOCUS_06760 17535 16192 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_06760 18761 17532 gene locus_tag LOCUS_06770 18761 17532 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742232.1 protein_id gnl|my_center|LOCUS_06770 20593 18809 gene locus_tag LOCUS_06780 gene typA 20593 18809 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229765.1 protein_id gnl|my_center|LOCUS_06780 21048 20737 gene locus_tag LOCUS_06790 21048 20737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 21164 21463 gene locus_tag LOCUS_06800 21164 21463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 21601 23529 gene locus_tag LOCUS_06810 21601 23529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 23530 23910 gene locus_tag LOCUS_06820 23530 23910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 23971 24552 gene locus_tag LOCUS_06830 23971 24552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 24673 27039 gene locus_tag LOCUS_06840 24673 27039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 27042 27800 gene locus_tag LOCUS_06850 27042 27800 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284474.1 protein_id gnl|my_center|LOCUS_06850 27864 29411 gene locus_tag LOCUS_06860 27864 29411 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_06860 29908 29408 gene locus_tag LOCUS_06870 29908 29408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 30771 30166 gene locus_tag LOCUS_06880 gene cofC 30771 30166 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256112.1 protein_id gnl|my_center|LOCUS_06880 30795 31406 gene locus_tag LOCUS_06890 30795 31406 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_06890 31426 32160 gene locus_tag LOCUS_06900 31426 32160 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462089.1 protein_id gnl|my_center|LOCUS_06900 32238 33179 gene locus_tag LOCUS_06910 32238 33179 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_06910 33972 33193 gene locus_tag LOCUS_06920 33972 33193 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389377.1 protein_id gnl|my_center|LOCUS_06920 34360 33965 gene locus_tag LOCUS_06930 34360 33965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 35340 34501 gene locus_tag LOCUS_06940 gene mca 35340 34501 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222092.1 protein_id gnl|my_center|LOCUS_06940 36620 35391 gene locus_tag LOCUS_06950 36620 35391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 39931 36722 gene locus_tag LOCUS_06960 39931 36722 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727789.1 protein_id gnl|my_center|LOCUS_06960 41421 39904 gene locus_tag LOCUS_06970 41421 39904 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727778.1 protein_id gnl|my_center|LOCUS_06970 41878 41423 gene locus_tag LOCUS_06980 41878 41423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 42873 42055 gene locus_tag LOCUS_06990 42873 42055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 44893 42878 gene locus_tag LOCUS_07000 gene ftsH 44893 42878 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_07000 44985 45722 gene locus_tag LOCUS_07010 44985 45722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 45821 46267 gene locus_tag LOCUS_07020 45821 46267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 46269 46766 gene locus_tag LOCUS_07030 46269 46766 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_07030 47467 46910 gene locus_tag LOCUS_07040 gene rfbC 47467 46910 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140473.1 protein_id gnl|my_center|LOCUS_07040 48599 47502 gene locus_tag LOCUS_07050 48599 47502 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228908.1 protein_id gnl|my_center|LOCUS_07050 49100 50086 gene locus_tag LOCUS_07060 49100 50086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 52250 50088 gene locus_tag LOCUS_07070 52250 50088 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803998.1 protein_id gnl|my_center|LOCUS_07070 52249 53649 gene locus_tag LOCUS_07080 gene sufB 52249 53649 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_07080 54394 53660 gene locus_tag LOCUS_07090 54394 53660 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031612.1 protein_id gnl|my_center|LOCUS_07090 56007 54376 gene locus_tag LOCUS_07100 56007 54376 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228517.1 protein_id gnl|my_center|LOCUS_07100 56729 56004 gene locus_tag LOCUS_07110 gene phoP 56729 56004 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403867.1 protein_id gnl|my_center|LOCUS_07110 58224 56833 gene locus_tag LOCUS_07120 58224 56833 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392257.1 protein_id gnl|my_center|LOCUS_07120 59067 58291 gene locus_tag LOCUS_07130 59067 58291 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111769.1 protein_id gnl|my_center|LOCUS_07130 59229 60419 gene locus_tag LOCUS_07140 59229 60419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 60416 60730 gene locus_tag LOCUS_07150 60416 60730 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259323.1 protein_id gnl|my_center|LOCUS_07150 60727 61455 gene locus_tag LOCUS_07160 gene sufC 60727 61455 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722442.1 protein_id gnl|my_center|LOCUS_07160 61658 62425 gene locus_tag LOCUS_07170 gene sufC 61658 62425 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 protein_id gnl|my_center|LOCUS_07170 62398 63663 gene locus_tag LOCUS_07180 62398 63663 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_07180 63674 64129 gene locus_tag LOCUS_07190 63674 64129 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_07190 65387 64167 gene locus_tag LOCUS_07200 65387 64167 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186383115.1 protein_id gnl|my_center|LOCUS_07200 66922 65384 gene locus_tag LOCUS_07210 66922 65384 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_07210 67651 66938 gene locus_tag LOCUS_07220 67651 66938 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_07220 68523 68014 gene locus_tag LOCUS_07230 68523 68014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 69152 68541 gene locus_tag LOCUS_07240 69152 68541 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_07240 69324 69749 gene locus_tag LOCUS_07250 69324 69749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 69819 70193 gene locus_tag LOCUS_07260 69819 70193 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_07260 70978 70199 gene locus_tag LOCUS_07270 70978 70199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 71832 70975 gene locus_tag LOCUS_07280 71832 70975 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762928.1 protein_id gnl|my_center|LOCUS_07280 71895 72584 gene locus_tag LOCUS_07290 71895 72584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 73171 72620 gene locus_tag LOCUS_07300 73171 72620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 73866 73237 gene locus_tag LOCUS_07310 gene thiE 73866 73237 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727194.1 protein_id gnl|my_center|LOCUS_07310 74447 73863 gene locus_tag LOCUS_07320 74447 73863 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_07320 77210 74469 gene locus_tag LOCUS_07330 gene aceE 77210 74469 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223999.1 protein_id gnl|my_center|LOCUS_07330 77410 77769 gene locus_tag LOCUS_07340 77410 77769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence08 36 248 gene locus_tag LOCUS_07350 36 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 401 3346 gene locus_tag LOCUS_07360 401 3346 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725349.1 protein_id gnl|my_center|LOCUS_07360 3423 4802 gene locus_tag LOCUS_07370 3423 4802 CDS product TIGR03279 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142769.1 protein_id gnl|my_center|LOCUS_07370 4799 6130 gene locus_tag LOCUS_07380 gene der 4799 6130 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079328.1 protein_id gnl|my_center|LOCUS_07380 6149 7669 gene locus_tag LOCUS_07390 6149 7669 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566963.1 protein_id gnl|my_center|LOCUS_07390 7885 8784 gene locus_tag LOCUS_07400 7885 8784 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222332.1 protein_id gnl|my_center|LOCUS_07400 8853 8930 gene locus_tag LOCUS_t00160 8853 8930 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9172 9086 gene locus_tag LOCUS_t00170 9172 9086 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9349 11394 gene locus_tag LOCUS_07410 9349 11394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_07410 12296 11391 gene locus_tag LOCUS_07420 12296 11391 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_07420 13881 12322 gene locus_tag LOCUS_07430 13881 12322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 14940 13996 gene locus_tag LOCUS_07440 14940 13996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_07440 15905 14958 gene locus_tag LOCUS_07450 15905 14958 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_07450 17842 16007 gene locus_tag LOCUS_07460 17842 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 18106 19305 gene locus_tag LOCUS_07470 18106 19305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 19867 19289 gene locus_tag LOCUS_07480 19867 19289 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010584.1 protein_id gnl|my_center|LOCUS_07480 21537 19882 gene locus_tag LOCUS_07490 gene cydC 21537 19882 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461539.1 protein_id gnl|my_center|LOCUS_07490 23207 21534 gene locus_tag LOCUS_07500 23207 21534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 24247 23204 gene locus_tag LOCUS_07510 gene cydB 24247 23204 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_07510 25661 24258 gene locus_tag LOCUS_07520 25661 24258 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_07520 26891 26184 gene locus_tag LOCUS_07530 26891 26184 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930880.1 protein_id gnl|my_center|LOCUS_07530 27814 26888 gene locus_tag LOCUS_07540 gene xerD 27814 26888 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_07540 28400 27798 gene locus_tag LOCUS_07550 28400 27798 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227807.1 protein_id gnl|my_center|LOCUS_07550 30004 28397 gene locus_tag LOCUS_07560 30004 28397 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_07560 31615 30047 gene locus_tag LOCUS_07570 gene recN 31615 30047 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_07570 32441 31608 gene locus_tag LOCUS_07580 32441 31608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 32555 33544 gene locus_tag LOCUS_07590 32555 33544 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977616.1 protein_id gnl|my_center|LOCUS_07590 33821 35098 gene locus_tag LOCUS_07600 33821 35098 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223633.1 protein_id gnl|my_center|LOCUS_07600 35108 35572 gene locus_tag LOCUS_07610 35108 35572 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225543.1 protein_id gnl|my_center|LOCUS_07610 35577 36353 gene locus_tag LOCUS_07620 35577 36353 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225542.1 protein_id gnl|my_center|LOCUS_07620 37945 36467 gene locus_tag LOCUS_07630 37945 36467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_07630 38114 38851 gene locus_tag LOCUS_07640 38114 38851 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393330.1 protein_id gnl|my_center|LOCUS_07640 38902 39405 gene locus_tag LOCUS_07650 38902 39405 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_07650 39470 39664 gene locus_tag LOCUS_07660 39470 39664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 41276 40560 gene locus_tag LOCUS_07670 41276 40560 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027756.1 protein_id gnl|my_center|LOCUS_07670 41779 41294 gene locus_tag LOCUS_07680 41779 41294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 42203 41826 gene locus_tag LOCUS_07690 gene gcvH 42203 41826 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895104.1 protein_id gnl|my_center|LOCUS_07690 44771 42270 gene locus_tag LOCUS_07700 44771 42270 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_07700 45376 44771 gene locus_tag LOCUS_07710 45376 44771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 45343 45897 gene locus_tag LOCUS_07720 45343 45897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 45950 47011 gene locus_tag LOCUS_07730 gene gcvT 45950 47011 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899219.1 protein_id gnl|my_center|LOCUS_07730 47087 48364 gene locus_tag LOCUS_07740 gene gcvPA 47087 48364 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933289.1 protein_id gnl|my_center|LOCUS_07740 48367 49878 gene locus_tag LOCUS_07750 gene gcvPB 48367 49878 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082890.1 protein_id gnl|my_center|LOCUS_07750 50416 49853 gene locus_tag LOCUS_07760 50416 49853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 50537 51307 gene locus_tag LOCUS_07770 50537 51307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 51384 51899 gene locus_tag LOCUS_07780 51384 51899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 52101 51922 gene locus_tag LOCUS_07790 52101 51922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 52079 53470 gene locus_tag LOCUS_07800 gene pyk 52079 53470 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227631.1 protein_id gnl|my_center|LOCUS_07800 53621 54277 gene locus_tag LOCUS_07810 53621 54277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 54825 54286 gene locus_tag LOCUS_07820 54825 54286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 55001 55981 gene locus_tag LOCUS_07830 55001 55981 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284614.1 protein_id gnl|my_center|LOCUS_07830 56883 55978 gene locus_tag LOCUS_07840 56883 55978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 58496 56907 gene locus_tag LOCUS_07850 58496 56907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 59691 58486 gene locus_tag LOCUS_07860 59691 58486 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_07860 62000 59688 gene locus_tag LOCUS_07870 62000 59688 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_07870 62535 62059 gene locus_tag LOCUS_07880 62535 62059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 62725 63780 gene locus_tag LOCUS_07890 gene patB 62725 63780 CDS product cystathionine beta-lyase PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228854.1 protein_id gnl|my_center|LOCUS_07890 64512 63799 gene locus_tag LOCUS_07900 64512 63799 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484635.1 protein_id gnl|my_center|LOCUS_07900 66281 64509 gene locus_tag LOCUS_07910 66281 64509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 66420 66713 gene locus_tag LOCUS_07920 66420 66713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 67702 66689 gene locus_tag LOCUS_07930 67702 66689 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084879622.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence09 853 563 gene locus_tag LOCUS_07940 853 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 1386 1102 gene locus_tag LOCUS_07950 1386 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 1841 1389 gene locus_tag LOCUS_07960 1841 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 2945 2136 gene locus_tag LOCUS_07970 2945 2136 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815367.1 protein_id gnl|my_center|LOCUS_07970 5014 2945 gene locus_tag LOCUS_07980 5014 2945 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748465.1 protein_id gnl|my_center|LOCUS_07980 6877 5435 gene locus_tag LOCUS_07990 6877 5435 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_07990 7016 8398 gene locus_tag LOCUS_08000 7016 8398 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_08000 9100 8435 gene locus_tag LOCUS_08010 9100 8435 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892083.1 protein_id gnl|my_center|LOCUS_08010 9398 11212 gene locus_tag LOCUS_08020 9398 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 11303 12931 gene locus_tag LOCUS_08030 11303 12931 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726949.1 protein_id gnl|my_center|LOCUS_08030 14903 12942 gene locus_tag LOCUS_08040 14903 12942 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_08040 15570 16514 gene locus_tag LOCUS_08050 15570 16514 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_08050 16554 18407 gene locus_tag LOCUS_08060 16554 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 18423 19364 gene locus_tag LOCUS_08070 18423 19364 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_08070 19562 20770 gene locus_tag LOCUS_08080 19562 20770 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08080 20760 22838 gene locus_tag LOCUS_08090 20760 22838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 23324 24712 gene locus_tag LOCUS_08100 23324 24712 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530465.1 protein_id gnl|my_center|LOCUS_08100 25180 24986 gene locus_tag LOCUS_08110 25180 24986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 26429 25182 gene locus_tag LOCUS_08120 26429 25182 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227734.1 protein_id gnl|my_center|LOCUS_08120 27085 26426 gene locus_tag LOCUS_08130 27085 26426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 27996 27070 gene locus_tag LOCUS_08140 27996 27070 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259359.1 protein_id gnl|my_center|LOCUS_08140 28336 28001 gene locus_tag LOCUS_08150 28336 28001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 28637 28362 gene locus_tag LOCUS_08160 28637 28362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 28606 29013 gene locus_tag LOCUS_08170 28606 29013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 29199 29486 gene locus_tag LOCUS_08180 29199 29486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 29490 30548 gene locus_tag LOCUS_08190 29490 30548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 30545 31738 gene locus_tag LOCUS_08200 30545 31738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 31729 32901 gene locus_tag LOCUS_08210 31729 32901 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170315952.1 protein_id gnl|my_center|LOCUS_08210 32898 34118 gene locus_tag LOCUS_08220 32898 34118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 34132 34527 gene locus_tag LOCUS_08230 34132 34527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 34524 35906 gene locus_tag LOCUS_08240 gene flgK 34524 35906 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_08240 35917 36822 gene locus_tag LOCUS_08250 35917 36822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 36861 37316 gene locus_tag LOCUS_08260 36861 37316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 37524 37297 gene locus_tag LOCUS_08270 gene csrA 37524 37297 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865081.1 protein_id gnl|my_center|LOCUS_08270 37833 40034 gene locus_tag LOCUS_08280 37833 40034 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918481.1 protein_id gnl|my_center|LOCUS_08280 40031 40468 gene locus_tag LOCUS_08290 40031 40468 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084983.1 protein_id gnl|my_center|LOCUS_08290 40470 41564 gene locus_tag LOCUS_08300 40470 41564 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918484.1 protein_id gnl|my_center|LOCUS_08300 41561 42379 gene locus_tag LOCUS_08310 41561 42379 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462295.1 protein_id gnl|my_center|LOCUS_08310 42545 43267 gene locus_tag LOCUS_08320 42545 43267 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 protein_id gnl|my_center|LOCUS_08320 43388 43756 gene locus_tag LOCUS_08330 43388 43756 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_08330 43753 44211 gene locus_tag LOCUS_08340 43753 44211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 44213 44713 gene locus_tag LOCUS_08350 44213 44713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 44715 46724 gene locus_tag LOCUS_08360 44715 46724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 47407 46721 gene locus_tag LOCUS_08370 47407 46721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 47518 48327 gene locus_tag LOCUS_08380 47518 48327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 48339 50330 gene locus_tag LOCUS_08390 48339 50330 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920917.1 protein_id gnl|my_center|LOCUS_08390 50324 51025 gene locus_tag LOCUS_08400 50324 51025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 51262 52455 gene locus_tag LOCUS_08410 51262 52455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 54201 52642 gene locus_tag LOCUS_08420 54201 52642 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_08420 54265 54918 gene locus_tag LOCUS_08430 gene aat 54265 54918 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259206.1 protein_id gnl|my_center|LOCUS_08430 55486 54893 gene locus_tag LOCUS_08440 55486 54893 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229469.1 protein_id gnl|my_center|LOCUS_08440 55638 56825 gene locus_tag LOCUS_08450 55638 56825 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803690.1 protein_id gnl|my_center|LOCUS_08450 56822 57448 gene locus_tag LOCUS_08460 56822 57448 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_08460 57523 57873 gene locus_tag LOCUS_08470 57523 57873 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862556.1 protein_id gnl|my_center|LOCUS_08470 57889 58167 gene locus_tag LOCUS_08480 57889 58167 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066609.1 protein_id gnl|my_center|LOCUS_08480 58170 59870 gene locus_tag LOCUS_08490 gene ureC 58170 59870 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205201.1 protein_id gnl|my_center|LOCUS_08490 59873 60568 gene locus_tag LOCUS_08500 59873 60568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 60583 61215 gene locus_tag LOCUS_08510 gene ureG 60583 61215 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537530.1 protein_id gnl|my_center|LOCUS_08510 61218 62009 gene locus_tag LOCUS_08520 61218 62009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 62115 62537 gene locus_tag LOCUS_08530 62115 62537 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087239.1 protein_id gnl|my_center|LOCUS_08530 62534 63619 gene locus_tag LOCUS_08540 62534 63619 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207962.1 protein_id gnl|my_center|LOCUS_08540 65005 63812 gene locus_tag LOCUS_08550 65005 63812 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222902.1 protein_id gnl|my_center|LOCUS_08550 65328 65002 gene locus_tag LOCUS_08560 65328 65002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 66097 65612 gene locus_tag LOCUS_08570 66097 65612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 67131 66355 gene locus_tag LOCUS_08580 gene fabI 67131 66355 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence10 122 862 gene locus_tag LOCUS_08590 122 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08590 859 1866 gene locus_tag LOCUS_08600 859 1866 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035552.1 protein_id gnl|my_center|LOCUS_08600 2309 1863 gene locus_tag LOCUS_08610 2309 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 3067 2306 gene locus_tag LOCUS_08620 gene rutB 3067 2306 CDS product pyrimidine utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367243.1 protein_id gnl|my_center|LOCUS_08620 4266 3064 gene locus_tag LOCUS_08630 4266 3064 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 protein_id gnl|my_center|LOCUS_08630 5624 4263 gene locus_tag LOCUS_08640 5624 4263 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223813.1 protein_id gnl|my_center|LOCUS_08640 6878 5628 gene locus_tag LOCUS_08650 6878 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384825.1 protein_id gnl|my_center|LOCUS_08650 7778 6936 gene locus_tag LOCUS_08660 7778 6936 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537901.1 protein_id gnl|my_center|LOCUS_08660 8542 7775 gene locus_tag LOCUS_08670 8542 7775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537900.1 protein_id gnl|my_center|LOCUS_08670 9699 8560 gene locus_tag LOCUS_08680 9699 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 9894 10904 gene locus_tag LOCUS_08690 gene cbbR 9894 10904 CDS product LysR family transcriptional regulator CbbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338845.1 protein_id gnl|my_center|LOCUS_08690 12584 10911 gene locus_tag LOCUS_08700 12584 10911 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_08700 13500 12667 gene locus_tag LOCUS_08710 13500 12667 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_08710 14986 13514 gene locus_tag LOCUS_08720 14986 13514 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_08720 15983 14967 gene locus_tag LOCUS_08730 gene deoC 15983 14967 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222794.1 protein_id gnl|my_center|LOCUS_08730 17263 15980 gene locus_tag LOCUS_08740 17263 15980 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222773.1 protein_id gnl|my_center|LOCUS_08740 17673 17260 gene locus_tag LOCUS_08750 17673 17260 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056128.1 protein_id gnl|my_center|LOCUS_08750 19060 17732 gene locus_tag LOCUS_08760 19060 17732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 20358 19057 gene locus_tag LOCUS_08770 20358 19057 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776142.1 protein_id gnl|my_center|LOCUS_08770 21946 20351 gene locus_tag LOCUS_08780 21946 20351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 protein_id gnl|my_center|LOCUS_08780 23108 22020 gene locus_tag LOCUS_08790 23108 22020 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357021.1 protein_id gnl|my_center|LOCUS_08790 24221 23229 gene locus_tag LOCUS_08800 24221 23229 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228421.1 protein_id gnl|my_center|LOCUS_08800 25688 24288 gene locus_tag LOCUS_08810 gene hydA 25688 24288 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_08810 26549 25710 gene locus_tag LOCUS_08820 26549 25710 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972565.1 protein_id gnl|my_center|LOCUS_08820 27352 29325 gene locus_tag LOCUS_08830 27352 29325 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089548.1 protein_id gnl|my_center|LOCUS_08830 29856 29350 gene locus_tag LOCUS_08840 29856 29350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08840 30304 29783 gene locus_tag LOCUS_08850 30304 29783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08850 31633 30416 gene locus_tag LOCUS_08860 31633 30416 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337440.1 protein_id gnl|my_center|LOCUS_08860 32211 31630 gene locus_tag LOCUS_08870 32211 31630 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 protein_id gnl|my_center|LOCUS_08870 32631 33029 gene locus_tag LOCUS_08880 32631 33029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 33350 33114 gene locus_tag LOCUS_08890 33350 33114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 34173 33757 gene locus_tag LOCUS_08900 34173 33757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 34876 34247 gene locus_tag LOCUS_08910 34876 34247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 35365 36615 gene locus_tag LOCUS_08920 35365 36615 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223886.1 protein_id gnl|my_center|LOCUS_08920 36612 37904 gene locus_tag LOCUS_08930 36612 37904 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403192.1 protein_id gnl|my_center|LOCUS_08930 37990 38742 gene locus_tag LOCUS_08940 37990 38742 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223881.1 protein_id gnl|my_center|LOCUS_08940 39933 38737 gene locus_tag LOCUS_08950 39933 38737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 41725 39962 gene locus_tag LOCUS_08960 41725 39962 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_08960 42622 41837 gene locus_tag LOCUS_08970 42622 41837 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975613.1 protein_id gnl|my_center|LOCUS_08970 42628 43539 gene locus_tag LOCUS_08980 42628 43539 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728494.1 protein_id gnl|my_center|LOCUS_08980 43566 44363 gene locus_tag LOCUS_08990 43566 44363 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804288.1 protein_id gnl|my_center|LOCUS_08990 45014 45113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48081 45598 gene locus_tag LOCUS_09000 48081 45598 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257648.1 protein_id gnl|my_center|LOCUS_09000 49735 48128 gene locus_tag LOCUS_09010 49735 48128 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257649.1 protein_id gnl|my_center|LOCUS_09010 50284 50087 gene locus_tag LOCUS_09020 50284 50087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 50476 50303 gene locus_tag LOCUS_09030 50476 50303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 52964 50610 gene locus_tag LOCUS_09040 52964 50610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 53782 52979 gene locus_tag LOCUS_09050 53782 52979 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967671.1 protein_id gnl|my_center|LOCUS_09050 54682 54053 gene locus_tag LOCUS_09060 gene parA 54682 54053 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194446.1 protein_id gnl|my_center|LOCUS_09060 54991 54695 gene locus_tag LOCUS_09070 54991 54695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 55434 54988 gene locus_tag LOCUS_09080 gene bfr 55434 54988 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035731.1 protein_id gnl|my_center|LOCUS_09080 55771 55451 gene locus_tag LOCUS_09090 55771 55451 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_09090 56101 55805 gene locus_tag LOCUS_09100 56101 55805 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_09100 56238 56077 gene locus_tag LOCUS_09110 56238 56077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 56104 56113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56531 56274 gene locus_tag LOCUS_09120 56531 56274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 56790 56542 gene locus_tag LOCUS_09130 56790 56542 CDS product carboxysome peptide A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124708.1 protein_id gnl|my_center|LOCUS_09130 58337 56787 gene locus_tag LOCUS_09140 58337 56787 CDS product carboxysome shell carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124707.1 protein_id gnl|my_center|LOCUS_09140 59957 58437 gene locus_tag LOCUS_09150 59957 58437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09150 60199 59984 gene locus_tag LOCUS_09160 60199 59984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 61071 60739 gene locus_tag LOCUS_09170 61071 60739 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_09170 62672 61158 gene locus_tag LOCUS_09180 62672 61158 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_09180 62753 63700 gene locus_tag LOCUS_09190 62753 63700 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 protein_id gnl|my_center|LOCUS_09190 63746 64726 gene locus_tag LOCUS_09200 63746 64726 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038292.1 protein_id gnl|my_center|LOCUS_09200 64756 64911 gene locus_tag LOCUS_09210 64756 64911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 64874 65161 gene locus_tag LOCUS_09220 64874 65161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 65162 65821 gene locus_tag LOCUS_09230 65162 65821 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727699.1 protein_id gnl|my_center|LOCUS_09230 65818 66999 gene locus_tag LOCUS_09240 65818 66999 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727698.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence11 1077 721 gene locus_tag LOCUS_09250 1077 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1414 1791 gene locus_tag LOCUS_09260 1414 1791 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_09260 2383 2201 gene locus_tag LOCUS_09270 2383 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 2354 2686 gene locus_tag LOCUS_09280 2354 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2689 4701 gene locus_tag LOCUS_09290 2689 4701 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_09290 4698 5684 gene locus_tag LOCUS_09300 4698 5684 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_09300 5681 6340 gene locus_tag LOCUS_09310 5681 6340 CDS product hydrogenase HycP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400661.1 protein_id gnl|my_center|LOCUS_09310 6340 7800 gene locus_tag LOCUS_09320 6340 7800 CDS product hydrogenase HycQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400662.1 protein_id gnl|my_center|LOCUS_09320 7797 9302 gene locus_tag LOCUS_09330 7797 9302 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400663.1 protein_id gnl|my_center|LOCUS_09330 10566 9757 gene locus_tag LOCUS_09340 10566 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 11359 10721 gene locus_tag LOCUS_09350 11359 10721 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976477.1 protein_id gnl|my_center|LOCUS_09350 11730 11395 gene locus_tag LOCUS_09360 11730 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 13145 11730 gene locus_tag LOCUS_09370 13145 11730 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523866.1 protein_id gnl|my_center|LOCUS_09370 14089 14188 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15992 14355 gene locus_tag LOCUS_09380 15992 14355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 17180 16551 gene locus_tag LOCUS_09390 17180 16551 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_09390 17653 17177 gene locus_tag LOCUS_09400 17653 17177 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226079.1 protein_id gnl|my_center|LOCUS_09400 18146 21343 gene locus_tag LOCUS_09410 18146 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 22115 21348 gene locus_tag LOCUS_09420 22115 21348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 23608 22115 gene locus_tag LOCUS_09430 gene metG 23608 22115 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_09430 24452 23643 gene locus_tag LOCUS_09440 gene rsmI 24452 23643 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 protein_id gnl|my_center|LOCUS_09440 24784 24470 gene locus_tag LOCUS_09450 24784 24470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 25857 24790 gene locus_tag LOCUS_09460 gene ychF 25857 24790 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642429.1 protein_id gnl|my_center|LOCUS_09460 26490 26026 gene locus_tag LOCUS_09470 26490 26026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 27617 26487 gene locus_tag LOCUS_09480 27617 26487 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081348.1 protein_id gnl|my_center|LOCUS_09480 28277 29278 gene locus_tag LOCUS_09490 gene galT 28277 29278 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_09490 30141 29275 gene locus_tag LOCUS_09500 30141 29275 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_09500 31499 30132 gene locus_tag LOCUS_09510 gene zwf 31499 30132 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974206.1 protein_id gnl|my_center|LOCUS_09510 33295 31499 gene locus_tag LOCUS_09520 33295 31499 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223305.1 protein_id gnl|my_center|LOCUS_09520 33392 34579 gene locus_tag LOCUS_09530 33392 34579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 35577 34576 gene locus_tag LOCUS_09540 35577 34576 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124659.1 protein_id gnl|my_center|LOCUS_09540 35748 38237 gene locus_tag LOCUS_09550 35748 38237 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_09550 38411 39058 gene locus_tag LOCUS_09560 38411 39058 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_09560 40075 39068 gene locus_tag LOCUS_09570 40075 39068 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028275.1 protein_id gnl|my_center|LOCUS_09570 40728 40072 gene locus_tag LOCUS_09580 40728 40072 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_09580 41945 40725 gene locus_tag LOCUS_09590 41945 40725 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09590 42073 43326 gene locus_tag LOCUS_09600 42073 43326 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082252.1 protein_id gnl|my_center|LOCUS_09600 44953 43343 gene locus_tag LOCUS_09610 44953 43343 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093506.1 protein_id gnl|my_center|LOCUS_09610 45847 45113 gene locus_tag LOCUS_09620 45847 45113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 47107 45857 gene locus_tag LOCUS_09630 47107 45857 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_09630 47173 47799 gene locus_tag LOCUS_09640 47173 47799 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112164891.1 protein_id gnl|my_center|LOCUS_09640 49639 47732 gene locus_tag LOCUS_09650 gene dxs 49639 47732 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081956.1 protein_id gnl|my_center|LOCUS_09650 50879 49773 gene locus_tag LOCUS_09660 50879 49773 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512886.1 protein_id gnl|my_center|LOCUS_09660 51164 52543 gene locus_tag LOCUS_09670 51164 52543 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_09670 52536 53876 gene locus_tag LOCUS_09680 52536 53876 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_09680 53877 54527 gene locus_tag LOCUS_09690 53877 54527 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_09690 54811 54524 gene locus_tag LOCUS_09700 54811 54524 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230041.1 protein_id gnl|my_center|LOCUS_09700 54934 55836 gene locus_tag LOCUS_09710 gene galU 54934 55836 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_09710 55820 57040 gene locus_tag LOCUS_09720 gene moeA 55820 57040 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211949.1 protein_id gnl|my_center|LOCUS_09720 57042 57509 gene locus_tag LOCUS_09730 57042 57509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 59027 57501 gene locus_tag LOCUS_09740 59027 57501 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_09740 <65201 59410 gene locus_tag LOCUS_09750 <65201 59410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000052484.1:Ig-like domain-containing protein >Feature sequence12 206 131 gene locus_tag LOCUS_t00180 206 131 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 473 706 gene locus_tag LOCUS_09760 473 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2792 1548 gene locus_tag LOCUS_09770 2792 1548 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_09770 3826 5520 gene locus_tag LOCUS_09780 gene kdpA 3826 5520 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529643.1 protein_id gnl|my_center|LOCUS_09780 5521 7557 gene locus_tag LOCUS_09790 gene kdpB 5521 7557 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_09790 7557 8102 gene locus_tag LOCUS_09800 gene kdpC 7557 8102 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529646.1 protein_id gnl|my_center|LOCUS_09800 9234 8086 gene locus_tag LOCUS_09810 9234 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 9255 10733 gene locus_tag LOCUS_09820 9255 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 10730 11410 gene locus_tag LOCUS_09830 10730 11410 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223789.1 protein_id gnl|my_center|LOCUS_09830 12033 11476 gene locus_tag LOCUS_09840 12033 11476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 13640 12180 gene locus_tag LOCUS_09850 13640 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 13869 14225 gene locus_tag LOCUS_09860 13869 14225 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259424.1 protein_id gnl|my_center|LOCUS_09860 14222 15514 gene locus_tag LOCUS_09870 14222 15514 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890424.1 protein_id gnl|my_center|LOCUS_09870 16344 15511 gene locus_tag LOCUS_09880 16344 15511 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093147.1 protein_id gnl|my_center|LOCUS_09880 17297 16341 gene locus_tag LOCUS_09890 17297 16341 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230918.1 protein_id gnl|my_center|LOCUS_09890 18838 17300 gene locus_tag LOCUS_09900 18838 17300 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230917.1 protein_id gnl|my_center|LOCUS_09900 19145 19594 gene locus_tag LOCUS_09910 19145 19594 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227629.1 protein_id gnl|my_center|LOCUS_09910 20066 20854 gene locus_tag LOCUS_09920 20066 20854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_09920 21018 22805 gene locus_tag LOCUS_09930 21018 22805 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_09930 22802 24676 gene locus_tag LOCUS_09940 22802 24676 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_09940 24673 25728 gene locus_tag LOCUS_09950 24673 25728 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_09950 25857 27425 gene locus_tag LOCUS_09960 25857 27425 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 protein_id gnl|my_center|LOCUS_09960 27461 28831 gene locus_tag LOCUS_09970 27461 28831 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876257.1 protein_id gnl|my_center|LOCUS_09970 28836 30200 gene locus_tag LOCUS_09980 28836 30200 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_09980 30214 30978 gene locus_tag LOCUS_09990 30214 30978 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223704.1 protein_id gnl|my_center|LOCUS_09990 32209 30965 gene locus_tag LOCUS_10000 32209 30965 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730277.1 protein_id gnl|my_center|LOCUS_10000 34068 32767 gene locus_tag LOCUS_10010 34068 32767 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809693.1 protein_id gnl|my_center|LOCUS_10010 34842 34132 gene locus_tag LOCUS_10020 34842 34132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532982.1 protein_id gnl|my_center|LOCUS_10020 35614 34823 gene locus_tag LOCUS_10030 35614 34823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_10030 36625 35618 gene locus_tag LOCUS_10040 36625 35618 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391162.1 protein_id gnl|my_center|LOCUS_10040 37511 36636 gene locus_tag LOCUS_10050 37511 36636 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_10050 37715 39265 gene locus_tag LOCUS_10060 37715 39265 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850856.1 protein_id gnl|my_center|LOCUS_10060 39258 39956 gene locus_tag LOCUS_10070 39258 39956 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030483.1 protein_id gnl|my_center|LOCUS_10070 41050 43692 gene locus_tag LOCUS_10080 41050 43692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 43804 44811 gene locus_tag LOCUS_10090 43804 44811 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477386.1 protein_id gnl|my_center|LOCUS_10090 45563 44955 gene locus_tag LOCUS_10100 45563 44955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 45722 46438 gene locus_tag LOCUS_10110 45722 46438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 46454 46651 gene locus_tag LOCUS_10120 46454 46651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 47990 46632 gene locus_tag LOCUS_10130 47990 46632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 48086 48313 gene locus_tag LOCUS_10140 48086 48313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 48303 48656 gene locus_tag LOCUS_10150 48303 48656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 51936 48676 gene locus_tag LOCUS_10160 51936 48676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 53199 53591 gene locus_tag LOCUS_10170 53199 53591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 53854 55410 gene locus_tag LOCUS_10180 53854 55410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 55621 57327 gene locus_tag LOCUS_10190 55621 57327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 57363 58205 gene locus_tag LOCUS_10200 57363 58205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 58463 61051 gene locus_tag LOCUS_10210 58463 61051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence13 1573 122 gene locus_tag LOCUS_10220 1573 122 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144591055.1 protein_id gnl|my_center|LOCUS_10220 1670 3361 gene locus_tag LOCUS_10230 1670 3361 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_10230 3447 3803 gene locus_tag LOCUS_10240 3447 3803 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877101.1 protein_id gnl|my_center|LOCUS_10240 5258 4185 gene locus_tag LOCUS_10250 5258 4185 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728263.1 protein_id gnl|my_center|LOCUS_10250 5428 5952 gene locus_tag LOCUS_10260 5428 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 5957 6328 gene locus_tag LOCUS_10270 gene hypA 5957 6328 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258629.1 protein_id gnl|my_center|LOCUS_10270 6322 6981 gene locus_tag LOCUS_10280 gene hypB 6322 6981 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258628.1 protein_id gnl|my_center|LOCUS_10280 7027 7998 gene locus_tag LOCUS_10290 7027 7998 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893633.1 protein_id gnl|my_center|LOCUS_10290 8074 9681 gene locus_tag LOCUS_10300 8074 9681 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728265.1 protein_id gnl|my_center|LOCUS_10300 9681 10262 gene locus_tag LOCUS_10310 9681 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 10259 11536 gene locus_tag LOCUS_10320 10259 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258623.1 protein_id gnl|my_center|LOCUS_10320 11529 11909 gene locus_tag LOCUS_10330 11529 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258622.1 protein_id gnl|my_center|LOCUS_10330 11922 12761 gene locus_tag LOCUS_10340 11922 12761 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909297.1 protein_id gnl|my_center|LOCUS_10340 12761 13912 gene locus_tag LOCUS_10350 12761 13912 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104264.1 protein_id gnl|my_center|LOCUS_10350 13932 14201 gene locus_tag LOCUS_10360 13932 14201 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_10360 14210 16510 gene locus_tag LOCUS_10370 gene hypF 14210 16510 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_10370 16540 17649 gene locus_tag LOCUS_10380 gene hypD 16540 17649 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_10380 17639 18712 gene locus_tag LOCUS_10390 gene hypE 17639 18712 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_10390 19173 19182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19572 20336 gene locus_tag LOCUS_10400 19572 20336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 21467 20418 gene locus_tag LOCUS_10410 21467 20418 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 protein_id gnl|my_center|LOCUS_10410 22499 21510 gene locus_tag LOCUS_10420 22499 21510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 22577 23344 gene locus_tag LOCUS_10430 22577 23344 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250685.1 protein_id gnl|my_center|LOCUS_10430 25048 23405 gene locus_tag LOCUS_10440 25048 23405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 25639 25061 gene locus_tag LOCUS_10450 25639 25061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 26237 25659 gene locus_tag LOCUS_10460 26237 25659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 26380 26721 gene locus_tag LOCUS_10470 26380 26721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 27878 28276 gene locus_tag LOCUS_10480 27878 28276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10480 29222 28497 gene locus_tag LOCUS_10490 29222 28497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 30518 29508 gene locus_tag LOCUS_10500 30518 29508 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057667.1 protein_id gnl|my_center|LOCUS_10500 32797 30515 gene locus_tag LOCUS_10510 32797 30515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 33936 33217 gene locus_tag LOCUS_10520 gene pgl 33936 33217 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258411.1 protein_id gnl|my_center|LOCUS_10520 34029 34322 gene locus_tag LOCUS_10530 34029 34322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 34363 34569 gene locus_tag LOCUS_10540 34363 34569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 34816 35616 gene locus_tag LOCUS_10550 gene trmI 34816 35616 CDS product tRNA (adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908265.1 protein_id gnl|my_center|LOCUS_10550 35986 35750 gene locus_tag LOCUS_10560 35986 35750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 36133 37881 gene locus_tag LOCUS_10570 gene arc 36133 37881 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_10570 37919 39412 gene locus_tag LOCUS_10580 gene dop 37919 39412 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_10580 39451 39645 gene locus_tag LOCUS_10590 39451 39645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 39704 40504 gene locus_tag LOCUS_10600 gene prcB 39704 40504 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_10600 40501 41184 gene locus_tag LOCUS_10610 gene prcA 40501 41184 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_10610 41186 42550 gene locus_tag LOCUS_10620 gene pafA 41186 42550 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_10620 42604 43092 gene locus_tag LOCUS_10630 gene lepB 42604 43092 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_10630 43350 43688 gene locus_tag LOCUS_10640 43350 43688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 43891 44892 gene locus_tag LOCUS_10650 gene trpS 43891 44892 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_10650 44889 45179 gene locus_tag LOCUS_10660 44889 45179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 45210 45965 gene locus_tag LOCUS_10670 gene tatC 45210 45965 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410764.1 protein_id gnl|my_center|LOCUS_10670 46046 48529 gene locus_tag LOCUS_10680 46046 48529 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226708.1 protein_id gnl|my_center|LOCUS_10680 48918 49658 gene locus_tag LOCUS_10690 48918 49658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 49661 50461 gene locus_tag LOCUS_10700 49661 50461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 50554 52449 gene locus_tag LOCUS_10710 gene ctaD 50554 52449 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140742.1 protein_id gnl|my_center|LOCUS_10710 52512 53126 gene locus_tag LOCUS_10720 52512 53126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 53228 54130 gene locus_tag LOCUS_10730 53228 54130 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533219.1 protein_id gnl|my_center|LOCUS_10730 54130 54603 gene locus_tag LOCUS_10740 54130 54603 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_10740 54674 55573 gene locus_tag LOCUS_10750 54674 55573 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence14 <1 1741 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgtagtcgcccggggtgagagagggagctacaac 2274 2573 gene locus_tag LOCUS_10760 2274 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2458 2757 gene locus_tag LOCUS_10770 2458 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3537 3461 gene locus_tag LOCUS_t00190 3537 3461 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4296 3550 gene locus_tag LOCUS_10780 gene suhB 4296 3550 CDS product bifunctional fructose-1,6-bisphosphatase/inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879859.1 protein_id gnl|my_center|LOCUS_10780 4999 4340 gene locus_tag LOCUS_10790 4999 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 6082 5111 gene locus_tag LOCUS_10800 6082 5111 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420817.1 protein_id gnl|my_center|LOCUS_10800 6223 6585 gene locus_tag LOCUS_10810 6223 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 6663 9113 gene locus_tag LOCUS_10820 6663 9113 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_10820 10260 9202 gene locus_tag LOCUS_10830 10260 9202 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388189.1 protein_id gnl|my_center|LOCUS_10830 11054 10305 gene locus_tag LOCUS_10840 11054 10305 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_10840 12222 11071 gene locus_tag LOCUS_10850 12222 11071 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486609.1 protein_id gnl|my_center|LOCUS_10850 13172 12483 gene locus_tag LOCUS_10860 13172 12483 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_10860 13298 13948 gene locus_tag LOCUS_10870 13298 13948 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_10870 13989 14750 gene locus_tag LOCUS_10880 13989 14750 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933138.1 protein_id gnl|my_center|LOCUS_10880 14818 16425 gene locus_tag LOCUS_10890 14818 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_10890 18899 17682 gene locus_tag LOCUS_10900 18899 17682 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094791896.1 protein_id gnl|my_center|LOCUS_10900 20028 18901 gene locus_tag LOCUS_10910 20028 18901 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228953.1 protein_id gnl|my_center|LOCUS_10910 20879 20025 gene locus_tag LOCUS_10920 20879 20025 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226336.1 protein_id gnl|my_center|LOCUS_10920 21676 20882 gene locus_tag LOCUS_10930 21676 20882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 22402 21743 gene locus_tag LOCUS_10940 22402 21743 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258777.1 protein_id gnl|my_center|LOCUS_10940 23522 22410 gene locus_tag LOCUS_10950 23522 22410 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_10950 25133 23550 gene locus_tag LOCUS_10960 25133 23550 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_10960 25923 25126 gene locus_tag LOCUS_10970 25923 25126 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_10970 26181 25981 gene locus_tag LOCUS_10980 26181 25981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 26444 26686 gene locus_tag LOCUS_10990 26444 26686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 27860 26631 gene locus_tag LOCUS_11000 gene rnd 27860 26631 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532283.1 protein_id gnl|my_center|LOCUS_11000 28431 27916 gene locus_tag LOCUS_11010 28431 27916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 28370 28855 gene locus_tag LOCUS_11020 28370 28855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 30096 28834 gene locus_tag LOCUS_11030 gene tyrS 30096 28834 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_11030 31805 30102 gene locus_tag LOCUS_11040 gene menD 31805 30102 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_11040 31790 32614 gene locus_tag LOCUS_11050 gene menH 31790 32614 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_11050 33473 32607 gene locus_tag LOCUS_11060 33473 32607 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094666.1 protein_id gnl|my_center|LOCUS_11060 34306 33473 gene locus_tag LOCUS_11070 gene menB 34306 33473 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963885.1 protein_id gnl|my_center|LOCUS_11070 34394 35503 gene locus_tag LOCUS_11080 gene menE 34394 35503 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742122.1 protein_id gnl|my_center|LOCUS_11080 37035 35587 gene locus_tag LOCUS_11090 37035 35587 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081393.1 protein_id gnl|my_center|LOCUS_11090 37930 37187 gene locus_tag LOCUS_11100 37930 37187 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_11100 38116 40032 gene locus_tag LOCUS_11110 38116 40032 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938026.1 protein_id gnl|my_center|LOCUS_11110 40029 40637 gene locus_tag LOCUS_11120 40029 40637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 42561 40768 gene locus_tag LOCUS_11130 gene uidA 42561 40768 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583888.1 protein_id gnl|my_center|LOCUS_11130 43209 43817 gene locus_tag LOCUS_11140 43209 43817 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 protein_id gnl|my_center|LOCUS_11140 44300 43836 gene locus_tag LOCUS_11150 44300 43836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 46401 44341 gene locus_tag LOCUS_11160 46401 44341 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112541.1 protein_id gnl|my_center|LOCUS_11160 46555 50127 gene locus_tag LOCUS_11170 gene dnaE 46555 50127 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407751.1 protein_id gnl|my_center|LOCUS_11170 50869 50513 gene locus_tag LOCUS_11180 50869 50513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 51010 51309 gene locus_tag LOCUS_11190 51010 51309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 51774 51577 gene locus_tag LOCUS_11200 51774 51577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence15 379 1014 gene locus_tag LOCUS_11210 379 1014 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228741.1 protein_id gnl|my_center|LOCUS_11210 1647 2804 gene locus_tag LOCUS_11220 1647 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2747 3352 gene locus_tag LOCUS_11230 2747 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 3847 3428 gene locus_tag LOCUS_11240 gene mce 3847 3428 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_11240 5199 3844 gene locus_tag LOCUS_11250 gene ccrA 5199 3844 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223473.1 protein_id gnl|my_center|LOCUS_11250 5277 6458 gene locus_tag LOCUS_11260 5277 6458 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_11260 6568 9552 gene locus_tag LOCUS_11270 6568 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 10111 9542 gene locus_tag LOCUS_11280 10111 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 10889 10131 gene locus_tag LOCUS_11290 10889 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 10989 12197 gene locus_tag LOCUS_11300 10989 12197 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063166.1 protein_id gnl|my_center|LOCUS_11300 12194 13198 gene locus_tag LOCUS_11310 12194 13198 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_11310 13302 14135 gene locus_tag LOCUS_11320 13302 14135 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_11320 14337 14185 gene locus_tag LOCUS_11330 14337 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 14336 16741 gene locus_tag LOCUS_11340 14336 16741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 16758 17162 gene locus_tag LOCUS_11350 16758 17162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 17155 17436 gene locus_tag LOCUS_11360 17155 17436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 18426 17728 gene locus_tag LOCUS_11370 18426 17728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 20130 20229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20641 20976 gene locus_tag LOCUS_11380 gene flgB 20641 20976 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989548.1 protein_id gnl|my_center|LOCUS_11380 20979 21413 gene locus_tag LOCUS_11390 gene flgC 20979 21413 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817176.1 protein_id gnl|my_center|LOCUS_11390 21413 21709 gene locus_tag LOCUS_11400 21413 21709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 21720 23249 gene locus_tag LOCUS_11410 gene fliF 21720 23249 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994484.1 protein_id gnl|my_center|LOCUS_11410 23246 24253 gene locus_tag LOCUS_11420 gene fliG 23246 24253 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870078.1 protein_id gnl|my_center|LOCUS_11420 24250 24876 gene locus_tag LOCUS_11430 24250 24876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 24867 26180 gene locus_tag LOCUS_11440 gene fliI 24867 26180 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_11440 26181 26588 gene locus_tag LOCUS_11450 26181 26588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 26678 27601 gene locus_tag LOCUS_11460 26678 27601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 27591 28895 gene locus_tag LOCUS_11470 27591 28895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 28920 29366 gene locus_tag LOCUS_11480 28920 29366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 29418 30713 gene locus_tag LOCUS_11490 gene flgE 29418 30713 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_11490 30864 31109 gene locus_tag LOCUS_11500 30864 31109 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816224.1 protein_id gnl|my_center|LOCUS_11500 31112 31897 gene locus_tag LOCUS_11510 31112 31897 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081357594.1 protein_id gnl|my_center|LOCUS_11510 31901 32671 gene locus_tag LOCUS_11520 31901 32671 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460802.1 protein_id gnl|my_center|LOCUS_11520 32681 33175 gene locus_tag LOCUS_11530 32681 33175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 33235 34149 gene locus_tag LOCUS_11540 33235 34149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 34149 34439 gene locus_tag LOCUS_11550 gene fliN 34149 34439 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720209.1 protein_id gnl|my_center|LOCUS_11550 34441 34839 gene locus_tag LOCUS_11560 34441 34839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 34836 35537 gene locus_tag LOCUS_11570 gene fliP 34836 35537 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852529.1 protein_id gnl|my_center|LOCUS_11570 35534 35809 gene locus_tag LOCUS_11580 gene fliQ 35534 35809 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811859.1 protein_id gnl|my_center|LOCUS_11580 35812 36576 gene locus_tag LOCUS_11590 35812 36576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 36577 37695 gene locus_tag LOCUS_11600 gene flhB 36577 37695 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858726.1 protein_id gnl|my_center|LOCUS_11600 38486 38585 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38619 39179 gene locus_tag LOCUS_11610 38619 39179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 40132 39182 gene locus_tag LOCUS_11620 gene speB 40132 39182 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224492.1 protein_id gnl|my_center|LOCUS_11620 40896 40147 gene locus_tag LOCUS_11630 40896 40147 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892438.1 protein_id gnl|my_center|LOCUS_11630 41600 40896 gene locus_tag LOCUS_11640 41600 40896 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727390.1 protein_id gnl|my_center|LOCUS_11640 43054 41600 gene locus_tag LOCUS_11650 43054 41600 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729780.1 protein_id gnl|my_center|LOCUS_11650 44010 43072 gene locus_tag LOCUS_11660 44010 43072 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729776.1 protein_id gnl|my_center|LOCUS_11660 44147 45697 gene locus_tag LOCUS_11670 44147 45697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 45706 47757 gene locus_tag LOCUS_11680 gene flhA 45706 47757 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870057.1 protein_id gnl|my_center|LOCUS_11680 47735 48727 gene locus_tag LOCUS_11690 47735 48727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 48724 48942 gene locus_tag LOCUS_11700 48724 48942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 49353 49006 gene locus_tag LOCUS_11710 49353 49006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 50842 49631 gene locus_tag LOCUS_11720 50842 49631 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056143.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence16 2052 1414 gene locus_tag LOCUS_11730 2052 1414 CDS product IS607-like element IS1535 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404760.1 protein_id gnl|my_center|LOCUS_11730 3123 2155 gene locus_tag LOCUS_11740 3123 2155 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065199.1 protein_id gnl|my_center|LOCUS_11740 4846 3107 gene locus_tag LOCUS_11750 4846 3107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021751.1 protein_id gnl|my_center|LOCUS_11750 5259 4924 gene locus_tag LOCUS_11760 5259 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 6205 5249 gene locus_tag LOCUS_11770 6205 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 6907 6215 gene locus_tag LOCUS_11780 6907 6215 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027577.1 protein_id gnl|my_center|LOCUS_11780 8359 7100 gene locus_tag LOCUS_11790 8359 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 9301 8438 gene locus_tag LOCUS_11800 9301 8438 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087566.1 protein_id gnl|my_center|LOCUS_11800 9678 9304 gene locus_tag LOCUS_11810 gene trxA 9678 9304 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_11810 9831 9748 gene locus_tag LOCUS_t00200 9831 9748 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10325 9861 gene locus_tag LOCUS_11820 10325 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 11001 10330 gene locus_tag LOCUS_11830 11001 10330 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730864.1 protein_id gnl|my_center|LOCUS_11830 11597 11004 gene locus_tag LOCUS_11840 11597 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 12802 11591 gene locus_tag LOCUS_11850 12802 11591 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_11850 13898 12756 gene locus_tag LOCUS_11860 13898 12756 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_11860 14836 13895 gene locus_tag LOCUS_11870 14836 13895 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_11870 15655 14843 gene locus_tag LOCUS_11880 15655 14843 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_11880 18047 15675 gene locus_tag LOCUS_11890 18047 15675 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_11890 18517 18044 gene locus_tag LOCUS_11900 18517 18044 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227068.1 protein_id gnl|my_center|LOCUS_11900 18821 19285 gene locus_tag LOCUS_11910 18821 19285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 19293 20231 gene locus_tag LOCUS_11920 19293 20231 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147080.1 protein_id gnl|my_center|LOCUS_11920 21018 23471 gene locus_tag LOCUS_11930 21018 23471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 23471 26548 gene locus_tag LOCUS_11940 23471 26548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 26558 27118 gene locus_tag LOCUS_11950 26558 27118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 27274 29025 gene locus_tag LOCUS_11960 27274 29025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 29046 29789 gene locus_tag LOCUS_11970 29046 29789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974037.1 protein_id gnl|my_center|LOCUS_11970 29825 31141 gene locus_tag LOCUS_11980 29825 31141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 31191 32474 gene locus_tag LOCUS_11990 gene eno 31191 32474 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_11990 32471 32785 gene locus_tag LOCUS_12000 32471 32785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 32817 35072 gene locus_tag LOCUS_12010 32817 35072 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_12010 36082 35069 gene locus_tag LOCUS_12020 36082 35069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 39506 36117 gene locus_tag LOCUS_12030 gene mfd 39506 36117 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730525.1 protein_id gnl|my_center|LOCUS_12030 40071 39499 gene locus_tag LOCUS_12040 gene pth 40071 39499 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941324.1 protein_id gnl|my_center|LOCUS_12040 40622 40107 gene locus_tag LOCUS_12050 40622 40107 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092871.1 protein_id gnl|my_center|LOCUS_12050 41655 40681 gene locus_tag LOCUS_12060 41655 40681 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896824.1 protein_id gnl|my_center|LOCUS_12060 42831 41734 gene locus_tag LOCUS_12070 gene glmU 42831 41734 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898727.1 protein_id gnl|my_center|LOCUS_12070 44393 42840 gene locus_tag LOCUS_12080 44393 42840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 46699 44636 gene locus_tag LOCUS_12090 46699 44636 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_12090 46847 48601 gene locus_tag LOCUS_12100 46847 48601 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086844353.1 protein_id gnl|my_center|LOCUS_12100 48707 48871 gene locus_tag LOCUS_12110 48707 48871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 49148 50005 gene locus_tag LOCUS_12120 gene rsmA 49148 50005 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence17 727 143 gene locus_tag LOCUS_12130 727 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 844 1521 gene locus_tag LOCUS_12140 844 1521 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757575.1 protein_id gnl|my_center|LOCUS_12140 1514 2548 gene locus_tag LOCUS_12150 gene mnmA 1514 2548 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093979.1 protein_id gnl|my_center|LOCUS_12150 2545 4557 gene locus_tag LOCUS_12160 gene ligA 2545 4557 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_12160 4635 6503 gene locus_tag LOCUS_12170 gene pknB 4635 6503 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_12170 6572 7015 gene locus_tag LOCUS_12180 6572 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 7046 7348 gene locus_tag LOCUS_12190 gene gatC 7046 7348 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_12190 7345 8793 gene locus_tag LOCUS_12200 gene gatA 7345 8793 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_12200 8790 10214 gene locus_tag LOCUS_12210 gene gatB 8790 10214 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_12210 10260 11927 gene locus_tag LOCUS_12220 gene ilvD 10260 11927 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900824.1 protein_id gnl|my_center|LOCUS_12220 12187 13893 gene locus_tag LOCUS_12230 12187 13893 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728299.1 protein_id gnl|my_center|LOCUS_12230 13890 14459 gene locus_tag LOCUS_12240 gene ilvN 13890 14459 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811897.1 protein_id gnl|my_center|LOCUS_12240 14463 15485 gene locus_tag LOCUS_12250 gene ilvC 14463 15485 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_12250 15619 16602 gene locus_tag LOCUS_12260 15619 16602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 16584 17207 gene locus_tag LOCUS_12270 16584 17207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 17265 18560 gene locus_tag LOCUS_12280 17265 18560 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938462.1 protein_id gnl|my_center|LOCUS_12280 19012 18557 gene locus_tag LOCUS_12290 19012 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 20642 19056 gene locus_tag LOCUS_12300 gene cimA 20642 19056 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146979.1 protein_id gnl|my_center|LOCUS_12300 21555 20632 gene locus_tag LOCUS_12310 21555 20632 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039182.1 protein_id gnl|my_center|LOCUS_12310 22571 21555 gene locus_tag LOCUS_12320 22571 21555 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014258.1 protein_id gnl|my_center|LOCUS_12320 22831 23301 gene locus_tag LOCUS_12330 gene greA 22831 23301 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229826.1 protein_id gnl|my_center|LOCUS_12330 23338 24738 gene locus_tag LOCUS_12340 gene leuC 23338 24738 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_12340 24752 25348 gene locus_tag LOCUS_12350 gene leuD 24752 25348 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 protein_id gnl|my_center|LOCUS_12350 26644 27090 gene locus_tag LOCUS_12360 26644 27090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 28345 27233 gene locus_tag LOCUS_12370 gene serC 28345 27233 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174401615.1 protein_id gnl|my_center|LOCUS_12370 28389 29612 gene locus_tag LOCUS_12380 28389 29612 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_12380 29664 31244 gene locus_tag LOCUS_12390 gene serA 29664 31244 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_12390 31402 32937 gene locus_tag LOCUS_12400 31402 32937 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_12400 34384 33023 gene locus_tag LOCUS_12410 34384 33023 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201008.1 protein_id gnl|my_center|LOCUS_12410 35319 34444 gene locus_tag LOCUS_12420 35319 34444 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810801.1 protein_id gnl|my_center|LOCUS_12420 36374 35331 gene locus_tag LOCUS_12430 36374 35331 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972896.1 protein_id gnl|my_center|LOCUS_12430 37596 36388 gene locus_tag LOCUS_12440 37596 36388 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 protein_id gnl|my_center|LOCUS_12440 38282 37593 gene locus_tag LOCUS_12450 38282 37593 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775885.1 protein_id gnl|my_center|LOCUS_12450 38803 38731 gene locus_tag LOCUS_t00210 38803 38731 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 40262 38886 gene locus_tag LOCUS_12460 gene gltX 40262 38886 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_12460 41161 40307 gene locus_tag LOCUS_12470 41161 40307 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230733.1 protein_id gnl|my_center|LOCUS_12470 42309 41161 gene locus_tag LOCUS_12480 42309 41161 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_12480 42529 46062 gene locus_tag LOCUS_12490 42529 46062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 46219 46410 gene locus_tag LOCUS_12500 46219 46410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 46400 47986 gene locus_tag LOCUS_12510 46400 47986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 48102 48177 gene locus_tag LOCUS_t00220 48102 48177 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence18 624 1838 gene locus_tag LOCUS_12520 624 1838 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230385.1 protein_id gnl|my_center|LOCUS_12520 1927 2754 gene locus_tag LOCUS_12530 1927 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3222 2779 gene locus_tag LOCUS_12540 gene cynS 3222 2779 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088475.1 protein_id gnl|my_center|LOCUS_12540 3396 4610 gene locus_tag LOCUS_12550 3396 4610 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970459.1 protein_id gnl|my_center|LOCUS_12550 4651 5145 gene locus_tag LOCUS_12560 4651 5145 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_12560 5392 5159 gene locus_tag LOCUS_12570 5392 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12570 6417 5389 gene locus_tag LOCUS_12580 6417 5389 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_12580 7414 6440 gene locus_tag LOCUS_12590 7414 6440 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263117.1 protein_id gnl|my_center|LOCUS_12590 8249 7515 gene locus_tag LOCUS_12600 8249 7515 CDS product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391262.1 protein_id gnl|my_center|LOCUS_12600 8420 9016 gene locus_tag LOCUS_12610 8420 9016 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461828.1 protein_id gnl|my_center|LOCUS_12610 9013 10929 gene locus_tag LOCUS_12620 gene cooS 9013 10929 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272665.1 protein_id gnl|my_center|LOCUS_12620 11010 12176 gene locus_tag LOCUS_12630 11010 12176 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_12630 12234 13046 gene locus_tag LOCUS_12640 12234 13046 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_12640 14347 13415 gene locus_tag LOCUS_12650 14347 13415 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110400.1 protein_id gnl|my_center|LOCUS_12650 16959 14977 gene locus_tag LOCUS_12660 16959 14977 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027760.1 protein_id gnl|my_center|LOCUS_12660 18639 17035 gene locus_tag LOCUS_12670 gene fadD5 18639 17035 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_12670 19524 18727 gene locus_tag LOCUS_12680 19524 18727 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_12680 21072 19555 gene locus_tag LOCUS_12690 21072 19555 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_12690 22233 21094 gene locus_tag LOCUS_12700 22233 21094 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172653.1 protein_id gnl|my_center|LOCUS_12700 22889 22230 gene locus_tag LOCUS_12710 22889 22230 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815309.1 protein_id gnl|my_center|LOCUS_12710 24498 22954 gene locus_tag LOCUS_12720 24498 22954 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_12720 24989 24516 gene locus_tag LOCUS_12730 24989 24516 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_12730 26294 25113 gene locus_tag LOCUS_12740 26294 25113 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877713.1 protein_id gnl|my_center|LOCUS_12740 27454 26309 gene locus_tag LOCUS_12750 27454 26309 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_12750 27703 29364 gene locus_tag LOCUS_12760 27703 29364 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879349.1 protein_id gnl|my_center|LOCUS_12760 29435 30862 gene locus_tag LOCUS_12770 29435 30862 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_12770 30865 32067 gene locus_tag LOCUS_12780 30865 32067 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_12780 33817 32474 gene locus_tag LOCUS_12790 33817 32474 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205737.1 protein_id gnl|my_center|LOCUS_12790 33948 35018 gene locus_tag LOCUS_12800 33948 35018 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_12800 35015 35893 gene locus_tag LOCUS_12810 35015 35893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 35979 36722 gene locus_tag LOCUS_12820 35979 36722 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_12820 36722 37012 gene locus_tag LOCUS_12830 36722 37012 CDS product DUF6295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226838.1 protein_id gnl|my_center|LOCUS_12830 38145 37009 gene locus_tag LOCUS_12840 38145 37009 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_12840 39916 38153 gene locus_tag LOCUS_12850 gene aspS 39916 38153 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_12850 41198 40077 gene locus_tag LOCUS_12860 41198 40077 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_12860 42477 41179 gene locus_tag LOCUS_12870 42477 41179 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_12870 43889 43023 gene locus_tag LOCUS_12880 gene hemC 43889 43023 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_12880 45174 43933 gene locus_tag LOCUS_12890 gene hemA 45174 43933 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_12890 46054 45275 gene locus_tag LOCUS_12900 gene proC 46054 45275 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence19 1549 1743 gene locus_tag LOCUS_12910 1549 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1688 1846 gene locus_tag LOCUS_12920 1688 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2102 1890 gene locus_tag LOCUS_12930 2102 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 2327 2163 gene locus_tag LOCUS_12940 2327 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 2420 2623 gene locus_tag LOCUS_12950 2420 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4381 2648 gene locus_tag LOCUS_12960 4381 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5215 5706 gene locus_tag LOCUS_12970 5215 5706 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224600.1 protein_id gnl|my_center|LOCUS_12970 5703 6332 gene locus_tag LOCUS_12980 5703 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 8420 6603 gene locus_tag LOCUS_12990 8420 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 9649 8750 gene locus_tag LOCUS_13000 gene rpoD 9649 8750 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280530.1 protein_id gnl|my_center|LOCUS_13000 11460 9646 gene locus_tag LOCUS_13010 11460 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 14157 11536 gene locus_tag LOCUS_13020 gene ppdK 14157 11536 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_13020 15114 14398 gene locus_tag LOCUS_13030 gene recO 15114 14398 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895862.1 protein_id gnl|my_center|LOCUS_13030 15290 15111 gene locus_tag LOCUS_13040 15290 15111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 16015 15287 gene locus_tag LOCUS_13050 16015 15287 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 protein_id gnl|my_center|LOCUS_13050 16472 16002 gene locus_tag LOCUS_13060 16472 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 17220 16543 gene locus_tag LOCUS_13070 gene era 17220 16543 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412224.1 protein_id gnl|my_center|LOCUS_13070 18677 17394 gene locus_tag LOCUS_13080 18677 17394 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_13080 19224 18688 gene locus_tag LOCUS_13090 gene ybeY 19224 18688 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_13090 20204 19221 gene locus_tag LOCUS_13100 20204 19221 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110199.1 protein_id gnl|my_center|LOCUS_13100 20312 20839 gene locus_tag LOCUS_13110 20312 20839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 21238 21960 gene locus_tag LOCUS_13120 21238 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 22334 23131 gene locus_tag LOCUS_13130 22334 23131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 23973 23146 gene locus_tag LOCUS_13140 23973 23146 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_13140 24093 25310 gene locus_tag LOCUS_13150 24093 25310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 25307 26116 gene locus_tag LOCUS_13160 25307 26116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 26269 26949 gene locus_tag LOCUS_13170 26269 26949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 27002 27256 gene locus_tag LOCUS_13180 27002 27256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 27256 27633 gene locus_tag LOCUS_13190 27256 27633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 27623 28048 gene locus_tag LOCUS_13200 27623 28048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 28447 28220 gene locus_tag LOCUS_13210 28447 28220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 28540 29379 gene locus_tag LOCUS_13220 28540 29379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 29546 31510 gene locus_tag LOCUS_13230 gene acs 29546 31510 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_13230 31639 32235 gene locus_tag LOCUS_13240 gene satP 31639 32235 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209246.1 protein_id gnl|my_center|LOCUS_13240 33381 32302 gene locus_tag LOCUS_13250 gene hemW 33381 32302 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285807.1 protein_id gnl|my_center|LOCUS_13250 33970 33386 gene locus_tag LOCUS_13260 33970 33386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 34605 34009 gene locus_tag LOCUS_13270 34605 34009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 35825 34713 gene locus_tag LOCUS_13280 gene dnaJ 35825 34713 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_13280 36844 35834 gene locus_tag LOCUS_13290 gene hrcA 36844 35834 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060339.1 protein_id gnl|my_center|LOCUS_13290 37205 36942 gene locus_tag LOCUS_13300 gene rpsT 37205 36942 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907833.1 protein_id gnl|my_center|LOCUS_13300 37311 39101 gene locus_tag LOCUS_13310 gene lepA 37311 39101 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775765.1 protein_id gnl|my_center|LOCUS_13310 40106 39153 gene locus_tag LOCUS_13320 40106 39153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 40969 40106 gene locus_tag LOCUS_13330 gene folP 40969 40106 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730302.1 protein_id gnl|my_center|LOCUS_13330 41657 40950 gene locus_tag LOCUS_13340 41657 40950 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_13340 44209 41768 gene locus_tag LOCUS_13350 gene leuS 44209 41768 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_13350 44313 44389 gene locus_tag LOCUS_t00230 44313 44389 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 45167 44589 gene locus_tag LOCUS_13360 45167 44589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence20 393 653 gene locus_tag LOCUS_13370 393 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1294 761 gene locus_tag LOCUS_13380 1294 761 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005123515.1 protein_id gnl|my_center|LOCUS_13380 1821 2204 gene locus_tag LOCUS_13390 1821 2204 CDS product DUF3054 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907641.1 protein_id gnl|my_center|LOCUS_13390 2241 2618 gene locus_tag LOCUS_13400 2241 2618 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228875.1 protein_id gnl|my_center|LOCUS_13400 3374 2643 gene locus_tag LOCUS_13410 3374 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 3480 4589 gene locus_tag LOCUS_13420 3480 4589 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761873.1 protein_id gnl|my_center|LOCUS_13420 6214 4616 gene locus_tag LOCUS_13430 6214 4616 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926032.1 protein_id gnl|my_center|LOCUS_13430 7042 6293 gene locus_tag LOCUS_13440 7042 6293 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028014.1 protein_id gnl|my_center|LOCUS_13440 7655 7056 gene locus_tag LOCUS_13450 7655 7056 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390739.1 protein_id gnl|my_center|LOCUS_13450 9531 7834 gene locus_tag LOCUS_13460 gene cobJ 9531 7834 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483898.1 protein_id gnl|my_center|LOCUS_13460 10730 9534 gene locus_tag LOCUS_13470 10730 9534 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531080.1 protein_id gnl|my_center|LOCUS_13470 11785 10727 gene locus_tag LOCUS_13480 11785 10727 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145958.1 protein_id gnl|my_center|LOCUS_13480 12606 11788 gene locus_tag LOCUS_13490 gene cobM 12606 11788 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970288.1 protein_id gnl|my_center|LOCUS_13490 13905 12619 gene locus_tag LOCUS_13500 13905 12619 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228815.1 protein_id gnl|my_center|LOCUS_13500 14429 13971 gene locus_tag LOCUS_13510 gene cobO 14429 13971 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_13510 14588 14896 gene locus_tag LOCUS_13520 14588 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 16046 14937 gene locus_tag LOCUS_13530 gene menC 16046 14937 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398737.1 protein_id gnl|my_center|LOCUS_13530 17210 16455 gene locus_tag LOCUS_13540 17210 16455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 18486 17386 gene locus_tag LOCUS_13550 18486 17386 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_13550 18508 18720 gene locus_tag LOCUS_13560 18508 18720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 18738 19652 gene locus_tag LOCUS_13570 gene miaA 18738 19652 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390091.1 protein_id gnl|my_center|LOCUS_13570 19639 20409 gene locus_tag LOCUS_13580 gene dapF 19639 20409 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_13580 20406 21701 gene locus_tag LOCUS_13590 gene hflX 20406 21701 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_13590 21701 22786 gene locus_tag LOCUS_13600 gene dapC 21701 22786 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088031.1 protein_id gnl|my_center|LOCUS_13600 22793 23617 gene locus_tag LOCUS_13610 22793 23617 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_13610 23614 24648 gene locus_tag LOCUS_13620 gene dapE 23614 24648 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092984.1 protein_id gnl|my_center|LOCUS_13620 25283 24645 gene locus_tag LOCUS_13630 gene lexA 25283 24645 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699857.1 protein_id gnl|my_center|LOCUS_13630 25427 25915 gene locus_tag LOCUS_13640 gene nrdR 25427 25915 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_13640 25896 26360 gene locus_tag LOCUS_13650 25896 26360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 27134 26352 gene locus_tag LOCUS_13660 27134 26352 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_13660 27210 28229 gene locus_tag LOCUS_13670 gene ltaE 27210 28229 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_13670 28226 28930 gene locus_tag LOCUS_13680 28226 28930 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256262.1 protein_id gnl|my_center|LOCUS_13680 28930 29304 gene locus_tag LOCUS_13690 28930 29304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 29442 29804 gene locus_tag LOCUS_13700 29442 29804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 29856 30071 gene locus_tag LOCUS_13710 29856 30071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 30262 30783 gene locus_tag LOCUS_13720 30262 30783 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_13720 31349 32170 gene locus_tag LOCUS_13730 31349 32170 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_13730 32163 32783 gene locus_tag LOCUS_13740 32163 32783 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227489.1 protein_id gnl|my_center|LOCUS_13740 33879 33307 gene locus_tag LOCUS_13750 33879 33307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 34622 34020 gene locus_tag LOCUS_13760 34622 34020 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence21 <1 2031 gene locus_tag LOCUS_13770 <1 2031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001282864.1:DNA gyrase subunit A 2028 2423 gene locus_tag LOCUS_13780 2028 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2448 2522 gene locus_tag LOCUS_t00240 2448 2522 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3701 2574 gene locus_tag LOCUS_13790 3701 2574 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_13790 4443 3808 gene locus_tag LOCUS_13800 4443 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 4925 4479 gene locus_tag LOCUS_13810 4925 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 6922 5135 gene locus_tag LOCUS_13820 6922 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 7095 6919 gene locus_tag LOCUS_13830 7095 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 8195 9379 gene locus_tag LOCUS_13840 gene trxB 8195 9379 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_13840 9929 10972 gene locus_tag LOCUS_13850 9929 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 11374 12000 gene locus_tag LOCUS_13860 11374 12000 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005133116.1 protein_id gnl|my_center|LOCUS_13860 12082 13458 gene locus_tag LOCUS_13870 12082 13458 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731297.1 protein_id gnl|my_center|LOCUS_13870 13520 14368 gene locus_tag LOCUS_13880 13520 14368 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_13880 14368 15186 gene locus_tag LOCUS_13890 14368 15186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227225.1 protein_id gnl|my_center|LOCUS_13890 15537 18038 gene locus_tag LOCUS_13900 15537 18038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 18194 18108 gene locus_tag LOCUS_t00250 18194 18108 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19136 18213 gene locus_tag LOCUS_13910 gene pheA 19136 18213 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256077.1 protein_id gnl|my_center|LOCUS_13910 19185 19898 gene locus_tag LOCUS_13920 gene larB 19185 19898 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_13920 19888 21054 gene locus_tag LOCUS_13930 gene larC 19888 21054 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_13930 21105 22022 gene locus_tag LOCUS_13940 21105 22022 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_13940 22022 22939 gene locus_tag LOCUS_13950 22022 22939 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480227.1 protein_id gnl|my_center|LOCUS_13950 25431 22936 gene locus_tag LOCUS_13960 gene ppc 25431 22936 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 protein_id gnl|my_center|LOCUS_13960 25577 25492 gene locus_tag LOCUS_t00260 25577 25492 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25814 27559 gene locus_tag LOCUS_13970 gene dnaX 25814 27559 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391576.1 protein_id gnl|my_center|LOCUS_13970 27546 28139 gene locus_tag LOCUS_13980 gene recR 27546 28139 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence22 504 250 gene locus_tag LOCUS_13990 gene purS 504 250 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879434.1 protein_id gnl|my_center|LOCUS_13990 1375 494 gene locus_tag LOCUS_14000 1375 494 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897243.1 protein_id gnl|my_center|LOCUS_14000 2685 1372 gene locus_tag LOCUS_14010 gene purB 2685 1372 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880354.1 protein_id gnl|my_center|LOCUS_14010 3930 2713 gene locus_tag LOCUS_14020 gene purD 3930 2713 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_14020 5201 3927 gene locus_tag LOCUS_14030 5201 3927 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_14030 6083 6182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6287 7120 gene locus_tag LOCUS_14040 6287 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 9315 7138 gene locus_tag LOCUS_14050 gene purL 9315 7138 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_14050 9634 10047 gene locus_tag LOCUS_14060 9634 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 11296 10055 gene locus_tag LOCUS_14070 11296 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 12731 11322 gene locus_tag LOCUS_14080 12731 11322 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_14080 12730 14229 gene locus_tag LOCUS_14090 12730 14229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 18043 14246 gene locus_tag LOCUS_14100 18043 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 18711 18148 gene locus_tag LOCUS_14110 gene pyrE 18711 18148 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_14110 19715 18702 gene locus_tag LOCUS_14120 gene purM 19715 18702 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_14120 21112 19691 gene locus_tag LOCUS_14130 gene purF 21112 19691 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_14130 21163 22020 gene locus_tag LOCUS_14140 21163 22020 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870266.1 protein_id gnl|my_center|LOCUS_14140 22078 22153 gene locus_tag LOCUS_t00270 22078 22153 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 22165 22238 gene locus_tag LOCUS_t00280 22165 22238 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 22696 22241 gene locus_tag LOCUS_14150 22696 22241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14150 22933 22697 gene locus_tag LOCUS_14160 22933 22697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14160 24845 23181 gene locus_tag LOCUS_14170 24845 23181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 26077 26286 gene locus_tag LOCUS_14180 26077 26286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence23 840 511 gene locus_tag LOCUS_14190 840 511 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235677901.1 protein_id gnl|my_center|LOCUS_14190 1017 926 gene locus_tag LOCUS_t00290 1017 926 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1101 2006 gene locus_tag LOCUS_14200 1101 2006 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_14200 3408 2032 gene locus_tag LOCUS_14210 3408 2032 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 protein_id gnl|my_center|LOCUS_14210 3535 4002 gene locus_tag LOCUS_14220 3535 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5396 3999 gene locus_tag LOCUS_14230 5396 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 6114 5371 gene locus_tag LOCUS_14240 6114 5371 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257281.1 protein_id gnl|my_center|LOCUS_14240 6264 6488 gene locus_tag LOCUS_14250 6264 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 7679 6687 gene locus_tag LOCUS_14260 7679 6687 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 protein_id gnl|my_center|LOCUS_14260 7880 8740 gene locus_tag LOCUS_14270 7880 8740 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980321.1 protein_id gnl|my_center|LOCUS_14270 8943 9905 gene locus_tag LOCUS_14280 8943 9905 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064421.1 protein_id gnl|my_center|LOCUS_14280 10491 9907 gene locus_tag LOCUS_14290 10491 9907 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_14290 11700 10522 gene locus_tag LOCUS_14300 11700 10522 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081124.1 protein_id gnl|my_center|LOCUS_14300 13494 11764 gene locus_tag LOCUS_14310 gene ade 13494 11764 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_14310 13688 15103 gene locus_tag LOCUS_14320 13688 15103 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777024.1 protein_id gnl|my_center|LOCUS_14320 15450 15100 gene locus_tag LOCUS_14330 15450 15100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 15754 17028 gene locus_tag LOCUS_14340 gene hisS 15754 17028 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142552.1 protein_id gnl|my_center|LOCUS_14340 17169 19259 gene locus_tag LOCUS_14350 17169 19259 CDS product protease pro-enzyme activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963944.1 protein_id gnl|my_center|LOCUS_14350 20016 19513 gene locus_tag LOCUS_14360 20016 19513 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223648.1 protein_id gnl|my_center|LOCUS_14360 20427 21413 gene locus_tag LOCUS_14370 20427 21413 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_14370 21410 22201 gene locus_tag LOCUS_14380 21410 22201 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_14380 23193 22627 gene locus_tag LOCUS_14390 23193 22627 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_14390 23333 23743 gene locus_tag LOCUS_14400 23333 23743 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 protein_id gnl|my_center|LOCUS_14400 24928 24422 gene locus_tag LOCUS_14410 24928 24422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 26741 25410 gene locus_tag LOCUS_14420 26741 25410 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857525.1 protein_id gnl|my_center|LOCUS_14420 27061 26741 gene locus_tag LOCUS_14430 27061 26741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence24 2143 245 gene locus_tag LOCUS_14440 2143 245 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878180.1 protein_id gnl|my_center|LOCUS_14440 3793 2354 gene locus_tag LOCUS_14450 3793 2354 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846386.1 protein_id gnl|my_center|LOCUS_14450 4065 5498 gene locus_tag LOCUS_14460 4065 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5703 6965 gene locus_tag LOCUS_14470 5703 6965 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_14470 7023 7829 gene locus_tag LOCUS_14480 7023 7829 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_14480 9508 7880 gene locus_tag LOCUS_14490 9508 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 10025 10816 gene locus_tag LOCUS_14500 10025 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 12011 10824 gene locus_tag LOCUS_14510 12011 10824 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 protein_id gnl|my_center|LOCUS_14510 12370 13362 gene locus_tag LOCUS_14520 12370 13362 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704826.1 protein_id gnl|my_center|LOCUS_14520 13398 13808 gene locus_tag LOCUS_14530 13398 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 14148 13849 gene locus_tag LOCUS_14540 14148 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 16344 14233 gene locus_tag LOCUS_14550 gene acs 16344 14233 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404429.1 protein_id gnl|my_center|LOCUS_14550 16634 16999 gene locus_tag LOCUS_14560 16634 16999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 17004 18191 gene locus_tag LOCUS_14570 17004 18191 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_14570 18193 20235 gene locus_tag LOCUS_14580 18193 20235 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927008.1 protein_id gnl|my_center|LOCUS_14580 20222 21631 gene locus_tag LOCUS_14590 20222 21631 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939673.1 protein_id gnl|my_center|LOCUS_14590 21642 22727 gene locus_tag LOCUS_14600 21642 22727 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940764.1 protein_id gnl|my_center|LOCUS_14600 22724 23563 gene locus_tag LOCUS_14610 22724 23563 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_14610 23574 24488 gene locus_tag LOCUS_14620 gene korB 23574 24488 CDS product 2-oxoglutarate synthase subunit KorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876665.1 protein_id gnl|my_center|LOCUS_14620 24481 25089 gene locus_tag LOCUS_14630 24481 25089 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence25 543 791 gene locus_tag LOCUS_14640 543 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 797 1867 gene locus_tag LOCUS_14650 gene rlmN 797 1867 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092553592.1 protein_id gnl|my_center|LOCUS_14650 1972 2655 gene locus_tag LOCUS_14660 gene rpe 1972 2655 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_14660 2652 5555 gene locus_tag LOCUS_14670 2652 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 5585 6523 gene locus_tag LOCUS_14680 5585 6523 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144407.1 protein_id gnl|my_center|LOCUS_14680 7549 6638 gene locus_tag LOCUS_14690 7549 6638 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726798.1 protein_id gnl|my_center|LOCUS_14690 8096 9022 gene locus_tag LOCUS_14700 gene cysK 8096 9022 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_14700 9817 9077 gene locus_tag LOCUS_14710 9817 9077 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726796.1 protein_id gnl|my_center|LOCUS_14710 9880 10809 gene locus_tag LOCUS_14720 9880 10809 CDS product choline/ethanolamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336755.1 protein_id gnl|my_center|LOCUS_14720 10878 11570 gene locus_tag LOCUS_14730 10878 11570 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143168.1 protein_id gnl|my_center|LOCUS_14730 11583 14036 gene locus_tag LOCUS_14740 11583 14036 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 protein_id gnl|my_center|LOCUS_14740 14161 15681 gene locus_tag LOCUS_14750 14161 15681 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224508.1 protein_id gnl|my_center|LOCUS_14750 16465 15704 gene locus_tag LOCUS_14760 16465 15704 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687752.1 protein_id gnl|my_center|LOCUS_14760 17483 16536 gene locus_tag LOCUS_14770 17483 16536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 19285 17480 gene locus_tag LOCUS_14780 19285 17480 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228162.1 protein_id gnl|my_center|LOCUS_14780 20534 19647 gene locus_tag LOCUS_14790 20534 19647 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_14790 21333 20524 gene locus_tag LOCUS_14800 21333 20524 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731501.1 protein_id gnl|my_center|LOCUS_14800 21591 22688 gene locus_tag LOCUS_14810 gene dpaL 21591 22688 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869174.1 protein_id gnl|my_center|LOCUS_14810 24357 23959 gene locus_tag LOCUS_14820 24357 23959 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728177.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence26 1446 1691 gene locus_tag LOCUS_14830 1446 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 2268 3491 gene locus_tag LOCUS_14840 gene nrfD 2268 3491 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_14840 3517 6423 gene locus_tag LOCUS_14850 3517 6423 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_14850 6426 7241 gene locus_tag LOCUS_14860 6426 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 7890 7252 gene locus_tag LOCUS_14870 7890 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 8032 8634 gene locus_tag LOCUS_14880 8032 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 8740 8997 gene locus_tag LOCUS_14890 8740 8997 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_14890 10455 9022 gene locus_tag LOCUS_14900 10455 9022 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223979.1 protein_id gnl|my_center|LOCUS_14900 10763 10452 gene locus_tag LOCUS_14910 10763 10452 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_14910 11929 10814 gene locus_tag LOCUS_14920 11929 10814 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_14920 12153 13772 gene locus_tag LOCUS_14930 12153 13772 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090588.1 protein_id gnl|my_center|LOCUS_14930 13899 15044 gene locus_tag LOCUS_14940 13899 15044 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227132.1 protein_id gnl|my_center|LOCUS_14940 15163 16734 gene locus_tag LOCUS_14950 15163 16734 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974603.1 protein_id gnl|my_center|LOCUS_14950 16748 18664 gene locus_tag LOCUS_14960 16748 18664 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_14960 18661 20400 gene locus_tag LOCUS_14970 18661 20400 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730568.1 protein_id gnl|my_center|LOCUS_14970 20393 21166 gene locus_tag LOCUS_14980 20393 21166 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_14980 21306 21379 gene locus_tag LOCUS_t00300 21306 21379 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 21384 21459 gene locus_tag LOCUS_t00310 21384 21459 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21520 22743 gene locus_tag LOCUS_14990 21520 22743 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_14990 22918 22634 gene locus_tag LOCUS_15000 22918 22634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 23130 22918 gene locus_tag LOCUS_15010 23130 22918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 23604 23308 gene locus_tag LOCUS_15020 23604 23308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 24243 23695 gene locus_tag LOCUS_15030 24243 23695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15030 24557 24240 gene locus_tag LOCUS_15040 24557 24240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 25291 24554 gene locus_tag LOCUS_15050 25291 24554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15050 >Feature sequence27 351 1406 gene locus_tag LOCUS_15060 351 1406 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228127.1 protein_id gnl|my_center|LOCUS_15060 1581 1411 gene locus_tag LOCUS_15070 1581 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1910 1566 gene locus_tag LOCUS_15080 1910 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3278 2226 gene locus_tag LOCUS_15090 gene trpD 3278 2226 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_15090 6008 3300 gene locus_tag LOCUS_15100 6008 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6435 8588 gene locus_tag LOCUS_15110 6435 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 9183 8596 gene locus_tag LOCUS_15120 9183 8596 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_15120 10558 9227 gene locus_tag LOCUS_15130 10558 9227 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_15130 11046 10630 gene locus_tag LOCUS_15140 11046 10630 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_15140 11572 11099 gene locus_tag LOCUS_15150 11572 11099 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_15150 11684 13066 gene locus_tag LOCUS_15160 gene glpK 11684 13066 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261933.1 protein_id gnl|my_center|LOCUS_15160 14019 13063 gene locus_tag LOCUS_15170 14019 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 14220 15263 gene locus_tag LOCUS_15180 14220 15263 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219537380.1 protein_id gnl|my_center|LOCUS_15180 15256 15732 gene locus_tag LOCUS_15190 gene purE 15256 15732 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877211.1 protein_id gnl|my_center|LOCUS_15190 15870 16175 gene locus_tag LOCUS_15200 15870 16175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 16770 16552 gene locus_tag LOCUS_15210 16770 16552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 17087 17581 gene locus_tag LOCUS_15220 17087 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 18293 18087 gene locus_tag LOCUS_15230 18293 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 19373 18684 gene locus_tag LOCUS_15240 19373 18684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 21414 19375 gene locus_tag LOCUS_15250 21414 19375 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 protein_id gnl|my_center|LOCUS_15250 21890 21423 gene locus_tag LOCUS_15260 21890 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 22935 21883 gene locus_tag LOCUS_15270 22935 21883 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298533.1 protein_id gnl|my_center|LOCUS_15270 23166 23648 gene locus_tag LOCUS_15280 23166 23648 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731048.1 protein_id gnl|my_center|LOCUS_15280 23702 24019 gene locus_tag LOCUS_15290 23702 24019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 24016 24762 gene locus_tag LOCUS_15300 24016 24762 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965766.1 protein_id gnl|my_center|LOCUS_15300 24755 24994 gene locus_tag LOCUS_15310 24755 24994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence28 1855 455 gene locus_tag LOCUS_15320 1855 455 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_15320 2899 1886 gene locus_tag LOCUS_15330 2899 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3070 3717 gene locus_tag LOCUS_15340 3070 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3710 5557 gene locus_tag LOCUS_15350 3710 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 5538 7142 gene locus_tag LOCUS_15360 5538 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 7139 7978 gene locus_tag LOCUS_15370 7139 7978 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_15370 8009 8350 gene locus_tag LOCUS_15380 8009 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 8354 9331 gene locus_tag LOCUS_15390 gene trxB 8354 9331 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855300.1 protein_id gnl|my_center|LOCUS_15390 9355 9741 gene locus_tag LOCUS_15400 gene trxA 9355 9741 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400164.1 protein_id gnl|my_center|LOCUS_15400 9816 10736 gene locus_tag LOCUS_15410 9816 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 11837 10767 gene locus_tag LOCUS_15420 11837 10767 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_15420 12500 11859 gene locus_tag LOCUS_15430 12500 11859 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082800.1 protein_id gnl|my_center|LOCUS_15430 12648 13055 gene locus_tag LOCUS_15440 12648 13055 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323592.1 protein_id gnl|my_center|LOCUS_15440 13098 13958 gene locus_tag LOCUS_15450 gene panB 13098 13958 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_15450 15707 13959 gene locus_tag LOCUS_15460 15707 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 16226 15777 gene locus_tag LOCUS_15470 gene rplI 16226 15777 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_15470 16588 16229 gene locus_tag LOCUS_15480 16588 16229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 17039 16593 gene locus_tag LOCUS_15490 17039 16593 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909031.1 protein_id gnl|my_center|LOCUS_15490 17402 17067 gene locus_tag LOCUS_15500 17402 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 18160 17531 gene locus_tag LOCUS_15510 18160 17531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 18336 18770 gene locus_tag LOCUS_15520 18336 18770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 19654 18767 gene locus_tag LOCUS_15530 19654 18767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 19586 19864 gene locus_tag LOCUS_15540 19586 19864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 19940 20596 gene locus_tag LOCUS_15550 19940 20596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 22623 20608 gene locus_tag LOCUS_15560 22623 20608 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_15560 23271 22678 gene locus_tag LOCUS_15570 gene dcd 23271 22678 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064104.1 protein_id gnl|my_center|LOCUS_15570 23325 23396 gene locus_tag LOCUS_t00320 23325 23396 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence29 1134 79 gene locus_tag LOCUS_15580 1134 79 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193577.1 protein_id gnl|my_center|LOCUS_15580 1203 1760 gene locus_tag LOCUS_15590 1203 1760 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_15590 1813 2208 gene locus_tag LOCUS_15600 1813 2208 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800772.1 protein_id gnl|my_center|LOCUS_15600 2254 3120 gene locus_tag LOCUS_15610 2254 3120 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_15610 3423 4130 gene locus_tag LOCUS_15620 gene ubiE 3423 4130 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_15620 4127 5272 gene locus_tag LOCUS_15630 4127 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 5284 8121 gene locus_tag LOCUS_15640 gene uvrA 5284 8121 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_15640 8118 9971 gene locus_tag LOCUS_15650 gene uvrC 8118 9971 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082304.1 protein_id gnl|my_center|LOCUS_15650 10009 10767 gene locus_tag LOCUS_15660 10009 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 10764 11612 gene locus_tag LOCUS_15670 gene rapZ 10764 11612 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_15670 11616 12479 gene locus_tag LOCUS_15680 11616 12479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 12588 13622 gene locus_tag LOCUS_15690 gene gap 12588 13622 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_15690 13622 14758 gene locus_tag LOCUS_15700 13622 14758 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545367.1 protein_id gnl|my_center|LOCUS_15700 14755 15567 gene locus_tag LOCUS_15710 gene tpiA 14755 15567 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014466.1 protein_id gnl|my_center|LOCUS_15710 15600 15827 gene locus_tag LOCUS_15720 gene secG 15600 15827 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224669.1 protein_id gnl|my_center|LOCUS_15720 16247 15843 gene locus_tag LOCUS_15730 16247 15843 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_15730 16531 16244 gene locus_tag LOCUS_15740 16531 16244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 16575 17972 gene locus_tag LOCUS_15750 16575 17972 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817012.1 protein_id gnl|my_center|LOCUS_15750 18069 19217 gene locus_tag LOCUS_15760 18069 19217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 19207 19857 gene locus_tag LOCUS_15770 19207 19857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 21396 19858 gene locus_tag LOCUS_15780 21396 19858 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900872.1 protein_id gnl|my_center|LOCUS_15780 <22628 21393 gene locus_tag LOCUS_15790 <22628 21393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003411690.1:FAD-binding oxidoreductase >Feature sequence30 210 1250 gene locus_tag LOCUS_15800 gene ispH 210 1250 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_15800 1960 1247 gene locus_tag LOCUS_15810 1960 1247 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222957.1 protein_id gnl|my_center|LOCUS_15810 2580 1957 gene locus_tag LOCUS_15820 gene cmk 2580 1957 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729300.1 protein_id gnl|my_center|LOCUS_15820 2770 3726 gene locus_tag LOCUS_15830 gene htpX 2770 3726 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_15830 3733 4296 gene locus_tag LOCUS_15840 3733 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_15840 5585 4293 gene locus_tag LOCUS_15850 gene aroA 5585 4293 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 protein_id gnl|my_center|LOCUS_15850 5951 5589 gene locus_tag LOCUS_15860 gene aroH 5951 5589 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_15860 6609 5932 gene locus_tag LOCUS_15870 6609 5932 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_15870 7262 6654 gene locus_tag LOCUS_15880 gene scpB 7262 6654 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389686.1 protein_id gnl|my_center|LOCUS_15880 7966 7259 gene locus_tag LOCUS_15890 7966 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 8376 7960 gene locus_tag LOCUS_15900 8376 7960 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964230.1 protein_id gnl|my_center|LOCUS_15900 9659 8394 gene locus_tag LOCUS_15910 9659 8394 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_15910 10759 9656 gene locus_tag LOCUS_15920 10759 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 12207 10756 gene locus_tag LOCUS_15930 12207 10756 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_15930 12254 12991 gene locus_tag LOCUS_15940 gene ydfG 12254 12991 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636564.1 protein_id gnl|my_center|LOCUS_15940 13027 14178 gene locus_tag LOCUS_15950 13027 14178 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_15950 14288 14797 gene locus_tag LOCUS_15960 14288 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 15710 15423 gene locus_tag LOCUS_15970 15710 15423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 16516 15827 gene locus_tag LOCUS_15980 16516 15827 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230360.1 protein_id gnl|my_center|LOCUS_15980 17862 16513 gene locus_tag LOCUS_15990 17862 16513 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742179.1 protein_id gnl|my_center|LOCUS_15990 18045 18977 gene locus_tag LOCUS_16000 18045 18977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 19079 19993 gene locus_tag LOCUS_16010 19079 19993 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_16010 20021 20674 gene locus_tag LOCUS_16020 gene phoU 20021 20674 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_16020 21341 20679 gene locus_tag LOCUS_16030 21341 20679 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_16030 21810 21379 gene locus_tag LOCUS_16040 21810 21379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence31 <1 719 gene locus_tag LOCUS_16050 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384089.1:bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase 712 1443 gene locus_tag LOCUS_16060 gene rlmB 712 1443 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_16060 1440 2033 gene locus_tag LOCUS_16070 1440 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2190 3236 gene locus_tag LOCUS_16080 2190 3236 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869311.1 protein_id gnl|my_center|LOCUS_16080 3313 4644 gene locus_tag LOCUS_16090 3313 4644 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888077.1 protein_id gnl|my_center|LOCUS_16090 4670 5662 gene locus_tag LOCUS_16100 4670 5662 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_16100 5659 6504 gene locus_tag LOCUS_16110 5659 6504 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_16110 6501 8099 gene locus_tag LOCUS_16120 6501 8099 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480032.1 protein_id gnl|my_center|LOCUS_16120 8125 9282 gene locus_tag LOCUS_16130 8125 9282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_16130 10271 9291 gene locus_tag LOCUS_16140 10271 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 10451 10272 gene locus_tag LOCUS_16150 10451 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 10942 10448 gene locus_tag LOCUS_16160 10942 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 11926 11045 gene locus_tag LOCUS_16170 11926 11045 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268899.1 protein_id gnl|my_center|LOCUS_16170 11994 13157 gene locus_tag LOCUS_16180 11994 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 13212 14426 gene locus_tag LOCUS_16190 13212 14426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 14464 15453 gene locus_tag LOCUS_16200 14464 15453 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_16200 17979 15466 gene locus_tag LOCUS_16210 gene valS 17979 15466 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_16210 18111 19454 gene locus_tag LOCUS_16220 gene cysS 18111 19454 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081016.1 protein_id gnl|my_center|LOCUS_16220 19507 20721 gene locus_tag LOCUS_16230 19507 20721 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_16230 21120 20680 gene locus_tag LOCUS_16240 21120 20680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 21464 21024 gene locus_tag LOCUS_16250 21464 21024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence32 314 1333 gene locus_tag LOCUS_16260 314 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2856 1525 gene locus_tag LOCUS_16270 gene hemG 2856 1525 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989606.1 protein_id gnl|my_center|LOCUS_16270 3917 2853 gene locus_tag LOCUS_16280 gene hemE 3917 2853 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224512.1 protein_id gnl|my_center|LOCUS_16280 3958 6099 gene locus_tag LOCUS_16290 3958 6099 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_16290 6127 6723 gene locus_tag LOCUS_16300 6127 6723 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729685.1 protein_id gnl|my_center|LOCUS_16300 6737 7546 gene locus_tag LOCUS_16310 6737 7546 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086661.1 protein_id gnl|my_center|LOCUS_16310 7543 8427 gene locus_tag LOCUS_16320 7543 8427 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805019.1 protein_id gnl|my_center|LOCUS_16320 8424 9965 gene locus_tag LOCUS_16330 8424 9965 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224083.1 protein_id gnl|my_center|LOCUS_16330 9962 10702 gene locus_tag LOCUS_16340 9962 10702 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466782.1 protein_id gnl|my_center|LOCUS_16340 10707 12389 gene locus_tag LOCUS_16350 gene ctaD 10707 12389 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229476.1 protein_id gnl|my_center|LOCUS_16350 12379 12801 gene locus_tag LOCUS_16360 12379 12801 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971910.1 protein_id gnl|my_center|LOCUS_16360 12898 14292 gene locus_tag LOCUS_16370 12898 14292 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230584.1 protein_id gnl|my_center|LOCUS_16370 14506 15054 gene locus_tag LOCUS_16380 14506 15054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 16479 15133 gene locus_tag LOCUS_16390 16479 15133 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_16390 17287 16472 gene locus_tag LOCUS_16400 gene lgt 17287 16472 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048192.1 protein_id gnl|my_center|LOCUS_16400 19134 17707 gene locus_tag LOCUS_16410 19134 17707 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence33 2734 131 gene locus_tag LOCUS_16420 2734 131 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063890.1 protein_id gnl|my_center|LOCUS_16420 3841 2735 gene locus_tag LOCUS_16430 3841 2735 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063891.1 protein_id gnl|my_center|LOCUS_16430 4058 4918 gene locus_tag LOCUS_16440 4058 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 5981 4884 gene locus_tag LOCUS_16450 5981 4884 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391983.1 protein_id gnl|my_center|LOCUS_16450 7060 5978 gene locus_tag LOCUS_16460 7060 5978 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979957.1 protein_id gnl|my_center|LOCUS_16460 8028 7057 gene locus_tag LOCUS_16470 8028 7057 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880219.1 protein_id gnl|my_center|LOCUS_16470 8468 8022 gene locus_tag LOCUS_16480 8468 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 9467 8496 gene locus_tag LOCUS_16490 9467 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 10214 9834 gene locus_tag LOCUS_16500 10214 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 10539 12137 gene locus_tag LOCUS_16510 gene ilvD 10539 12137 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900824.1 protein_id gnl|my_center|LOCUS_16510 12536 12291 gene locus_tag LOCUS_16520 12536 12291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 12426 12950 gene locus_tag LOCUS_16530 12426 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 13510 13058 gene locus_tag LOCUS_16540 13510 13058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 13893 13522 gene locus_tag LOCUS_16550 13893 13522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 14267 13893 gene locus_tag LOCUS_16560 gene sdhC 14267 13893 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222765.1 protein_id gnl|my_center|LOCUS_16560 15754 14444 gene locus_tag LOCUS_16570 gene serS 15754 14444 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_16570 15778 16698 gene locus_tag LOCUS_16580 15778 16698 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907823.1 protein_id gnl|my_center|LOCUS_16580 16699 17430 gene locus_tag LOCUS_16590 16699 17430 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_16590 17553 18515 gene locus_tag LOCUS_16600 17553 18515 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_16600 18551 18832 gene locus_tag LOCUS_16610 gene clpS 18551 18832 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406906.1 protein_id gnl|my_center|LOCUS_16610 18829 19263 gene locus_tag LOCUS_16620 18829 19263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence34 418 624 gene locus_tag LOCUS_16630 418 624 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428513.1 protein_id gnl|my_center|LOCUS_16630 626 1036 gene locus_tag LOCUS_16640 626 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1026 2795 gene locus_tag LOCUS_16650 1026 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 3786 3013 gene locus_tag LOCUS_16660 3786 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 4375 4001 gene locus_tag LOCUS_16670 4375 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4325 5191 gene locus_tag LOCUS_16680 4325 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 5194 5766 gene locus_tag LOCUS_16690 5194 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16690 6206 5838 gene locus_tag LOCUS_16700 6206 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 6536 7447 gene locus_tag LOCUS_16710 6536 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16710 10091 7590 gene locus_tag LOCUS_16720 10091 7590 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211121229.1 protein_id gnl|my_center|LOCUS_16720 12671 10155 gene locus_tag LOCUS_16730 12671 10155 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 protein_id gnl|my_center|LOCUS_16730 13667 12681 gene locus_tag LOCUS_16740 13667 12681 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_16740 14604 14050 gene locus_tag LOCUS_16750 14604 14050 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729581.1 protein_id gnl|my_center|LOCUS_16750 15244 14906 gene locus_tag LOCUS_16760 15244 14906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16760 15769 15257 gene locus_tag LOCUS_16770 15769 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 16121 16858 gene locus_tag LOCUS_16780 16121 16858 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224827.1 protein_id gnl|my_center|LOCUS_16780 17517 16903 gene locus_tag LOCUS_16790 17517 16903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 18288 17866 gene locus_tag LOCUS_16800 18288 17866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence35 1099 107 gene locus_tag LOCUS_16810 1099 107 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 protein_id gnl|my_center|LOCUS_16810 1290 1102 gene locus_tag LOCUS_16820 gene rpmB 1290 1102 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_16820 1427 3013 gene locus_tag LOCUS_16830 1427 3013 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992286.1 protein_id gnl|my_center|LOCUS_16830 3041 5218 gene locus_tag LOCUS_16840 gene recG 3041 5218 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141278.1 protein_id gnl|my_center|LOCUS_16840 5427 5870 gene locus_tag LOCUS_16850 gene rsmD 5427 5870 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932644.1 protein_id gnl|my_center|LOCUS_16850 5867 6346 gene locus_tag LOCUS_16860 gene coaD 5867 6346 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_16860 6343 6888 gene locus_tag LOCUS_16870 6343 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 7292 6987 gene locus_tag LOCUS_16880 7292 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 7662 8660 gene locus_tag LOCUS_16890 gene plsX 7662 8660 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239753.1 protein_id gnl|my_center|LOCUS_16890 8650 8931 gene locus_tag LOCUS_16900 gene acpP 8650 8931 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065130.1 protein_id gnl|my_center|LOCUS_16900 8967 9641 gene locus_tag LOCUS_16910 8967 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 9648 10490 gene locus_tag LOCUS_16920 gene mutM 9648 10490 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_16920 10481 13819 gene locus_tag LOCUS_16930 gene smc 10481 13819 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014857.1 protein_id gnl|my_center|LOCUS_16930 13868 14932 gene locus_tag LOCUS_16940 13868 14932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 14945 16282 gene locus_tag LOCUS_16950 gene ffh 14945 16282 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014851.1 protein_id gnl|my_center|LOCUS_16950 16329 16583 gene locus_tag LOCUS_16960 gene rpsP 16329 16583 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_16960 16580 16957 gene locus_tag LOCUS_16970 16580 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 16929 17417 gene locus_tag LOCUS_16980 gene rimM 16929 17417 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_16980 17435 18208 gene locus_tag LOCUS_16990 gene trmD 17435 18208 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272440.1 protein_id gnl|my_center|LOCUS_16990 18195 18536 gene locus_tag LOCUS_17000 gene rplS 18195 18536 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence36 970 491 gene locus_tag LOCUS_17010 970 491 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_17010 1057 1797 gene locus_tag LOCUS_17020 gene crp 1057 1797 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908817.1 protein_id gnl|my_center|LOCUS_17020 2852 1776 gene locus_tag LOCUS_17030 gene disA 2852 1776 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296331.1 protein_id gnl|my_center|LOCUS_17030 5471 2979 gene locus_tag LOCUS_17040 5471 2979 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_17040 5909 6934 gene locus_tag LOCUS_17050 5909 6934 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222468.1 protein_id gnl|my_center|LOCUS_17050 8384 6939 gene locus_tag LOCUS_17060 gene lysS 8384 6939 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_17060 9253 8432 gene locus_tag LOCUS_17070 9253 8432 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_17070 10098 9250 gene locus_tag LOCUS_17080 gene panC 10098 9250 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336964.1 protein_id gnl|my_center|LOCUS_17080 10580 10098 gene locus_tag LOCUS_17090 gene folK 10580 10098 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531872.1 protein_id gnl|my_center|LOCUS_17090 11089 10577 gene locus_tag LOCUS_17100 11089 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 12208 11432 gene locus_tag LOCUS_17110 gene folP 12208 11432 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_17110 12773 12216 gene locus_tag LOCUS_17120 gene folE 12773 12216 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975226.1 protein_id gnl|my_center|LOCUS_17120 13320 12766 gene locus_tag LOCUS_17130 gene hpt 13320 12766 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_17130 14255 13317 gene locus_tag LOCUS_17140 14255 13317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 15255 14260 gene locus_tag LOCUS_17150 15255 14260 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230475.1 protein_id gnl|my_center|LOCUS_17150 15488 15291 gene locus_tag LOCUS_17160 15488 15291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 15790 15524 gene locus_tag LOCUS_17170 15790 15524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 16366 15797 gene locus_tag LOCUS_17180 16366 15797 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_17180 17782 17117 gene locus_tag LOCUS_17190 17782 17117 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223072.1 protein_id gnl|my_center|LOCUS_17190 18326 18646 gene locus_tag LOCUS_17200 18326 18646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence37 191 1774 gene locus_tag LOCUS_17210 191 1774 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_17210 1852 2412 gene locus_tag LOCUS_17220 1852 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2486 3061 gene locus_tag LOCUS_17230 2486 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3480 3073 gene locus_tag LOCUS_17240 3480 3073 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532564.1 protein_id gnl|my_center|LOCUS_17240 3809 3456 gene locus_tag LOCUS_17250 3809 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 5013 3793 gene locus_tag LOCUS_17260 5013 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 5105 5929 gene locus_tag LOCUS_17270 5105 5929 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_17270 7503 5965 gene locus_tag LOCUS_17280 7503 5965 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933376.1 protein_id gnl|my_center|LOCUS_17280 8233 7547 gene locus_tag LOCUS_17290 8233 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 10316 8226 gene locus_tag LOCUS_17300 10316 8226 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415097.1 protein_id gnl|my_center|LOCUS_17300 10382 11722 gene locus_tag LOCUS_17310 10382 11722 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013343.1 protein_id gnl|my_center|LOCUS_17310 11715 12797 gene locus_tag LOCUS_17320 11715 12797 CDS product lipoate protein ligase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881270.1 protein_id gnl|my_center|LOCUS_17320 12835 13173 gene locus_tag LOCUS_17330 12835 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 13948 13202 gene locus_tag LOCUS_17340 gene fdhD 13948 13202 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_17340 14731 14447 gene locus_tag LOCUS_17350 14731 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 14690 14881 gene locus_tag LOCUS_17360 14690 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 15314 15024 gene locus_tag LOCUS_17370 15314 15024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 16084 15512 gene locus_tag LOCUS_17380 16084 15512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence38 1590 268 gene locus_tag LOCUS_17390 1590 268 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086065.1 protein_id gnl|my_center|LOCUS_17390 2271 1597 gene locus_tag LOCUS_17400 2271 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3216 2476 gene locus_tag LOCUS_17410 3216 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 4184 3303 gene locus_tag LOCUS_17420 gene ftsX 4184 3303 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056458.1 protein_id gnl|my_center|LOCUS_17420 4870 4184 gene locus_tag LOCUS_17430 gene ftsE 4870 4184 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_17430 6065 4965 gene locus_tag LOCUS_17440 gene prfB 6065 4965 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018379.1 protein_id gnl|my_center|LOCUS_17440 8763 6058 gene locus_tag LOCUS_17450 gene secA 8763 6058 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_17450 9348 8779 gene locus_tag LOCUS_17460 gene raiA 9348 8779 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583763.1 protein_id gnl|my_center|LOCUS_17460 10655 9381 gene locus_tag LOCUS_17470 gene ahcY 10655 9381 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_17470 11713 10682 gene locus_tag LOCUS_17480 11713 10682 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_17480 11943 11728 gene locus_tag LOCUS_17490 11943 11728 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408362.1 protein_id gnl|my_center|LOCUS_17490 13298 11940 gene locus_tag LOCUS_17500 13298 11940 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_17500 14774 13518 gene locus_tag LOCUS_17510 14774 13518 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_17510 15375 15175 gene locus_tag LOCUS_17520 15375 15175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence39 653 889 gene locus_tag LOCUS_17530 653 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1236 772 gene locus_tag LOCUS_17540 1236 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1210 1740 gene locus_tag LOCUS_17550 1210 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1880 2920 gene locus_tag LOCUS_17560 1880 2920 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053640.1 protein_id gnl|my_center|LOCUS_17560 3671 3598 gene locus_tag LOCUS_t00330 3671 3598 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3772 5007 gene locus_tag LOCUS_17570 3772 5007 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429682.1 protein_id gnl|my_center|LOCUS_17570 7233 4984 gene locus_tag LOCUS_17580 7233 4984 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223834.1 protein_id gnl|my_center|LOCUS_17580 7546 7208 gene locus_tag LOCUS_17590 7546 7208 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223833.1 protein_id gnl|my_center|LOCUS_17590 9041 7698 gene locus_tag LOCUS_17600 9041 7698 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028829.1 protein_id gnl|my_center|LOCUS_17600 9116 10027 gene locus_tag LOCUS_17610 9116 10027 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728397.1 protein_id gnl|my_center|LOCUS_17610 10039 10620 gene locus_tag LOCUS_17620 gene nadD 10039 10620 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296447.1 protein_id gnl|my_center|LOCUS_17620 10670 11131 gene locus_tag LOCUS_17630 10670 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 11707 11138 gene locus_tag LOCUS_17640 11707 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 11913 12245 gene locus_tag LOCUS_17650 11913 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 12341 13177 gene locus_tag LOCUS_17660 12341 13177 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 protein_id gnl|my_center|LOCUS_17660 13490 15406 gene locus_tag LOCUS_17670 13490 15406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence40 398 21 gene locus_tag LOCUS_17680 398 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 964 1911 gene locus_tag LOCUS_17690 964 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847040.1 protein_id gnl|my_center|LOCUS_17690 1874 2296 gene locus_tag LOCUS_17700 1874 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 3013 2291 gene locus_tag LOCUS_17710 3013 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 3243 4790 gene locus_tag LOCUS_17720 3243 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 4804 7134 gene locus_tag LOCUS_17730 4804 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 8545 7376 gene locus_tag LOCUS_17740 8545 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 8659 9729 gene locus_tag LOCUS_17750 8659 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 10206 9739 gene locus_tag LOCUS_17760 10206 9739 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_17760 10536 10219 gene locus_tag LOCUS_17770 10536 10219 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_17770 11816 10572 gene locus_tag LOCUS_17780 11816 10572 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_17780 13216 11924 gene locus_tag LOCUS_17790 13216 11924 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_17790 14436 13228 gene locus_tag LOCUS_17800 14436 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence41 1267 314 gene locus_tag LOCUS_17810 1267 314 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889389.1 protein_id gnl|my_center|LOCUS_17810 2109 1279 gene locus_tag LOCUS_17820 2109 1279 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_17820 2140 2529 gene locus_tag LOCUS_17830 2140 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2529 3758 gene locus_tag LOCUS_17840 2529 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 3786 4595 gene locus_tag LOCUS_17850 3786 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 5446 4592 gene locus_tag LOCUS_17860 5446 4592 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382877.1 protein_id gnl|my_center|LOCUS_17860 6835 5471 gene locus_tag LOCUS_17870 6835 5471 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918707.1 protein_id gnl|my_center|LOCUS_17870 7778 6864 gene locus_tag LOCUS_17880 7778 6864 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_17880 8689 7775 gene locus_tag LOCUS_17890 8689 7775 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118115.1 protein_id gnl|my_center|LOCUS_17890 10076 8754 gene locus_tag LOCUS_17900 10076 8754 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 protein_id gnl|my_center|LOCUS_17900 11841 10144 gene locus_tag LOCUS_17910 gene araD 11841 10144 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968358.1 protein_id gnl|my_center|LOCUS_17910 13197 12028 gene locus_tag LOCUS_17920 13197 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence42 2634 709 gene locus_tag LOCUS_17930 gene gyrB 2634 709 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_17930 3026 2682 gene locus_tag LOCUS_17940 3026 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 4074 3019 gene locus_tag LOCUS_17950 gene recF 4074 3019 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940680.1 protein_id gnl|my_center|LOCUS_17950 5199 4090 gene locus_tag LOCUS_17960 gene dnaN 5199 4090 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420481.1 protein_id gnl|my_center|LOCUS_17960 6843 5458 gene locus_tag LOCUS_17970 gene dnaA 6843 5458 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898364.1 protein_id gnl|my_center|LOCUS_17970 7200 7535 gene locus_tag LOCUS_17980 7200 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 7837 8820 gene locus_tag LOCUS_17990 7837 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 8879 9751 gene locus_tag LOCUS_18000 8879 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 9717 10334 gene locus_tag LOCUS_18010 gene rsmG 9717 10334 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868910.1 protein_id gnl|my_center|LOCUS_18010 11468 10581 gene locus_tag LOCUS_18020 11468 10581 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_18020 12228 11461 gene locus_tag LOCUS_18030 gene soj 12228 11461 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence43 310 870 gene locus_tag LOCUS_18040 310 870 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_18040 1602 853 gene locus_tag LOCUS_18050 1602 853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727371.1 protein_id gnl|my_center|LOCUS_18050 1842 2810 gene locus_tag LOCUS_18060 1842 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 3793 2807 gene locus_tag LOCUS_18070 3793 2807 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_18070 5801 3825 gene locus_tag LOCUS_18080 5801 3825 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_18080 5995 5798 gene locus_tag LOCUS_18090 5995 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 7722 6001 gene locus_tag LOCUS_18100 7722 6001 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230133.1 protein_id gnl|my_center|LOCUS_18100 8013 8975 gene locus_tag LOCUS_18110 gene thiO 8013 8975 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_18110 9010 9183 gene locus_tag LOCUS_18120 gene thiS 9010 9183 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005357774.1 protein_id gnl|my_center|LOCUS_18120 9185 9964 gene locus_tag LOCUS_18130 9185 9964 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_18130 10012 10824 gene locus_tag LOCUS_18140 gene thiD 10012 10824 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_18140 10959 12923 gene locus_tag LOCUS_18150 10959 12923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence44 79 306 gene locus_tag LOCUS_18160 79 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 378 575 gene locus_tag LOCUS_18170 378 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1202 831 gene locus_tag LOCUS_18180 1202 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18180 1695 1339 gene locus_tag LOCUS_18190 1695 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18190 1745 2074 gene locus_tag LOCUS_18200 1745 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2267 2554 gene locus_tag LOCUS_18210 2267 2554 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253939.1 protein_id gnl|my_center|LOCUS_18210 2618 2693 gene locus_tag LOCUS_t00340 2618 2693 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2786 4327 gene locus_tag LOCUS_18220 2786 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 4749 4324 gene locus_tag LOCUS_18230 4749 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 6876 4765 gene locus_tag LOCUS_18240 6876 4765 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_18240 7066 6857 gene locus_tag LOCUS_18250 7066 6857 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256480.1 protein_id gnl|my_center|LOCUS_18250 7111 8286 gene locus_tag LOCUS_18260 7111 8286 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919764.1 protein_id gnl|my_center|LOCUS_18260 8386 8313 gene locus_tag LOCUS_t00350 8386 8313 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 8482 8967 gene locus_tag LOCUS_18270 8482 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 8964 10214 gene locus_tag LOCUS_18280 8964 10214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 10771 10211 gene locus_tag LOCUS_18290 10771 10211 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_18290 10864 11439 gene locus_tag LOCUS_18300 10864 11439 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_18300 11554 12453 gene locus_tag LOCUS_18310 gene pheA 11554 12453 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256077.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence45 2069 144 gene locus_tag LOCUS_18320 2069 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2415 3743 gene locus_tag LOCUS_18330 2415 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 3740 5266 gene locus_tag LOCUS_18340 3740 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 9914 5280 gene locus_tag LOCUS_18350 9914 5280 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072543.1 protein_id gnl|my_center|LOCUS_18350 10084 10407 gene locus_tag LOCUS_18360 10084 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 11877 10435 gene locus_tag LOCUS_18370 11877 10435 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_18370 <12953 12058 gene locus_tag LOCUS_18380 <12953 12058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980555.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence46 1029 157 gene locus_tag LOCUS_18390 1029 157 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019565706.1 protein_id gnl|my_center|LOCUS_18390 2207 1026 gene locus_tag LOCUS_18400 2207 1026 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243172.1 protein_id gnl|my_center|LOCUS_18400 3158 2538 gene locus_tag LOCUS_18410 3158 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 4280 3171 gene locus_tag LOCUS_18420 4280 3171 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142694.1 protein_id gnl|my_center|LOCUS_18420 6070 4457 gene locus_tag LOCUS_18430 6070 4457 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459110.1 protein_id gnl|my_center|LOCUS_18430 6717 6085 gene locus_tag LOCUS_18440 6717 6085 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530303.1 protein_id gnl|my_center|LOCUS_18440 7703 6714 gene locus_tag LOCUS_18450 7703 6714 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810095.1 protein_id gnl|my_center|LOCUS_18450 8580 7705 gene locus_tag LOCUS_18460 8580 7705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969922.1 protein_id gnl|my_center|LOCUS_18460 10583 8571 gene locus_tag LOCUS_18470 10583 8571 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406602.1 protein_id gnl|my_center|LOCUS_18470 11389 11060 gene locus_tag LOCUS_18480 11389 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence47 1484 288 gene locus_tag LOCUS_18490 1484 288 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_18490 2230 1481 gene locus_tag LOCUS_18500 2230 1481 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906339.1 protein_id gnl|my_center|LOCUS_18500 2892 4319 gene locus_tag LOCUS_18510 gene merA 2892 4319 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296234.1 protein_id gnl|my_center|LOCUS_18510 4712 4485 gene locus_tag LOCUS_18520 4712 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 6512 6111 gene locus_tag LOCUS_18530 6512 6111 CDS product hypoxia response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 protein_id gnl|my_center|LOCUS_18530 7596 6850 gene locus_tag LOCUS_18540 7596 6850 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083971.1 protein_id gnl|my_center|LOCUS_18540 7691 8689 gene locus_tag LOCUS_18550 7691 8689 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028588.1 protein_id gnl|my_center|LOCUS_18550 9473 8934 gene locus_tag LOCUS_18560 9473 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 11305 10745 gene locus_tag LOCUS_18570 11305 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18570 >Feature sequence48 223 1425 gene locus_tag LOCUS_18580 223 1425 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908688.1 protein_id gnl|my_center|LOCUS_18580 1529 2878 gene locus_tag LOCUS_18590 gene hemL 1529 2878 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878736.1 protein_id gnl|my_center|LOCUS_18590 3083 3976 gene locus_tag LOCUS_18600 3083 3976 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668747.1 protein_id gnl|my_center|LOCUS_18600 3969 5495 gene locus_tag LOCUS_18610 gene glpK 3969 5495 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_18610 5492 6502 gene locus_tag LOCUS_18620 gene dhaK 5492 6502 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166915.1 protein_id gnl|my_center|LOCUS_18620 6509 7141 gene locus_tag LOCUS_18630 gene dhaL 6509 7141 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379705.1 protein_id gnl|my_center|LOCUS_18630 7138 7524 gene locus_tag LOCUS_18640 7138 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 7549 9195 gene locus_tag LOCUS_18650 gene ptsP 7549 9195 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231021.1 protein_id gnl|my_center|LOCUS_18650 9263 10714 gene locus_tag LOCUS_18660 gene glpA 9263 10714 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939226.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence49 477 157 gene locus_tag LOCUS_18670 477 157 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 protein_id gnl|my_center|LOCUS_18670 1200 514 gene locus_tag LOCUS_18680 1200 514 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642405.1 protein_id gnl|my_center|LOCUS_18680 1405 3234 gene locus_tag LOCUS_18690 gene dnaK 1405 3234 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065061.1 protein_id gnl|my_center|LOCUS_18690 3239 3823 gene locus_tag LOCUS_18700 3239 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 3844 4920 gene locus_tag LOCUS_18710 gene dnaJ 3844 4920 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401821.1 protein_id gnl|my_center|LOCUS_18710 4927 5316 gene locus_tag LOCUS_18720 4927 5316 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_18720 5348 7828 gene locus_tag LOCUS_18730 gene clpB 5348 7828 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_18730 8986 7958 gene locus_tag LOCUS_18740 8986 7958 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730921.1 protein_id gnl|my_center|LOCUS_18740 9292 8987 gene locus_tag LOCUS_18750 9292 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 <10689 9712 gene locus_tag LOCUS_18760 <10689 9712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193427766.1:nucleotide sugar dehydrogenase >Feature sequence50 677 321 gene locus_tag LOCUS_18770 677 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1023 1538 gene locus_tag LOCUS_18780 1023 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490290.1 protein_id gnl|my_center|LOCUS_18780 1531 1779 gene locus_tag LOCUS_18790 1531 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18790 2079 2501 gene locus_tag LOCUS_18800 2079 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3260 2580 gene locus_tag LOCUS_18810 3260 2580 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140026.1 protein_id gnl|my_center|LOCUS_18810 4753 3257 gene locus_tag LOCUS_18820 4753 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 5247 4777 gene locus_tag LOCUS_18830 5247 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 5491 6513 gene locus_tag LOCUS_18840 5491 6513 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_18840 6510 7220 gene locus_tag LOCUS_18850 6510 7220 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_18850 7213 7674 gene locus_tag LOCUS_18860 7213 7674 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392657.1 protein_id gnl|my_center|LOCUS_18860 8887 7658 gene locus_tag LOCUS_18870 8887 7658 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015567.1 protein_id gnl|my_center|LOCUS_18870 9007 9912 gene locus_tag LOCUS_18880 9007 9912 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187502.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence51 1317 7 gene locus_tag LOCUS_18890 1317 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2129 1329 gene locus_tag LOCUS_18900 2129 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 2438 5206 gene locus_tag LOCUS_18910 2438 5206 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_18910 6629 5562 gene locus_tag LOCUS_18920 6629 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 8104 6866 gene locus_tag LOCUS_18930 8104 6866 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_18930 8799 8101 gene locus_tag LOCUS_18940 8799 8101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_18940 9736 8774 gene locus_tag LOCUS_18950 9736 8774 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083145.1 protein_id gnl|my_center|LOCUS_18950 10205 10354 gene locus_tag LOCUS_18960 10205 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence52 715 140 gene locus_tag LOCUS_18970 715 140 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207928.1 protein_id gnl|my_center|LOCUS_18970 1016 930 gene locus_tag LOCUS_t00360 1016 930 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1111 1770 gene locus_tag LOCUS_18980 1111 1770 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257858.1 protein_id gnl|my_center|LOCUS_18980 1772 2272 gene locus_tag LOCUS_18990 1772 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2269 3468 gene locus_tag LOCUS_19000 2269 3468 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 protein_id gnl|my_center|LOCUS_19000 3468 4940 gene locus_tag LOCUS_19010 3468 4940 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947090.1 protein_id gnl|my_center|LOCUS_19010 4951 6873 gene locus_tag LOCUS_19020 gene pknB 4951 6873 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_19020 7782 6817 gene locus_tag LOCUS_19030 7782 6817 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951710.1 protein_id gnl|my_center|LOCUS_19030 8515 7775 gene locus_tag LOCUS_19040 gene cobS 8515 7775 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388426.1 protein_id gnl|my_center|LOCUS_19040 9036 8512 gene locus_tag LOCUS_19050 gene cobU 9036 8512 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_19050 9751 9038 gene locus_tag LOCUS_19060 gene cobI 9751 9038 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028010.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence53 1385 822 gene locus_tag LOCUS_19070 1385 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2223 1810 gene locus_tag LOCUS_19080 2223 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 3350 2271 gene locus_tag LOCUS_19090 3350 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 4342 3347 gene locus_tag LOCUS_19100 4342 3347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926098.1 protein_id gnl|my_center|LOCUS_19100 5132 4329 gene locus_tag LOCUS_19110 5132 4329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249669.1 protein_id gnl|my_center|LOCUS_19110 6066 5116 gene locus_tag LOCUS_19120 6066 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 6215 7339 gene locus_tag LOCUS_19130 6215 7339 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730742.1 protein_id gnl|my_center|LOCUS_19130 7871 7326 gene locus_tag LOCUS_19140 7871 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 8961 7996 gene locus_tag LOCUS_19150 8961 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence54 1414 599 gene locus_tag LOCUS_19160 1414 599 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804450.1 protein_id gnl|my_center|LOCUS_19160 1674 3005 gene locus_tag LOCUS_19170 1674 3005 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 protein_id gnl|my_center|LOCUS_19170 3093 4019 gene locus_tag LOCUS_19180 3093 4019 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091310187.1 protein_id gnl|my_center|LOCUS_19180 4067 4960 gene locus_tag LOCUS_19190 4067 4960 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_19190 5016 5747 gene locus_tag LOCUS_19200 5016 5747 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173486.1 protein_id gnl|my_center|LOCUS_19200 5775 6929 gene locus_tag LOCUS_19210 5775 6929 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_19210 7003 7923 gene locus_tag LOCUS_19220 7003 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028332.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence55 1912 134 gene locus_tag LOCUS_19230 1912 134 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_19230 2187 1999 gene locus_tag LOCUS_19240 2187 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2230 2940 gene locus_tag LOCUS_19250 gene thiL 2230 2940 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_19250 3037 3300 gene locus_tag LOCUS_19260 3037 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 3297 4061 gene locus_tag LOCUS_19270 3297 4061 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111142.1 protein_id gnl|my_center|LOCUS_19270 4317 3949 gene locus_tag LOCUS_19280 4317 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 5135 5575 gene locus_tag LOCUS_19290 5135 5575 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400421.1 protein_id gnl|my_center|LOCUS_19290 5677 6915 gene locus_tag LOCUS_19300 5677 6915 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088477.1 protein_id gnl|my_center|LOCUS_19300 6912 8573 gene locus_tag LOCUS_19310 6912 8573 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248486.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence56 2070 403 gene locus_tag LOCUS_19320 2070 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2695 3294 gene locus_tag LOCUS_19330 2695 3294 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223009.1 protein_id gnl|my_center|LOCUS_19330 4124 3291 gene locus_tag LOCUS_19340 gene zitB 4124 3291 CDS product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367655.1 protein_id gnl|my_center|LOCUS_19340 4338 4967 gene locus_tag LOCUS_19350 4338 4967 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 protein_id gnl|my_center|LOCUS_19350 5456 5677 gene locus_tag LOCUS_19360 5456 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 5661 6629 gene locus_tag LOCUS_19370 5661 6629 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731394.1 protein_id gnl|my_center|LOCUS_19370 7242 6655 gene locus_tag LOCUS_19380 gene orn 7242 6655 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015149.1 protein_id gnl|my_center|LOCUS_19380 7299 8126 gene locus_tag LOCUS_19390 7299 8126 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_19390 8107 8580 gene locus_tag LOCUS_19400 gene dut 8107 8580 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_19400 8618 8693 gene locus_tag LOCUS_t00370 8618 8693 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence57 607 230 gene locus_tag LOCUS_19410 607 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1272 604 gene locus_tag LOCUS_19420 1272 604 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_19420 1387 2427 gene locus_tag LOCUS_19430 1387 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2436 4358 gene locus_tag LOCUS_19440 2436 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 4370 7234 gene locus_tag LOCUS_19450 4370 7234 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_19450 7268 7344 gene locus_tag LOCUS_t00380 7268 7344 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7456 8616 gene locus_tag LOCUS_19460 7456 8616 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence58 1133 204 gene locus_tag LOCUS_19470 gene mshD 1133 204 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_19470 1174 1827 gene locus_tag LOCUS_19480 gene nth 1174 1827 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814299.1 protein_id gnl|my_center|LOCUS_19480 4034 1824 gene locus_tag LOCUS_19490 4034 1824 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876131.1 protein_id gnl|my_center|LOCUS_19490 3930 4130 gene locus_tag LOCUS_19500 3930 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 4421 5191 gene locus_tag LOCUS_19510 4421 5191 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225327.1 protein_id gnl|my_center|LOCUS_19510 6161 5202 gene locus_tag LOCUS_19520 6161 5202 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535190.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence59 161 1279 gene locus_tag LOCUS_19530 161 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1276 2025 gene locus_tag LOCUS_19540 gene istB 1276 2025 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090918.1 protein_id gnl|my_center|LOCUS_19540 2337 2570 gene locus_tag LOCUS_19550 2337 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 5267 2604 gene locus_tag LOCUS_19560 5267 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 6025 5183 gene locus_tag LOCUS_19570 6025 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 <6562 6033 gene locus_tag LOCUS_19580 <6562 6033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101895.1:phosphoribosylformylglycinamidine synthase subunit PurQ >Feature sequence60 296 616 gene locus_tag LOCUS_19590 296 616 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 protein_id gnl|my_center|LOCUS_19590 603 1001 gene locus_tag LOCUS_19600 603 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1188 2318 gene locus_tag LOCUS_19610 1188 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2866 4182 gene locus_tag LOCUS_19620 2866 4182 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109056605.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence61 2187 292 gene locus_tag LOCUS_19630 2187 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3589 2198 gene locus_tag LOCUS_19640 3589 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence62 1207 2382 gene locus_tag LOCUS_19650 1207 2382 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392213.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence63 944 168 gene locus_tag LOCUS_19660 944 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1089 2231 gene locus_tag LOCUS_19670 1089 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2246 2319 gene locus_tag LOCUS_t00390 2246 2319 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence64 858 1037 gene locus_tag LOCUS_19680 858 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1040 2095 gene locus_tag LOCUS_19690 1040 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2213 2377 gene locus_tag LOCUS_19700 2213 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700