>Feature sequence001 196 846 gene locus_tag LOCUS_00010 196 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 894 2492 gene locus_tag LOCUS_00020 894 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3909 2554 gene locus_tag LOCUS_00030 gene rlmD 3909 2554 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143127.1 protein_id gnl|my_center|LOCUS_00030 5025 4057 gene locus_tag LOCUS_00040 5025 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023363.1 protein_id gnl|my_center|LOCUS_00040 5610 5134 gene locus_tag LOCUS_00050 5610 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6420 5662 gene locus_tag LOCUS_00060 6420 5662 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_00060 6842 7756 gene locus_tag LOCUS_00070 6842 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7874 8455 gene locus_tag LOCUS_00080 7874 8455 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_00080 8715 9308 gene locus_tag LOCUS_00090 8715 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9985 9434 gene locus_tag LOCUS_00100 9985 9434 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_00100 10090 10254 gene locus_tag LOCUS_00110 10090 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10244 10423 gene locus_tag LOCUS_00120 10244 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10612 12093 gene locus_tag LOCUS_00130 10612 12093 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909443.1 protein_id gnl|my_center|LOCUS_00130 12238 12154 gene locus_tag LOCUS_t00010 12238 12154 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12462 14285 gene locus_tag LOCUS_00140 12462 14285 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259298.1 protein_id gnl|my_center|LOCUS_00140 14239 14248 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14255 14548 gene locus_tag LOCUS_00150 14255 14548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14886 15569 gene locus_tag LOCUS_00160 14886 15569 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257704.1 protein_id gnl|my_center|LOCUS_00160 15607 16776 gene locus_tag LOCUS_00170 15607 16776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18036 16750 gene locus_tag LOCUS_00180 18036 16750 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168581903.1 protein_id gnl|my_center|LOCUS_00180 19554 18067 gene locus_tag LOCUS_00190 19554 18067 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_00190 20813 19683 gene locus_tag LOCUS_00200 20813 19683 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040635.1 protein_id gnl|my_center|LOCUS_00200 21723 20878 gene locus_tag LOCUS_00210 21723 20878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22889 21723 gene locus_tag LOCUS_00220 22889 21723 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_00220 >Feature sequence002 1984 1007 gene locus_tag LOCUS_00230 gene galE 1984 1007 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966243.1 protein_id gnl|my_center|LOCUS_00230 2813 2271 gene locus_tag LOCUS_00240 2813 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 3083 3559 gene locus_tag LOCUS_00250 3083 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 4645 3599 gene locus_tag LOCUS_00260 gene zitB 4645 3599 CDS product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 protein_id gnl|my_center|LOCUS_00260 5067 4642 gene locus_tag LOCUS_00270 5067 4642 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918378.1 protein_id gnl|my_center|LOCUS_00270 5275 7293 gene locus_tag LOCUS_00280 5275 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 8059 7274 gene locus_tag LOCUS_00290 8059 7274 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_00290 9107 8139 gene locus_tag LOCUS_00300 9107 8139 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_00300 9405 9941 gene locus_tag LOCUS_00310 9405 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 9954 10382 gene locus_tag LOCUS_00320 9954 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 10617 10408 gene locus_tag LOCUS_00330 10617 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 11153 10776 gene locus_tag LOCUS_00340 gene erpA 11153 10776 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228822.1 protein_id gnl|my_center|LOCUS_00340 12945 11308 gene locus_tag LOCUS_00350 12945 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 13145 14221 gene locus_tag LOCUS_00360 13145 14221 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606693.1 protein_id gnl|my_center|LOCUS_00360 14314 15900 gene locus_tag LOCUS_00370 14314 15900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 16010 17038 gene locus_tag LOCUS_00380 gene sapM 16010 17038 CDS product phosphatidylinositol-3-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900013.1 protein_id gnl|my_center|LOCUS_00380 17131 18090 gene locus_tag LOCUS_00390 gene trxB 17131 18090 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731638.1 protein_id gnl|my_center|LOCUS_00390 18136 18270 gene locus_tag LOCUS_00400 18136 18270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 18395 19495 gene locus_tag LOCUS_00410 18395 19495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 19758 20264 gene locus_tag LOCUS_00420 19758 20264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 21303 20254 gene locus_tag LOCUS_00430 21303 20254 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975879.1 protein_id gnl|my_center|LOCUS_00430 21466 22053 gene locus_tag LOCUS_00440 21466 22053 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256887.1 protein_id gnl|my_center|LOCUS_00440 22071 23120 gene locus_tag LOCUS_00450 22071 23120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 >Feature sequence003 <1 657 gene locus_tag LOCUS_00460 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810029.1:SDR family oxidoreductase 1003 2793 gene locus_tag LOCUS_00470 1003 2793 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186395.1 protein_id gnl|my_center|LOCUS_00470 3421 2888 gene locus_tag LOCUS_00480 3421 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 5941 3569 gene locus_tag LOCUS_00490 5941 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 5899 6138 gene locus_tag LOCUS_00500 5899 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 6150 6482 gene locus_tag LOCUS_00510 6150 6482 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225569.1 protein_id gnl|my_center|LOCUS_00510 6933 6544 gene locus_tag LOCUS_00520 6933 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 7874 7341 gene locus_tag LOCUS_00530 7874 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258086.1 protein_id gnl|my_center|LOCUS_00530 8366 7929 gene locus_tag LOCUS_00540 8366 7929 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037789.1 protein_id gnl|my_center|LOCUS_00540 8292 8301 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9270 9494 gene locus_tag LOCUS_00550 9270 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 9995 9645 gene locus_tag LOCUS_00560 9995 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 13033 10316 gene locus_tag LOCUS_00570 13033 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 13802 13059 gene locus_tag LOCUS_00580 13802 13059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_00580 14987 14001 gene locus_tag LOCUS_00590 14987 14001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 15165 15917 gene locus_tag LOCUS_00600 15165 15917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 16460 16011 gene locus_tag LOCUS_00610 16460 16011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 17602 16652 gene locus_tag LOCUS_00620 17602 16652 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_00620 18517 17624 gene locus_tag LOCUS_00630 gene accD 18517 17624 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_00630 19515 18559 gene locus_tag LOCUS_00640 gene fabD 19515 18559 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515899.1 protein_id gnl|my_center|LOCUS_00640 21332 19839 gene locus_tag LOCUS_00650 21332 19839 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_00650 21608 21372 gene locus_tag LOCUS_00660 21608 21372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 >Feature sequence004 <1 787 gene locus_tag LOCUS_00670 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329803.1:Fe-S cluster assembly protein SufB 1437 877 gene locus_tag LOCUS_00680 1437 877 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140313.1 protein_id gnl|my_center|LOCUS_00680 2100 1807 gene locus_tag LOCUS_00690 2100 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 3276 2542 gene locus_tag LOCUS_00700 3276 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 3478 4353 gene locus_tag LOCUS_00710 3478 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 4963 4376 gene locus_tag LOCUS_00720 4963 4376 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_00720 5999 5127 gene locus_tag LOCUS_00730 5999 5127 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_00730 6323 7702 gene locus_tag LOCUS_00740 6323 7702 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197580.1 protein_id gnl|my_center|LOCUS_00740 7834 8793 gene locus_tag LOCUS_00750 7834 8793 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896978.1 protein_id gnl|my_center|LOCUS_00750 8797 9627 gene locus_tag LOCUS_00760 8797 9627 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896977.1 protein_id gnl|my_center|LOCUS_00760 9669 11225 gene locus_tag LOCUS_00770 9669 11225 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067242.1 protein_id gnl|my_center|LOCUS_00770 11244 12281 gene locus_tag LOCUS_00780 11244 12281 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_00780 12299 13810 gene locus_tag LOCUS_00790 12299 13810 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928604.1 protein_id gnl|my_center|LOCUS_00790 13813 14466 gene locus_tag LOCUS_00800 13813 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 18569 14505 gene locus_tag LOCUS_00810 18569 14505 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222635.1 protein_id gnl|my_center|LOCUS_00810 18943 18584 gene locus_tag LOCUS_00820 18943 18584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 19288 19007 gene locus_tag LOCUS_00830 19288 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 19686 19294 gene locus_tag LOCUS_00840 19686 19294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 20088 19711 gene locus_tag LOCUS_00850 20088 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 20926 20156 gene locus_tag LOCUS_00860 20926 20156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 >Feature sequence005 34 690 gene locus_tag LOCUS_00870 34 690 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074680.1 protein_id gnl|my_center|LOCUS_00870 1914 694 gene locus_tag LOCUS_00880 1914 694 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812489.1 protein_id gnl|my_center|LOCUS_00880 2721 1921 gene locus_tag LOCUS_00890 2721 1921 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921431.1 protein_id gnl|my_center|LOCUS_00890 3160 2735 gene locus_tag LOCUS_00900 3160 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 4300 3179 gene locus_tag LOCUS_00910 4300 3179 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_00910 4504 6057 gene locus_tag LOCUS_00920 4504 6057 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243920.1 protein_id gnl|my_center|LOCUS_00920 6807 6109 gene locus_tag LOCUS_00930 6807 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 6985 7587 gene locus_tag LOCUS_00940 6985 7587 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205505.1 protein_id gnl|my_center|LOCUS_00940 7965 8849 gene locus_tag LOCUS_00950 7965 8849 CDS product CRISPR-associated ring nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258133.1 protein_id gnl|my_center|LOCUS_00950 8984 10039 gene locus_tag LOCUS_00960 8984 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 10036 12141 gene locus_tag LOCUS_00970 gene cas10 10036 12141 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229144.1 protein_id gnl|my_center|LOCUS_00970 12141 13352 gene locus_tag LOCUS_00980 gene cmr3 12141 13352 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879359.1 protein_id gnl|my_center|LOCUS_00980 13349 14320 gene locus_tag LOCUS_00990 gene cmr4 13349 14320 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_00990 14358 14804 gene locus_tag LOCUS_01000 14358 14804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 14806 15624 gene locus_tag LOCUS_01010 14806 15624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 15647 16804 gene locus_tag LOCUS_01020 15647 16804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 16807 17196 gene locus_tag LOCUS_01030 gene csx15 16807 17196 CDS product CRISPR-associated protein Csx15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257334.1 protein_id gnl|my_center|LOCUS_01030 18192 17392 gene locus_tag LOCUS_01040 18192 17392 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028287.1 protein_id gnl|my_center|LOCUS_01040 18753 18307 gene locus_tag LOCUS_01050 18753 18307 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486482.1 protein_id gnl|my_center|LOCUS_01050 19545 18919 gene locus_tag LOCUS_01060 19545 18919 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140484.1 protein_id gnl|my_center|LOCUS_01060 <20689 19774 gene locus_tag LOCUS_01070 <20689 19774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977764.1:LacI family DNA-binding transcriptional regulator >Feature sequence006 1229 24 gene locus_tag LOCUS_01080 1229 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 1760 1284 gene locus_tag LOCUS_01090 1760 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 2641 1754 gene locus_tag LOCUS_01100 2641 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 2552 2815 gene locus_tag LOCUS_01110 2552 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 2808 4022 gene locus_tag LOCUS_01120 2808 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 4019 4420 gene locus_tag LOCUS_01130 4019 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 4519 4767 gene locus_tag LOCUS_01140 4519 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 4932 5120 gene locus_tag LOCUS_01150 4932 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 5509 5823 gene locus_tag LOCUS_01160 5509 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 6192 6353 gene locus_tag LOCUS_01170 6192 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 10523 6471 gene locus_tag LOCUS_01180 10523 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 11105 11401 gene locus_tag LOCUS_01190 11105 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01190 12098 11610 gene locus_tag LOCUS_01200 12098 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 12441 12271 gene locus_tag LOCUS_01210 12441 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 16138 12767 gene locus_tag LOCUS_01220 16138 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 16737 16390 gene locus_tag LOCUS_01230 16737 16390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 17397 16810 gene locus_tag LOCUS_01240 17397 16810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 18041 17826 gene locus_tag LOCUS_01250 18041 17826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 18594 19163 gene locus_tag LOCUS_01260 18594 19163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 >Feature sequence007 <1 573 gene locus_tag LOCUS_01270 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969556.1:form I ribulose bisphosphate carboxylase large subunit 712 927 gene locus_tag LOCUS_01280 712 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 2596 893 gene locus_tag LOCUS_01290 2596 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 2577 2729 gene locus_tag LOCUS_01300 2577 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 3322 4110 gene locus_tag LOCUS_01310 3322 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 4251 4733 gene locus_tag LOCUS_01320 4251 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 4975 6186 gene locus_tag LOCUS_01330 4975 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 6295 6696 gene locus_tag LOCUS_01340 6295 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 6812 7360 gene locus_tag LOCUS_01350 6812 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 7472 7693 gene locus_tag LOCUS_01360 7472 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 7690 7890 gene locus_tag LOCUS_01370 7690 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 7960 8484 gene locus_tag LOCUS_01380 7960 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 9445 10197 gene locus_tag LOCUS_01390 9445 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 10223 10843 gene locus_tag LOCUS_01400 10223 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 10864 11268 gene locus_tag LOCUS_01410 10864 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 11281 12054 gene locus_tag LOCUS_01420 11281 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 12212 13396 gene locus_tag LOCUS_01430 12212 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 13437 15398 gene locus_tag LOCUS_01440 13437 15398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 15631 16236 gene locus_tag LOCUS_01450 15631 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 >Feature sequence008 101 2893 gene locus_tag LOCUS_01460 101 2893 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_01460 3142 3369 gene locus_tag LOCUS_01470 3142 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 3579 4790 gene locus_tag LOCUS_01480 gene yjiB 3579 4790 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_01480 4825 6345 gene locus_tag LOCUS_01490 4825 6345 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860163.1 protein_id gnl|my_center|LOCUS_01490 6400 7611 gene locus_tag LOCUS_01500 6400 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 7760 8815 gene locus_tag LOCUS_01510 7760 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 10488 9016 gene locus_tag LOCUS_01520 10488 9016 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186217.1 protein_id gnl|my_center|LOCUS_01520 11475 10528 gene locus_tag LOCUS_01530 11475 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 11709 11960 gene locus_tag LOCUS_01540 11709 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 11957 12394 gene locus_tag LOCUS_01550 11957 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 12539 13963 gene locus_tag LOCUS_01560 gene glnA 12539 13963 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259233.1 protein_id gnl|my_center|LOCUS_01560 15085 14123 gene locus_tag LOCUS_01570 15085 14123 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_01570 >Feature sequence009 3045 1327 gene locus_tag LOCUS_01580 3045 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 3766 4671 gene locus_tag LOCUS_01590 3766 4671 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974553.1 protein_id gnl|my_center|LOCUS_01590 4671 5021 gene locus_tag LOCUS_01600 4671 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 5034 5381 gene locus_tag LOCUS_01610 5034 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 5529 7448 gene locus_tag LOCUS_01620 5529 7448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 7445 8485 gene locus_tag LOCUS_01630 7445 8485 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_01630 8521 8979 gene locus_tag LOCUS_01640 8521 8979 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800772.1 protein_id gnl|my_center|LOCUS_01640 9004 10581 gene locus_tag LOCUS_01650 9004 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 10606 11748 gene locus_tag LOCUS_01660 10606 11748 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_01660 11742 12083 gene locus_tag LOCUS_01670 11742 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 12084 12449 gene locus_tag LOCUS_01680 12084 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 12480 12866 gene locus_tag LOCUS_01690 12480 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 12757 13980 gene locus_tag LOCUS_01700 12757 13980 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01700 14315 15619 gene locus_tag LOCUS_01710 14315 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 >Feature sequence010 871 293 gene locus_tag LOCUS_01720 871 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 1664 861 gene locus_tag LOCUS_01730 1664 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 2347 1901 gene locus_tag LOCUS_01740 2347 1901 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391728.1 protein_id gnl|my_center|LOCUS_01740 2663 2340 gene locus_tag LOCUS_01750 2663 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 2980 3501 gene locus_tag LOCUS_01760 2980 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01760 4331 3768 gene locus_tag LOCUS_01770 4331 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 5441 4410 gene locus_tag LOCUS_01780 5441 4410 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256958.1 protein_id gnl|my_center|LOCUS_01780 7011 5533 gene locus_tag LOCUS_01790 7011 5533 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_01790 9017 7119 gene locus_tag LOCUS_01800 gene iolD 9017 7119 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_01800 10077 9037 gene locus_tag LOCUS_01810 10077 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 10963 10118 gene locus_tag LOCUS_01820 gene iolB 10963 10118 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528375.1 protein_id gnl|my_center|LOCUS_01820 11893 10985 gene locus_tag LOCUS_01830 gene iolE 11893 10985 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192432.1 protein_id gnl|my_center|LOCUS_01830 12736 11966 gene locus_tag LOCUS_01840 12736 11966 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_01840 13833 12823 gene locus_tag LOCUS_01850 gene iolG 13833 12823 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387540.1 protein_id gnl|my_center|LOCUS_01850 14846 13830 gene locus_tag LOCUS_01860 gene cytR 14846 13830 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence011 725 1438 gene locus_tag LOCUS_01870 725 1438 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221295.1 protein_id gnl|my_center|LOCUS_01870 1505 2386 gene locus_tag LOCUS_01880 1505 2386 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_01880 2462 3448 gene locus_tag LOCUS_01890 2462 3448 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 protein_id gnl|my_center|LOCUS_01890 3435 4463 gene locus_tag LOCUS_01900 3435 4463 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529315.1 protein_id gnl|my_center|LOCUS_01900 4494 5813 gene locus_tag LOCUS_01910 4494 5813 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_01910 5813 7123 gene locus_tag LOCUS_01920 5813 7123 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112433653.1 protein_id gnl|my_center|LOCUS_01920 7274 8536 gene locus_tag LOCUS_01930 7274 8536 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_01930 8686 9561 gene locus_tag LOCUS_01940 8686 9561 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_01940 9558 10613 gene locus_tag LOCUS_01950 9558 10613 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727510.1 protein_id gnl|my_center|LOCUS_01950 10610 11341 gene locus_tag LOCUS_01960 10610 11341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_01960 11346 12071 gene locus_tag LOCUS_01970 11346 12071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243768.1 protein_id gnl|my_center|LOCUS_01970 12130 13194 gene locus_tag LOCUS_01980 12130 13194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 13214 14308 gene locus_tag LOCUS_01990 13214 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 <15237 14325 gene locus_tag LOCUS_02000 <15237 14325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258791.1:arginase >Feature sequence012 4424 3045 gene locus_tag LOCUS_02010 4424 3045 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_02010 5923 4808 gene locus_tag LOCUS_02020 5923 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 7071 6160 gene locus_tag LOCUS_02030 7071 6160 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_02030 7294 8667 gene locus_tag LOCUS_02040 7294 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 8768 9874 gene locus_tag LOCUS_02050 8768 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 10581 9847 gene locus_tag LOCUS_02060 10581 9847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 10784 10578 gene locus_tag LOCUS_02070 10784 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 10731 11462 gene locus_tag LOCUS_02080 10731 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 13732 11582 gene locus_tag LOCUS_02090 13732 11582 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_02090 14782 13823 gene locus_tag LOCUS_02100 14782 13823 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_02100 >Feature sequence013 407 1102 gene locus_tag LOCUS_02110 407 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 1817 1587 gene locus_tag LOCUS_02120 1817 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2293 1775 gene locus_tag LOCUS_02130 2293 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 3200 2595 gene locus_tag LOCUS_02140 3200 2595 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074453.1 protein_id gnl|my_center|LOCUS_02140 6359 3336 gene locus_tag LOCUS_02150 6359 3336 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077210409.1 protein_id gnl|my_center|LOCUS_02150 7170 6346 gene locus_tag LOCUS_02160 7170 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 7655 7353 gene locus_tag LOCUS_02170 7655 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 8555 7680 gene locus_tag LOCUS_02180 8555 7680 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458865.1 protein_id gnl|my_center|LOCUS_02180 8769 8578 gene locus_tag LOCUS_02190 8769 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 10244 8811 gene locus_tag LOCUS_02200 10244 8811 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227940.1 protein_id gnl|my_center|LOCUS_02200 10669 10241 gene locus_tag LOCUS_02210 10669 10241 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092936.1 protein_id gnl|my_center|LOCUS_02210 10933 10691 gene locus_tag LOCUS_02220 10933 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 11260 10976 gene locus_tag LOCUS_02230 11260 10976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 11868 11257 gene locus_tag LOCUS_02240 11868 11257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 12344 12033 gene locus_tag LOCUS_02250 12344 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 12904 12341 gene locus_tag LOCUS_02260 12904 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 13998 12904 gene locus_tag LOCUS_02270 13998 12904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 14183 13995 gene locus_tag LOCUS_02280 14183 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence014 33 2303 gene locus_tag LOCUS_02290 33 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 2335 3681 gene locus_tag LOCUS_02300 2335 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 3934 4569 gene locus_tag LOCUS_02310 3934 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 8105 4578 gene locus_tag LOCUS_02320 gene mfd 8105 4578 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_02320 7948 7957 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8916 8311 gene locus_tag LOCUS_02330 8916 8311 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258339.1 protein_id gnl|my_center|LOCUS_02330 9962 8922 gene locus_tag LOCUS_02340 9962 8922 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258490.1 protein_id gnl|my_center|LOCUS_02340 11885 9981 gene locus_tag LOCUS_02350 gene recN 11885 9981 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_02350 12738 11875 gene locus_tag LOCUS_02360 12738 11875 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_02360 13548 12898 gene locus_tag LOCUS_02370 13548 12898 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572360.1 protein_id gnl|my_center|LOCUS_02370 13902 13681 gene locus_tag LOCUS_02380 13902 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence015 1056 661 gene locus_tag LOCUS_02390 1056 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 2709 1075 gene locus_tag LOCUS_02400 2709 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 3080 2862 gene locus_tag LOCUS_02410 3080 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3400 4869 gene locus_tag LOCUS_02420 3400 4869 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531949.1 protein_id gnl|my_center|LOCUS_02420 5135 4764 gene locus_tag LOCUS_02430 5135 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 5325 6077 gene locus_tag LOCUS_02440 5325 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 6131 6535 gene locus_tag LOCUS_02450 6131 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 6537 7376 gene locus_tag LOCUS_02460 6537 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 7382 7798 gene locus_tag LOCUS_02470 7382 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7819 8109 gene locus_tag LOCUS_02480 7819 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 8202 8492 gene locus_tag LOCUS_02490 8202 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 8699 8998 gene locus_tag LOCUS_02500 8699 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 9016 9291 gene locus_tag LOCUS_02510 9016 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 9470 9288 gene locus_tag LOCUS_02520 9470 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 9572 9814 gene locus_tag LOCUS_02530 9572 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 10802 10188 gene locus_tag LOCUS_02540 10802 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 11746 10799 gene locus_tag LOCUS_02550 11746 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 12094 11768 gene locus_tag LOCUS_02560 12094 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 <13890 12096 gene locus_tag LOCUS_02570 <13890 12096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000044547.1:serine-rich repeat glycoprotein adhesin SasA 12651 12660 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence016 2179 1382 gene locus_tag LOCUS_02580 2179 1382 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172659.1 protein_id gnl|my_center|LOCUS_02580 2392 4179 gene locus_tag LOCUS_02590 2392 4179 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_02590 4230 6011 gene locus_tag LOCUS_02600 4230 6011 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_02600 6261 7457 gene locus_tag LOCUS_02610 6261 7457 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_02610 7460 9901 gene locus_tag LOCUS_02620 7460 9901 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 protein_id gnl|my_center|LOCUS_02620 10207 9965 gene locus_tag LOCUS_02630 10207 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 10539 10928 gene locus_tag LOCUS_02640 10539 10928 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174007.1 protein_id gnl|my_center|LOCUS_02640 10982 11368 gene locus_tag LOCUS_02650 10982 11368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 11439 12317 gene locus_tag LOCUS_02660 11439 12317 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459069.1 protein_id gnl|my_center|LOCUS_02660 13198 12314 gene locus_tag LOCUS_02670 13198 12314 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence017 2959 3726 gene locus_tag LOCUS_02680 2959 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 3753 4520 gene locus_tag LOCUS_02690 3753 4520 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_02690 6159 4522 gene locus_tag LOCUS_02700 6159 4522 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256724.1 protein_id gnl|my_center|LOCUS_02700 7134 6163 gene locus_tag LOCUS_02710 7134 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 8687 7197 gene locus_tag LOCUS_02720 8687 7197 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021506.1 protein_id gnl|my_center|LOCUS_02720 10193 8721 gene locus_tag LOCUS_02730 10193 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 11061 10297 gene locus_tag LOCUS_02740 11061 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 11420 13069 gene locus_tag LOCUS_02750 11420 13069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 13129 13737 gene locus_tag LOCUS_02760 13129 13737 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence018 297 1439 gene locus_tag LOCUS_02770 297 1439 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_02770 1577 2776 gene locus_tag LOCUS_02780 1577 2776 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 protein_id gnl|my_center|LOCUS_02780 3077 4129 gene locus_tag LOCUS_02790 3077 4129 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224400.1 protein_id gnl|my_center|LOCUS_02790 5539 4244 gene locus_tag LOCUS_02800 gene melA 5539 4244 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988031.1 protein_id gnl|my_center|LOCUS_02800 7163 5709 gene locus_tag LOCUS_02810 7163 5709 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908530.1 protein_id gnl|my_center|LOCUS_02810 8167 7274 gene locus_tag LOCUS_02820 8167 7274 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878045.1 protein_id gnl|my_center|LOCUS_02820 9189 8239 gene locus_tag LOCUS_02830 9189 8239 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908528.1 protein_id gnl|my_center|LOCUS_02830 9523 10554 gene locus_tag LOCUS_02840 9523 10554 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307767.1 protein_id gnl|my_center|LOCUS_02840 11010 10576 gene locus_tag LOCUS_02850 11010 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 11756 11091 gene locus_tag LOCUS_02860 11756 11091 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393805.1 protein_id gnl|my_center|LOCUS_02860 <13073 11880 gene locus_tag LOCUS_02870 <13073 11880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081361309.1:DHA2 family efflux MFS transporter permease subunit >Feature sequence019 1618 497 gene locus_tag LOCUS_02880 gene speY 1618 497 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_02880 1881 2339 gene locus_tag LOCUS_02890 1881 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 4276 2291 gene locus_tag LOCUS_02900 gene uvrB 4276 2291 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256952.1 protein_id gnl|my_center|LOCUS_02900 4471 5859 gene locus_tag LOCUS_02910 4471 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 5988 7121 gene locus_tag LOCUS_02920 5988 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 8490 7189 gene locus_tag LOCUS_02930 8490 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 8747 8490 gene locus_tag LOCUS_02940 8747 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 8700 8942 gene locus_tag LOCUS_02950 8700 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 9862 9134 gene locus_tag LOCUS_02960 9862 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 9585 9594 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10497 11420 gene locus_tag LOCUS_02970 10497 11420 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383967.1 protein_id gnl|my_center|LOCUS_02970 12500 11553 gene locus_tag LOCUS_02980 12500 11553 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705777.1 protein_id gnl|my_center|LOCUS_02980 >Feature sequence020 3292 1766 gene locus_tag LOCUS_02990 3292 1766 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_02990 4401 3352 gene locus_tag LOCUS_03000 4401 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 4707 4907 gene locus_tag LOCUS_03010 4707 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 5010 5981 gene locus_tag LOCUS_03020 5010 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 6534 8921 gene locus_tag LOCUS_03030 6534 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 9093 9359 gene locus_tag LOCUS_03040 9093 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 10130 9384 gene locus_tag LOCUS_03050 10130 9384 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775969.1 protein_id gnl|my_center|LOCUS_03050 10508 10813 gene locus_tag LOCUS_03060 10508 10813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 11563 10841 gene locus_tag LOCUS_03070 11563 10841 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_03070 >Feature sequence021 1277 45 gene locus_tag LOCUS_03080 1277 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 1499 1669 gene locus_tag LOCUS_03090 1499 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 3384 1996 gene locus_tag LOCUS_03100 3384 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 4678 3785 gene locus_tag LOCUS_03110 4678 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 7030 5087 gene locus_tag LOCUS_03120 7030 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 10287 7036 gene locus_tag LOCUS_03130 10287 7036 CDS product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151756788.1 protein_id gnl|my_center|LOCUS_03130 12397 10433 gene locus_tag LOCUS_03140 12397 10433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 >Feature sequence022 314 1714 gene locus_tag LOCUS_03150 314 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 4567 1718 gene locus_tag LOCUS_03160 4567 1718 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_03160 4860 4573 gene locus_tag LOCUS_03170 4860 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03170 4610 4619 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6747 5146 gene locus_tag LOCUS_03180 6747 5146 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010729380.1 protein_id gnl|my_center|LOCUS_03180 7794 6823 gene locus_tag LOCUS_03190 7794 6823 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_03190 8870 7860 gene locus_tag LOCUS_03200 8870 7860 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_03200 10966 8891 gene locus_tag LOCUS_03210 10966 8891 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 protein_id gnl|my_center|LOCUS_03210 12130 11126 gene locus_tag LOCUS_03220 12130 11126 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704143.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence023 375 1847 gene locus_tag LOCUS_03230 375 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 2192 5752 gene locus_tag LOCUS_03240 2192 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 5808 5993 gene locus_tag LOCUS_03250 5808 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 6194 6015 gene locus_tag LOCUS_03260 6194 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 6808 7449 gene locus_tag LOCUS_03270 6808 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 7446 9692 gene locus_tag LOCUS_03280 7446 9692 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_03280 9762 10637 gene locus_tag LOCUS_03290 9762 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 10654 12258 gene locus_tag LOCUS_03300 10654 12258 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226673.1 protein_id gnl|my_center|LOCUS_03300 >Feature sequence024 <1 504 gene locus_tag LOCUS_03310 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001829621.1:CHAP domain-containing protein 717 1988 gene locus_tag LOCUS_03320 717 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 2246 3424 gene locus_tag LOCUS_03330 2246 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 5175 3442 gene locus_tag LOCUS_03340 5175 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 8695 5237 gene locus_tag LOCUS_03350 8695 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 9065 9700 gene locus_tag LOCUS_03360 9065 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 11303 9708 gene locus_tag LOCUS_03370 11303 9708 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454965.1 protein_id gnl|my_center|LOCUS_03370 12032 11439 gene locus_tag LOCUS_03380 12032 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence025 1167 433 gene locus_tag LOCUS_03390 1167 433 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258252.1 protein_id gnl|my_center|LOCUS_03390 4354 1490 gene locus_tag LOCUS_03400 4354 1490 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258962.1 protein_id gnl|my_center|LOCUS_03400 6414 4354 gene locus_tag LOCUS_03410 6414 4354 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259247.1 protein_id gnl|my_center|LOCUS_03410 7342 6443 gene locus_tag LOCUS_03420 7342 6443 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_03420 8431 7379 gene locus_tag LOCUS_03430 8431 7379 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_03430 10073 8439 gene locus_tag LOCUS_03440 10073 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 11105 10242 gene locus_tag LOCUS_03450 11105 10242 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257907.1 protein_id gnl|my_center|LOCUS_03450 <11974 11102 gene locus_tag LOCUS_03460 <11974 11102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256857.1:ABC transporter ATP-binding protein >Feature sequence026 2177 447 gene locus_tag LOCUS_03470 2177 447 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_03470 2352 3911 gene locus_tag LOCUS_03480 2352 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 3939 5195 gene locus_tag LOCUS_03490 gene dprA 3939 5195 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_03490 5330 7912 gene locus_tag LOCUS_03500 gene alr 5330 7912 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257666.1 protein_id gnl|my_center|LOCUS_03500 8008 8994 gene locus_tag LOCUS_03510 8008 8994 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_03510 9622 9107 gene locus_tag LOCUS_03520 9622 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 <11954 9839 gene locus_tag LOCUS_03530 <11954 9839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004537186.1:carbohydrate-binding module family 20 domain-containing protein >Feature sequence027 3610 3386 gene locus_tag LOCUS_03540 3610 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 5319 4591 gene locus_tag LOCUS_03550 5319 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 5989 5633 gene locus_tag LOCUS_03560 5989 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 6155 6394 gene locus_tag LOCUS_03570 6155 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 11076 6958 gene locus_tag LOCUS_03580 11076 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence028 2131 281 gene locus_tag LOCUS_03590 2131 281 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248185.1 protein_id gnl|my_center|LOCUS_03590 3216 2104 gene locus_tag LOCUS_03600 3216 2104 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928654.1 protein_id gnl|my_center|LOCUS_03600 3523 4566 gene locus_tag LOCUS_03610 3523 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4566 5471 gene locus_tag LOCUS_03620 4566 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258540.1 protein_id gnl|my_center|LOCUS_03620 5349 5358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6490 5897 gene locus_tag LOCUS_03630 gene clpP 6490 5897 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583450.1 protein_id gnl|my_center|LOCUS_03630 6781 6500 gene locus_tag LOCUS_03640 6781 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6934 7341 gene locus_tag LOCUS_03650 6934 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 7643 7353 gene locus_tag LOCUS_03660 7643 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 8098 7721 gene locus_tag LOCUS_03670 8098 7721 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392516.1 protein_id gnl|my_center|LOCUS_03670 8255 8749 gene locus_tag LOCUS_03680 8255 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 11390 8811 gene locus_tag LOCUS_03690 11390 8811 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence029 932 1225 gene locus_tag LOCUS_03700 932 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03700 1259 2011 gene locus_tag LOCUS_03710 1259 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03710 2325 2498 gene locus_tag LOCUS_03720 2325 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2596 3480 gene locus_tag LOCUS_03730 2596 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 3508 4593 gene locus_tag LOCUS_03740 3508 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4683 5333 gene locus_tag LOCUS_03750 4683 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5358 5873 gene locus_tag LOCUS_03760 5358 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5917 6618 gene locus_tag LOCUS_03770 5917 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 6776 7660 gene locus_tag LOCUS_03780 6776 7660 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707345.1 protein_id gnl|my_center|LOCUS_03780 8379 7603 gene locus_tag LOCUS_03790 8379 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 9429 8395 gene locus_tag LOCUS_03800 9429 8395 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_03800 10938 9448 gene locus_tag LOCUS_03810 10938 9448 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_03810 11252 11046 gene locus_tag LOCUS_03820 gene rpmE 11252 11046 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_03820 >Feature sequence030 <1 1009 gene locus_tag LOCUS_03830 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256059.1:APC family permease 1311 2636 gene locus_tag LOCUS_03840 1311 2636 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_03840 2675 4831 gene locus_tag LOCUS_03850 2675 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 4971 5699 gene locus_tag LOCUS_03860 gene rsmG 4971 5699 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258170.1 protein_id gnl|my_center|LOCUS_03860 7115 5784 gene locus_tag LOCUS_03870 7115 5784 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056381.1 protein_id gnl|my_center|LOCUS_03870 8756 7248 gene locus_tag LOCUS_03880 8756 7248 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_03880 10025 8775 gene locus_tag LOCUS_03890 10025 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 10805 10290 gene locus_tag LOCUS_03900 10805 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 11489 10815 gene locus_tag LOCUS_03910 11489 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence031 1210 104 gene locus_tag LOCUS_03920 1210 104 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063816.1 protein_id gnl|my_center|LOCUS_03920 1493 2635 gene locus_tag LOCUS_03930 1493 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2788 3471 gene locus_tag LOCUS_03940 2788 3471 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968594.1 protein_id gnl|my_center|LOCUS_03940 4298 3546 gene locus_tag LOCUS_03950 4298 3546 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369352.1 protein_id gnl|my_center|LOCUS_03950 4720 4307 gene locus_tag LOCUS_03960 gene rplS 4720 4307 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068669.1 protein_id gnl|my_center|LOCUS_03960 5058 4792 gene locus_tag LOCUS_03970 gene rpsT 5058 4792 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258282.1 protein_id gnl|my_center|LOCUS_03970 6923 5220 gene locus_tag LOCUS_03980 6923 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 8279 7143 gene locus_tag LOCUS_03990 8279 7143 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_03990 8610 9293 gene locus_tag LOCUS_04000 8610 9293 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_04000 9290 10702 gene locus_tag LOCUS_04010 9290 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 >Feature sequence032 1242 829 gene locus_tag LOCUS_04020 1242 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 3077 1563 gene locus_tag LOCUS_04030 3077 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 3677 5317 gene locus_tag LOCUS_04040 3677 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 5979 7430 gene locus_tag LOCUS_04050 5979 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 7785 9548 gene locus_tag LOCUS_04060 7785 9548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 protein_id gnl|my_center|LOCUS_04060 9749 10858 gene locus_tag LOCUS_04070 9749 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 >Feature sequence033 1270 587 gene locus_tag LOCUS_04080 1270 587 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_04080 2798 1383 gene locus_tag LOCUS_04090 2798 1383 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461173.1 protein_id gnl|my_center|LOCUS_04090 4356 2965 gene locus_tag LOCUS_04100 4356 2965 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403007.1 protein_id gnl|my_center|LOCUS_04100 4551 5912 gene locus_tag LOCUS_04110 4551 5912 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259289.1 protein_id gnl|my_center|LOCUS_04110 5912 6835 gene locus_tag LOCUS_04120 5912 6835 CDS product Bpu10I family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259288.1 protein_id gnl|my_center|LOCUS_04120 6930 8486 gene locus_tag LOCUS_04130 6930 8486 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_04130 8717 10234 gene locus_tag LOCUS_04140 8717 10234 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258284.1 protein_id gnl|my_center|LOCUS_04140 >Feature sequence034 519 1559 gene locus_tag LOCUS_04150 519 1559 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226170.1 protein_id gnl|my_center|LOCUS_04150 1607 2704 gene locus_tag LOCUS_04160 1607 2704 CDS product toluene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226171.1 protein_id gnl|my_center|LOCUS_04160 2701 3096 gene locus_tag LOCUS_04170 2701 3096 CDS product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893349.1 protein_id gnl|my_center|LOCUS_04170 3274 4338 gene locus_tag LOCUS_04180 3274 4338 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259023.1 protein_id gnl|my_center|LOCUS_04180 4485 5315 gene locus_tag LOCUS_04190 4485 5315 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259024.1 protein_id gnl|my_center|LOCUS_04190 5293 5736 gene locus_tag LOCUS_04200 5293 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04200 5733 6302 gene locus_tag LOCUS_04210 5733 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04210 6350 7963 gene locus_tag LOCUS_04220 gene groL 6350 7963 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258740.1 protein_id gnl|my_center|LOCUS_04220 8111 9592 gene locus_tag LOCUS_04230 8111 9592 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971553.1 protein_id gnl|my_center|LOCUS_04230 10277 10861 gene locus_tag LOCUS_04240 10277 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence035 985 359 gene locus_tag LOCUS_04250 985 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 1786 1097 gene locus_tag LOCUS_04260 1786 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2239 1994 gene locus_tag LOCUS_04270 2239 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 3290 2280 gene locus_tag LOCUS_04280 3290 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3872 3513 gene locus_tag LOCUS_04290 3872 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 4628 4993 gene locus_tag LOCUS_04300 4628 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 6627 5848 gene locus_tag LOCUS_04310 6627 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 7464 6751 gene locus_tag LOCUS_04320 7464 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 8059 8925 gene locus_tag LOCUS_04330 8059 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 8957 9226 gene locus_tag LOCUS_04340 8957 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 >Feature sequence036 <1 1690 gene locus_tag LOCUS_04350 <1 1690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256152.1:selenocysteine-specific translation elongation factor 1872 3878 gene locus_tag LOCUS_04360 1872 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 4282 4073 gene locus_tag LOCUS_04370 4282 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5645 4305 gene locus_tag LOCUS_04380 5645 4305 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04380 4352 4361 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6464 5979 gene locus_tag LOCUS_04390 6464 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 6855 7061 gene locus_tag LOCUS_04400 6855 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 7125 7613 gene locus_tag LOCUS_04410 7125 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 7627 10527 gene locus_tag LOCUS_04420 gene lon 7627 10527 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256210.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence037 2001 1018 gene locus_tag LOCUS_04430 2001 1018 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705390.1 protein_id gnl|my_center|LOCUS_04430 2396 2025 gene locus_tag LOCUS_04440 2396 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 2811 2452 gene locus_tag LOCUS_04450 2811 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 3665 3045 gene locus_tag LOCUS_04460 3665 3045 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098519.1 protein_id gnl|my_center|LOCUS_04460 4483 3761 gene locus_tag LOCUS_04470 4483 3761 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827762.1 protein_id gnl|my_center|LOCUS_04470 4685 4410 gene locus_tag LOCUS_04480 4685 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4437 4446 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5239 4706 gene locus_tag LOCUS_04490 5239 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 5831 6520 gene locus_tag LOCUS_04500 5831 6520 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533045.1 protein_id gnl|my_center|LOCUS_04500 6669 7760 gene locus_tag LOCUS_04510 6669 7760 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228210.1 protein_id gnl|my_center|LOCUS_04510 10022 7866 gene locus_tag LOCUS_04520 10022 7866 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_04520 <11033 10102 gene locus_tag LOCUS_04530 <11033 10102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258940.1:DUF3445 domain-containing protein >Feature sequence038 564 992 gene locus_tag LOCUS_04540 564 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 1239 1634 gene locus_tag LOCUS_04550 1239 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 2724 1711 gene locus_tag LOCUS_04560 2724 1711 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_04560 3719 2742 gene locus_tag LOCUS_04570 3719 2742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583524.1 protein_id gnl|my_center|LOCUS_04570 4888 3767 gene locus_tag LOCUS_04580 4888 3767 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_04580 5863 4904 gene locus_tag LOCUS_04590 gene dppB 5863 4904 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174906.1 protein_id gnl|my_center|LOCUS_04590 8004 6250 gene locus_tag LOCUS_04600 8004 6250 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_04600 8509 9627 gene locus_tag LOCUS_04610 8509 9627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 9913 9650 gene locus_tag LOCUS_04620 9913 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 10169 10600 gene locus_tag LOCUS_04630 10169 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 >Feature sequence039 590 237 gene locus_tag LOCUS_04640 590 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 1050 2720 gene locus_tag LOCUS_04650 1050 2720 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226759.1 protein_id gnl|my_center|LOCUS_04650 2950 4170 gene locus_tag LOCUS_04660 2950 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 4532 5197 gene locus_tag LOCUS_04670 4532 5197 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569935.1 protein_id gnl|my_center|LOCUS_04670 7785 5926 gene locus_tag LOCUS_04680 7785 5926 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_04680 8845 7895 gene locus_tag LOCUS_04690 8845 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 9239 8874 gene locus_tag LOCUS_04700 9239 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 <10783 9236 gene locus_tag LOCUS_04710 <10783 9236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879268.1:long-chain fatty acid--CoA ligase >Feature sequence040 <1 1167 gene locus_tag LOCUS_04720 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224114.1:type VII secretion protein EccC 1379 2275 gene locus_tag LOCUS_04730 1379 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 2390 3253 gene locus_tag LOCUS_04740 2390 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 3265 3777 gene locus_tag LOCUS_04750 3265 3777 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_04750 4497 3961 gene locus_tag LOCUS_04760 4497 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4666 7122 gene locus_tag LOCUS_04770 4666 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 7855 7139 gene locus_tag LOCUS_04780 7855 7139 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086475.1 protein_id gnl|my_center|LOCUS_04780 9302 8109 gene locus_tag LOCUS_04790 9302 8109 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258516.1 protein_id gnl|my_center|LOCUS_04790 9529 9458 gene locus_tag LOCUS_t00020 9529 9458 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9756 10013 gene locus_tag LOCUS_04800 9756 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 >Feature sequence041 1715 492 gene locus_tag LOCUS_04810 1715 492 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085634.1 protein_id gnl|my_center|LOCUS_04810 2640 1795 gene locus_tag LOCUS_04820 2640 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3660 2797 gene locus_tag LOCUS_04830 3660 2797 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 protein_id gnl|my_center|LOCUS_04830 3846 5150 gene locus_tag LOCUS_04840 3846 5150 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583229.1 protein_id gnl|my_center|LOCUS_04840 5287 6378 gene locus_tag LOCUS_04850 5287 6378 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_04850 6467 7084 gene locus_tag LOCUS_04860 6467 7084 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966689.1 protein_id gnl|my_center|LOCUS_04860 7132 7506 gene locus_tag LOCUS_04870 7132 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 7532 8023 gene locus_tag LOCUS_04880 gene ybaK 7532 8023 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217103.1 protein_id gnl|my_center|LOCUS_04880 8241 8038 gene locus_tag LOCUS_04890 8241 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 8395 9264 gene locus_tag LOCUS_04900 8395 9264 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458999.1 protein_id gnl|my_center|LOCUS_04900 9327 10250 gene locus_tag LOCUS_04910 9327 10250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence042 714 1007 gene locus_tag LOCUS_04920 714 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 1108 1368 gene locus_tag LOCUS_04930 1108 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 1365 1694 gene locus_tag LOCUS_04940 1365 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 1936 2913 gene locus_tag LOCUS_04950 1936 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 3053 3541 gene locus_tag LOCUS_04960 3053 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3529 4242 gene locus_tag LOCUS_04970 3529 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4258 4725 gene locus_tag LOCUS_04980 4258 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 4745 5482 gene locus_tag LOCUS_04990 4745 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 5823 6341 gene locus_tag LOCUS_05000 5823 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 6655 7878 gene locus_tag LOCUS_05010 6655 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 8098 8289 gene locus_tag LOCUS_05020 8098 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 8552 9124 gene locus_tag LOCUS_05030 8552 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 9529 9903 gene locus_tag LOCUS_05040 9529 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 >Feature sequence043 1011 340 gene locus_tag LOCUS_05050 1011 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 2523 1135 gene locus_tag LOCUS_05060 2523 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2684 2520 gene locus_tag LOCUS_05070 2684 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3217 2867 gene locus_tag LOCUS_05080 3217 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 3828 3118 gene locus_tag LOCUS_05090 3828 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 3289 3298 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4679 4008 gene locus_tag LOCUS_05100 4679 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 5899 4904 gene locus_tag LOCUS_05110 5899 4904 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079997.1 protein_id gnl|my_center|LOCUS_05110 6826 6017 gene locus_tag LOCUS_05120 6826 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 7830 6865 gene locus_tag LOCUS_05130 7830 6865 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_05130 8491 8243 gene locus_tag LOCUS_05140 8491 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 9005 8655 gene locus_tag LOCUS_05150 9005 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 <10587 9094 gene locus_tag LOCUS_05160 <10587 9094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259434.1:transglutaminaseTgpA domain-containing protein >Feature sequence044 1597 773 gene locus_tag LOCUS_05170 1597 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 2795 2031 gene locus_tag LOCUS_05180 2795 2031 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258536.1 protein_id gnl|my_center|LOCUS_05180 3059 3436 gene locus_tag LOCUS_05190 3059 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3517 4296 gene locus_tag LOCUS_05200 3517 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 4996 4349 gene locus_tag LOCUS_05210 gene tmk 4996 4349 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051604.1 protein_id gnl|my_center|LOCUS_05210 5618 5004 gene locus_tag LOCUS_05220 gene dcd 5618 5004 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604072.1 protein_id gnl|my_center|LOCUS_05220 6476 5760 gene locus_tag LOCUS_05230 6476 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184364.1 protein_id gnl|my_center|LOCUS_05230 7333 6488 gene locus_tag LOCUS_05240 7333 6488 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_05240 9518 7428 gene locus_tag LOCUS_05250 9518 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence045 66 383 gene locus_tag LOCUS_05260 66 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 1088 771 gene locus_tag LOCUS_05270 1088 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2851 1196 gene locus_tag LOCUS_05280 2851 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 4530 3157 gene locus_tag LOCUS_05290 4530 3157 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_05290 5653 4805 gene locus_tag LOCUS_05300 5653 4805 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390347.1 protein_id gnl|my_center|LOCUS_05300 6548 5847 gene locus_tag LOCUS_05310 6548 5847 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257014.1 protein_id gnl|my_center|LOCUS_05310 6809 7669 gene locus_tag LOCUS_05320 6809 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 8001 7813 gene locus_tag LOCUS_05330 8001 7813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 9394 7994 gene locus_tag LOCUS_05340 9394 7994 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_05340 <10556 9406 gene locus_tag LOCUS_05350 <10556 9406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393612.1:acyl-CoA synthetase FdrA >Feature sequence046 795 232 gene locus_tag LOCUS_05360 795 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 1629 3566 gene locus_tag LOCUS_05370 gene dxs 1629 3566 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_05370 3874 3656 gene locus_tag LOCUS_05380 3874 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 4646 3972 gene locus_tag LOCUS_05390 4646 3972 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871031.1 protein_id gnl|my_center|LOCUS_05390 4960 4730 gene locus_tag LOCUS_05400 4960 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 5854 5159 gene locus_tag LOCUS_05410 gene pth 5854 5159 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_05410 7065 5866 gene locus_tag LOCUS_05420 7065 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 8161 7166 gene locus_tag LOCUS_05430 8161 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 8356 8583 gene locus_tag LOCUS_05440 8356 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 10131 8674 gene locus_tag LOCUS_05450 gene gatA 10131 8674 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_05450 10427 10137 gene locus_tag LOCUS_05460 gene gatC 10427 10137 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257310.1 protein_id gnl|my_center|LOCUS_05460 >Feature sequence047 1088 2335 gene locus_tag LOCUS_05470 1088 2335 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_05470 3081 2332 gene locus_tag LOCUS_05480 3081 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 3503 3096 gene locus_tag LOCUS_05490 3503 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 3232 3241 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3611 4141 gene locus_tag LOCUS_05500 3611 4141 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230688.1 protein_id gnl|my_center|LOCUS_05500 4411 6213 gene locus_tag LOCUS_05510 4411 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 6149 7228 gene locus_tag LOCUS_05520 6149 7228 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402005.1 protein_id gnl|my_center|LOCUS_05520 7427 9235 gene locus_tag LOCUS_05530 7427 9235 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_05530 10063 9326 gene locus_tag LOCUS_05540 10063 9326 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence048 677 1471 gene locus_tag LOCUS_05550 677 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 2003 2539 gene locus_tag LOCUS_05560 2003 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3102 2542 gene locus_tag LOCUS_05570 3102 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3443 4360 gene locus_tag LOCUS_05580 3443 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 4737 6017 gene locus_tag LOCUS_05590 gene serS 4737 6017 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_05590 6670 6080 gene locus_tag LOCUS_05600 6670 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 7388 6855 gene locus_tag LOCUS_05610 7388 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 8104 7796 gene locus_tag LOCUS_05620 gene clpS 8104 7796 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140748.1 protein_id gnl|my_center|LOCUS_05620 <10409 8295 gene locus_tag LOCUS_05630 <10409 8295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393251.1:phenylalanine--tRNA ligase subunit beta >Feature sequence049 112 300 gene locus_tag LOCUS_05640 112 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 344 1306 gene locus_tag LOCUS_05650 344 1306 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837553.1 protein_id gnl|my_center|LOCUS_05650 1754 1353 gene locus_tag LOCUS_05660 1754 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3728 1935 gene locus_tag LOCUS_05670 gene aspS 3728 1935 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_05670 6288 3874 gene locus_tag LOCUS_05680 6288 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6807 7934 gene locus_tag LOCUS_05690 6807 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 8268 9458 gene locus_tag LOCUS_05700 8268 9458 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence050 2172 2426 gene locus_tag LOCUS_05710 2172 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 2612 2761 gene locus_tag LOCUS_05720 2612 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 5708 2811 gene locus_tag LOCUS_05730 gene ppc 5708 2811 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_05730 6087 6353 gene locus_tag LOCUS_05740 6087 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 7912 6524 gene locus_tag LOCUS_05750 7912 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 9830 8205 gene locus_tag LOCUS_05760 9830 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence051 1796 525 gene locus_tag LOCUS_05770 1796 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 2301 2227 gene locus_tag LOCUS_t00030 2301 2227 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2378 2305 gene locus_tag LOCUS_t00040 2378 2305 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3431 3057 gene locus_tag LOCUS_05780 3431 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3617 4606 gene locus_tag LOCUS_05790 3617 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 6032 4623 gene locus_tag LOCUS_05800 6032 4623 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_05800 8026 6083 gene locus_tag LOCUS_05810 8026 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 8349 9062 gene locus_tag LOCUS_05820 8349 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 <10272 9075 gene locus_tag LOCUS_05830 <10272 9075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704114.1:cytosine deaminase >Feature sequence052 977 525 gene locus_tag LOCUS_05840 gene pilG 977 525 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389061.1 protein_id gnl|my_center|LOCUS_05840 1700 1137 gene locus_tag LOCUS_05850 gene ylaC 1700 1137 CDS product RNA polymerase sigma factor YlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245485.1 protein_id gnl|my_center|LOCUS_05850 2304 1756 gene locus_tag LOCUS_05860 2304 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 2977 2495 gene locus_tag LOCUS_05870 2977 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 3450 3271 gene locus_tag LOCUS_05880 3450 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 4826 3564 gene locus_tag LOCUS_05890 4826 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 5553 4966 gene locus_tag LOCUS_05900 5553 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 6466 5528 gene locus_tag LOCUS_05910 6466 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 7473 7081 gene locus_tag LOCUS_05920 7473 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 8524 7655 gene locus_tag LOCUS_05930 8524 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 8715 9845 gene locus_tag LOCUS_05940 8715 9845 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706213.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence053 1203 289 gene locus_tag LOCUS_05950 1203 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 5340 1219 gene locus_tag LOCUS_05960 5340 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 5528 5731 gene locus_tag LOCUS_05970 5528 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 5757 7775 gene locus_tag LOCUS_05980 5757 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 8008 7781 gene locus_tag LOCUS_05990 8008 7781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 8170 9087 gene locus_tag LOCUS_06000 8170 9087 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_06000 9811 9137 gene locus_tag LOCUS_06010 gene nth 9811 9137 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_06010 10221 9853 gene locus_tag LOCUS_06020 10221 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence054 <1 586 gene locus_tag LOCUS_06030 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867437.1:FAD-binding oxidoreductase 495 1421 gene locus_tag LOCUS_06040 gene yjiB 495 1421 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_06040 1547 2710 gene locus_tag LOCUS_06050 gene argJ 1547 2710 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966302.1 protein_id gnl|my_center|LOCUS_06050 4024 2954 gene locus_tag LOCUS_06060 4024 2954 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966295.1 protein_id gnl|my_center|LOCUS_06060 4140 4979 gene locus_tag LOCUS_06070 4140 4979 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_06070 5304 6596 gene locus_tag LOCUS_06080 5304 6596 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194502.1 protein_id gnl|my_center|LOCUS_06080 6956 6630 gene locus_tag LOCUS_06090 6956 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 7125 7943 gene locus_tag LOCUS_06100 7125 7943 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_06100 9506 7998 gene locus_tag LOCUS_06110 9506 7998 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033262715.1 protein_id gnl|my_center|LOCUS_06110 9698 9519 gene locus_tag LOCUS_06120 9698 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 >Feature sequence055 1147 254 gene locus_tag LOCUS_06130 1147 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 1256 1116 gene locus_tag LOCUS_06140 1256 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 1516 1268 gene locus_tag LOCUS_06150 1516 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5765 1539 gene locus_tag LOCUS_06160 5765 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 7945 5762 gene locus_tag LOCUS_06170 7945 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 8073 7951 gene locus_tag LOCUS_06180 8073 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 8543 8070 gene locus_tag LOCUS_06190 8543 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 9221 8559 gene locus_tag LOCUS_06200 9221 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 9645 9244 gene locus_tag LOCUS_06210 9645 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 10030 9680 gene locus_tag LOCUS_06220 10030 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 >Feature sequence056 1623 2666 gene locus_tag LOCUS_06230 1623 2666 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530527.1 protein_id gnl|my_center|LOCUS_06230 2890 4227 gene locus_tag LOCUS_06240 2890 4227 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530526.1 protein_id gnl|my_center|LOCUS_06240 4471 5418 gene locus_tag LOCUS_06250 4471 5418 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392451.1 protein_id gnl|my_center|LOCUS_06250 5452 6318 gene locus_tag LOCUS_06260 5452 6318 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976274.1 protein_id gnl|my_center|LOCUS_06260 6338 8215 gene locus_tag LOCUS_06270 6338 8215 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_06270 9982 8297 gene locus_tag LOCUS_06280 9982 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence057 1147 212 gene locus_tag LOCUS_06290 gene xerD 1147 212 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203577.1 protein_id gnl|my_center|LOCUS_06290 1318 4431 gene locus_tag LOCUS_06300 1318 4431 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153164114.1 protein_id gnl|my_center|LOCUS_06300 4606 5850 gene locus_tag LOCUS_06310 4606 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 5819 5992 gene locus_tag LOCUS_06320 5819 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 6108 6635 gene locus_tag LOCUS_06330 6108 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 6692 7117 gene locus_tag LOCUS_06340 6692 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 7158 7337 gene locus_tag LOCUS_06350 7158 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 7395 8063 gene locus_tag LOCUS_06360 7395 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 8340 9134 gene locus_tag LOCUS_06370 8340 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 9131 9472 gene locus_tag LOCUS_06380 9131 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 9469 9936 gene locus_tag LOCUS_06390 9469 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 9933 10115 gene locus_tag LOCUS_06400 9933 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence058 206 400 gene locus_tag LOCUS_06410 gene rpmD 206 400 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081798.1 protein_id gnl|my_center|LOCUS_06410 387 923 gene locus_tag LOCUS_06420 gene rplO 387 923 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258250.1 protein_id gnl|my_center|LOCUS_06420 1067 2404 gene locus_tag LOCUS_06430 gene secY 1067 2404 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_06430 2576 3238 gene locus_tag LOCUS_06440 2576 3238 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258252.1 protein_id gnl|my_center|LOCUS_06440 3253 4005 gene locus_tag LOCUS_06450 gene map 3253 4005 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_06450 4333 4551 gene locus_tag LOCUS_06460 gene infA 4333 4551 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356224.1 protein_id gnl|my_center|LOCUS_06460 4966 5349 gene locus_tag LOCUS_06470 gene rpsM 4966 5349 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_06470 5405 5806 gene locus_tag LOCUS_06480 gene rpsK 5405 5806 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_06480 5890 6516 gene locus_tag LOCUS_06490 gene rpsD 5890 6516 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869903.1 protein_id gnl|my_center|LOCUS_06490 6582 7679 gene locus_tag LOCUS_06500 6582 7679 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_06500 7681 8307 gene locus_tag LOCUS_06510 7681 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 8410 9213 gene locus_tag LOCUS_06520 gene truA 8410 9213 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706494.1 protein_id gnl|my_center|LOCUS_06520 9210 9692 gene locus_tag LOCUS_06530 gene rplM 9210 9692 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence059 <1 589 gene locus_tag LOCUS_06540 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928681.1:BTAD domain-containing putative transcriptional regulator 811 1404 gene locus_tag LOCUS_06550 811 1404 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102156.1 protein_id gnl|my_center|LOCUS_06550 1436 1603 gene locus_tag LOCUS_06560 1436 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 1955 2167 gene locus_tag LOCUS_06570 1955 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 2174 3013 gene locus_tag LOCUS_06580 2174 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 3780 3025 gene locus_tag LOCUS_06590 3780 3025 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_06590 4328 3870 gene locus_tag LOCUS_06600 4328 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 5215 4433 gene locus_tag LOCUS_06610 5215 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5474 5232 gene locus_tag LOCUS_06620 5474 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5664 6947 gene locus_tag LOCUS_06630 5664 6947 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973654.1 protein_id gnl|my_center|LOCUS_06630 6940 8175 gene locus_tag LOCUS_06640 6940 8175 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742108.1 protein_id gnl|my_center|LOCUS_06640 8200 8592 gene locus_tag LOCUS_06650 8200 8592 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227256.1 protein_id gnl|my_center|LOCUS_06650 8616 9371 gene locus_tag LOCUS_06660 8616 9371 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227246.1 protein_id gnl|my_center|LOCUS_06660 9414 9740 gene locus_tag LOCUS_06670 9414 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence060 780 40 gene locus_tag LOCUS_06680 780 40 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242345.1 protein_id gnl|my_center|LOCUS_06680 1036 2673 gene locus_tag LOCUS_06690 1036 2673 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081361309.1 protein_id gnl|my_center|LOCUS_06690 4214 2802 gene locus_tag LOCUS_06700 4214 2802 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257882.1 protein_id gnl|my_center|LOCUS_06700 5308 4523 gene locus_tag LOCUS_06710 gene infC 5308 4523 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256288.1 protein_id gnl|my_center|LOCUS_06710 5588 7213 gene locus_tag LOCUS_06720 5588 7213 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879233.1 protein_id gnl|my_center|LOCUS_06720 9234 7315 gene locus_tag LOCUS_06730 9234 7315 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_06730 9453 9914 gene locus_tag LOCUS_06740 9453 9914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence061 1198 221 gene locus_tag LOCUS_06750 1198 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224152.1 protein_id gnl|my_center|LOCUS_06750 2117 1368 gene locus_tag LOCUS_06760 2117 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3702 2326 gene locus_tag LOCUS_06770 3702 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141950.1 protein_id gnl|my_center|LOCUS_06770 4969 3722 gene locus_tag LOCUS_06780 4969 3722 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815690.1 protein_id gnl|my_center|LOCUS_06780 6980 5790 gene locus_tag LOCUS_06790 6980 5790 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124880.1 protein_id gnl|my_center|LOCUS_06790 7607 9058 gene locus_tag LOCUS_06800 7607 9058 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081361309.1 protein_id gnl|my_center|LOCUS_06800 9351 9818 gene locus_tag LOCUS_06810 9351 9818 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530635.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence062 379 945 gene locus_tag LOCUS_06820 379 945 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_06820 2124 1087 gene locus_tag LOCUS_06830 2124 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 2922 2257 gene locus_tag LOCUS_06840 2922 2257 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259269.1 protein_id gnl|my_center|LOCUS_06840 4778 3006 gene locus_tag LOCUS_06850 4778 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 5126 4854 gene locus_tag LOCUS_06860 5126 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 5231 7177 gene locus_tag LOCUS_06870 5231 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 8717 7149 gene locus_tag LOCUS_06880 8717 7149 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392987.1 protein_id gnl|my_center|LOCUS_06880 9391 8717 gene locus_tag LOCUS_06890 9391 8717 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence063 111 581 gene locus_tag LOCUS_06900 111 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2108 462 gene locus_tag LOCUS_06910 2108 462 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256006.1 protein_id gnl|my_center|LOCUS_06910 3410 2304 gene locus_tag LOCUS_06920 3410 2304 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382304.1 protein_id gnl|my_center|LOCUS_06920 4245 3427 gene locus_tag LOCUS_06930 gene menB 4245 3427 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963873.1 protein_id gnl|my_center|LOCUS_06930 5101 4259 gene locus_tag LOCUS_06940 gene menH 5101 4259 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398592.1 protein_id gnl|my_center|LOCUS_06940 7001 5181 gene locus_tag LOCUS_06950 gene menD 7001 5181 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059249.1 protein_id gnl|my_center|LOCUS_06950 8536 7061 gene locus_tag LOCUS_06960 8536 7061 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_06960 9406 8825 gene locus_tag LOCUS_06970 9406 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 9520 9765 gene locus_tag LOCUS_06980 9520 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence064 110 964 gene locus_tag LOCUS_06990 gene minD 110 964 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255922.1 protein_id gnl|my_center|LOCUS_06990 977 1318 gene locus_tag LOCUS_07000 gene minE 977 1318 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392080.1 protein_id gnl|my_center|LOCUS_07000 2084 1365 gene locus_tag LOCUS_07010 2084 1365 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259746.1 protein_id gnl|my_center|LOCUS_07010 2821 2081 gene locus_tag LOCUS_07020 2821 2081 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_07020 6418 2987 gene locus_tag LOCUS_07030 6418 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 9574 6992 gene locus_tag LOCUS_07040 9574 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence065 245 78 gene locus_tag LOCUS_07050 245 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 503 1879 gene locus_tag LOCUS_07060 503 1879 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187263000.1 protein_id gnl|my_center|LOCUS_07060 1894 2958 gene locus_tag LOCUS_07070 1894 2958 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_07070 2995 3426 gene locus_tag LOCUS_07080 2995 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 3731 3498 gene locus_tag LOCUS_07090 3731 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 4093 5031 gene locus_tag LOCUS_07100 gene menA 4093 5031 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_07100 5045 5809 gene locus_tag LOCUS_07110 5045 5809 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817589.1 protein_id gnl|my_center|LOCUS_07110 6607 5951 gene locus_tag LOCUS_07120 6607 5951 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453954.1 protein_id gnl|my_center|LOCUS_07120 6835 7752 gene locus_tag LOCUS_07130 6835 7752 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061260.1 protein_id gnl|my_center|LOCUS_07130 7768 8529 gene locus_tag LOCUS_07140 7768 8529 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206049.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence066 514 2616 gene locus_tag LOCUS_07150 514 2616 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_07150 3257 2718 gene locus_tag LOCUS_07160 3257 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3492 3764 gene locus_tag LOCUS_07170 3492 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4033 4257 gene locus_tag LOCUS_07180 4033 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 5187 4342 gene locus_tag LOCUS_07190 5187 4342 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_07190 6971 5184 gene locus_tag LOCUS_07200 6971 5184 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_07200 7390 7462 gene locus_tag LOCUS_t00050 7390 7462 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8353 7466 gene locus_tag LOCUS_07210 8353 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 8623 8820 gene locus_tag LOCUS_07220 8623 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 8798 9256 gene locus_tag LOCUS_07230 8798 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 >Feature sequence067 441 1508 gene locus_tag LOCUS_07240 441 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 1547 2581 gene locus_tag LOCUS_07250 1547 2581 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 protein_id gnl|my_center|LOCUS_07250 2800 4521 gene locus_tag LOCUS_07260 2800 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4533 5942 gene locus_tag LOCUS_07270 4533 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 7085 5976 gene locus_tag LOCUS_07280 7085 5976 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783220.1 protein_id gnl|my_center|LOCUS_07280 7958 7152 gene locus_tag LOCUS_07290 7958 7152 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350071.1 protein_id gnl|my_center|LOCUS_07290 9003 7969 gene locus_tag LOCUS_07300 9003 7969 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103823.1 protein_id gnl|my_center|LOCUS_07300 <9631 9000 gene locus_tag LOCUS_07310 <9631 9000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071877.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence068 777 1454 gene locus_tag LOCUS_07320 gene rsmD 777 1454 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_07320 1429 1803 gene locus_tag LOCUS_07330 1429 1803 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143622.1 protein_id gnl|my_center|LOCUS_07330 1838 2320 gene locus_tag LOCUS_07340 1838 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 3159 2365 gene locus_tag LOCUS_07350 3159 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 6511 3161 gene locus_tag LOCUS_07360 6511 3161 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_07360 6737 7186 gene locus_tag LOCUS_07370 6737 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 7684 7217 gene locus_tag LOCUS_07380 7684 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 8121 7873 gene locus_tag LOCUS_07390 8121 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 9433 8162 gene locus_tag LOCUS_07400 gene fabF 9433 8162 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583310.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence069 <1 571 gene locus_tag LOCUS_07410 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249284.1:methylmalonyl Co-A mutase-associated GTPase MeaB 943 656 gene locus_tag LOCUS_07420 943 656 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971166.1 protein_id gnl|my_center|LOCUS_07420 1392 1685 gene locus_tag LOCUS_07430 1392 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1746 2066 gene locus_tag LOCUS_07440 1746 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 5132 2253 gene locus_tag LOCUS_07450 5132 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 6401 5166 gene locus_tag LOCUS_07460 6401 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 7391 6522 gene locus_tag LOCUS_07470 7391 6522 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_07470 8544 7558 gene locus_tag LOCUS_07480 8544 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 <9428 8659 gene locus_tag LOCUS_07490 <9428 8659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000920542.1:membrane protein insertase YidC >Feature sequence070 <1 840 gene locus_tag LOCUS_07500 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259648.1:PQQ-binding-like beta-propeller repeat protein 1083 835 gene locus_tag LOCUS_07510 1083 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 1334 1101 gene locus_tag LOCUS_07520 1334 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1556 2767 gene locus_tag LOCUS_07530 1556 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2936 3139 gene locus_tag LOCUS_07540 gene rpmI 2936 3139 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172638.1 protein_id gnl|my_center|LOCUS_07540 3171 3530 gene locus_tag LOCUS_07550 gene rplT 3171 3530 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393257.1 protein_id gnl|my_center|LOCUS_07550 3676 4512 gene locus_tag LOCUS_07560 3676 4512 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_07560 4811 4581 gene locus_tag LOCUS_07570 4811 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 5229 5023 gene locus_tag LOCUS_07580 5229 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 5837 5511 gene locus_tag LOCUS_07590 5837 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 8334 6001 gene locus_tag LOCUS_07600 8334 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence071 390 1649 gene locus_tag LOCUS_07610 390 1649 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479765.1 protein_id gnl|my_center|LOCUS_07610 1888 2469 gene locus_tag LOCUS_07620 1888 2469 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 protein_id gnl|my_center|LOCUS_07620 2503 3147 gene locus_tag LOCUS_07630 2503 3147 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970384.1 protein_id gnl|my_center|LOCUS_07630 3234 4049 gene locus_tag LOCUS_07640 3234 4049 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143646.1 protein_id gnl|my_center|LOCUS_07640 6196 4133 gene locus_tag LOCUS_07650 gene ftsH 6196 4133 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529152.1 protein_id gnl|my_center|LOCUS_07650 6726 6514 gene locus_tag LOCUS_07660 6726 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 <9403 7366 gene locus_tag LOCUS_07670 <9403 7366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392105.1:leucine--tRNA ligase >Feature sequence072 346 936 gene locus_tag LOCUS_07680 gene rpoE 346 936 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_07680 933 3329 gene locus_tag LOCUS_07690 933 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 3691 3392 gene locus_tag LOCUS_07700 3691 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 3934 3704 gene locus_tag LOCUS_07710 3934 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 5259 4072 gene locus_tag LOCUS_07720 5259 4072 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_07720 5982 5272 gene locus_tag LOCUS_07730 5982 5272 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 protein_id gnl|my_center|LOCUS_07730 <9403 6025 gene locus_tag LOCUS_07740 <9403 6025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224347.1:helix-turn-helix transcriptional regulator 8009 8018 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence073 <1 806 gene locus_tag LOCUS_07750 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222149.1:BTAD domain-containing putative transcriptional regulator 1853 963 gene locus_tag LOCUS_07760 1853 963 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 protein_id gnl|my_center|LOCUS_07760 2817 2017 gene locus_tag LOCUS_07770 2817 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 3023 2814 gene locus_tag LOCUS_07780 3023 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3784 3020 gene locus_tag LOCUS_07790 gene paaC 3784 3020 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228337.1 protein_id gnl|my_center|LOCUS_07790 4043 3804 gene locus_tag LOCUS_07800 4043 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 4393 4040 gene locus_tag LOCUS_07810 4393 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 5352 4390 gene locus_tag LOCUS_07820 gene paaA 5352 4390 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031683.1 protein_id gnl|my_center|LOCUS_07820 5907 5452 gene locus_tag LOCUS_07830 5907 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 6573 5953 gene locus_tag LOCUS_07840 6573 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6802 7017 gene locus_tag LOCUS_07850 6802 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 7450 7037 gene locus_tag LOCUS_07860 7450 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 7941 7447 gene locus_tag LOCUS_07870 7941 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 8684 7938 gene locus_tag LOCUS_07880 8684 7938 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929490.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence074 2490 931 gene locus_tag LOCUS_07890 2490 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 2854 2564 gene locus_tag LOCUS_07900 2854 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 4677 2905 gene locus_tag LOCUS_07910 4677 2905 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_07910 5278 4835 gene locus_tag LOCUS_07920 5278 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6291 5278 gene locus_tag LOCUS_07930 gene rsmH 6291 5278 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_07930 6723 6316 gene locus_tag LOCUS_07940 gene mraZ 6723 6316 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256658.1 protein_id gnl|my_center|LOCUS_07940 7421 7987 gene locus_tag LOCUS_07950 7421 7987 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142343.1 protein_id gnl|my_center|LOCUS_07950 8027 9067 gene locus_tag LOCUS_07960 8027 9067 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence075 3661 2519 gene locus_tag LOCUS_07970 gene yhbH 3661 2519 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392048.1 protein_id gnl|my_center|LOCUS_07970 7049 3792 gene locus_tag LOCUS_07980 7049 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 >Feature sequence076 283 1386 gene locus_tag LOCUS_07990 283 1386 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_07990 1521 2435 gene locus_tag LOCUS_08000 1521 2435 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_08000 2435 3793 gene locus_tag LOCUS_08010 2435 3793 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_08010 3865 4182 gene locus_tag LOCUS_08020 3865 4182 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256664.1 protein_id gnl|my_center|LOCUS_08020 4245 5024 gene locus_tag LOCUS_08030 4245 5024 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256663.1 protein_id gnl|my_center|LOCUS_08030 5178 6638 gene locus_tag LOCUS_08040 5178 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 6764 8092 gene locus_tag LOCUS_08050 6764 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 8336 9013 gene locus_tag LOCUS_08060 8336 9013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence077 757 2229 gene locus_tag LOCUS_08070 757 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2241 5501 gene locus_tag LOCUS_08080 2241 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5718 5509 gene locus_tag LOCUS_08090 5718 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 6571 5738 gene locus_tag LOCUS_08100 6571 5738 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093945347.1 protein_id gnl|my_center|LOCUS_08100 7134 6712 gene locus_tag LOCUS_08110 7134 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7647 7192 gene locus_tag LOCUS_08120 7647 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 7915 8868 gene locus_tag LOCUS_08130 7915 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence078 <1 1036 gene locus_tag LOCUS_08140 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943456.1:deoxyribodipyrimidine photo-lyase 4762 1133 gene locus_tag LOCUS_08150 4762 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 7576 4982 gene locus_tag LOCUS_08160 7576 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 8347 7856 gene locus_tag LOCUS_08170 8347 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 8893 8360 gene locus_tag LOCUS_08180 8893 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence079 <1 1884 gene locus_tag LOCUS_08190 <1 1884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259048.1:molybdopterin-dependent oxidoreductase 2199 1981 gene locus_tag LOCUS_08200 2199 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2987 2202 gene locus_tag LOCUS_08210 2987 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 3726 3148 gene locus_tag LOCUS_08220 3726 3148 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880208.1 protein_id gnl|my_center|LOCUS_08220 4969 3890 gene locus_tag LOCUS_08230 4969 3890 CDS product lipoate protein ligase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881270.1 protein_id gnl|my_center|LOCUS_08230 5498 5040 gene locus_tag LOCUS_08240 5498 5040 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880218.1 protein_id gnl|my_center|LOCUS_08240 6013 5576 gene locus_tag LOCUS_08250 6013 5576 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880218.1 protein_id gnl|my_center|LOCUS_08250 6321 6052 gene locus_tag LOCUS_08260 6321 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 8571 6337 gene locus_tag LOCUS_08270 8571 6337 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289484.1 protein_id gnl|my_center|LOCUS_08270 8959 8597 gene locus_tag LOCUS_08280 8959 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence080 1831 512 gene locus_tag LOCUS_08290 1831 512 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104227.1 protein_id gnl|my_center|LOCUS_08290 2100 3437 gene locus_tag LOCUS_08300 2100 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 3753 4883 gene locus_tag LOCUS_08310 3753 4883 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266608.1 protein_id gnl|my_center|LOCUS_08310 5854 4931 gene locus_tag LOCUS_08320 5854 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 6058 6990 gene locus_tag LOCUS_08330 6058 6990 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227264.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence081 234 28 gene locus_tag LOCUS_08340 234 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1043 231 gene locus_tag LOCUS_08350 1043 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 2190 1321 gene locus_tag LOCUS_08360 2190 1321 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287639.1 protein_id gnl|my_center|LOCUS_08360 3034 2267 gene locus_tag LOCUS_08370 gene fabG 3034 2267 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_08370 3174 4739 gene locus_tag LOCUS_08380 3174 4739 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222413.1 protein_id gnl|my_center|LOCUS_08380 4755 6668 gene locus_tag LOCUS_08390 4755 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 8272 7193 gene locus_tag LOCUS_08400 8272 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 8553 8915 gene locus_tag LOCUS_08410 8553 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence082 219 359 gene locus_tag LOCUS_08420 219 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2004 487 gene locus_tag LOCUS_08430 2004 487 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_08430 2838 2170 gene locus_tag LOCUS_08440 2838 2170 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_08440 4035 3019 gene locus_tag LOCUS_08450 4035 3019 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_08450 5266 4208 gene locus_tag LOCUS_08460 5266 4208 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_08460 5852 5250 gene locus_tag LOCUS_08470 5852 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 6722 5925 gene locus_tag LOCUS_08480 6722 5925 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073799.1 protein_id gnl|my_center|LOCUS_08480 7517 6732 gene locus_tag LOCUS_08490 7517 6732 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_08490 7864 8121 gene locus_tag LOCUS_08500 7864 8121 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015947.1 protein_id gnl|my_center|LOCUS_08500 8247 8696 gene locus_tag LOCUS_08510 8247 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence083 1117 1479 gene locus_tag LOCUS_08520 1117 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1494 5807 gene locus_tag LOCUS_08530 1494 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 6563 5808 gene locus_tag LOCUS_08540 gene radC 6563 5808 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_08540 6798 8138 gene locus_tag LOCUS_08550 6798 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence084 921 2075 gene locus_tag LOCUS_08560 921 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3435 2143 gene locus_tag LOCUS_08570 3435 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 4832 3759 gene locus_tag LOCUS_08580 4832 3759 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257668.1 protein_id gnl|my_center|LOCUS_08580 5158 4865 gene locus_tag LOCUS_08590 5158 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 6621 5389 gene locus_tag LOCUS_08600 6621 5389 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459778.1 protein_id gnl|my_center|LOCUS_08600 8396 6633 gene locus_tag LOCUS_08610 8396 6633 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence085 2647 2168 gene locus_tag LOCUS_08620 2647 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3947 2832 gene locus_tag LOCUS_08630 gene thiO 3947 2832 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245044.1 protein_id gnl|my_center|LOCUS_08630 6582 3997 gene locus_tag LOCUS_08640 6582 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 6829 7305 gene locus_tag LOCUS_08650 6829 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 7466 8824 gene locus_tag LOCUS_08660 7466 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence086 <1 505 gene locus_tag LOCUS_08670 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256073.1:biosynthetic-type acetolactate synthase large subunit 540 1100 gene locus_tag LOCUS_08680 gene ilvN 540 1100 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810756.1 protein_id gnl|my_center|LOCUS_08680 1161 2201 gene locus_tag LOCUS_08690 gene ilvC 1161 2201 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_08690 2235 3413 gene locus_tag LOCUS_08700 2235 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3637 4683 gene locus_tag LOCUS_08710 gene thrB 3637 4683 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816738.1 protein_id gnl|my_center|LOCUS_08710 4616 6121 gene locus_tag LOCUS_08720 4616 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6118 8310 gene locus_tag LOCUS_08730 6118 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence087 495 1112 gene locus_tag LOCUS_08740 495 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1660 1199 gene locus_tag LOCUS_08750 1660 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1886 4732 gene locus_tag LOCUS_08760 gene fxsT 1886 4732 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129885631.1 protein_id gnl|my_center|LOCUS_08760 4982 5551 gene locus_tag LOCUS_08770 4982 5551 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 protein_id gnl|my_center|LOCUS_08770 5933 5580 gene locus_tag LOCUS_08780 5933 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 8216 6120 gene locus_tag LOCUS_08790 8216 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 8533 8342 gene locus_tag LOCUS_08800 8533 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence088 1179 472 gene locus_tag LOCUS_08810 1179 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1461 1850 gene locus_tag LOCUS_08820 1461 1850 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_08820 2841 1870 gene locus_tag LOCUS_08830 2841 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 4041 2845 gene locus_tag LOCUS_08840 4041 2845 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_08840 5282 4038 gene locus_tag LOCUS_08850 5282 4038 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_08850 6693 5383 gene locus_tag LOCUS_08860 6693 5383 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_08860 7203 8192 gene locus_tag LOCUS_08870 7203 8192 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence089 708 1847 gene locus_tag LOCUS_08880 708 1847 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_08880 1877 2551 gene locus_tag LOCUS_08890 1877 2551 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 protein_id gnl|my_center|LOCUS_08890 2535 4103 gene locus_tag LOCUS_08900 2535 4103 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_08900 4281 6506 gene locus_tag LOCUS_08910 4281 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 6551 7483 gene locus_tag LOCUS_08920 6551 7483 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_08920 8679 7573 gene locus_tag LOCUS_08930 8679 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence090 1674 94 gene locus_tag LOCUS_08940 1674 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 4075 1685 gene locus_tag LOCUS_08950 4075 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 6477 4105 gene locus_tag LOCUS_08960 6477 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 8634 6682 gene locus_tag LOCUS_08970 8634 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence091 527 1501 gene locus_tag LOCUS_08980 527 1501 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257219.1 protein_id gnl|my_center|LOCUS_08980 1498 2553 gene locus_tag LOCUS_08990 1498 2553 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_08990 2594 3910 gene locus_tag LOCUS_09000 2594 3910 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257843.1 protein_id gnl|my_center|LOCUS_09000 3939 4205 gene locus_tag LOCUS_09010 3939 4205 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_09010 6028 4265 gene locus_tag LOCUS_09020 gene ptsP 6028 4265 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391565.1 protein_id gnl|my_center|LOCUS_09020 7077 6049 gene locus_tag LOCUS_09030 7077 6049 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257220.1 protein_id gnl|my_center|LOCUS_09030 7277 8311 gene locus_tag LOCUS_09040 7277 8311 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence092 18 941 gene locus_tag LOCUS_09050 18 941 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259109.1 protein_id gnl|my_center|LOCUS_09050 943 1908 gene locus_tag LOCUS_09060 943 1908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_09060 1924 2706 gene locus_tag LOCUS_09070 1924 2706 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660412.1 protein_id gnl|my_center|LOCUS_09070 2789 3106 gene locus_tag LOCUS_09080 2789 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3093 3845 gene locus_tag LOCUS_09090 3093 3845 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817114.1 protein_id gnl|my_center|LOCUS_09090 4104 5012 gene locus_tag LOCUS_09100 gene rpsB 4104 5012 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_09100 5234 5830 gene locus_tag LOCUS_09110 gene tsf 5234 5830 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228249.1 protein_id gnl|my_center|LOCUS_09110 5879 6613 gene locus_tag LOCUS_09120 gene pyrH 5879 6613 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_09120 6738 7295 gene locus_tag LOCUS_09130 gene frr 6738 7295 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_09130 7298 8104 gene locus_tag LOCUS_09140 7298 8104 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence093 1095 247 gene locus_tag LOCUS_09150 gene dinD 1095 247 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460715.1 protein_id gnl|my_center|LOCUS_09150 2041 1235 gene locus_tag LOCUS_09160 2041 1235 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532122.1 protein_id gnl|my_center|LOCUS_09160 3024 2155 gene locus_tag LOCUS_09170 3024 2155 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_09170 3918 3049 gene locus_tag LOCUS_09180 3918 3049 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907735.1 protein_id gnl|my_center|LOCUS_09180 5075 4050 gene locus_tag LOCUS_09190 5075 4050 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_09190 5544 6806 gene locus_tag LOCUS_09200 5544 6806 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582770.1 protein_id gnl|my_center|LOCUS_09200 6918 7907 gene locus_tag LOCUS_09210 6918 7907 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence094 77 2659 gene locus_tag LOCUS_09220 77 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 2663 3385 gene locus_tag LOCUS_09230 2663 3385 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_09230 3720 5150 gene locus_tag LOCUS_09240 3720 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5151 5582 gene locus_tag LOCUS_09250 gene pilG 5151 5582 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_09250 5796 6161 gene locus_tag LOCUS_09260 5796 6161 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 protein_id gnl|my_center|LOCUS_09260 6360 6980 gene locus_tag LOCUS_09270 6360 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence095 212 1372 gene locus_tag LOCUS_09280 212 1372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021256.1 protein_id gnl|my_center|LOCUS_09280 1446 1733 gene locus_tag LOCUS_09290 1446 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1733 2854 gene locus_tag LOCUS_09300 gene mftC 1733 2854 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112050.1 protein_id gnl|my_center|LOCUS_09300 4513 2882 gene locus_tag LOCUS_09310 4513 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 6120 4510 gene locus_tag LOCUS_09320 6120 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 7038 6139 gene locus_tag LOCUS_09330 7038 6139 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731422.1 protein_id gnl|my_center|LOCUS_09330 7221 7763 gene locus_tag LOCUS_09340 7221 7763 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824675.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence096 17 397 gene locus_tag LOCUS_09350 17 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 531 1160 gene locus_tag LOCUS_09360 531 1160 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_09360 1197 2507 gene locus_tag LOCUS_09370 1197 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 5915 2571 gene locus_tag LOCUS_09380 5915 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 6288 7463 gene locus_tag LOCUS_09390 6288 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence097 460 1368 gene locus_tag LOCUS_09400 460 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1429 3228 gene locus_tag LOCUS_09410 1429 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 3594 3289 gene locus_tag LOCUS_09420 3594 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3843 6461 gene locus_tag LOCUS_09430 3843 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence098 104 1096 gene locus_tag LOCUS_09440 104 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1107 2501 gene locus_tag LOCUS_09450 1107 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 6424 2528 gene locus_tag LOCUS_09460 6424 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 7868 6441 gene locus_tag LOCUS_09470 7868 6441 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583973.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence099 514 1371 gene locus_tag LOCUS_09480 514 1371 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142528.1 protein_id gnl|my_center|LOCUS_09480 2218 1349 gene locus_tag LOCUS_09490 2218 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3221 2226 gene locus_tag LOCUS_09500 3221 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 4305 3343 gene locus_tag LOCUS_09510 4305 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 4740 5957 gene locus_tag LOCUS_09520 gene nusA 4740 5957 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258863.1 protein_id gnl|my_center|LOCUS_09520 5977 6315 gene locus_tag LOCUS_09530 5977 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 7072 7479 gene locus_tag LOCUS_09540 7072 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence100 2871 16 gene locus_tag LOCUS_09550 2871 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 5696 2973 gene locus_tag LOCUS_09560 5696 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 6358 5906 gene locus_tag LOCUS_09570 6358 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 6618 6373 gene locus_tag LOCUS_09580 6618 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 7552 7349 gene locus_tag LOCUS_09590 7552 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 7757 7984 gene locus_tag LOCUS_09600 7757 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence101 <1 580 gene locus_tag LOCUS_09610 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941475.1:carbonic anhydrase 1790 657 gene locus_tag LOCUS_09620 1790 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2733 1834 gene locus_tag LOCUS_09630 2733 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 4276 2894 gene locus_tag LOCUS_09640 4276 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 4900 6456 gene locus_tag LOCUS_09650 4900 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 6475 7146 gene locus_tag LOCUS_09660 gene rsmI 6475 7146 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166903.1 protein_id gnl|my_center|LOCUS_09660 7375 7575 gene locus_tag LOCUS_09670 7375 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence102 <1 2512 gene locus_tag LOCUS_09680 <1 2512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021623.1:tetratricopeptide repeat protein 3679 2525 gene locus_tag LOCUS_09690 3679 2525 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338170.1 protein_id gnl|my_center|LOCUS_09690 4586 3696 gene locus_tag LOCUS_09700 4586 3696 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976266.1 protein_id gnl|my_center|LOCUS_09700 5528 4587 gene locus_tag LOCUS_09710 5528 4587 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976265.1 protein_id gnl|my_center|LOCUS_09710 6790 5603 gene locus_tag LOCUS_09720 6790 5603 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529193.1 protein_id gnl|my_center|LOCUS_09720 6986 7141 gene locus_tag LOCUS_09730 6986 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 8096 7194 gene locus_tag LOCUS_09740 8096 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence103 1550 3601 gene locus_tag LOCUS_09750 1550 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3341 3350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4375 3671 gene locus_tag LOCUS_09760 4375 3671 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730508.1 protein_id gnl|my_center|LOCUS_09760 6035 4368 gene locus_tag LOCUS_09770 6035 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 6137 7483 gene locus_tag LOCUS_09780 6137 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 7594 7779 gene locus_tag LOCUS_09790 7594 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence104 488 1855 gene locus_tag LOCUS_09800 488 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1852 2490 gene locus_tag LOCUS_09810 1852 2490 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_09810 2684 3571 gene locus_tag LOCUS_09820 2684 3571 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_09820 3564 4076 gene locus_tag LOCUS_09830 3564 4076 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_09830 4076 6445 gene locus_tag LOCUS_09840 4076 6445 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_09840 6538 7503 gene locus_tag LOCUS_09850 6538 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 7511 7975 gene locus_tag LOCUS_09860 7511 7975 CDS product CoxG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978538.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence105 <1 1035 gene locus_tag LOCUS_09870 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256402.1:PucR family transcriptional regulator 2109 1030 gene locus_tag LOCUS_09880 2109 1030 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272791.1 protein_id gnl|my_center|LOCUS_09880 3140 2142 gene locus_tag LOCUS_09890 gene kdgK1 3140 2142 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_09890 4319 3171 gene locus_tag LOCUS_09900 gene dgoD 4319 3171 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 protein_id gnl|my_center|LOCUS_09900 4565 5203 gene locus_tag LOCUS_09910 gene eda 4565 5203 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_09910 5278 6153 gene locus_tag LOCUS_09920 5278 6153 CDS product CBU_1789 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958443.1 protein_id gnl|my_center|LOCUS_09920 6533 6174 gene locus_tag LOCUS_09930 6533 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 <8079 6831 gene locus_tag LOCUS_09940 <8079 6831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878529.1:ABC transporter permease >Feature sequence106 <1 1174 gene locus_tag LOCUS_09950 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272520.1:NADH-quinone oxidoreductase subunit C 1206 1595 gene locus_tag LOCUS_09960 1206 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1592 2152 gene locus_tag LOCUS_09970 1592 2152 CDS product hydrogenase/oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528368.1 protein_id gnl|my_center|LOCUS_09970 2152 4287 gene locus_tag LOCUS_09980 gene hyfB 2152 4287 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_09980 4305 6188 gene locus_tag LOCUS_09990 4305 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7767 6583 gene locus_tag LOCUS_10000 7767 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence107 3012 2278 gene locus_tag LOCUS_10010 gene cas5b 3012 2278 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909329.1 protein_id gnl|my_center|LOCUS_10010 4093 3029 gene locus_tag LOCUS_10020 gene cas7i 4093 3029 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258799.1 protein_id gnl|my_center|LOCUS_10020 5636 4110 gene locus_tag LOCUS_10030 5636 4110 CDS product CRISPR-associated protein Cst1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258798.1 protein_id gnl|my_center|LOCUS_10030 6495 5734 gene locus_tag LOCUS_10040 6495 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 6913 6518 gene locus_tag LOCUS_10050 gene cmr5 6913 6518 CDS product type III-B CRISPR module-associated protein Cmr5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229140.1 protein_id gnl|my_center|LOCUS_10050 7824 6928 gene locus_tag LOCUS_10060 gene cmr4 7824 6928 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence108 260 148 gene locus_tag LOCUS_r00010 260 148 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 361 765 gene locus_tag LOCUS_10070 gene queD 361 765 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082502.1 protein_id gnl|my_center|LOCUS_10070 776 1471 gene locus_tag LOCUS_10080 776 1471 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979539.1 protein_id gnl|my_center|LOCUS_10080 1892 1518 gene locus_tag LOCUS_10090 1892 1518 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327826.1 protein_id gnl|my_center|LOCUS_10090 2420 2019 gene locus_tag LOCUS_10100 2420 2019 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660557.1 protein_id gnl|my_center|LOCUS_10100 3626 2523 gene locus_tag LOCUS_10110 3626 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 3819 3613 gene locus_tag LOCUS_10120 3819 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 4004 5098 gene locus_tag LOCUS_10130 4004 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5523 6986 gene locus_tag LOCUS_10140 5523 6986 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978704.1 protein_id gnl|my_center|LOCUS_10140 7218 7290 gene locus_tag LOCUS_t00060 7218 7290 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence109 306 602 gene locus_tag LOCUS_10150 306 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 638 2134 gene locus_tag LOCUS_10160 638 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2226 2927 gene locus_tag LOCUS_10170 2226 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3190 5016 gene locus_tag LOCUS_10180 3190 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 5211 6617 gene locus_tag LOCUS_10190 5211 6617 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084259.1 protein_id gnl|my_center|LOCUS_10190 6638 7441 gene locus_tag LOCUS_10200 6638 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence110 1287 211 gene locus_tag LOCUS_10210 gene asd 1287 211 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_10210 2792 1287 gene locus_tag LOCUS_10220 2792 1287 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870075.1 protein_id gnl|my_center|LOCUS_10220 4163 2838 gene locus_tag LOCUS_10230 4163 2838 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259308.1 protein_id gnl|my_center|LOCUS_10230 5477 4227 gene locus_tag LOCUS_10240 5477 4227 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392821.1 protein_id gnl|my_center|LOCUS_10240 6522 6911 gene locus_tag LOCUS_10250 gene spo0F 6522 6911 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227621.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence111 2630 186 gene locus_tag LOCUS_10260 2630 186 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_10260 5178 2719 gene locus_tag LOCUS_10270 5178 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 5912 5175 gene locus_tag LOCUS_10280 gene fsa 5912 5175 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228415.1 protein_id gnl|my_center|LOCUS_10280 6831 5929 gene locus_tag LOCUS_10290 6831 5929 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314872.1 protein_id gnl|my_center|LOCUS_10290 7804 6875 gene locus_tag LOCUS_10300 7804 6875 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence112 <1 780 gene locus_tag LOCUS_10310 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056314.1:glutamate racemase 792 1466 gene locus_tag LOCUS_10320 792 1466 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932444.1 protein_id gnl|my_center|LOCUS_10320 1663 1463 gene locus_tag LOCUS_10330 1663 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 2476 1682 gene locus_tag LOCUS_10340 2476 1682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022096.1 protein_id gnl|my_center|LOCUS_10340 3483 2473 gene locus_tag LOCUS_10350 3483 2473 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809360.1 protein_id gnl|my_center|LOCUS_10350 4100 3594 gene locus_tag LOCUS_10360 4100 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 5024 5203 gene locus_tag LOCUS_10370 gene lysW 5024 5203 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_10370 5257 6141 gene locus_tag LOCUS_10380 gene lysX 5257 6141 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_10380 6138 7202 gene locus_tag LOCUS_10390 gene argC 6138 7202 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence113 2176 212 gene locus_tag LOCUS_10400 2176 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 3237 2188 gene locus_tag LOCUS_10410 3237 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 3905 3303 gene locus_tag LOCUS_10420 gene pdxT 3905 3303 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_10420 4920 4003 gene locus_tag LOCUS_10430 gene pdxS 4920 4003 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258093.1 protein_id gnl|my_center|LOCUS_10430 5341 6264 gene locus_tag LOCUS_10440 5341 6264 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392729.1 protein_id gnl|my_center|LOCUS_10440 6328 7257 gene locus_tag LOCUS_10450 6328 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 7576 7355 gene locus_tag LOCUS_10460 7576 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7843 7661 gene locus_tag LOCUS_10470 7843 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence114 240 1856 gene locus_tag LOCUS_10480 240 1856 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222690.1 protein_id gnl|my_center|LOCUS_10480 2632 1862 gene locus_tag LOCUS_10490 2632 1862 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_10490 3089 3589 gene locus_tag LOCUS_10500 3089 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 5359 6495 gene locus_tag LOCUS_10510 5359 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 7682 6528 gene locus_tag LOCUS_10520 gene yjiB 7682 6528 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence115 37 2634 gene locus_tag LOCUS_10530 37 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2676 3149 gene locus_tag LOCUS_10540 2676 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3288 4154 gene locus_tag LOCUS_10550 3288 4154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_10550 4172 5887 gene locus_tag LOCUS_10560 4172 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 6792 5962 gene locus_tag LOCUS_10570 6792 5962 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 protein_id gnl|my_center|LOCUS_10570 7143 7652 gene locus_tag LOCUS_10580 7143 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence116 2014 1010 gene locus_tag LOCUS_10590 2014 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10590 1249 1258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2611 2027 gene locus_tag LOCUS_10600 2611 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3222 2830 gene locus_tag LOCUS_10610 gene pilG 3222 2830 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_10610 4023 3427 gene locus_tag LOCUS_10620 4023 3427 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257866.1 protein_id gnl|my_center|LOCUS_10620 6297 4156 gene locus_tag LOCUS_10630 6297 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 7300 6434 gene locus_tag LOCUS_10640 7300 6434 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403827.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence117 1518 403 gene locus_tag LOCUS_10650 1518 403 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_10650 2460 1585 gene locus_tag LOCUS_10660 2460 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 2900 2457 gene locus_tag LOCUS_10670 2900 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3887 3081 gene locus_tag LOCUS_10680 3887 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 4739 3894 gene locus_tag LOCUS_10690 4739 3894 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888221.1 protein_id gnl|my_center|LOCUS_10690 5839 4763 gene locus_tag LOCUS_10700 5839 4763 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837478.1 protein_id gnl|my_center|LOCUS_10700 5890 6072 gene locus_tag LOCUS_10710 5890 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 6345 7520 gene locus_tag LOCUS_10720 6345 7520 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence118 1720 608 gene locus_tag LOCUS_10730 1720 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2716 1733 gene locus_tag LOCUS_10740 2716 1733 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 protein_id gnl|my_center|LOCUS_10740 3288 2770 gene locus_tag LOCUS_10750 3288 2770 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461111.1 protein_id gnl|my_center|LOCUS_10750 5060 3678 gene locus_tag LOCUS_10760 5060 3678 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957528.1 protein_id gnl|my_center|LOCUS_10760 5344 6105 gene locus_tag LOCUS_10770 5344 6105 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732177.1 protein_id gnl|my_center|LOCUS_10770 6145 6396 gene locus_tag LOCUS_10780 6145 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence119 384 1739 gene locus_tag LOCUS_10790 384 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1773 1997 gene locus_tag LOCUS_10800 1773 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2275 2784 gene locus_tag LOCUS_10810 2275 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 4945 2927 gene locus_tag LOCUS_10820 4945 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 5530 5132 gene locus_tag LOCUS_10830 5530 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6227 5568 gene locus_tag LOCUS_10840 6227 5568 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831502.1 protein_id gnl|my_center|LOCUS_10840 6905 6258 gene locus_tag LOCUS_10850 6905 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 <7723 7024 gene locus_tag LOCUS_10860 <7723 7024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211061.1:23S rRNA (guanine(745)-N(1))-methyltransferase >Feature sequence120 6765 3655 gene locus_tag LOCUS_10870 6765 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 6971 6762 gene locus_tag LOCUS_10880 6971 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence121 602 1198 gene locus_tag LOCUS_10890 gene scpB 602 1198 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_10890 1195 2085 gene locus_tag LOCUS_10900 1195 2085 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_10900 5486 2088 gene locus_tag LOCUS_10910 5486 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 6065 6391 gene locus_tag LOCUS_10920 6065 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 6403 6825 gene locus_tag LOCUS_10930 gene mazF9 6403 6825 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_10930 6866 7510 gene locus_tag LOCUS_10940 6866 7510 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence122 24 3047 gene locus_tag LOCUS_10950 24 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3414 3947 gene locus_tag LOCUS_10960 3414 3947 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_10960 3954 4277 gene locus_tag LOCUS_10970 gene nuoK 3954 4277 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_10970 4283 6403 gene locus_tag LOCUS_10980 gene nuoL 4283 6403 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785040.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence123 319 1296 gene locus_tag LOCUS_10990 319 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1293 2708 gene locus_tag LOCUS_11000 1293 2708 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393833.1 protein_id gnl|my_center|LOCUS_11000 2723 4129 gene locus_tag LOCUS_11010 2723 4129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_11010 4565 4215 gene locus_tag LOCUS_11020 4565 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 4585 4740 gene locus_tag LOCUS_11030 4585 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 4954 5418 gene locus_tag LOCUS_11040 4954 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 <7599 5925 gene locus_tag LOCUS_11050 <7599 5925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257805.1:PrsW family intramembrane metalloprotease >Feature sequence124 1094 429 gene locus_tag LOCUS_11060 1094 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2483 1116 gene locus_tag LOCUS_11070 2483 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3050 2628 gene locus_tag LOCUS_11080 3050 2628 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_11080 3975 3118 gene locus_tag LOCUS_11090 3975 3118 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460266.1 protein_id gnl|my_center|LOCUS_11090 4604 3981 gene locus_tag LOCUS_11100 4604 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 5537 4668 gene locus_tag LOCUS_11110 5537 4668 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258376.1 protein_id gnl|my_center|LOCUS_11110 5933 5607 gene locus_tag LOCUS_11120 5933 5607 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259014.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence125 39 746 gene locus_tag LOCUS_11130 39 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 752 1597 gene locus_tag LOCUS_11140 752 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1590 2423 gene locus_tag LOCUS_11150 1590 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2612 2621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2627 2905 gene locus_tag LOCUS_11160 2627 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 3095 5020 gene locus_tag LOCUS_11170 3095 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5054 5344 gene locus_tag LOCUS_11180 5054 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 5348 6304 gene locus_tag LOCUS_11190 5348 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 6592 6957 gene locus_tag LOCUS_11200 6592 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence126 200 1603 gene locus_tag LOCUS_11210 200 1603 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_11210 1801 3486 gene locus_tag LOCUS_11220 1801 3486 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225960.1 protein_id gnl|my_center|LOCUS_11220 4928 3543 gene locus_tag LOCUS_11230 4928 3543 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_11230 5712 4948 gene locus_tag LOCUS_11240 5712 4948 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_11240 <7527 5913 gene locus_tag LOCUS_11250 <7527 5913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230797.1:amino acid permease >Feature sequence127 <1 1537 gene locus_tag LOCUS_11260 <1 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256639.1:protein kinase 1577 3382 gene locus_tag LOCUS_11270 1577 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3468 4748 gene locus_tag LOCUS_11280 3468 4748 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258538.1 protein_id gnl|my_center|LOCUS_11280 4809 5432 gene locus_tag LOCUS_11290 4809 5432 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259645.1 protein_id gnl|my_center|LOCUS_11290 6292 5522 gene locus_tag LOCUS_11300 6292 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 6528 7019 gene locus_tag LOCUS_11310 6528 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence128 683 162 gene locus_tag LOCUS_11320 683 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1634 960 gene locus_tag LOCUS_11330 1634 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1917 2690 gene locus_tag LOCUS_11340 1917 2690 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461794.1 protein_id gnl|my_center|LOCUS_11340 2712 4274 gene locus_tag LOCUS_11350 2712 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 5883 4378 gene locus_tag LOCUS_11360 5883 4378 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_11360 6076 6387 gene locus_tag LOCUS_11370 6076 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 <7489 6435 gene locus_tag LOCUS_11380 <7489 6435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055915.1:DNA repair exonuclease >Feature sequence129 <1 781 gene locus_tag LOCUS_11390 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393478.1:acyl--CoA ligase 774 2135 gene locus_tag LOCUS_11400 774 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2392 3195 gene locus_tag LOCUS_11410 2392 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4130 3270 gene locus_tag LOCUS_11420 4130 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5171 4227 gene locus_tag LOCUS_11430 gene cysK 5171 4227 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_11430 5579 5193 gene locus_tag LOCUS_11440 5579 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 6150 5725 gene locus_tag LOCUS_11450 6150 5725 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_11450 6379 6960 gene locus_tag LOCUS_11460 6379 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 6964 7182 gene locus_tag LOCUS_11470 6964 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence130 213 1952 gene locus_tag LOCUS_11480 213 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1993 2352 gene locus_tag LOCUS_11490 1993 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 2378 3172 gene locus_tag LOCUS_11500 2378 3172 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122123.1 protein_id gnl|my_center|LOCUS_11500 3326 4750 gene locus_tag LOCUS_11510 gene lpdA 3326 4750 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_11510 4911 6362 gene locus_tag LOCUS_11520 4911 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 7394 6435 gene locus_tag LOCUS_11530 7394 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence131 <1 777 gene locus_tag LOCUS_11540 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035918.1:glycosyltransferase family 2 protein 948 2843 gene locus_tag LOCUS_11550 948 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2942 6124 gene locus_tag LOCUS_11560 2942 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence132 1204 1016 gene locus_tag LOCUS_11570 1204 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2742 1564 gene locus_tag LOCUS_11580 2742 1564 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407399.1 protein_id gnl|my_center|LOCUS_11580 3294 2905 gene locus_tag LOCUS_11590 3294 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4060 3362 gene locus_tag LOCUS_11600 4060 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4384 4599 gene locus_tag LOCUS_11610 4384 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 4611 6770 gene locus_tag LOCUS_11620 4611 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence133 1 1926 gene locus_tag LOCUS_11630 1 1926 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 protein_id gnl|my_center|LOCUS_11630 2546 2082 gene locus_tag LOCUS_11640 2546 2082 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229651.1 protein_id gnl|my_center|LOCUS_11640 3730 2597 gene locus_tag LOCUS_11650 3730 2597 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593063.1 protein_id gnl|my_center|LOCUS_11650 5404 4034 gene locus_tag LOCUS_11660 5404 4034 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_11660 6483 5560 gene locus_tag LOCUS_11670 6483 5560 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974523.1 protein_id gnl|my_center|LOCUS_11670 <7311 6489 gene locus_tag LOCUS_11680 <7311 6489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006315886.1:sugar ABC transporter permease >Feature sequence134 1447 266 gene locus_tag LOCUS_11690 1447 266 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_11690 1907 1665 gene locus_tag LOCUS_11700 1907 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2097 1891 gene locus_tag LOCUS_11710 2097 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2205 3104 gene locus_tag LOCUS_11720 gene pgeF 2205 3104 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_11720 4512 3220 gene locus_tag LOCUS_11730 4512 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 4598 5218 gene locus_tag LOCUS_11740 4598 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 5867 5280 gene locus_tag LOCUS_11750 5867 5280 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_11750 <7286 5864 gene locus_tag LOCUS_11760 <7286 5864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980092.1:glycoside hydrolase family 15 protein >Feature sequence135 731 492 gene locus_tag LOCUS_11770 731 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 968 771 gene locus_tag LOCUS_11780 968 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 2395 980 gene locus_tag LOCUS_11790 2395 980 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979161.1 protein_id gnl|my_center|LOCUS_11790 2563 2871 gene locus_tag LOCUS_11800 2563 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 6745 2885 gene locus_tag LOCUS_11810 6745 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 7278 6817 gene locus_tag LOCUS_11820 7278 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence136 <1 515 gene locus_tag LOCUS_11830 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235624176.1:amidohydrolase family protein 1205 591 gene locus_tag LOCUS_11840 1205 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1345 2232 gene locus_tag LOCUS_11850 1345 2232 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414686.1 protein_id gnl|my_center|LOCUS_11850 2733 2272 gene locus_tag LOCUS_11860 2733 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 3559 2708 gene locus_tag LOCUS_11870 3559 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11870 4394 3591 gene locus_tag LOCUS_11880 4394 3591 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967912.1 protein_id gnl|my_center|LOCUS_11880 5477 4758 gene locus_tag LOCUS_11890 gene bcrC 5477 4758 CDS product undecaprenyl-diphosphate phosphatase BcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243362.1 protein_id gnl|my_center|LOCUS_11890 5709 5491 gene locus_tag LOCUS_11900 5709 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 7110 5884 gene locus_tag LOCUS_11910 7110 5884 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006741.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence137 585 139 gene locus_tag LOCUS_11920 585 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 802 638 gene locus_tag LOCUS_11930 802 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1763 1008 gene locus_tag LOCUS_11940 1763 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2861 1767 gene locus_tag LOCUS_11950 2861 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3325 3074 gene locus_tag LOCUS_11960 3325 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 4173 3841 gene locus_tag LOCUS_11970 4173 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 4928 4173 gene locus_tag LOCUS_11980 4928 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5660 5106 gene locus_tag LOCUS_11990 5660 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 6008 5793 gene locus_tag LOCUS_12000 6008 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 6185 6021 gene locus_tag LOCUS_12010 6185 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 6640 6197 gene locus_tag LOCUS_12020 6640 6197 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963099.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence138 416 1375 gene locus_tag LOCUS_12030 416 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1350 1745 gene locus_tag LOCUS_12040 1350 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2798 2094 gene locus_tag LOCUS_12050 2798 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3378 2881 gene locus_tag LOCUS_12060 3378 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3878 3378 gene locus_tag LOCUS_12070 3878 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 5273 4011 gene locus_tag LOCUS_12080 5273 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 5939 5274 gene locus_tag LOCUS_12090 5939 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 6262 5936 gene locus_tag LOCUS_12100 6262 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 6928 6266 gene locus_tag LOCUS_12110 6928 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence139 325 1692 gene locus_tag LOCUS_12120 325 1692 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888077.1 protein_id gnl|my_center|LOCUS_12120 1884 2801 gene locus_tag LOCUS_12130 1884 2801 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_12130 2850 3743 gene locus_tag LOCUS_12140 2850 3743 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_12140 5471 3837 gene locus_tag LOCUS_12150 5471 3837 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389949.1 protein_id gnl|my_center|LOCUS_12150 5665 5901 gene locus_tag LOCUS_12160 5665 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence140 891 1886 gene locus_tag LOCUS_12170 891 1886 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_12170 1910 2788 gene locus_tag LOCUS_12180 1910 2788 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804269.1 protein_id gnl|my_center|LOCUS_12180 2851 3951 gene locus_tag LOCUS_12190 2851 3951 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_12190 4003 5145 gene locus_tag LOCUS_12200 4003 5145 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_12200 5251 5793 gene locus_tag LOCUS_12210 5251 5793 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247931.1 protein_id gnl|my_center|LOCUS_12210 6013 7182 gene locus_tag LOCUS_12220 6013 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222340.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence141 1856 2386 gene locus_tag LOCUS_12230 1856 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 3962 2562 gene locus_tag LOCUS_12240 gene sufB 3962 2562 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_12240 6653 4194 gene locus_tag LOCUS_12250 6653 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence142 1685 1014 gene locus_tag LOCUS_12260 gene coxH3 1685 1014 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_12260 2336 3400 gene locus_tag LOCUS_12270 2336 3400 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255942.1 protein_id gnl|my_center|LOCUS_12270 3589 3981 gene locus_tag LOCUS_12280 3589 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4659 3997 gene locus_tag LOCUS_12290 4659 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 6768 4840 gene locus_tag LOCUS_12300 6768 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence143 2227 911 gene locus_tag LOCUS_12310 gene hemL 2227 911 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_12310 3075 2284 gene locus_tag LOCUS_12320 3075 2284 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_12320 3956 3057 gene locus_tag LOCUS_12330 3956 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4911 3949 gene locus_tag LOCUS_12340 gene hemC 4911 3949 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258453.1 protein_id gnl|my_center|LOCUS_12340 6214 4856 gene locus_tag LOCUS_12350 gene hemA 6214 4856 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258452.1 protein_id gnl|my_center|LOCUS_12350 6977 6825 gene locus_tag LOCUS_12360 6977 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence144 2984 1062 gene locus_tag LOCUS_12370 2984 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 3290 3988 gene locus_tag LOCUS_12380 gene rpiA 3290 3988 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364539.1 protein_id gnl|my_center|LOCUS_12380 4238 4840 gene locus_tag LOCUS_12390 4238 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 4846 5685 gene locus_tag LOCUS_12400 4846 5685 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_12400 5670 6539 gene locus_tag LOCUS_12410 5670 6539 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435657.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence145 49 1044 gene locus_tag LOCUS_12420 gene selD 49 1044 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301201.1 protein_id gnl|my_center|LOCUS_12420 1048 1737 gene locus_tag LOCUS_12430 gene rnc 1048 1737 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287896.1 protein_id gnl|my_center|LOCUS_12430 1780 3246 gene locus_tag LOCUS_12440 gene rpoN 1780 3246 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462176.1 protein_id gnl|my_center|LOCUS_12440 5244 3217 gene locus_tag LOCUS_12450 gene rqcH 5244 3217 CDS product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 protein_id gnl|my_center|LOCUS_12450 5637 6287 gene locus_tag LOCUS_12460 gene gmk 5637 6287 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002997509.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence146 314 1420 gene locus_tag LOCUS_12470 314 1420 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582708.1 protein_id gnl|my_center|LOCUS_12470 1694 2104 gene locus_tag LOCUS_12480 1694 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 3122 2208 gene locus_tag LOCUS_12490 3122 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 4738 3122 gene locus_tag LOCUS_12500 4738 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 5586 4870 gene locus_tag LOCUS_12510 5586 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 5844 6752 gene locus_tag LOCUS_12520 5844 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence147 1179 49 gene locus_tag LOCUS_12530 1179 49 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_12530 1586 1176 gene locus_tag LOCUS_12540 1586 1176 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932464.1 protein_id gnl|my_center|LOCUS_12540 2328 1603 gene locus_tag LOCUS_12550 2328 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4919 2325 gene locus_tag LOCUS_12560 gene ptsP 4919 2325 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938280.1 protein_id gnl|my_center|LOCUS_12560 5729 5097 gene locus_tag LOCUS_12570 gene dhaL 5729 5097 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257203.1 protein_id gnl|my_center|LOCUS_12570 6816 5815 gene locus_tag LOCUS_12580 gene dhaK 6816 5815 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259135.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence148 2606 324 gene locus_tag LOCUS_12590 2606 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3289 2786 gene locus_tag LOCUS_12600 3289 2786 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence149 3 224 gene locus_tag LOCUS_12610 3 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 643 1950 gene locus_tag LOCUS_12620 gene aspS 643 1950 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193209104.1 protein_id gnl|my_center|LOCUS_12620 2058 2348 gene locus_tag LOCUS_12630 2058 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2345 2872 gene locus_tag LOCUS_12640 2345 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 2963 4864 gene locus_tag LOCUS_12650 2963 4864 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531013.1 protein_id gnl|my_center|LOCUS_12650 6019 5330 gene locus_tag LOCUS_12660 6019 5330 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018377503.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence150 639 2042 gene locus_tag LOCUS_12670 639 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2504 2124 gene locus_tag LOCUS_12680 2504 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 3018 2569 gene locus_tag LOCUS_12690 3018 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 3405 4088 gene locus_tag LOCUS_12700 3405 4088 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980407.1 protein_id gnl|my_center|LOCUS_12700 4629 4261 gene locus_tag LOCUS_12710 4629 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 5013 5762 gene locus_tag LOCUS_12720 5013 5762 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence151 1619 864 gene locus_tag LOCUS_12730 1619 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2711 1851 gene locus_tag LOCUS_12740 2711 1851 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_12740 3664 2726 gene locus_tag LOCUS_12750 3664 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3936 3679 gene locus_tag LOCUS_12760 3936 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 5154 4162 gene locus_tag LOCUS_12770 5154 4162 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_12770 5929 5180 gene locus_tag LOCUS_12780 5929 5180 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence152 409 579 gene locus_tag LOCUS_12790 409 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 576 758 gene locus_tag LOCUS_12800 576 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1190 1786 gene locus_tag LOCUS_12810 1190 1786 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390294.1 protein_id gnl|my_center|LOCUS_12810 1787 2275 gene locus_tag LOCUS_12820 1787 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2314 2910 gene locus_tag LOCUS_12830 2314 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 5611 2942 gene locus_tag LOCUS_12840 5611 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 <7002 5613 gene locus_tag LOCUS_12850 <7002 5613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020571.1:DNA mismatch repair endonuclease MutL >Feature sequence153 61 1026 gene locus_tag LOCUS_12860 61 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 950 2380 gene locus_tag LOCUS_12870 950 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3251 2391 gene locus_tag LOCUS_12880 3251 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 5947 3530 gene locus_tag LOCUS_12890 5947 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 <6986 6135 gene locus_tag LOCUS_12900 <6986 6135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257250.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence154 19 1122 gene locus_tag LOCUS_12910 19 1122 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_12910 1119 2996 gene locus_tag LOCUS_12920 1119 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3049 3960 gene locus_tag LOCUS_12930 3049 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3977 5419 gene locus_tag LOCUS_12940 3977 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 5448 6626 gene locus_tag LOCUS_12950 5448 6626 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023659.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence155 2636 186 gene locus_tag LOCUS_12960 gene relA 2636 186 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268592.1 protein_id gnl|my_center|LOCUS_12960 4006 2747 gene locus_tag LOCUS_12970 4006 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12970 5185 4034 gene locus_tag LOCUS_12980 5185 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12980 5940 5632 gene locus_tag LOCUS_12990 5940 5632 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_12990 6656 6426 gene locus_tag LOCUS_13000 6656 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence156 763 2748 gene locus_tag LOCUS_13010 763 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 2964 3185 gene locus_tag LOCUS_13020 2964 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 3352 4575 gene locus_tag LOCUS_13030 3352 4575 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_13030 4908 5459 gene locus_tag LOCUS_13040 4908 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 6810 5545 gene locus_tag LOCUS_13050 6810 5545 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence157 919 1092 gene locus_tag LOCUS_13060 919 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2176 1232 gene locus_tag LOCUS_13070 2176 1232 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964783.1 protein_id gnl|my_center|LOCUS_13070 2934 2275 gene locus_tag LOCUS_13080 2934 2275 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644316.1 protein_id gnl|my_center|LOCUS_13080 3650 2994 gene locus_tag LOCUS_13090 3650 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 4687 3671 gene locus_tag LOCUS_13100 4687 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 5419 4853 gene locus_tag LOCUS_13110 5419 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence158 <1 2262 gene locus_tag LOCUS_13120 <1 2262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883927.1:DNA methyltransferase 2626 3756 gene locus_tag LOCUS_13130 2626 3756 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909314.1 protein_id gnl|my_center|LOCUS_13130 3841 4665 gene locus_tag LOCUS_13140 3841 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4868 5266 gene locus_tag LOCUS_13150 gene pilG 4868 5266 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_13150 5271 5894 gene locus_tag LOCUS_13160 5271 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence159 2145 1576 gene locus_tag LOCUS_13170 2145 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 3569 2259 gene locus_tag LOCUS_13180 3569 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 5019 3712 gene locus_tag LOCUS_13190 5019 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence160 <1 624 gene locus_tag LOCUS_13200 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041233550.1:RNA-guided endonuclease TnpB family protein 996 1352 gene locus_tag LOCUS_13210 996 1352 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831581.1 protein_id gnl|my_center|LOCUS_13210 1595 2269 gene locus_tag LOCUS_13220 1595 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2644 2279 gene locus_tag LOCUS_13230 2644 2279 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971062.1 protein_id gnl|my_center|LOCUS_13230 3128 2691 gene locus_tag LOCUS_13240 3128 2691 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944306.1 protein_id gnl|my_center|LOCUS_13240 3634 3137 gene locus_tag LOCUS_13250 gene smpB 3634 3137 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_13250 4687 3746 gene locus_tag LOCUS_13260 4687 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence161 1821 1405 gene locus_tag LOCUS_13270 1821 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2048 1833 gene locus_tag LOCUS_13280 2048 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2284 3513 gene locus_tag LOCUS_13290 2284 3513 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226634.1 protein_id gnl|my_center|LOCUS_13290 3526 3822 gene locus_tag LOCUS_13300 3526 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 4748 3882 gene locus_tag LOCUS_13310 4748 3882 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_13310 5235 6146 gene locus_tag LOCUS_13320 5235 6146 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023142.1 protein_id gnl|my_center|LOCUS_13320 6869 6195 gene locus_tag LOCUS_13330 6869 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence162 1619 579 gene locus_tag LOCUS_13340 1619 579 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453966.1 protein_id gnl|my_center|LOCUS_13340 2234 3058 gene locus_tag LOCUS_13350 2234 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 3055 3756 gene locus_tag LOCUS_13360 3055 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3832 4101 gene locus_tag LOCUS_13370 3832 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 5040 4174 gene locus_tag LOCUS_13380 5040 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 5704 5189 gene locus_tag LOCUS_13390 5704 5189 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479987.1 protein_id gnl|my_center|LOCUS_13390 <6894 5787 gene locus_tag LOCUS_13400 <6894 5787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813072.1:MFS transporter >Feature sequence163 <1 535 gene locus_tag LOCUS_13410 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031089.1:MMPL family transporter 878 609 gene locus_tag LOCUS_13420 878 609 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197795.1 protein_id gnl|my_center|LOCUS_13420 1963 1541 gene locus_tag LOCUS_13430 1963 1541 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262786.1 protein_id gnl|my_center|LOCUS_13430 3402 2245 gene locus_tag LOCUS_13440 3402 2245 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258391.1 protein_id gnl|my_center|LOCUS_13440 4838 3423 gene locus_tag LOCUS_13450 gene dnaB 4838 3423 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_13450 6787 4865 gene locus_tag LOCUS_13460 6787 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence164 <1 542 gene locus_tag LOCUS_13470 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005463707.1:substrate-binding domain-containing protein 708 1556 gene locus_tag LOCUS_13480 708 1556 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276285.1 protein_id gnl|my_center|LOCUS_13480 1576 2820 gene locus_tag LOCUS_13490 1576 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2847 4334 gene locus_tag LOCUS_13500 2847 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 5032 4340 gene locus_tag LOCUS_13510 5032 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 5124 5933 gene locus_tag LOCUS_13520 5124 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 5948 6532 gene locus_tag LOCUS_13530 5948 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence165 1134 115 gene locus_tag LOCUS_13540 1134 115 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892758.1 protein_id gnl|my_center|LOCUS_13540 2058 1219 gene locus_tag LOCUS_13550 2058 1219 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777099.1 protein_id gnl|my_center|LOCUS_13550 2536 2880 gene locus_tag LOCUS_13560 2536 2880 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965471.1 protein_id gnl|my_center|LOCUS_13560 2908 3483 gene locus_tag LOCUS_13570 2908 3483 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243497.1 protein_id gnl|my_center|LOCUS_13570 3510 4001 gene locus_tag LOCUS_13580 3510 4001 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_13580 4032 4592 gene locus_tag LOCUS_13590 4032 4592 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222876.1 protein_id gnl|my_center|LOCUS_13590 6247 4649 gene locus_tag LOCUS_13600 6247 4649 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225352.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence166 1131 202 gene locus_tag LOCUS_13610 gene lolS 1131 202 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747187.1 protein_id gnl|my_center|LOCUS_13610 1606 1211 gene locus_tag LOCUS_13620 1606 1211 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531183.1 protein_id gnl|my_center|LOCUS_13620 2063 3151 gene locus_tag LOCUS_13630 2063 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 4286 3315 gene locus_tag LOCUS_13640 gene ctaA 4286 3315 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188743.1 protein_id gnl|my_center|LOCUS_13640 5384 4491 gene locus_tag LOCUS_13650 5384 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence167 <1 1645 gene locus_tag LOCUS_13660 <1 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257870.1:response regulator transcription factor 1801 2418 gene locus_tag LOCUS_13670 1801 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2556 3125 gene locus_tag LOCUS_13680 2556 3125 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142807.1 protein_id gnl|my_center|LOCUS_13680 3607 4869 gene locus_tag LOCUS_13690 3607 4869 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225936.1 protein_id gnl|my_center|LOCUS_13690 5113 6078 gene locus_tag LOCUS_13700 5113 6078 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225935.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence168 782 1963 gene locus_tag LOCUS_13710 782 1963 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_13710 2183 1983 gene locus_tag LOCUS_13720 2183 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2951 3970 gene locus_tag LOCUS_13730 2951 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 4145 3936 gene locus_tag LOCUS_13740 4145 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4898 5665 gene locus_tag LOCUS_13750 4898 5665 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423797.1 protein_id gnl|my_center|LOCUS_13750 5685 5948 gene locus_tag LOCUS_13760 5685 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 6160 5954 gene locus_tag LOCUS_13770 6160 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence169 <1 2455 gene locus_tag LOCUS_13780 <1 2455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000401853.1:helicase-related protein 2706 2503 gene locus_tag LOCUS_13790 2706 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 4033 2777 gene locus_tag LOCUS_13800 4033 2777 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673890.1 protein_id gnl|my_center|LOCUS_13800 4656 4075 gene locus_tag LOCUS_13810 4656 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4874 6706 gene locus_tag LOCUS_13820 4874 6706 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence170 9 1685 gene locus_tag LOCUS_13830 9 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 2326 1871 gene locus_tag LOCUS_13840 2326 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 4208 2448 gene locus_tag LOCUS_13850 4208 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 6011 4302 gene locus_tag LOCUS_13860 6011 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 6629 6168 gene locus_tag LOCUS_13870 6629 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence171 322 3522 gene locus_tag LOCUS_13880 322 3522 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_13880 3519 4229 gene locus_tag LOCUS_13890 3519 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 4351 5226 gene locus_tag LOCUS_13900 4351 5226 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113846.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence172 318 992 gene locus_tag LOCUS_13910 318 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 968 2134 gene locus_tag LOCUS_13920 gene solA 968 2134 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268258.1 protein_id gnl|my_center|LOCUS_13920 2172 3200 gene locus_tag LOCUS_13930 2172 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4924 3206 gene locus_tag LOCUS_13940 4924 3206 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530062.1 protein_id gnl|my_center|LOCUS_13940 6203 5067 gene locus_tag LOCUS_13950 6203 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 6663 6220 gene locus_tag LOCUS_13960 6663 6220 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence173 520 822 gene locus_tag LOCUS_13970 gene groES 520 822 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583188.1 protein_id gnl|my_center|LOCUS_13970 835 2484 gene locus_tag LOCUS_13980 gene groL 835 2484 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_13980 3329 2556 gene locus_tag LOCUS_13990 3329 2556 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227843.1 protein_id gnl|my_center|LOCUS_13990 3721 3368 gene locus_tag LOCUS_14000 3721 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3966 3727 gene locus_tag LOCUS_14010 3966 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 4534 4121 gene locus_tag LOCUS_14020 4534 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4705 5604 gene locus_tag LOCUS_14030 4705 5604 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_14030 <6708 5654 gene locus_tag LOCUS_14040 <6708 5654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141470.1:S9 family peptidase >Feature sequence174 1115 636 gene locus_tag LOCUS_14050 1115 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1378 2586 gene locus_tag LOCUS_14060 1378 2586 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_14060 3251 2583 gene locus_tag LOCUS_14070 3251 2583 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861651.1 protein_id gnl|my_center|LOCUS_14070 3899 3345 gene locus_tag LOCUS_14080 3899 3345 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229479.1 protein_id gnl|my_center|LOCUS_14080 4063 4965 gene locus_tag LOCUS_14090 4063 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence175 1347 406 gene locus_tag LOCUS_14100 1347 406 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640552.1 protein_id gnl|my_center|LOCUS_14100 1622 2683 gene locus_tag LOCUS_14110 1622 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2978 3967 gene locus_tag LOCUS_14120 2978 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4853 4140 gene locus_tag LOCUS_14130 4853 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 5465 5034 gene locus_tag LOCUS_14140 5465 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 6151 5657 gene locus_tag LOCUS_14150 6151 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence176 485 805 gene locus_tag LOCUS_14160 485 805 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808431.1 protein_id gnl|my_center|LOCUS_14160 933 2714 gene locus_tag LOCUS_14170 933 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2734 3507 gene locus_tag LOCUS_14180 2734 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 3935 3549 gene locus_tag LOCUS_14190 3935 3549 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142760.1 protein_id gnl|my_center|LOCUS_14190 4698 3913 gene locus_tag LOCUS_14200 4698 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256421.1 protein_id gnl|my_center|LOCUS_14200 4917 6578 gene locus_tag LOCUS_14210 4917 6578 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence177 356 24 gene locus_tag LOCUS_14220 356 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14220 941 414 gene locus_tag LOCUS_14230 941 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14230 1873 938 gene locus_tag LOCUS_14240 1873 938 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467636.1 protein_id gnl|my_center|LOCUS_14240 3160 1961 gene locus_tag LOCUS_14250 3160 1961 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225936.1 protein_id gnl|my_center|LOCUS_14250 3296 3129 gene locus_tag LOCUS_14260 3296 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 4639 3443 gene locus_tag LOCUS_14270 4639 3443 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528101.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence178 949 2478 gene locus_tag LOCUS_14280 949 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2711 2908 gene locus_tag LOCUS_14290 2711 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 2939 3922 gene locus_tag LOCUS_14300 2939 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 4893 4039 gene locus_tag LOCUS_14310 4893 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 <6624 5019 gene locus_tag LOCUS_14320 <6624 5019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888825.1:glycosyltransferase family 1 protein >Feature sequence179 738 1718 gene locus_tag LOCUS_14330 738 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3051 1849 gene locus_tag LOCUS_14340 3051 1849 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_14340 3426 3731 gene locus_tag LOCUS_14350 gene rpsP 3426 3731 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_14350 3832 4062 gene locus_tag LOCUS_14360 3832 4062 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_14360 4077 4661 gene locus_tag LOCUS_14370 gene rimM 4077 4661 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_14370 5308 5577 gene locus_tag LOCUS_14380 5308 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 <6619 5677 gene locus_tag LOCUS_14390 <6619 5677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141330.1:cobalamin-binding protein >Feature sequence180 535 44 gene locus_tag LOCUS_14400 535 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2296 581 gene locus_tag LOCUS_14410 2296 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 2734 3444 gene locus_tag LOCUS_14420 2734 3444 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466681.1 protein_id gnl|my_center|LOCUS_14420 3441 4550 gene locus_tag LOCUS_14430 3441 4550 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_14430 6131 4680 gene locus_tag LOCUS_14440 6131 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 6602 6288 gene locus_tag LOCUS_14450 6602 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence181 304 1206 gene locus_tag LOCUS_14460 304 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1224 2240 gene locus_tag LOCUS_14470 1224 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2030 2039 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2946 2308 gene locus_tag LOCUS_14480 2946 2308 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_14480 3100 4647 gene locus_tag LOCUS_14490 gene hutH 3100 4647 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889407.1 protein_id gnl|my_center|LOCUS_14490 5426 4671 gene locus_tag LOCUS_14500 gene fabG 5426 4671 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence182 750 953 gene locus_tag LOCUS_14510 750 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1202 1552 gene locus_tag LOCUS_14520 1202 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1696 2559 gene locus_tag LOCUS_14530 1696 2559 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258853.1 protein_id gnl|my_center|LOCUS_14530 2686 3459 gene locus_tag LOCUS_14540 2686 3459 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_14540 3765 6311 gene locus_tag LOCUS_14550 3765 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence183 680 2638 gene locus_tag LOCUS_14560 680 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2656 3030 gene locus_tag LOCUS_14570 2656 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 3847 3050 gene locus_tag LOCUS_14580 3847 3050 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902331.1 protein_id gnl|my_center|LOCUS_14580 4550 3882 gene locus_tag LOCUS_14590 4550 3882 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026924.1 protein_id gnl|my_center|LOCUS_14590 6478 4553 gene locus_tag LOCUS_14600 6478 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence184 1978 1688 gene locus_tag LOCUS_14610 gene rpsO 1978 1688 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414128.1 protein_id gnl|my_center|LOCUS_14610 2501 2118 gene locus_tag LOCUS_14620 gene rplL 2501 2118 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258053.1 protein_id gnl|my_center|LOCUS_14620 3060 2518 gene locus_tag LOCUS_14630 gene rplJ 3060 2518 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258052.1 protein_id gnl|my_center|LOCUS_14630 4111 3404 gene locus_tag LOCUS_14640 gene rplA 4111 3404 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_14640 4717 4292 gene locus_tag LOCUS_14650 gene rplK 4717 4292 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_14650 5345 4758 gene locus_tag LOCUS_14660 gene nusG 5345 4758 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_14660 5793 5380 gene locus_tag LOCUS_14670 5793 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 6280 6110 gene locus_tag LOCUS_14680 gene rpmG 6280 6110 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776157.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence185 115 1386 gene locus_tag LOCUS_14690 gene fabF 115 1386 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706107.1 protein_id gnl|my_center|LOCUS_14690 1427 2704 gene locus_tag LOCUS_14700 gene fabF 1427 2704 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_14700 2764 3474 gene locus_tag LOCUS_14710 2764 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4820 3471 gene locus_tag LOCUS_14720 4820 3471 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088413.1 protein_id gnl|my_center|LOCUS_14720 5426 4836 gene locus_tag LOCUS_14730 gene pcaG 5426 4836 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083750.1 protein_id gnl|my_center|LOCUS_14730 6151 5426 gene locus_tag LOCUS_14740 gene pcaH 6151 5426 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223753.1 protein_id gnl|my_center|LOCUS_14740 6558 6217 gene locus_tag LOCUS_14750 6558 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence186 655 362 gene locus_tag LOCUS_14760 655 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1748 804 gene locus_tag LOCUS_14770 1748 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2683 1829 gene locus_tag LOCUS_14780 2683 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 3472 2708 gene locus_tag LOCUS_14790 3472 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3736 5175 gene locus_tag LOCUS_14800 3736 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5771 5283 gene locus_tag LOCUS_14810 5771 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence187 1770 184 gene locus_tag LOCUS_14820 1770 184 CDS product T2SS-translocated chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193152.1 protein_id gnl|my_center|LOCUS_14820 3935 1767 gene locus_tag LOCUS_14830 3935 1767 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856231.1 protein_id gnl|my_center|LOCUS_14830 4663 6048 gene locus_tag LOCUS_14840 4663 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 6048 6266 gene locus_tag LOCUS_14850 6048 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 6263 6535 gene locus_tag LOCUS_14860 6263 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence188 468 31 gene locus_tag LOCUS_14870 468 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1339 503 gene locus_tag LOCUS_14880 1339 503 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257858.1 protein_id gnl|my_center|LOCUS_14880 2333 1344 gene locus_tag LOCUS_14890 2333 1344 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_14890 3449 2568 gene locus_tag LOCUS_14900 gene truB 3449 2568 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_14900 4498 3446 gene locus_tag LOCUS_14910 4498 3446 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220194564.1 protein_id gnl|my_center|LOCUS_14910 4885 4505 gene locus_tag LOCUS_14920 gene rbfA 4885 4505 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144020.1 protein_id gnl|my_center|LOCUS_14920 <6537 5067 gene locus_tag LOCUS_14930 <6537 5067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258865.1:translation initiation factor IF-2 >Feature sequence189 120 683 gene locus_tag LOCUS_14940 120 683 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 protein_id gnl|my_center|LOCUS_14940 689 820 gene locus_tag LOCUS_14950 689 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1085 2224 gene locus_tag LOCUS_14960 1085 2224 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_14960 2227 2913 gene locus_tag LOCUS_14970 2227 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 3530 2937 gene locus_tag LOCUS_14980 3530 2937 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082737.1 protein_id gnl|my_center|LOCUS_14980 3904 4704 gene locus_tag LOCUS_14990 3904 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 6519 4726 gene locus_tag LOCUS_15000 gene ligA 6519 4726 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence190 424 2685 gene locus_tag LOCUS_15010 424 2685 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257888.1 protein_id gnl|my_center|LOCUS_15010 2845 2921 gene locus_tag LOCUS_t00070 2845 2921 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3182 3568 gene locus_tag LOCUS_15020 3182 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 3844 4455 gene locus_tag LOCUS_15030 3844 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4949 5455 gene locus_tag LOCUS_15040 4949 5455 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence191 439 1116 gene locus_tag LOCUS_15050 439 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1109 2686 gene locus_tag LOCUS_15060 1109 2686 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258690.1 protein_id gnl|my_center|LOCUS_15060 2743 3660 gene locus_tag LOCUS_15070 2743 3660 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256986.1 protein_id gnl|my_center|LOCUS_15070 3623 4393 gene locus_tag LOCUS_15080 3623 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4492 5262 gene locus_tag LOCUS_15090 4492 5262 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_15090 6035 5319 gene locus_tag LOCUS_15100 gene nfi 6035 5319 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172477.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence192 642 124 gene locus_tag LOCUS_15110 642 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1254 2993 gene locus_tag LOCUS_15120 1254 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 3580 3026 gene locus_tag LOCUS_15130 3580 3026 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_15130 3780 5513 gene locus_tag LOCUS_15140 3780 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 6455 5571 gene locus_tag LOCUS_15150 6455 5571 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence193 2185 1472 gene locus_tag LOCUS_15160 2185 1472 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243013.1 protein_id gnl|my_center|LOCUS_15160 2305 3390 gene locus_tag LOCUS_15170 2305 3390 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089310.1 protein_id gnl|my_center|LOCUS_15170 3554 4171 gene locus_tag LOCUS_15180 3554 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 4305 6335 gene locus_tag LOCUS_15190 gene glgB 4305 6335 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141306.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence194 1033 377 gene locus_tag LOCUS_15200 1033 377 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_15200 1203 2567 gene locus_tag LOCUS_15210 1203 2567 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980555.1 protein_id gnl|my_center|LOCUS_15210 3845 2667 gene locus_tag LOCUS_15220 3845 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 4633 3866 gene locus_tag LOCUS_15230 gene hisF 4633 3866 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_15230 5373 4639 gene locus_tag LOCUS_15240 gene hisA 5373 4639 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256251.1 protein_id gnl|my_center|LOCUS_15240 5978 5370 gene locus_tag LOCUS_15250 gene hisH 5978 5370 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207858.1 protein_id gnl|my_center|LOCUS_15250 6493 5984 gene locus_tag LOCUS_15260 6493 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence195 338 1732 gene locus_tag LOCUS_15270 338 1732 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402863.1 protein_id gnl|my_center|LOCUS_15270 3065 1896 gene locus_tag LOCUS_15280 3065 1896 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224970.1 protein_id gnl|my_center|LOCUS_15280 3285 3100 gene locus_tag LOCUS_15290 3285 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3769 3320 gene locus_tag LOCUS_15300 3769 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4335 3805 gene locus_tag LOCUS_15310 4335 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 5132 4353 gene locus_tag LOCUS_15320 5132 4353 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114771.1 protein_id gnl|my_center|LOCUS_15320 5491 5150 gene locus_tag LOCUS_15330 5491 5150 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898986.1 protein_id gnl|my_center|LOCUS_15330 6290 5505 gene locus_tag LOCUS_15340 6290 5505 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296767.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence196 2233 986 gene locus_tag LOCUS_15350 2233 986 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence197 131 1954 gene locus_tag LOCUS_15360 131 1954 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_15360 1951 3012 gene locus_tag LOCUS_15370 1951 3012 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_15370 3009 3842 gene locus_tag LOCUS_15380 3009 3842 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015208.1 protein_id gnl|my_center|LOCUS_15380 3998 4195 gene locus_tag LOCUS_15390 3998 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 4176 5228 gene locus_tag LOCUS_15400 4176 5228 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_15400 5331 6122 gene locus_tag LOCUS_15410 5331 6122 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391834.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence198 <1 774 gene locus_tag LOCUS_15420 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258594.1:chaperonin GroEL 1470 850 gene locus_tag LOCUS_15430 1470 850 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395734.1 protein_id gnl|my_center|LOCUS_15430 1673 2122 gene locus_tag LOCUS_15440 1673 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 3032 2112 gene locus_tag LOCUS_15450 3032 2112 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257415.1 protein_id gnl|my_center|LOCUS_15450 6228 3259 gene locus_tag LOCUS_15460 6228 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence199 3321 2827 gene locus_tag LOCUS_15470 3321 2827 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257723.1 protein_id gnl|my_center|LOCUS_15470 3701 4012 gene locus_tag LOCUS_15480 3701 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 6212 3990 gene locus_tag LOCUS_15490 6212 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence200 425 258 gene locus_tag LOCUS_15500 425 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 593 1612 gene locus_tag LOCUS_15510 593 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1815 2105 gene locus_tag LOCUS_15520 1815 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 2533 2177 gene locus_tag LOCUS_15530 2533 2177 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059470.1 protein_id gnl|my_center|LOCUS_15530 2736 4196 gene locus_tag LOCUS_15540 2736 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 4379 5443 gene locus_tag LOCUS_15550 4379 5443 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257568.1 protein_id gnl|my_center|LOCUS_15550 6006 5539 gene locus_tag LOCUS_15560 6006 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence201 1508 735 gene locus_tag LOCUS_15570 1508 735 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226922.1 protein_id gnl|my_center|LOCUS_15570 2533 1508 gene locus_tag LOCUS_15580 2533 1508 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947876.1 protein_id gnl|my_center|LOCUS_15580 3877 2795 gene locus_tag LOCUS_15590 3877 2795 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226924.1 protein_id gnl|my_center|LOCUS_15590 4561 6033 gene locus_tag LOCUS_15600 4561 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence202 265 1554 gene locus_tag LOCUS_15610 265 1554 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641027.1 protein_id gnl|my_center|LOCUS_15610 2387 1530 gene locus_tag LOCUS_15620 2387 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2546 3436 gene locus_tag LOCUS_15630 2546 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 4751 3498 gene locus_tag LOCUS_15640 4751 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 5389 4940 gene locus_tag LOCUS_15650 5389 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 5474 5722 gene locus_tag LOCUS_15660 5474 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence203 <1 1278 gene locus_tag LOCUS_15670 <1 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244597.1:myo-inositol transporter IolF 1359 1673 gene locus_tag LOCUS_15680 1359 1673 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258148.1 protein_id gnl|my_center|LOCUS_15680 1695 3137 gene locus_tag LOCUS_15690 1695 3137 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_15690 3339 4520 gene locus_tag LOCUS_15700 gene rhaI 3339 4520 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence204 425 958 gene locus_tag LOCUS_15710 425 958 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229253.1 protein_id gnl|my_center|LOCUS_15710 1099 1878 gene locus_tag LOCUS_15720 1099 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1937 2749 gene locus_tag LOCUS_15730 1937 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3042 2752 gene locus_tag LOCUS_15740 3042 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3780 3070 gene locus_tag LOCUS_15750 3780 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 4248 3886 gene locus_tag LOCUS_15760 4248 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 4497 4258 gene locus_tag LOCUS_15770 4497 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4773 4504 gene locus_tag LOCUS_15780 4773 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5744 4881 gene locus_tag LOCUS_15790 5744 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 <6363 5771 gene locus_tag LOCUS_15800 <6363 5771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_187247289.1:acyl-CoA dehydrogenase family protein >Feature sequence205 1766 813 gene locus_tag LOCUS_15810 1766 813 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466227.1 protein_id gnl|my_center|LOCUS_15810 1887 3137 gene locus_tag LOCUS_15820 1887 3137 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence206 19 519 gene locus_tag LOCUS_15830 19 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 2274 595 gene locus_tag LOCUS_15840 2274 595 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_15840 2438 3295 gene locus_tag LOCUS_15850 2438 3295 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256946.1 protein_id gnl|my_center|LOCUS_15850 4115 3261 gene locus_tag LOCUS_15860 4115 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 5454 4510 gene locus_tag LOCUS_15870 5454 4510 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_15870 6047 5469 gene locus_tag LOCUS_15880 gene lspA 6047 5469 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256792.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence207 2038 65 gene locus_tag LOCUS_15890 gene ftsH 2038 65 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_15890 3170 2466 gene locus_tag LOCUS_15900 3170 2466 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541081.1 protein_id gnl|my_center|LOCUS_15900 3904 3167 gene locus_tag LOCUS_15910 3904 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 4434 5291 gene locus_tag LOCUS_15920 4434 5291 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742057.1 protein_id gnl|my_center|LOCUS_15920 6328 5351 gene locus_tag LOCUS_15930 6328 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence208 1131 2087 gene locus_tag LOCUS_15940 1131 2087 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_15940 3129 2128 gene locus_tag LOCUS_15950 3129 2128 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_15950 4284 3154 gene locus_tag LOCUS_15960 4284 3154 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_15960 4666 5316 gene locus_tag LOCUS_15970 4666 5316 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 protein_id gnl|my_center|LOCUS_15970 5721 5368 gene locus_tag LOCUS_15980 5721 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence209 72 881 gene locus_tag LOCUS_15990 gene aadA1 72 881 CDS product ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206317.1 protein_id gnl|my_center|LOCUS_15990 3403 890 gene locus_tag LOCUS_16000 3403 890 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_16000 3970 3407 gene locus_tag LOCUS_16010 3970 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 4301 4038 gene locus_tag LOCUS_16020 4301 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 4604 4386 gene locus_tag LOCUS_16030 4604 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 5036 4785 gene locus_tag LOCUS_16040 5036 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence210 1544 339 gene locus_tag LOCUS_16050 1544 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 2098 1628 gene locus_tag LOCUS_16060 2098 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2237 2311 gene locus_tag LOCUS_t00080 2237 2311 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2468 3592 gene locus_tag LOCUS_16070 gene xerC 2468 3592 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079116.1 protein_id gnl|my_center|LOCUS_16070 5182 4139 gene locus_tag LOCUS_16080 5182 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence211 3786 3061 gene locus_tag LOCUS_16090 gene alaXM 3786 3061 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 protein_id gnl|my_center|LOCUS_16090 4299 4511 gene locus_tag LOCUS_16100 4299 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence212 1424 627 gene locus_tag LOCUS_16110 1424 627 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258224.1 protein_id gnl|my_center|LOCUS_16110 3051 1552 gene locus_tag LOCUS_16120 3051 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3986 3063 gene locus_tag LOCUS_16130 3986 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4269 4063 gene locus_tag LOCUS_16140 4269 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 4222 5100 gene locus_tag LOCUS_16150 4222 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 6055 5126 gene locus_tag LOCUS_16160 gene dinD 6055 5126 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence213 81 260 gene locus_tag LOCUS_16170 81 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 278 1570 gene locus_tag LOCUS_16180 278 1570 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 protein_id gnl|my_center|LOCUS_16180 1570 2946 gene locus_tag LOCUS_16190 1570 2946 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_16190 3331 4221 gene locus_tag LOCUS_16200 gene garR 3331 4221 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303675.1 protein_id gnl|my_center|LOCUS_16200 4438 6189 gene locus_tag LOCUS_16210 gene gcl 4438 6189 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125316584.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence214 1410 1102 gene locus_tag LOCUS_16220 1410 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2381 1497 gene locus_tag LOCUS_16230 gene garR 2381 1497 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 protein_id gnl|my_center|LOCUS_16230 2504 2722 gene locus_tag LOCUS_16240 2504 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2728 3486 gene locus_tag LOCUS_16250 2728 3486 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948429.1 protein_id gnl|my_center|LOCUS_16250 3588 6134 gene locus_tag LOCUS_16260 3588 6134 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814441.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence215 <1 1798 gene locus_tag LOCUS_16270 <1 1798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein 1983 2258 gene locus_tag LOCUS_16280 1983 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2296 2571 gene locus_tag LOCUS_16290 2296 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 3273 2707 gene locus_tag LOCUS_16300 3273 2707 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869658.1 protein_id gnl|my_center|LOCUS_16300 3994 3275 gene locus_tag LOCUS_16310 gene afsQ1 3994 3275 CDS product two-component system response regulator AfsQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974066.1 protein_id gnl|my_center|LOCUS_16310 6228 3994 gene locus_tag LOCUS_16320 6228 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence216 761 282 gene locus_tag LOCUS_16330 761 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 702 986 gene locus_tag LOCUS_16340 702 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1273 2097 gene locus_tag LOCUS_16350 1273 2097 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977223.1 protein_id gnl|my_center|LOCUS_16350 1985 1994 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2264 2905 gene locus_tag LOCUS_16360 2264 2905 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_16360 3252 2917 gene locus_tag LOCUS_16370 3252 2917 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403775.1 protein_id gnl|my_center|LOCUS_16370 3484 4494 gene locus_tag LOCUS_16380 3484 4494 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228820.1 protein_id gnl|my_center|LOCUS_16380 <6283 4491 gene locus_tag LOCUS_16390 <6283 4491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_182528942.1:Eco57I restriction-modification methylase domain-containing protein >Feature sequence217 2735 1389 gene locus_tag LOCUS_16400 2735 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 <6253 2839 gene locus_tag LOCUS_16410 <6253 2839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228162.1:glycosyltransferase >Feature sequence218 901 119 gene locus_tag LOCUS_16420 901 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2836 1226 gene locus_tag LOCUS_16430 2836 1226 CDS product glycosyltransferase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877359.1 protein_id gnl|my_center|LOCUS_16430 3482 4621 gene locus_tag LOCUS_16440 3482 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4638 5750 gene locus_tag LOCUS_16450 gene hisC 4638 5750 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257801.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence219 637 167 gene locus_tag LOCUS_16460 637 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 924 757 gene locus_tag LOCUS_16470 924 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1695 937 gene locus_tag LOCUS_16480 gene ccsA 1695 937 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_16480 2387 1701 gene locus_tag LOCUS_16490 2387 1701 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_16490 3091 2384 gene locus_tag LOCUS_16500 3091 2384 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_16500 4401 3088 gene locus_tag LOCUS_16510 4401 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 4756 4382 gene locus_tag LOCUS_16520 4756 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 5445 4756 gene locus_tag LOCUS_16530 5445 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 <6194 5458 gene locus_tag LOCUS_16540 <6194 5458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005158627.1:heme lyase CcmF/NrfE family subunit >Feature sequence220 <1 1087 gene locus_tag LOCUS_16550 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393241.1:Gfo/Idh/MocA family oxidoreductase 1092 2255 gene locus_tag LOCUS_16560 1092 2255 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968365.1 protein_id gnl|my_center|LOCUS_16560 2311 3126 gene locus_tag LOCUS_16570 2311 3126 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228703.1 protein_id gnl|my_center|LOCUS_16570 3286 4098 gene locus_tag LOCUS_16580 3286 4098 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224974.1 protein_id gnl|my_center|LOCUS_16580 4993 4157 gene locus_tag LOCUS_16590 4993 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence221 891 1457 gene locus_tag LOCUS_16600 891 1457 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072993.1 protein_id gnl|my_center|LOCUS_16600 1508 3400 gene locus_tag LOCUS_16610 1508 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4800 3502 gene locus_tag LOCUS_16620 4800 3502 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064557.1 protein_id gnl|my_center|LOCUS_16620 5755 4811 gene locus_tag LOCUS_16630 gene rbsK 5755 4811 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence222 1155 952 gene locus_tag LOCUS_16640 1155 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1340 2278 gene locus_tag LOCUS_16650 1340 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2405 3613 gene locus_tag LOCUS_16660 2405 3613 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_16660 3637 4320 gene locus_tag LOCUS_16670 3637 4320 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_16670 4690 5262 gene locus_tag LOCUS_16680 4690 5262 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206879.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence223 1442 789 gene locus_tag LOCUS_16690 gene lexA 1442 789 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942262.1 protein_id gnl|my_center|LOCUS_16690 1824 2363 gene locus_tag LOCUS_16700 1824 2363 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_16700 3160 2408 gene locus_tag LOCUS_16710 3160 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 4586 3249 gene locus_tag LOCUS_16720 gene lysA 4586 3249 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256477.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence224 <1 946 gene locus_tag LOCUS_16730 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257057.1:ATP-binding protein 1481 984 gene locus_tag LOCUS_16740 1481 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 2141 1533 gene locus_tag LOCUS_16750 2141 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 2397 3752 gene locus_tag LOCUS_16760 2397 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 5249 3852 gene locus_tag LOCUS_16770 5249 3852 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230584.1 protein_id gnl|my_center|LOCUS_16770 <6084 5397 gene locus_tag LOCUS_16780 <6084 5397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227162.1:CocE/NonD family hydrolase >Feature sequence225 234 1616 gene locus_tag LOCUS_16790 234 1616 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_16790 1709 2830 gene locus_tag LOCUS_16800 1709 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2921 5308 gene locus_tag LOCUS_16810 2921 5308 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence226 2114 309 gene locus_tag LOCUS_16820 2114 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 3304 2177 gene locus_tag LOCUS_16830 3304 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 4348 3311 gene locus_tag LOCUS_16840 4348 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 4679 4419 gene locus_tag LOCUS_16850 4679 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 5173 4895 gene locus_tag LOCUS_16860 5173 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence227 197 1015 gene locus_tag LOCUS_16870 197 1015 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230136.1 protein_id gnl|my_center|LOCUS_16870 1133 2500 gene locus_tag LOCUS_16880 1133 2500 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816106.1 protein_id gnl|my_center|LOCUS_16880 2553 4142 gene locus_tag LOCUS_16890 2553 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 4262 4939 gene locus_tag LOCUS_16900 4262 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 5773 4943 gene locus_tag LOCUS_16910 5773 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence228 1378 542 gene locus_tag LOCUS_16920 1378 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1970 1644 gene locus_tag LOCUS_16930 1970 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2484 2032 gene locus_tag LOCUS_16940 2484 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 2993 3676 gene locus_tag LOCUS_16950 2993 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4730 3807 gene locus_tag LOCUS_16960 4730 3807 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence229 <1 1345 gene locus_tag LOCUS_16970 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106497.1:APC family permease 1659 2642 gene locus_tag LOCUS_16980 1659 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2768 2956 gene locus_tag LOCUS_16990 2768 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 3002 4306 gene locus_tag LOCUS_17000 3002 4306 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838638.1 protein_id gnl|my_center|LOCUS_17000 4319 4684 gene locus_tag LOCUS_17010 4319 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17010 4666 4941 gene locus_tag LOCUS_17020 4666 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17020 >Feature sequence230 209 1138 gene locus_tag LOCUS_17030 209 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1227 2132 gene locus_tag LOCUS_17040 1227 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2646 3269 gene locus_tag LOCUS_17050 2646 3269 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_17050 4277 3525 gene locus_tag LOCUS_17060 4277 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 4531 5535 gene locus_tag LOCUS_17070 4531 5535 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence231 2674 1244 gene locus_tag LOCUS_17080 2674 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3660 2671 gene locus_tag LOCUS_17090 3660 2671 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061177.1 protein_id gnl|my_center|LOCUS_17090 3859 4788 gene locus_tag LOCUS_17100 3859 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 4754 5320 gene locus_tag LOCUS_17110 4754 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence232 <1 978 gene locus_tag LOCUS_17120 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013231061.1:PLP-dependent aminotransferase family protein 1027 1722 gene locus_tag LOCUS_17130 1027 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1780 2007 gene locus_tag LOCUS_17140 1780 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 2366 2614 gene locus_tag LOCUS_17150 2366 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2611 3117 gene locus_tag LOCUS_17160 2611 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 3218 4291 gene locus_tag LOCUS_17170 gene ada 3218 4291 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_17170 4584 4357 gene locus_tag LOCUS_17180 4584 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence233 1011 385 gene locus_tag LOCUS_17190 1011 385 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_17190 3100 1274 gene locus_tag LOCUS_17200 3100 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 3930 4265 gene locus_tag LOCUS_17210 3930 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence234 572 850 gene locus_tag LOCUS_17220 572 850 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257693.1 protein_id gnl|my_center|LOCUS_17220 1011 2177 gene locus_tag LOCUS_17230 1011 2177 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_17230 2237 3439 gene locus_tag LOCUS_17240 2237 3439 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246392.1 protein_id gnl|my_center|LOCUS_17240 3480 3860 gene locus_tag LOCUS_17250 3480 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 3913 4872 gene locus_tag LOCUS_17260 3913 4872 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence235 470 1891 gene locus_tag LOCUS_17270 470 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2257 1982 gene locus_tag LOCUS_17280 2257 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3274 2420 gene locus_tag LOCUS_17290 gene larB 3274 2420 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_17290 4806 3826 gene locus_tag LOCUS_17300 gene mutM 4806 3826 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257743.1 protein_id gnl|my_center|LOCUS_17300 5330 4896 gene locus_tag LOCUS_17310 5330 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 5616 5362 gene locus_tag LOCUS_17320 5616 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence236 1002 430 gene locus_tag LOCUS_17330 1002 430 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257866.1 protein_id gnl|my_center|LOCUS_17330 1176 1021 gene locus_tag LOCUS_17340 1176 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2296 1220 gene locus_tag LOCUS_17350 gene aroF 2296 1220 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_17350 3459 2614 gene locus_tag LOCUS_17360 3459 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4124 3471 gene locus_tag LOCUS_17370 4124 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 5128 4292 gene locus_tag LOCUS_17380 gene lipM 5128 4292 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 protein_id gnl|my_center|LOCUS_17380 <5858 5145 gene locus_tag LOCUS_17390 <5858 5145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229725.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence237 <1 1959 gene locus_tag LOCUS_17400 <1 1959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230264.1:S53 family serine peptidase 1490 1499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3027 2023 gene locus_tag LOCUS_17410 3027 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3718 3011 gene locus_tag LOCUS_17420 3718 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 5389 3890 gene locus_tag LOCUS_17430 5389 3890 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055900.1 protein_id gnl|my_center|LOCUS_17430 5856 5485 gene locus_tag LOCUS_17440 5856 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence238 61 579 gene locus_tag LOCUS_17450 61 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 921 751 gene locus_tag LOCUS_17460 921 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1242 970 gene locus_tag LOCUS_17470 1242 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17470 1344 2201 gene locus_tag LOCUS_17480 1344 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 2246 2896 gene locus_tag LOCUS_17490 2246 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3725 4117 gene locus_tag LOCUS_17500 3725 4117 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206417.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence239 294 1532 gene locus_tag LOCUS_17510 294 1532 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351354.1 protein_id gnl|my_center|LOCUS_17510 1914 1657 gene locus_tag LOCUS_17520 1914 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2323 1964 gene locus_tag LOCUS_17530 2323 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2662 2363 gene locus_tag LOCUS_17540 2662 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3027 2818 gene locus_tag LOCUS_17550 3027 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 3192 3482 gene locus_tag LOCUS_17560 3192 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3488 3769 gene locus_tag LOCUS_17570 3488 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4599 3802 gene locus_tag LOCUS_17580 4599 3802 CDS product glutaconate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272325.1 protein_id gnl|my_center|LOCUS_17580 5522 4611 gene locus_tag LOCUS_17590 5522 4611 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence240 1172 1933 gene locus_tag LOCUS_17600 gene fabG 1172 1933 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_17600 2009 3658 gene locus_tag LOCUS_17610 gene guaA 2009 3658 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_17610 3671 4486 gene locus_tag LOCUS_17620 3671 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 4556 5404 gene locus_tag LOCUS_17630 4556 5404 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868073.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence241 1837 584 gene locus_tag LOCUS_17640 1837 584 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_17640 2139 2738 gene locus_tag LOCUS_17650 2139 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2746 4740 gene locus_tag LOCUS_17660 gene uvrC 2746 4740 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257899.1 protein_id gnl|my_center|LOCUS_17660 4887 5651 gene locus_tag LOCUS_17670 gene tmk 4887 5651 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence242 560 291 gene locus_tag LOCUS_17680 560 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 788 570 gene locus_tag LOCUS_17690 788 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1189 2340 gene locus_tag LOCUS_17700 1189 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2420 2986 gene locus_tag LOCUS_17710 2420 2986 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228340.1 protein_id gnl|my_center|LOCUS_17710 3008 3880 gene locus_tag LOCUS_17720 gene paaA 3008 3880 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976335.1 protein_id gnl|my_center|LOCUS_17720 3839 3848 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3975 4283 gene locus_tag LOCUS_17730 3975 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4273 5100 gene locus_tag LOCUS_17740 4273 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 5104 5604 gene locus_tag LOCUS_17750 gene paaJ 5104 5604 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618854.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence243 1795 299 gene locus_tag LOCUS_17760 1795 299 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_17760 3303 1795 gene locus_tag LOCUS_17770 3303 1795 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_17770 4865 3306 gene locus_tag LOCUS_17780 4865 3306 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257847.1 protein_id gnl|my_center|LOCUS_17780 5335 4862 gene locus_tag LOCUS_17790 5335 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 5304 5537 gene locus_tag LOCUS_17800 5304 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence244 2894 774 gene locus_tag LOCUS_17810 gene nuoG 2894 774 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258754.1 protein_id gnl|my_center|LOCUS_17810 4260 2968 gene locus_tag LOCUS_17820 gene nuoF 4260 2968 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909320.1 protein_id gnl|my_center|LOCUS_17820 4788 4285 gene locus_tag LOCUS_17830 gene nuoE 4788 4285 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_17830 5768 4785 gene locus_tag LOCUS_17840 gene nuoD 5768 4785 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence245 496 795 gene locus_tag LOCUS_17850 496 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1646 852 gene locus_tag LOCUS_17860 1646 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3165 1780 gene locus_tag LOCUS_17870 3165 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3625 5724 gene locus_tag LOCUS_17880 gene gyrB 3625 5724 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence246 20 439 gene locus_tag LOCUS_17890 20 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 509 1192 gene locus_tag LOCUS_17900 509 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1211 1693 gene locus_tag LOCUS_17910 1211 1693 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_17910 1694 2605 gene locus_tag LOCUS_17920 1694 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 3140 2610 gene locus_tag LOCUS_17930 3140 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3931 3206 gene locus_tag LOCUS_17940 3931 3206 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259190.1 protein_id gnl|my_center|LOCUS_17940 4242 4586 gene locus_tag LOCUS_17950 4242 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4833 5165 gene locus_tag LOCUS_17960 4833 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence247 162 668 gene locus_tag LOCUS_17970 162 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1855 1064 gene locus_tag LOCUS_17980 1855 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 3227 4060 gene locus_tag LOCUS_17990 3227 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 4547 4795 gene locus_tag LOCUS_18000 4547 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 5660 4956 gene locus_tag LOCUS_18010 5660 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence248 2081 1086 gene locus_tag LOCUS_18020 gene deoC 2081 1086 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339574.1 protein_id gnl|my_center|LOCUS_18020 2305 3483 gene locus_tag LOCUS_18030 2305 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 3634 4311 gene locus_tag LOCUS_18040 3634 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 4298 4930 gene locus_tag LOCUS_18050 4298 4930 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002761477.1 protein_id gnl|my_center|LOCUS_18050 5361 4939 gene locus_tag LOCUS_18060 gene iscU 5361 4939 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331704.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence249 1411 2319 gene locus_tag LOCUS_18070 1411 2319 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_18070 3686 2427 gene locus_tag LOCUS_18080 3686 2427 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199255502.1 protein_id gnl|my_center|LOCUS_18080 4628 3867 gene locus_tag LOCUS_18090 4628 3867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384137.1 protein_id gnl|my_center|LOCUS_18090 5505 4669 gene locus_tag LOCUS_18100 5505 4669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence250 1370 2131 gene locus_tag LOCUS_18110 1370 2131 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 protein_id gnl|my_center|LOCUS_18110 2159 2632 gene locus_tag LOCUS_18120 2159 2632 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103516.1 protein_id gnl|my_center|LOCUS_18120 2776 3657 gene locus_tag LOCUS_18130 2776 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 3910 5241 gene locus_tag LOCUS_18140 3910 5241 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258489.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence251 1293 1377 gene locus_tag LOCUS_t00090 1293 1377 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1395 1467 gene locus_tag LOCUS_t00100 1395 1467 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1658 3124 gene locus_tag LOCUS_18150 gene tig 1658 3124 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_18150 3264 4559 gene locus_tag LOCUS_18160 gene clpX 3264 4559 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence252 893 18 gene locus_tag LOCUS_18170 893 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 559 568 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2417 1017 gene locus_tag LOCUS_18180 2417 1017 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029023.1 protein_id gnl|my_center|LOCUS_18180 2881 3204 gene locus_tag LOCUS_18190 2881 3204 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_18190 3570 4595 gene locus_tag LOCUS_18200 gene pdhA 3570 4595 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_18200 4613 5611 gene locus_tag LOCUS_18210 4613 5611 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence253 1917 100 gene locus_tag LOCUS_18220 1917 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 2726 1914 gene locus_tag LOCUS_18230 gene dinD 2726 1914 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460715.1 protein_id gnl|my_center|LOCUS_18230 3869 2976 gene locus_tag LOCUS_18240 gene dinD 3869 2976 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350563.1 protein_id gnl|my_center|LOCUS_18240 4605 3973 gene locus_tag LOCUS_18250 4605 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4824 4609 gene locus_tag LOCUS_18260 4824 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 5154 4855 gene locus_tag LOCUS_18270 5154 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence254 303 893 gene locus_tag LOCUS_18280 303 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 1280 1945 gene locus_tag LOCUS_18290 1280 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2701 2111 gene locus_tag LOCUS_18300 2701 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 3405 2941 gene locus_tag LOCUS_18310 gene accB 3405 2941 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472859.1 protein_id gnl|my_center|LOCUS_18310 4676 3420 gene locus_tag LOCUS_18320 gene fabF 4676 3420 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_18320 5643 4756 gene locus_tag LOCUS_18330 5643 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence255 277 1983 gene locus_tag LOCUS_18340 gene ilvD 277 1983 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_18340 2621 2040 gene locus_tag LOCUS_18350 2621 2040 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972496.1 protein_id gnl|my_center|LOCUS_18350 3518 2826 gene locus_tag LOCUS_18360 3518 2826 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259021.1 protein_id gnl|my_center|LOCUS_18360 <5638 3549 gene locus_tag LOCUS_18370 <5638 3549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259022.1:ATP-binding protein >Feature sequence256 2199 1438 gene locus_tag LOCUS_18380 2199 1438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_18380 2570 3979 gene locus_tag LOCUS_18390 gene secD 2570 3979 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258879.1 protein_id gnl|my_center|LOCUS_18390 3992 5401 gene locus_tag LOCUS_18400 3992 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 >Feature sequence257 3187 941 gene locus_tag LOCUS_18410 3187 941 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 protein_id gnl|my_center|LOCUS_18410 3783 3280 gene locus_tag LOCUS_18420 gene ripB 3783 3280 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_18420 4965 3814 gene locus_tag LOCUS_18430 4965 3814 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_18430 5454 4975 gene locus_tag LOCUS_18440 5454 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence258 323 2164 gene locus_tag LOCUS_18450 323 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3931 2348 gene locus_tag LOCUS_18460 3931 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence259 2587 2039 gene locus_tag LOCUS_18470 2587 2039 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242999.1 protein_id gnl|my_center|LOCUS_18470 3492 2584 gene locus_tag LOCUS_18480 3492 2584 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_18480 4442 3633 gene locus_tag LOCUS_18490 4442 3633 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_18490 4533 4922 gene locus_tag LOCUS_18500 4533 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 5019 5429 gene locus_tag LOCUS_18510 5019 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence260 4 789 gene locus_tag LOCUS_18520 4 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1883 834 gene locus_tag LOCUS_18530 1883 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2176 2784 gene locus_tag LOCUS_18540 2176 2784 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_18540 4474 2834 gene locus_tag LOCUS_18550 4474 2834 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_18550 4661 4870 gene locus_tag LOCUS_18560 4661 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 4867 5073 gene locus_tag LOCUS_18570 4867 5073 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence261 601 2313 gene locus_tag LOCUS_18580 601 2313 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_18580 2456 3478 gene locus_tag LOCUS_18590 2456 3478 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258589.1 protein_id gnl|my_center|LOCUS_18590 3772 5064 gene locus_tag LOCUS_18600 3772 5064 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974524.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence262 2134 767 gene locus_tag LOCUS_18610 2134 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2366 3844 gene locus_tag LOCUS_18620 2366 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4469 3807 gene locus_tag LOCUS_18630 4469 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence263 2720 996 gene locus_tag LOCUS_18640 2720 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 3076 3996 gene locus_tag LOCUS_18650 3076 3996 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_18650 4042 4635 gene locus_tag LOCUS_18660 4042 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 5209 4799 gene locus_tag LOCUS_18670 5209 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 5445 5206 gene locus_tag LOCUS_18680 5445 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence264 89 373 gene locus_tag LOCUS_18690 89 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18690 488 1078 gene locus_tag LOCUS_18700 488 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18700 1230 1625 gene locus_tag LOCUS_18710 1230 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1837 2817 gene locus_tag LOCUS_18720 1837 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 3060 4136 gene locus_tag LOCUS_18730 3060 4136 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082657.1 protein_id gnl|my_center|LOCUS_18730 4310 4948 gene locus_tag LOCUS_18740 4310 4948 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722596.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence265 2431 1592 gene locus_tag LOCUS_18750 2431 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2797 3825 gene locus_tag LOCUS_18760 gene holB 2797 3825 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_18760 3902 4699 gene locus_tag LOCUS_18770 3902 4699 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence266 302 985 gene locus_tag LOCUS_18780 302 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1647 994 gene locus_tag LOCUS_18790 1647 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1914 2393 gene locus_tag LOCUS_18800 1914 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2551 2919 gene locus_tag LOCUS_18810 2551 2919 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020712.1 protein_id gnl|my_center|LOCUS_18810 3276 3974 gene locus_tag LOCUS_18820 3276 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence267 3170 759 gene locus_tag LOCUS_18830 3170 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 4316 3306 gene locus_tag LOCUS_18840 4316 3306 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_18840 5283 4543 gene locus_tag LOCUS_18850 5283 4543 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence268 2059 728 gene locus_tag LOCUS_18860 2059 728 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257404.1 protein_id gnl|my_center|LOCUS_18860 3130 2243 gene locus_tag LOCUS_18870 gene prmC 3130 2243 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_18870 3557 3165 gene locus_tag LOCUS_18880 3557 3165 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978601.1 protein_id gnl|my_center|LOCUS_18880 4746 3703 gene locus_tag LOCUS_18890 4746 3703 CDS product endo-alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108998.1 protein_id gnl|my_center|LOCUS_18890 5449 5018 gene locus_tag LOCUS_18900 5449 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence269 746 4498 gene locus_tag LOCUS_18910 746 4498 CDS product NB-ARC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_18910 5286 4510 gene locus_tag LOCUS_18920 5286 4510 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408460.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence270 695 474 gene locus_tag LOCUS_18930 695 474 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_18930 891 697 gene locus_tag LOCUS_18940 891 697 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_18940 1045 2688 gene locus_tag LOCUS_18950 1045 2688 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_18950 2707 3576 gene locus_tag LOCUS_18960 2707 3576 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886781.1 protein_id gnl|my_center|LOCUS_18960 4112 3714 gene locus_tag LOCUS_18970 4112 3714 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975873.1 protein_id gnl|my_center|LOCUS_18970 4585 4109 gene locus_tag LOCUS_18980 4585 4109 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039522.1 protein_id gnl|my_center|LOCUS_18980 <5455 4643 gene locus_tag LOCUS_18990 <5455 4643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001350194.1:deaminated glutathione amidase >Feature sequence271 1590 2753 gene locus_tag LOCUS_19000 1590 2753 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941162.1 protein_id gnl|my_center|LOCUS_19000 2896 3879 gene locus_tag LOCUS_19010 2896 3879 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_19010 4097 5200 gene locus_tag LOCUS_19020 4097 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence272 817 278 gene locus_tag LOCUS_19030 gene msrA 817 278 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_19030 983 992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1282 1025 gene locus_tag LOCUS_19040 1282 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1599 1303 gene locus_tag LOCUS_19050 1599 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1883 3202 gene locus_tag LOCUS_19060 1883 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 4215 3220 gene locus_tag LOCUS_19070 gene mftM 4215 3220 CDS product mycofactocin oligosaccharide methyltransferase MftM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731146.1 protein_id gnl|my_center|LOCUS_19070 4410 5267 gene locus_tag LOCUS_19080 4410 5267 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence273 920 1108 gene locus_tag LOCUS_19090 920 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1359 2246 gene locus_tag LOCUS_19100 gene pheA 1359 2246 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_19100 3327 2293 gene locus_tag LOCUS_19110 3327 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3595 4281 gene locus_tag LOCUS_19120 3595 4281 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 protein_id gnl|my_center|LOCUS_19120 4353 5378 gene locus_tag LOCUS_19130 4353 5378 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence274 1934 648 gene locus_tag LOCUS_19140 1934 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2317 3552 gene locus_tag LOCUS_19150 2317 3552 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_19150 3693 3702 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3814 5190 gene locus_tag LOCUS_19160 3814 5190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393890.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence275 <1 747 gene locus_tag LOCUS_19170 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003432446.1:glutamine--fructose-6-phosphate transaminase (isomerizing) 1063 770 gene locus_tag LOCUS_19180 1063 770 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379963.1 protein_id gnl|my_center|LOCUS_19180 1415 1047 gene locus_tag LOCUS_19190 1415 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2225 1494 gene locus_tag LOCUS_19200 2225 1494 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_19200 5280 2215 gene locus_tag LOCUS_19210 5280 2215 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence276 952 650 gene locus_tag LOCUS_19220 952 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 3104 1305 gene locus_tag LOCUS_19230 3104 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 3436 4431 gene locus_tag LOCUS_19240 3436 4431 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833199.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence277 2187 262 gene locus_tag LOCUS_19250 2187 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2129 2138 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3923 2184 gene locus_tag LOCUS_19260 3923 2184 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_19260 4426 3941 gene locus_tag LOCUS_19270 4426 3941 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445822.1 protein_id gnl|my_center|LOCUS_19270 <5390 4568 gene locus_tag LOCUS_19280 <5390 4568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943869.1:glycogen synthase GlgA >Feature sequence278 3427 1061 gene locus_tag LOCUS_19290 3427 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 3758 4825 gene locus_tag LOCUS_19300 3758 4825 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479721.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence279 2571 73 gene locus_tag LOCUS_19310 2571 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2914 3144 gene locus_tag LOCUS_19320 2914 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 4007 3255 gene locus_tag LOCUS_19330 4007 3255 CDS product RsmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460869.1 protein_id gnl|my_center|LOCUS_19330 4979 4020 gene locus_tag LOCUS_19340 4979 4020 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_19340 5361 4963 gene locus_tag LOCUS_19350 5361 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence280 1957 1283 gene locus_tag LOCUS_19360 1957 1283 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_19360 2388 3527 gene locus_tag LOCUS_19370 2388 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 3719 4615 gene locus_tag LOCUS_19380 3719 4615 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence281 519 274 gene locus_tag LOCUS_19390 519 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 721 1041 gene locus_tag LOCUS_19400 721 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2444 1089 gene locus_tag LOCUS_19410 2444 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_19410 2749 2471 gene locus_tag LOCUS_19420 2749 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2938 3612 gene locus_tag LOCUS_19430 2938 3612 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257105.1 protein_id gnl|my_center|LOCUS_19430 4064 3609 gene locus_tag LOCUS_19440 4064 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 4888 4196 gene locus_tag LOCUS_19450 4888 4196 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103807.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence282 325 2097 gene locus_tag LOCUS_19460 325 2097 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_19460 2738 4414 gene locus_tag LOCUS_19470 gene glcA 2738 4414 CDS product glycolate permease GlcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259302.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence283 1772 2338 gene locus_tag LOCUS_19480 1772 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2590 3747 gene locus_tag LOCUS_19490 gene hflX 2590 3747 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_19490 <5338 3960 gene locus_tag LOCUS_19500 <5338 3960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256915.1:ABC transporter substrate-binding protein >Feature sequence284 2023 2409 gene locus_tag LOCUS_19510 2023 2409 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392516.1 protein_id gnl|my_center|LOCUS_19510 3070 2468 gene locus_tag LOCUS_19520 3070 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 4509 3115 gene locus_tag LOCUS_19530 4509 3115 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence285 947 690 gene locus_tag LOCUS_19540 947 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 1386 1048 gene locus_tag LOCUS_19550 1386 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2029 1760 gene locus_tag LOCUS_19560 2029 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3630 2293 gene locus_tag LOCUS_19570 3630 2293 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_19570 5100 3646 gene locus_tag LOCUS_19580 5100 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence286 434 1402 gene locus_tag LOCUS_19590 434 1402 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287490.1 protein_id gnl|my_center|LOCUS_19590 1549 2157 gene locus_tag LOCUS_19600 1549 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2271 3374 gene locus_tag LOCUS_19610 2271 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 3924 3724 gene locus_tag LOCUS_19620 3924 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 4718 4278 gene locus_tag LOCUS_19630 4718 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence287 <1 1282 gene locus_tag LOCUS_19640 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257292.1:anthranilate synthase component I 1284 1874 gene locus_tag LOCUS_19650 1284 1874 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_19650 1887 2927 gene locus_tag LOCUS_19660 gene trpD 1887 2927 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_19660 2935 4356 gene locus_tag LOCUS_19670 gene trpCF 2935 4356 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818276.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence288 1317 1063 gene locus_tag LOCUS_19680 1317 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1977 1366 gene locus_tag LOCUS_19690 gene recR 1977 1366 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256424.1 protein_id gnl|my_center|LOCUS_19690 2277 1981 gene locus_tag LOCUS_19700 2277 1981 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359499.1 protein_id gnl|my_center|LOCUS_19700 4488 2293 gene locus_tag LOCUS_19710 gene dnaX 4488 2293 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660459.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence289 158 1603 gene locus_tag LOCUS_19720 gene pyk 158 1603 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_19720 1635 1829 gene locus_tag LOCUS_19730 1635 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 1826 2983 gene locus_tag LOCUS_19740 1826 2983 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582464.1 protein_id gnl|my_center|LOCUS_19740 3005 4732 gene locus_tag LOCUS_19750 gene serA 3005 4732 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence290 1476 586 gene locus_tag LOCUS_19760 1476 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1822 1673 gene locus_tag LOCUS_19770 1822 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence291 55 513 gene locus_tag LOCUS_19780 55 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 827 1240 gene locus_tag LOCUS_19790 827 1240 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845472.1 protein_id gnl|my_center|LOCUS_19790 1323 2420 gene locus_tag LOCUS_19800 1323 2420 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272954.1 protein_id gnl|my_center|LOCUS_19800 <5248 2637 gene locus_tag LOCUS_19810 <5248 2637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788239.1:carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit >Feature sequence292 <1 877 gene locus_tag LOCUS_19820 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275127.1:carboxylesterase/lipase family protein 1556 915 gene locus_tag LOCUS_19830 1556 915 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141508.1 protein_id gnl|my_center|LOCUS_19830 1994 1623 gene locus_tag LOCUS_19840 1994 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 5247 1957 gene locus_tag LOCUS_19850 5247 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence293 902 1552 gene locus_tag LOCUS_19860 902 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1695 3362 gene locus_tag LOCUS_19870 1695 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence294 2065 1283 gene locus_tag LOCUS_19880 2065 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 4463 2220 gene locus_tag LOCUS_19890 4463 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4673 5104 gene locus_tag LOCUS_19900 4673 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence295 237 668 gene locus_tag LOCUS_19910 gene rplP 237 668 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_19910 655 864 gene locus_tag LOCUS_19920 655 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 861 1229 gene locus_tag LOCUS_19930 861 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1242 1610 gene locus_tag LOCUS_19940 gene rplN 1242 1610 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258241.1 protein_id gnl|my_center|LOCUS_19940 1694 2083 gene locus_tag LOCUS_19950 gene rplX 1694 2083 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583356.1 protein_id gnl|my_center|LOCUS_19950 2085 2627 gene locus_tag LOCUS_19960 gene rplE 2085 2627 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_19960 2642 2827 gene locus_tag LOCUS_19970 2642 2827 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938611.1 protein_id gnl|my_center|LOCUS_19970 2913 3308 gene locus_tag LOCUS_19980 gene rpsH 2913 3308 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258245.1 protein_id gnl|my_center|LOCUS_19980 3323 3898 gene locus_tag LOCUS_19990 gene rplF 3323 3898 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258246.1 protein_id gnl|my_center|LOCUS_19990 3912 4523 gene locus_tag LOCUS_20000 3912 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence296 1808 492 gene locus_tag LOCUS_20010 gene hisD 1808 492 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530482.1 protein_id gnl|my_center|LOCUS_20010 2009 2617 gene locus_tag LOCUS_20020 2009 2617 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_20020 2704 3288 gene locus_tag LOCUS_20030 2704 3288 CDS product IS607-like element IS1602 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414146.1 protein_id gnl|my_center|LOCUS_20030 3289 4455 gene locus_tag LOCUS_20040 3289 4455 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109278575.1 protein_id gnl|my_center|LOCUS_20040 <5189 4621 gene locus_tag LOCUS_20050 <5189 4621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087688.1:MFS transporter >Feature sequence297 1113 331 gene locus_tag LOCUS_20060 1113 331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808734.1 protein_id gnl|my_center|LOCUS_20060 2089 1196 gene locus_tag LOCUS_20070 2089 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2818 2297 gene locus_tag LOCUS_20080 2818 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 3391 3579 gene locus_tag LOCUS_20090 3391 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 3652 4083 gene locus_tag LOCUS_20100 3652 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence298 <1 1151 gene locus_tag LOCUS_20110 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082660.1:ABC transporter permease 1155 2096 gene locus_tag LOCUS_20120 1155 2096 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964024.1 protein_id gnl|my_center|LOCUS_20120 2119 3705 gene locus_tag LOCUS_20130 2119 3705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948025.1 protein_id gnl|my_center|LOCUS_20130 3801 4556 gene locus_tag LOCUS_20140 3801 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 4560 4937 gene locus_tag LOCUS_20150 4560 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence299 167 1273 gene locus_tag LOCUS_20160 167 1273 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_20160 1709 1287 gene locus_tag LOCUS_20170 1709 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 2021 1812 gene locus_tag LOCUS_20180 2021 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2078 3343 gene locus_tag LOCUS_20190 2078 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 3803 3336 gene locus_tag LOCUS_20200 3803 3336 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204517.1 protein_id gnl|my_center|LOCUS_20200 4013 4174 gene locus_tag LOCUS_20210 4013 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 4174 4344 gene locus_tag LOCUS_20220 4174 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence300 543 322 gene locus_tag LOCUS_20230 543 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1192 668 gene locus_tag LOCUS_20240 1192 668 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480180.1 protein_id gnl|my_center|LOCUS_20240 3056 1824 gene locus_tag LOCUS_20250 3056 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 3924 3154 gene locus_tag LOCUS_20260 3924 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 4052 4252 gene locus_tag LOCUS_20270 4052 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 <5162 4360 gene locus_tag LOCUS_20280 <5162 4360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813053.1:GNAT family N-acetyltransferase >Feature sequence301 1 1377 gene locus_tag LOCUS_20290 1 1377 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_20290 1441 2877 gene locus_tag LOCUS_20300 1441 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 2874 5075 gene locus_tag LOCUS_20310 gene xdh 2874 5075 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20310 >Feature sequence302 2125 2325 gene locus_tag LOCUS_20320 2125 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2702 5041 gene locus_tag LOCUS_20330 2702 5041 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence303 1948 866 gene locus_tag LOCUS_20340 1948 866 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181780048.1 protein_id gnl|my_center|LOCUS_20340 2300 3586 gene locus_tag LOCUS_20350 gene tetA(P) 2300 3586 CDS product tetracycline efflux MFS transporter TetA(P) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964756.1 protein_id gnl|my_center|LOCUS_20350 3814 5031 gene locus_tag LOCUS_20360 3814 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence304 61 1776 gene locus_tag LOCUS_20370 61 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 1773 2942 gene locus_tag LOCUS_20380 1773 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2939 3727 gene locus_tag LOCUS_20390 2939 3727 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_20390 3837 4511 gene locus_tag LOCUS_20400 gene cmk 3837 4511 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence305 1409 426 gene locus_tag LOCUS_20410 1409 426 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_20410 1579 2523 gene locus_tag LOCUS_20420 1579 2523 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 protein_id gnl|my_center|LOCUS_20420 2662 4263 gene locus_tag LOCUS_20430 2662 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence306 2236 1181 gene locus_tag LOCUS_20440 gene hrcA 2236 1181 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_20440 2842 2564 gene locus_tag LOCUS_20450 2842 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2989 3120 gene locus_tag LOCUS_20460 2989 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 <5112 3439 gene locus_tag LOCUS_20470 <5112 3439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257770.1:PBP1A family penicillin-binding protein >Feature sequence307 8 646 gene locus_tag LOCUS_20480 8 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2104 659 gene locus_tag LOCUS_20490 2104 659 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_20490 2391 4280 gene locus_tag LOCUS_20500 2391 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 4297 4665 gene locus_tag LOCUS_20510 4297 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence308 288 43 gene locus_tag LOCUS_20520 288 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1196 285 gene locus_tag LOCUS_20530 1196 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 4810 1481 gene locus_tag LOCUS_20540 4810 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence309 558 1526 gene locus_tag LOCUS_20550 558 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 1540 2406 gene locus_tag LOCUS_20560 1540 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2409 4715 gene locus_tag LOCUS_20570 2409 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence310 1318 2061 gene locus_tag LOCUS_20580 gene map 1318 2061 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_20580 2934 2200 gene locus_tag LOCUS_20590 2934 2200 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584081.1 protein_id gnl|my_center|LOCUS_20590 3087 4037 gene locus_tag LOCUS_20600 3087 4037 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832962.1 protein_id gnl|my_center|LOCUS_20600 4198 5025 gene locus_tag LOCUS_20610 4198 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence311 85 1677 gene locus_tag LOCUS_20620 85 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2311 3204 gene locus_tag LOCUS_20630 2311 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 3606 3376 gene locus_tag LOCUS_20640 3606 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence312 160 684 gene locus_tag LOCUS_20650 160 684 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030945.1 protein_id gnl|my_center|LOCUS_20650 761 1783 gene locus_tag LOCUS_20660 761 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2943 1786 gene locus_tag LOCUS_20670 2943 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615347.1 protein_id gnl|my_center|LOCUS_20670 4075 2948 gene locus_tag LOCUS_20680 4075 2948 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_20680 4871 4185 gene locus_tag LOCUS_20690 4871 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence313 1723 170 gene locus_tag LOCUS_20700 1723 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 4371 1963 gene locus_tag LOCUS_20710 4371 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 <5069 4391 gene locus_tag LOCUS_20720 <5069 4391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082447.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence314 250 1392 gene locus_tag LOCUS_20730 250 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1408 2058 gene locus_tag LOCUS_20740 1408 2058 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_20740 2433 2083 gene locus_tag LOCUS_20750 2433 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 3778 2624 gene locus_tag LOCUS_20760 3778 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 5004 3958 gene locus_tag LOCUS_20770 5004 3958 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903320.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence315 <1 837 gene locus_tag LOCUS_20780 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973382.1:polysaccharide deacetylase family protein 818 2137 gene locus_tag LOCUS_20790 818 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2137 3381 gene locus_tag LOCUS_20800 2137 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 3532 4581 gene locus_tag LOCUS_20810 3532 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence316 1131 10 gene locus_tag LOCUS_20820 1131 10 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_20820 1539 1177 gene locus_tag LOCUS_20830 1539 1177 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942071.1 protein_id gnl|my_center|LOCUS_20830 3153 1687 gene locus_tag LOCUS_20840 3153 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4826 3420 gene locus_tag LOCUS_20850 4826 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence317 2609 1530 gene locus_tag LOCUS_20860 2609 1530 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582887.1 protein_id gnl|my_center|LOCUS_20860 2904 4331 gene locus_tag LOCUS_20870 2904 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 <5053 4339 gene locus_tag LOCUS_20880 <5053 4339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776033.1:dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein >Feature sequence318 <1 944 gene locus_tag LOCUS_20890 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001093009.1:4-aminobutyrate--2-oxoglutarate transaminase 1799 1083 gene locus_tag LOCUS_20900 1799 1083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_20900 2677 1847 gene locus_tag LOCUS_20910 2677 1847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_20910 4558 2696 gene locus_tag LOCUS_20920 4558 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence319 342 130 gene locus_tag LOCUS_20930 342 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 341 1438 gene locus_tag LOCUS_20940 341 1438 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026821.1 protein_id gnl|my_center|LOCUS_20940 1744 2529 gene locus_tag LOCUS_20950 1744 2529 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189285322.1 protein_id gnl|my_center|LOCUS_20950 2540 3433 gene locus_tag LOCUS_20960 2540 3433 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189285321.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence320 913 722 gene locus_tag LOCUS_20970 913 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4655 915 gene locus_tag LOCUS_20980 4655 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence321 1166 522 gene locus_tag LOCUS_20990 1166 522 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888969.1 protein_id gnl|my_center|LOCUS_20990 1655 1284 gene locus_tag LOCUS_21000 1655 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2229 1876 gene locus_tag LOCUS_21010 2229 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2618 3094 gene locus_tag LOCUS_21020 2618 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3095 3712 gene locus_tag LOCUS_21030 3095 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence322 105 278 gene locus_tag LOCUS_21040 105 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 486 4253 gene locus_tag LOCUS_21050 486 4253 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241751.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence323 178 1398 gene locus_tag LOCUS_21060 178 1398 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011244.1 protein_id gnl|my_center|LOCUS_21060 2804 1452 gene locus_tag LOCUS_21070 2804 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 3548 2985 gene locus_tag LOCUS_21080 3548 2985 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142343.1 protein_id gnl|my_center|LOCUS_21080 4201 3590 gene locus_tag LOCUS_21090 4201 3590 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_21090 <5017 4267 gene locus_tag LOCUS_21100 <5017 4267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405161.1:FAD-dependent oxidoreductase >Feature sequence324 481 1305 gene locus_tag LOCUS_21110 481 1305 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582612.1 protein_id gnl|my_center|LOCUS_21110 1497 2771 gene locus_tag LOCUS_21120 1497 2771 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_21120 2883 3665 gene locus_tag LOCUS_21130 2883 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 3915 4904 gene locus_tag LOCUS_21140 3915 4904 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732008.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence325 29 3550 gene locus_tag LOCUS_21150 gene metH 29 3550 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259744.1 protein_id gnl|my_center|LOCUS_21150 3616 3625 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3805 3632 gene locus_tag LOCUS_21160 3805 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 >Feature sequence326 1447 362 gene locus_tag LOCUS_21170 1447 362 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143081.1 protein_id gnl|my_center|LOCUS_21170 4081 1538 gene locus_tag LOCUS_21180 gene topA 4081 1538 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958589.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence327 385 312 gene locus_tag LOCUS_t00110 385 312 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1810 611 gene locus_tag LOCUS_21190 1810 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2604 1813 gene locus_tag LOCUS_21200 2604 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3089 2790 gene locus_tag LOCUS_21210 3089 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 4330 3470 gene locus_tag LOCUS_21220 4330 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 <4960 4345 gene locus_tag LOCUS_21230 <4960 4345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000626569.1:ABC transporter ATP-binding protein >Feature sequence328 1069 107 gene locus_tag LOCUS_21240 1069 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1293 1081 gene locus_tag LOCUS_21250 1293 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 1823 1551 gene locus_tag LOCUS_21260 1823 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 3408 2092 gene locus_tag LOCUS_21270 3408 2092 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920174.1 protein_id gnl|my_center|LOCUS_21270 4459 3431 gene locus_tag LOCUS_21280 4459 3431 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260258.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence329 2543 1008 gene locus_tag LOCUS_21290 2543 1008 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_21290 2679 3572 gene locus_tag LOCUS_21300 2679 3572 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_21300 4844 3672 gene locus_tag LOCUS_21310 4844 3672 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence330 840 136 gene locus_tag LOCUS_21320 840 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2237 840 gene locus_tag LOCUS_21330 2237 840 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_21330 2396 3883 gene locus_tag LOCUS_21340 2396 3883 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928673.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence331 1900 449 gene locus_tag LOCUS_21350 gene sufB 1900 449 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805064.1 protein_id gnl|my_center|LOCUS_21350 2729 1893 gene locus_tag LOCUS_21360 gene sufC 2729 1893 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_21360 3339 2797 gene locus_tag LOCUS_21370 3339 2797 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_21370 4339 3977 gene locus_tag LOCUS_21380 4339 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence332 1355 3 gene locus_tag LOCUS_21390 1355 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3310 1502 gene locus_tag LOCUS_21400 3310 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence333 340 966 gene locus_tag LOCUS_21410 340 966 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_21410 1205 975 gene locus_tag LOCUS_21420 1205 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228247.1 protein_id gnl|my_center|LOCUS_21420 1937 1521 gene locus_tag LOCUS_21430 1937 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 2773 2021 gene locus_tag LOCUS_21440 2773 2021 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583290.1 protein_id gnl|my_center|LOCUS_21440 2937 4478 gene locus_tag LOCUS_21450 2937 4478 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence334 791 1231 gene locus_tag LOCUS_21460 791 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 1506 1643 gene locus_tag LOCUS_21470 1506 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2580 2338 gene locus_tag LOCUS_21480 2580 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 3038 2865 gene locus_tag LOCUS_21490 3038 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence335 1439 1050 gene locus_tag LOCUS_21500 1439 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21500 <4932 1461 gene locus_tag LOCUS_21510 <4932 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259000.1:aconitate hydratase AcnA note possible pseudo, internal stop codon >Feature sequence336 191 583 gene locus_tag LOCUS_21520 191 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1493 591 gene locus_tag LOCUS_21530 1493 591 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804073.1 protein_id gnl|my_center|LOCUS_21530 2577 1642 gene locus_tag LOCUS_21540 2577 1642 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259671.1 protein_id gnl|my_center|LOCUS_21540 2815 3804 gene locus_tag LOCUS_21550 2815 3804 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967414.1 protein_id gnl|my_center|LOCUS_21550 4851 3895 gene locus_tag LOCUS_21560 4851 3895 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530745.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence337 <1 1047 gene locus_tag LOCUS_21570 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973742.1:sodium:solute symporter family protein 1902 1111 gene locus_tag LOCUS_21580 1902 1111 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965976.1 protein_id gnl|my_center|LOCUS_21580 2603 2016 gene locus_tag LOCUS_21590 gene comE 2603 2016 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496438.1 protein_id gnl|my_center|LOCUS_21590 3119 2607 gene locus_tag LOCUS_21600 gene comD 3119 2607 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 protein_id gnl|my_center|LOCUS_21600 3376 4338 gene locus_tag LOCUS_21610 3376 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence338 <1 1720 gene locus_tag LOCUS_21620 <1 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002937025.1:response regulator transcription factor 1954 3363 gene locus_tag LOCUS_21630 1954 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 3334 3343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3350 4858 gene locus_tag LOCUS_21640 3350 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence339 <1 1009 gene locus_tag LOCUS_21650 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256247.1:DNA mismatch repair protein MutS 1261 2220 gene locus_tag LOCUS_21660 1261 2220 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_21660 2266 2976 gene locus_tag LOCUS_21670 2266 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_21670 2984 4459 gene locus_tag LOCUS_21680 2984 4459 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181950125.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence340 2542 1055 gene locus_tag LOCUS_21690 gene gcvPB 2542 1055 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_21690 3918 2539 gene locus_tag LOCUS_21700 gene gcvPA 3918 2539 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_21700 4639 4244 gene locus_tag LOCUS_21710 gene gcvH 4639 4244 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence341 1255 146 gene locus_tag LOCUS_21720 1255 146 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814621.1 protein_id gnl|my_center|LOCUS_21720 1418 2278 gene locus_tag LOCUS_21730 1418 2278 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530129.1 protein_id gnl|my_center|LOCUS_21730 4089 2275 gene locus_tag LOCUS_21740 4089 2275 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186395.1 protein_id gnl|my_center|LOCUS_21740 <4860 4143 gene locus_tag LOCUS_21750 <4860 4143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056556.1:pentapeptide repeat-containing protein >Feature sequence342 276 3386 gene locus_tag LOCUS_21760 276 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 3572 3648 gene locus_tag LOCUS_t00120 3572 3648 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4028 4573 gene locus_tag LOCUS_21770 4028 4573 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence343 94 1899 gene locus_tag LOCUS_21780 94 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 1984 4725 gene locus_tag LOCUS_21790 1984 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence344 999 61 gene locus_tag LOCUS_21800 999 61 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_21800 1917 1165 gene locus_tag LOCUS_21810 1917 1165 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190909.1 protein_id gnl|my_center|LOCUS_21810 2519 4210 gene locus_tag LOCUS_21820 gene lldP 2519 4210 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099323.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence345 1074 565 gene locus_tag LOCUS_21830 1074 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1780 1115 gene locus_tag LOCUS_21840 1780 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2978 2124 gene locus_tag LOCUS_21850 2978 2124 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066517.1 protein_id gnl|my_center|LOCUS_21850 4657 3071 gene locus_tag LOCUS_21860 4657 3071 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence346 994 1797 gene locus_tag LOCUS_21870 994 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 1798 2988 gene locus_tag LOCUS_21880 1798 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 3468 3148 gene locus_tag LOCUS_21890 3468 3148 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083228.1 protein_id gnl|my_center|LOCUS_21890 3725 4117 gene locus_tag LOCUS_21900 3725 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 <4838 4167 gene locus_tag LOCUS_21910 <4838 4167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256851.1:dynamin family protein >Feature sequence347 252 1028 gene locus_tag LOCUS_21920 252 1028 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259712.1 protein_id gnl|my_center|LOCUS_21920 1090 1890 gene locus_tag LOCUS_21930 1090 1890 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_21930 3549 1957 gene locus_tag LOCUS_21940 3549 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence348 237 737 gene locus_tag LOCUS_21950 237 737 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_21950 1919 840 gene locus_tag LOCUS_21960 gene aroF 1919 840 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258092.1 protein_id gnl|my_center|LOCUS_21960 2456 2088 gene locus_tag LOCUS_21970 gene aroH 2456 2088 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_21970 3562 2693 gene locus_tag LOCUS_21980 gene trpA 3562 2693 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256579.1 protein_id gnl|my_center|LOCUS_21980 4309 3584 gene locus_tag LOCUS_21990 4309 3584 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397506.1 protein_id gnl|my_center|LOCUS_21990 <4828 4320 gene locus_tag LOCUS_22000 <4828 4320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223173845.1:tryptophan synthase subunit beta >Feature sequence349 2307 583 gene locus_tag LOCUS_22010 2307 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 2576 4300 gene locus_tag LOCUS_22020 2576 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence350 1 678 gene locus_tag LOCUS_22030 1 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2196 760 gene locus_tag LOCUS_22040 gene glnA 2196 760 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_22040 2473 3120 gene locus_tag LOCUS_22050 2473 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 3761 3135 gene locus_tag LOCUS_22060 gene cofC 3761 3135 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081461.1 protein_id gnl|my_center|LOCUS_22060 <4821 3892 gene locus_tag LOCUS_22070 <4821 3892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256113.1:2-phospho-L-lactate transferase >Feature sequence351 517 1296 gene locus_tag LOCUS_22080 517 1296 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 protein_id gnl|my_center|LOCUS_22080 1293 2111 gene locus_tag LOCUS_22090 1293 2111 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057157.1 protein_id gnl|my_center|LOCUS_22090 2158 3234 gene locus_tag LOCUS_22100 2158 3234 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256331.1 protein_id gnl|my_center|LOCUS_22100 3846 3322 gene locus_tag LOCUS_22110 3846 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 >Feature sequence352 810 1631 gene locus_tag LOCUS_22120 810 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1700 3436 gene locus_tag LOCUS_22130 1700 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 <4798 3605 gene locus_tag LOCUS_22140 <4798 3605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258512.1:Stp1/IreP family PP2C-type Ser/Thr phosphatase >Feature sequence353 1351 149 gene locus_tag LOCUS_22150 1351 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 1510 1391 gene locus_tag LOCUS_22160 1510 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 4282 4291 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence354 <1 580 gene locus_tag LOCUS_22170 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258145.1:rhamnulokinase family protein 1729 1896 gene locus_tag LOCUS_22180 1729 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2061 2801 gene locus_tag LOCUS_22190 2061 2801 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888542.1 protein_id gnl|my_center|LOCUS_22190 2801 4240 gene locus_tag LOCUS_22200 2801 4240 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence355 <1 597 gene locus_tag LOCUS_22210 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545898.1:pyridoxal phosphate-dependent aminotransferase 629 1636 gene locus_tag LOCUS_22220 629 1636 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_22220 1761 3305 gene locus_tag LOCUS_22230 1761 3305 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_22230 3315 4589 gene locus_tag LOCUS_22240 3315 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence356 381 1799 gene locus_tag LOCUS_22250 381 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 1861 2220 gene locus_tag LOCUS_22260 1861 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2359 2430 gene locus_tag LOCUS_t00130 2359 2430 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3913 2564 gene locus_tag LOCUS_22270 3913 2564 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764944.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence357 84 608 gene locus_tag LOCUS_22280 84 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 883 2496 gene locus_tag LOCUS_22290 883 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence358 665 1354 gene locus_tag LOCUS_22300 gene mocA 665 1354 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459387.1 protein_id gnl|my_center|LOCUS_22300 1555 2172 gene locus_tag LOCUS_22310 1555 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 2199 3701 gene locus_tag LOCUS_22320 2199 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 <4772 3778 gene locus_tag LOCUS_22330 <4772 3778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064254325.1:aldehyde dehydrogenase family protein >Feature sequence359 <1 585 gene locus_tag LOCUS_22340 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903344.1:dipeptide epimerase 673 1920 gene locus_tag LOCUS_22350 673 1920 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093954241.1 protein_id gnl|my_center|LOCUS_22350 2407 1922 gene locus_tag LOCUS_22360 2407 1922 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091014.1 protein_id gnl|my_center|LOCUS_22360 2642 3394 gene locus_tag LOCUS_22370 2642 3394 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345437.1 protein_id gnl|my_center|LOCUS_22370 3562 4149 gene locus_tag LOCUS_22380 3562 4149 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_22380 4195 4632 gene locus_tag LOCUS_22390 4195 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence360 638 2239 gene locus_tag LOCUS_22400 638 2239 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963828.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence361 820 131 gene locus_tag LOCUS_22410 820 131 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973319.1 protein_id gnl|my_center|LOCUS_22410 3519 817 gene locus_tag LOCUS_22420 3519 817 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529647.1 protein_id gnl|my_center|LOCUS_22420 4119 3529 gene locus_tag LOCUS_22430 4119 3529 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089516.1 protein_id gnl|my_center|LOCUS_22430 <4763 4132 gene locus_tag LOCUS_22440 <4763 4132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973322.1:potassium-transporting ATPase subunit KdpB >Feature sequence362 675 3086 gene locus_tag LOCUS_22450 675 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3083 4159 gene locus_tag LOCUS_22460 3083 4159 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence363 2655 4364 gene locus_tag LOCUS_22470 2655 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence364 1603 896 gene locus_tag LOCUS_22480 1603 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 3004 1619 gene locus_tag LOCUS_22490 3004 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 3325 3510 gene locus_tag LOCUS_22500 3325 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 3783 4301 gene locus_tag LOCUS_22510 3783 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 4243 4252 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence365 109 576 gene locus_tag LOCUS_22520 109 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 607 891 gene locus_tag LOCUS_22530 607 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 944 1393 gene locus_tag LOCUS_22540 944 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence366 1799 2596 gene locus_tag LOCUS_22550 1799 2596 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258853.1 protein_id gnl|my_center|LOCUS_22550 3445 2567 gene locus_tag LOCUS_22560 3445 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 4356 3445 gene locus_tag LOCUS_22570 4356 3445 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728702.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence367 631 1824 gene locus_tag LOCUS_22580 631 1824 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582595.1 protein_id gnl|my_center|LOCUS_22580 2919 1840 gene locus_tag LOCUS_22590 2919 1840 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_22590 4232 2994 gene locus_tag LOCUS_22600 4232 2994 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525270.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence368 <1 802 gene locus_tag LOCUS_22610 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963198.1:DNA polymerase III subunit delta 817 1923 gene locus_tag LOCUS_22620 817 1923 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142380.1 protein_id gnl|my_center|LOCUS_22620 2686 1898 gene locus_tag LOCUS_22630 2686 1898 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064851.1 protein_id gnl|my_center|LOCUS_22630 3002 4228 gene locus_tag LOCUS_22640 3002 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 >Feature sequence369 738 1316 gene locus_tag LOCUS_22650 738 1316 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_22650 1313 2311 gene locus_tag LOCUS_22660 1313 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 3699 2449 gene locus_tag LOCUS_22670 3699 2449 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence370 2171 606 gene locus_tag LOCUS_22680 2171 606 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807737.1 protein_id gnl|my_center|LOCUS_22680 2905 2195 gene locus_tag LOCUS_22690 2905 2195 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_22690 3782 3027 gene locus_tag LOCUS_22700 3782 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 <4685 3975 gene locus_tag LOCUS_22710 <4685 3975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583250.1:excinuclease ABC subunit UvrA >Feature sequence371 1835 1389 gene locus_tag LOCUS_22720 1835 1389 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385395.1 protein_id gnl|my_center|LOCUS_22720 2240 3691 gene locus_tag LOCUS_22730 gene proS 2240 3691 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_22730 3810 4478 gene locus_tag LOCUS_22740 3810 4478 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439746.1 protein_id gnl|my_center|LOCUS_22740 4648 4529 gene locus_tag LOCUS_22750 4648 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence372 1386 562 gene locus_tag LOCUS_22760 1386 562 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350071.1 protein_id gnl|my_center|LOCUS_22760 1999 1388 gene locus_tag LOCUS_22770 1999 1388 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023672.1 protein_id gnl|my_center|LOCUS_22770 2155 3396 gene locus_tag LOCUS_22780 gene cypA 2155 3396 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240954.1 protein_id gnl|my_center|LOCUS_22780 4166 3402 gene locus_tag LOCUS_22790 4166 3402 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221295.1 protein_id gnl|my_center|LOCUS_22790 <4672 4163 gene locus_tag LOCUS_22800 <4672 4163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272527.1:Ldh family oxidoreductase >Feature sequence373 568 1605 gene locus_tag LOCUS_22810 568 1605 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943997.1 protein_id gnl|my_center|LOCUS_22810 2227 2096 gene locus_tag LOCUS_22820 2227 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence374 1557 610 gene locus_tag LOCUS_22830 1557 610 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206677.1 protein_id gnl|my_center|LOCUS_22830 3126 2098 gene locus_tag LOCUS_22840 3126 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence375 486 34 gene locus_tag LOCUS_22850 486 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22850 1029 688 gene locus_tag LOCUS_22860 1029 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22860 2408 1203 gene locus_tag LOCUS_22870 2408 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3396 2497 gene locus_tag LOCUS_22880 3396 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 <4661 3459 gene locus_tag LOCUS_22890 <4661 3459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392068.1:endopeptidase La >Feature sequence376 434 1282 gene locus_tag LOCUS_22900 434 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22900 1305 4145 gene locus_tag LOCUS_22910 1305 4145 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_22910 4457 4639 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgaggtaggacatgcatctcggttgagattgaaac >Feature sequence377 1910 636 gene locus_tag LOCUS_22920 1910 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 <4652 2037 gene locus_tag LOCUS_22930 <4652 2037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932586.1:helicase-related protein >Feature sequence378 1720 5 gene locus_tag LOCUS_22940 1720 5 CDS product reverse transcriptase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272172.1 protein_id gnl|my_center|LOCUS_22940 2777 3649 gene locus_tag LOCUS_22950 2777 3649 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence379 208 369 gene locus_tag LOCUS_22960 208 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 531 1901 gene locus_tag LOCUS_22970 531 1901 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_22970 2154 1969 gene locus_tag LOCUS_22980 2154 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 3407 2220 gene locus_tag LOCUS_22990 3407 2220 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259394.1 protein_id gnl|my_center|LOCUS_22990 3742 4554 gene locus_tag LOCUS_23000 3742 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence380 2 181 gene locus_tag LOCUS_23010 2 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 199 993 gene locus_tag LOCUS_23020 199 993 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_23020 1135 1407 gene locus_tag LOCUS_23030 1135 1407 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461371.1 protein_id gnl|my_center|LOCUS_23030 1425 1772 gene locus_tag LOCUS_23040 1425 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1772 1975 gene locus_tag LOCUS_23050 1772 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2081 2329 gene locus_tag LOCUS_23060 2081 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2377 2586 gene locus_tag LOCUS_23070 2377 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2583 2795 gene locus_tag LOCUS_23080 2583 2795 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_23080 2870 3745 gene locus_tag LOCUS_23090 2870 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 4374 3829 gene locus_tag LOCUS_23100 4374 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence381 2974 1640 gene locus_tag LOCUS_23110 2974 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 4296 2971 gene locus_tag LOCUS_23120 4296 2971 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022158.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence382 1082 567 gene locus_tag LOCUS_23130 1082 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 1574 1089 gene locus_tag LOCUS_23140 1574 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 3691 1817 gene locus_tag LOCUS_23150 3691 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948590.1 protein_id gnl|my_center|LOCUS_23150 3952 4563 gene locus_tag LOCUS_23160 3952 4563 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence383 <1 1381 gene locus_tag LOCUS_23170 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941018.1:NADH-quinone oxidoreductase subunit M 1392 3143 gene locus_tag LOCUS_23180 1392 3143 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence384 336 821 gene locus_tag LOCUS_23190 336 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 845 1567 gene locus_tag LOCUS_23200 845 1567 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223631.1 protein_id gnl|my_center|LOCUS_23200 1585 3084 gene locus_tag LOCUS_23210 1585 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 <4611 3153 gene locus_tag LOCUS_23220 <4611 3153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392144.1:pyruvate, phosphate dikinase >Feature sequence385 1266 112 gene locus_tag LOCUS_23230 1266 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2366 1287 gene locus_tag LOCUS_23240 2366 1287 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_23240 2661 3845 gene locus_tag LOCUS_23250 gene ychF 2661 3845 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_23250 4515 3868 gene locus_tag LOCUS_23260 4515 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence386 >Feature sequence387 114 1025 gene locus_tag LOCUS_23270 114 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 1055 1933 gene locus_tag LOCUS_23280 1055 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 1991 2941 gene locus_tag LOCUS_23290 1991 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 3408 3770 gene locus_tag LOCUS_23300 3408 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3772 3978 gene locus_tag LOCUS_23310 3772 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3979 4485 gene locus_tag LOCUS_23320 3979 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence388 64 747 gene locus_tag LOCUS_23330 64 747 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263036.1 protein_id gnl|my_center|LOCUS_23330 2475 832 gene locus_tag LOCUS_23340 2475 832 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062821440.1 protein_id gnl|my_center|LOCUS_23340 3104 2472 gene locus_tag LOCUS_23350 3104 2472 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990826.1 protein_id gnl|my_center|LOCUS_23350 <4592 3128 gene locus_tag LOCUS_23360 <4592 3128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062821440.1:FAD-dependent monooxygenase >Feature sequence389 670 840 gene locus_tag LOCUS_23370 670 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 1634 837 gene locus_tag LOCUS_23380 1634 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2336 1842 gene locus_tag LOCUS_23390 2336 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23390 2533 2237 gene locus_tag LOCUS_23400 2533 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23400 3511 2570 gene locus_tag LOCUS_23410 3511 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence390 2709 1534 gene locus_tag LOCUS_23420 2709 1534 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764762.1 protein_id gnl|my_center|LOCUS_23420 4254 2821 gene locus_tag LOCUS_23430 gene ygjG 4254 2821 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098827.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence391 117 1061 gene locus_tag LOCUS_23440 117 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 1309 1974 gene locus_tag LOCUS_23450 gene clpP 1309 1974 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829659.1 protein_id gnl|my_center|LOCUS_23450 2049 3029 gene locus_tag LOCUS_23460 2049 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 3026 3748 gene locus_tag LOCUS_23470 3026 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence392 2206 968 gene locus_tag LOCUS_23480 2206 968 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383259.1 protein_id gnl|my_center|LOCUS_23480 2723 3952 gene locus_tag LOCUS_23490 2723 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence393 395 1399 gene locus_tag LOCUS_23500 395 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2646 1423 gene locus_tag LOCUS_23510 2646 1423 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_23510 2850 2777 gene locus_tag LOCUS_t00140 2850 2777 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3041 4054 gene locus_tag LOCUS_23520 3041 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence394 2538 1348 gene locus_tag LOCUS_23530 gene nadA 2538 1348 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_23530 3426 2584 gene locus_tag LOCUS_23540 gene nadC 3426 2584 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_23540 <4559 3419 gene locus_tag LOCUS_23550 <4559 3419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119573.1:L-aspartate oxidase >Feature sequence395 795 145 gene locus_tag LOCUS_23560 gene ispD 795 145 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_23560 1225 932 gene locus_tag LOCUS_23570 1225 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23570 2118 1255 gene locus_tag LOCUS_23580 2118 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23580 1302 1311 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2414 2268 gene locus_tag LOCUS_23590 2414 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 3778 2435 gene locus_tag LOCUS_23600 gene radA 3778 2435 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085202.1 protein_id gnl|my_center|LOCUS_23600 <4551 3907 gene locus_tag LOCUS_23610 <4551 3907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391709.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence396 1472 771 gene locus_tag LOCUS_23620 1472 771 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 protein_id gnl|my_center|LOCUS_23620 1758 3833 gene locus_tag LOCUS_23630 1758 3833 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963517.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence397 1479 3293 gene locus_tag LOCUS_23640 1479 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence398 449 237 gene locus_tag LOCUS_23650 449 237 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_23650 1217 501 gene locus_tag LOCUS_23660 1217 501 CDS product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 protein_id gnl|my_center|LOCUS_23660 1521 2519 gene locus_tag LOCUS_23670 1521 2519 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259152.1 protein_id gnl|my_center|LOCUS_23670 2516 3307 gene locus_tag LOCUS_23680 2516 3307 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259153.1 protein_id gnl|my_center|LOCUS_23680 3364 4101 gene locus_tag LOCUS_23690 3364 4101 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259154.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence399 270 698 gene locus_tag LOCUS_23700 270 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 832 1728 gene locus_tag LOCUS_23710 832 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 3076 1772 gene locus_tag LOCUS_23720 3076 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 3312 4319 gene locus_tag LOCUS_23730 3312 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence400 547 3183 gene locus_tag LOCUS_23740 547 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 4242 3277 gene locus_tag LOCUS_23750 4242 3277 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979027.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence401 <1 1733 gene locus_tag LOCUS_23760 <1 1733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119978.1:asparagine synthase (glutamine-hydrolyzing) 1779 2849 gene locus_tag LOCUS_23770 1779 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2836 4113 gene locus_tag LOCUS_23780 2836 4113 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466568.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence402 575 174 gene locus_tag LOCUS_23790 575 174 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816710.1 protein_id gnl|my_center|LOCUS_23790 951 1685 gene locus_tag LOCUS_23800 951 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2502 1699 gene locus_tag LOCUS_23810 2502 1699 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_23810 2790 2921 gene locus_tag LOCUS_23820 2790 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 3005 3679 gene locus_tag LOCUS_23830 3005 3679 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence403 1345 80 gene locus_tag LOCUS_23840 1345 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1360 1369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3864 1891 gene locus_tag LOCUS_23850 3864 1891 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259019.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence404 64 1035 gene locus_tag LOCUS_23860 64 1035 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644043.1 protein_id gnl|my_center|LOCUS_23860 2259 1123 gene locus_tag LOCUS_23870 2259 1123 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_23870 2524 3516 gene locus_tag LOCUS_23880 2524 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 3545 4429 gene locus_tag LOCUS_23890 3545 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence405 <1 1226 gene locus_tag LOCUS_23900 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775953.1:extracellular solute-binding protein 1305 2243 gene locus_tag LOCUS_23910 1305 2243 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_23910 2271 3104 gene locus_tag LOCUS_23920 2271 3104 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775955.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence406 >Feature sequence407 646 894 gene locus_tag LOCUS_23930 646 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2362 1718 gene locus_tag LOCUS_23940 2362 1718 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187868.1 protein_id gnl|my_center|LOCUS_23940 3496 2657 gene locus_tag LOCUS_23950 3496 2657 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066795948.1 protein_id gnl|my_center|LOCUS_23950 <4430 3503 gene locus_tag LOCUS_23960 <4430 3503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523315.1:glycosyltransferase family 1 protein >Feature sequence408 <1 1473 gene locus_tag LOCUS_23970 <1 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257930.1:ATP-binding protein 1473 2204 gene locus_tag LOCUS_23980 1473 2204 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_23980 2218 3204 gene locus_tag LOCUS_23990 2218 3204 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837553.1 protein_id gnl|my_center|LOCUS_23990 3496 4032 gene locus_tag LOCUS_24000 3496 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 4038 4370 gene locus_tag LOCUS_24010 4038 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence409 <1 1220 gene locus_tag LOCUS_24020 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259232.1:acetoacetate--CoA ligase 1970 1314 gene locus_tag LOCUS_24030 1970 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2683 1997 gene locus_tag LOCUS_24040 2683 1997 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775429.1 protein_id gnl|my_center|LOCUS_24040 3597 2761 gene locus_tag LOCUS_24050 3597 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 <4422 3663 gene locus_tag LOCUS_24060 <4422 3663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966352.1:glycosyltransferase family 4 protein >Feature sequence410 613 416 gene locus_tag LOCUS_24070 613 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1017 2132 gene locus_tag LOCUS_24080 1017 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2222 3676 gene locus_tag LOCUS_24090 2222 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 3861 4364 gene locus_tag LOCUS_24100 3861 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 >Feature sequence411 2286 3143 gene locus_tag LOCUS_24110 2286 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 4391 3171 gene locus_tag LOCUS_24120 4391 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence412 <1 1013 gene locus_tag LOCUS_24130 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056887.1:sulfate adenylyltransferase 1216 2268 gene locus_tag LOCUS_24140 1216 2268 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_24140 2287 2883 gene locus_tag LOCUS_24150 2287 2883 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_24150 3813 2893 gene locus_tag LOCUS_24160 3813 2893 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence413 1 879 gene locus_tag LOCUS_24170 1 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 967 1374 gene locus_tag LOCUS_24180 967 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 3293 2145 gene locus_tag LOCUS_24190 3293 2145 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_24190 3779 3399 gene locus_tag LOCUS_24200 3779 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 <4410 3851 gene locus_tag LOCUS_24210 <4410 3851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence414 64 1821 gene locus_tag LOCUS_24220 64 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 2785 1880 gene locus_tag LOCUS_24230 2785 1880 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence415 975 1502 gene locus_tag LOCUS_24240 gene uraD 975 1502 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640536.1 protein_id gnl|my_center|LOCUS_24240 1624 2562 gene locus_tag LOCUS_24250 1624 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 2620 2997 gene locus_tag LOCUS_24260 gene uraH 2620 2997 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521222.1 protein_id gnl|my_center|LOCUS_24260 3164 4255 gene locus_tag LOCUS_24270 3164 4255 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966724.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence416 784 146 gene locus_tag LOCUS_24280 gene rimI 784 146 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258576.1 protein_id gnl|my_center|LOCUS_24280 1604 768 gene locus_tag LOCUS_24290 1604 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2130 1585 gene locus_tag LOCUS_24300 gene tsaE 2130 1585 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049642.1 protein_id gnl|my_center|LOCUS_24300 2359 3288 gene locus_tag LOCUS_24310 2359 3288 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085299.1 protein_id gnl|my_center|LOCUS_24310 3874 3341 gene locus_tag LOCUS_24320 3874 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 4338 3949 gene locus_tag LOCUS_24330 4338 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence417 1175 2347 gene locus_tag LOCUS_24340 1175 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2478 3161 gene locus_tag LOCUS_24350 2478 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 3539 3387 gene locus_tag LOCUS_24360 3539 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 <4401 3564 gene locus_tag LOCUS_24370 <4401 3564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225065.1:polysulfide reductase NrfD >Feature sequence418 299 1312 gene locus_tag LOCUS_24380 299 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 1315 1497 gene locus_tag LOCUS_24390 1315 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 1593 1814 gene locus_tag LOCUS_24400 1593 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1829 2068 gene locus_tag LOCUS_24410 1829 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2093 2440 gene locus_tag LOCUS_24420 2093 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2457 3104 gene locus_tag LOCUS_24430 2457 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 3183 4199 gene locus_tag LOCUS_24440 3183 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence419 2617 3108 gene locus_tag LOCUS_24450 2617 3108 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243655.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence420 349 579 gene locus_tag LOCUS_24460 349 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 941 1984 gene locus_tag LOCUS_24470 941 1984 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_24470 2886 1981 gene locus_tag LOCUS_24480 2886 1981 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_24480 3093 2902 gene locus_tag LOCUS_24490 3093 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 3225 3866 gene locus_tag LOCUS_24500 3225 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence421 1780 797 gene locus_tag LOCUS_24510 gene gluQRS 1780 797 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_24510 2534 1866 gene locus_tag LOCUS_24520 2534 1866 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_24520 3841 2531 gene locus_tag LOCUS_24530 gene rlmD 3841 2531 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence422 <1 1367 gene locus_tag LOCUS_24540 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870567.1:nucleotide sugar dehydrogenase 1372 1911 gene locus_tag LOCUS_24550 1372 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 1957 2274 gene locus_tag LOCUS_24560 1957 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2274 2738 gene locus_tag LOCUS_24570 2274 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 3238 3684 gene locus_tag LOCUS_24580 gene dtd 3238 3684 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence423 225 614 gene locus_tag LOCUS_24590 gene zntR 225 614 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215702.1 protein_id gnl|my_center|LOCUS_24590 685 888 gene locus_tag LOCUS_24600 685 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 1931 954 gene locus_tag LOCUS_24610 1931 954 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256277.1 protein_id gnl|my_center|LOCUS_24610 3223 1961 gene locus_tag LOCUS_24620 3223 1961 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191282.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence424 3399 2155 gene locus_tag LOCUS_24630 3399 2155 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097941129.1 protein_id gnl|my_center|LOCUS_24630 3701 3579 gene locus_tag LOCUS_24640 3701 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence425 <1 1270 gene locus_tag LOCUS_24650 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141175.1:NB-ARC domain-containing protein 2554 1292 gene locus_tag LOCUS_24660 2554 1292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_24660 3159 4304 gene locus_tag LOCUS_24670 3159 4304 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence426 145 555 gene locus_tag LOCUS_24680 145 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 563 949 gene locus_tag LOCUS_24690 563 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1662 1060 gene locus_tag LOCUS_24700 1662 1060 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941226.1 protein_id gnl|my_center|LOCUS_24700 2308 3048 gene locus_tag LOCUS_24710 2308 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence427 120 326 gene locus_tag LOCUS_24720 120 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 3453 358 gene locus_tag LOCUS_24730 3453 358 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_24730 4118 3501 gene locus_tag LOCUS_24740 gene rdgB 4118 3501 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256394.1 protein_id gnl|my_center|LOCUS_24740 >Feature sequence428 432 1934 gene locus_tag LOCUS_24750 gene hisZ 432 1934 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257149.1 protein_id gnl|my_center|LOCUS_24750 1935 3014 gene locus_tag LOCUS_24760 gene hisG 1935 3014 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257147.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence429 505 432 gene locus_tag LOCUS_t00150 505 432 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 912 839 gene locus_tag LOCUS_t00160 912 839 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2121 973 gene locus_tag LOCUS_24770 2121 973 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706990.1 protein_id gnl|my_center|LOCUS_24770 2659 2126 gene locus_tag LOCUS_24780 2659 2126 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709765.1 protein_id gnl|my_center|LOCUS_24780 2889 3149 gene locus_tag LOCUS_24790 2889 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 3146 3568 gene locus_tag LOCUS_24800 3146 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence430 870 2387 gene locus_tag LOCUS_24810 870 2387 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_24810 3808 2477 gene locus_tag LOCUS_24820 3808 2477 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546372.1 protein_id gnl|my_center|LOCUS_24820 2559 2568 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence431 <1 609 gene locus_tag LOCUS_24830 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140106.1:4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase 634 792 gene locus_tag LOCUS_24840 634 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 931 758 gene locus_tag LOCUS_24850 931 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 973 1617 gene locus_tag LOCUS_24860 973 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 1641 2807 gene locus_tag LOCUS_24870 gene waaF 1641 2807 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_24870 2804 4036 gene locus_tag LOCUS_24880 2804 4036 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257829.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence432 819 1370 gene locus_tag LOCUS_24890 819 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 1749 1345 gene locus_tag LOCUS_24900 1749 1345 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 protein_id gnl|my_center|LOCUS_24900 1976 1812 gene locus_tag LOCUS_24910 1976 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 2462 2013 gene locus_tag LOCUS_24920 2462 2013 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276952.1 protein_id gnl|my_center|LOCUS_24920 4056 2491 gene locus_tag LOCUS_24930 4056 2491 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence433 1438 536 gene locus_tag LOCUS_24940 1438 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 2135 1578 gene locus_tag LOCUS_24950 2135 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 1934 1943 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3070 2441 gene locus_tag LOCUS_24960 3070 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3633 3136 gene locus_tag LOCUS_24970 3633 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence434 536 132 gene locus_tag LOCUS_24980 gene mce 536 132 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867372.1 protein_id gnl|my_center|LOCUS_24980 1139 576 gene locus_tag LOCUS_24990 1139 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence435 194 697 gene locus_tag LOCUS_25000 194 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 895 1503 gene locus_tag LOCUS_25010 895 1503 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444156.1 protein_id gnl|my_center|LOCUS_25010 2261 1581 gene locus_tag LOCUS_25020 2261 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 <4296 2409 gene locus_tag LOCUS_25030 <4296 2409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257660.1:tetratricopeptide repeat protein >Feature sequence436 1380 799 gene locus_tag LOCUS_25040 1380 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1634 3532 gene locus_tag LOCUS_25050 1634 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 3529 3783 gene locus_tag LOCUS_25060 3529 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence437 1014 532 gene locus_tag LOCUS_25070 1014 532 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337321.1 protein_id gnl|my_center|LOCUS_25070 1259 1107 gene locus_tag LOCUS_25080 1259 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 1576 1259 gene locus_tag LOCUS_25090 1576 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2249 1692 gene locus_tag LOCUS_25100 2249 1692 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140313.1 protein_id gnl|my_center|LOCUS_25100 3083 2523 gene locus_tag LOCUS_25110 3083 2523 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140313.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence438 1388 702 gene locus_tag LOCUS_25120 1388 702 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_25120 3005 2391 gene locus_tag LOCUS_25130 3005 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 3223 3008 gene locus_tag LOCUS_25140 3223 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 3511 3804 gene locus_tag LOCUS_25150 3511 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence439 36 407 gene locus_tag LOCUS_25160 36 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 612 815 gene locus_tag LOCUS_25170 612 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 1761 958 gene locus_tag LOCUS_25180 1761 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2095 2766 gene locus_tag LOCUS_25190 2095 2766 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_25190 2949 4151 gene locus_tag LOCUS_25200 2949 4151 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968370.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence440 1037 105 gene locus_tag LOCUS_25210 1037 105 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 protein_id gnl|my_center|LOCUS_25210 1331 3469 gene locus_tag LOCUS_25220 gene pulA 1331 3469 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082389.1 protein_id gnl|my_center|LOCUS_25220 <4270 3524 gene locus_tag LOCUS_25230 <4270 3524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257665.1:L-glutamate gamma-semialdehyde dehydrogenase >Feature sequence441 1771 581 gene locus_tag LOCUS_25240 1771 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 1956 2123 gene locus_tag LOCUS_25250 1956 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2110 2964 gene locus_tag LOCUS_25260 2110 2964 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228939.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence442 146 745 gene locus_tag LOCUS_25270 gene purE 146 745 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056214.1 protein_id gnl|my_center|LOCUS_25270 943 1290 gene locus_tag LOCUS_25280 943 1290 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227633.1 protein_id gnl|my_center|LOCUS_25280 1293 1703 gene locus_tag LOCUS_25290 1293 1703 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_25290 1745 2080 gene locus_tag LOCUS_25300 1745 2080 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_25300 3585 2242 gene locus_tag LOCUS_25310 3585 2242 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence443 2294 603 gene locus_tag LOCUS_25320 2294 603 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272451.1 protein_id gnl|my_center|LOCUS_25320 2735 2337 gene locus_tag LOCUS_25330 2735 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 2935 3132 gene locus_tag LOCUS_25340 gene rpmB 2935 3132 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938507.1 protein_id gnl|my_center|LOCUS_25340 <4259 3245 gene locus_tag LOCUS_25350 <4259 3245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545924.1:acyl--CoA ligase >Feature sequence444 215 2137 gene locus_tag LOCUS_25360 215 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2988 2215 gene locus_tag LOCUS_25370 2988 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence445 719 1387 gene locus_tag LOCUS_25380 719 1387 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 protein_id gnl|my_center|LOCUS_25380 1926 1405 gene locus_tag LOCUS_25390 1926 1405 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257236.1 protein_id gnl|my_center|LOCUS_25390 3581 2013 gene locus_tag LOCUS_25400 3581 2013 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257231.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence446 556 92 gene locus_tag LOCUS_25410 gene greA 556 92 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_25410 1495 623 gene locus_tag LOCUS_25420 1495 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2715 2915 gene locus_tag LOCUS_25430 2715 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence447 533 138 gene locus_tag LOCUS_25440 533 138 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727319.1 protein_id gnl|my_center|LOCUS_25440 858 1721 gene locus_tag LOCUS_25450 gene dinD 858 1721 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 protein_id gnl|my_center|LOCUS_25450 2065 1763 gene locus_tag LOCUS_25460 2065 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 3669 2245 gene locus_tag LOCUS_25470 3669 2245 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_25470 4223 3852 gene locus_tag LOCUS_25480 4223 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence448 137 907 gene locus_tag LOCUS_25490 137 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 1074 1727 gene locus_tag LOCUS_25500 1074 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 2123 1800 gene locus_tag LOCUS_25510 2123 1800 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256599.1 protein_id gnl|my_center|LOCUS_25510 2344 3042 gene locus_tag LOCUS_25520 2344 3042 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence449 1017 757 gene locus_tag LOCUS_25530 1017 757 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_25530 2873 1146 gene locus_tag LOCUS_25540 2873 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 4167 3109 gene locus_tag LOCUS_25550 4167 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence450 <1 903 gene locus_tag LOCUS_25560 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978319.1:CYTH and CHAD domain-containing protein note possible pseudo, internal stop codon, frameshifted 903 1490 gene locus_tag LOCUS_25570 903 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 1487 2128 gene locus_tag LOCUS_25580 1487 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 3119 2211 gene locus_tag LOCUS_25590 3119 2211 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222502.1 protein_id gnl|my_center|LOCUS_25590 <4209 3289 gene locus_tag LOCUS_25600 <4209 3289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245490.1:ATPase YjoB >Feature sequence451 1424 960 gene locus_tag LOCUS_25610 1424 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 1792 1454 gene locus_tag LOCUS_25620 1792 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2721 1867 gene locus_tag LOCUS_25630 2721 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3798 2755 gene locus_tag LOCUS_25640 3798 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence452 46 633 gene locus_tag LOCUS_25650 46 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 1072 2274 gene locus_tag LOCUS_25660 1072 2274 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230385.1 protein_id gnl|my_center|LOCUS_25660 2478 3842 gene locus_tag LOCUS_25670 gene lpdA 2478 3842 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_25670 >Feature sequence453 1369 116 gene locus_tag LOCUS_25680 1369 116 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869034.1 protein_id gnl|my_center|LOCUS_25680 2587 1409 gene locus_tag LOCUS_25690 2587 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence454 767 177 gene locus_tag LOCUS_25700 767 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 1257 865 gene locus_tag LOCUS_25710 1257 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 1667 1281 gene locus_tag LOCUS_25720 1667 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2325 2110 gene locus_tag LOCUS_25730 2325 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 3703 2309 gene locus_tag LOCUS_25740 3703 2309 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223556.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence455 407 1960 gene locus_tag LOCUS_25750 gene crtI 407 1960 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_25750 2328 2624 gene locus_tag LOCUS_25760 2328 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2684 4063 gene locus_tag LOCUS_25770 2684 4063 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence456 351 1622 gene locus_tag LOCUS_25780 351 1622 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 protein_id gnl|my_center|LOCUS_25780 3000 1693 gene locus_tag LOCUS_25790 3000 1693 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992353.1 protein_id gnl|my_center|LOCUS_25790 <4168 3055 gene locus_tag LOCUS_25800 <4168 3055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928673.1:glycosyltransferase >Feature sequence457 990 649 gene locus_tag LOCUS_25810 990 649 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090236.1 protein_id gnl|my_center|LOCUS_25810 1559 990 gene locus_tag LOCUS_25820 1559 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1826 2062 gene locus_tag LOCUS_25830 1826 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 3326 2124 gene locus_tag LOCUS_25840 gene rlmI 3326 2124 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170850.1 protein_id gnl|my_center|LOCUS_25840 <4167 3559 gene locus_tag LOCUS_25850 <4167 3559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186147.1:glycoside hydrolase family 15 protein >Feature sequence458 <1 796 gene locus_tag LOCUS_25860 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224955.1:aldo/keto reductase 914 1744 gene locus_tag LOCUS_25870 914 1744 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_25870 1788 2807 gene locus_tag LOCUS_25880 1788 2807 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence459 793 62 gene locus_tag LOCUS_25890 793 62 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_25890 1061 1723 gene locus_tag LOCUS_25900 1061 1723 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552750.1 protein_id gnl|my_center|LOCUS_25900 2264 1788 gene locus_tag LOCUS_25910 2264 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 3314 2283 gene locus_tag LOCUS_25920 3314 2283 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_25920 3975 3307 gene locus_tag LOCUS_25930 3975 3307 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence460 858 2387 gene locus_tag LOCUS_25940 gene rpsA 858 2387 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence461 515 393 gene locus_tag LOCUS_25950 515 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 1996 551 gene locus_tag LOCUS_25960 1996 551 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942946.1 protein_id gnl|my_center|LOCUS_25960 2617 2222 gene locus_tag LOCUS_25970 2617 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2856 3671 gene locus_tag LOCUS_25980 2856 3671 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403095.1 protein_id gnl|my_center|LOCUS_25980 3988 3692 gene locus_tag LOCUS_25990 3988 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 >Feature sequence462 1671 562 gene locus_tag LOCUS_26000 1671 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2258 1683 gene locus_tag LOCUS_26010 2258 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 3211 2435 gene locus_tag LOCUS_26020 3211 2435 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948022.1 protein_id gnl|my_center|LOCUS_26020 4124 3195 gene locus_tag LOCUS_26030 4124 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence463 3217 872 gene locus_tag LOCUS_26040 3217 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3388 3251 gene locus_tag LOCUS_26050 3388 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence464 272 1450 gene locus_tag LOCUS_26060 272 1450 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421599.1 protein_id gnl|my_center|LOCUS_26060 1469 1951 gene locus_tag LOCUS_26070 1469 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 1959 2540 gene locus_tag LOCUS_26080 1959 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2682 2885 gene locus_tag LOCUS_26090 2682 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2966 3319 gene locus_tag LOCUS_26100 2966 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 3316 3702 gene locus_tag LOCUS_26110 3316 3702 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391728.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence465 <1 1053 gene locus_tag LOCUS_26120 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989870.1:alpha-mannosidase 1233 2159 gene locus_tag LOCUS_26130 1233 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2159 3448 gene locus_tag LOCUS_26140 2159 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 3564 4028 gene locus_tag LOCUS_26150 3564 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence466 657 1709 gene locus_tag LOCUS_26160 gene rsgA 657 1709 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_26160 1724 3325 gene locus_tag LOCUS_26170 1724 3325 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229206.1 protein_id gnl|my_center|LOCUS_26170 <4110 3261 gene locus_tag LOCUS_26180 <4110 3261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256909.1:L-seryl-tRNA(Sec) selenium transferase >Feature sequence467 532 2166 gene locus_tag LOCUS_26190 532 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2197 3426 gene locus_tag LOCUS_26200 2197 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 <4106 3488 gene locus_tag LOCUS_26210 <4106 3488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256879.1:glycosyltransferase family 4 protein >Feature sequence468 211 20 gene locus_tag LOCUS_26220 211 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 745 239 gene locus_tag LOCUS_26230 745 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1680 928 gene locus_tag LOCUS_26240 1680 928 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_26240 <4106 1718 gene locus_tag LOCUS_26250 <4106 1718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257930.1:ATP-binding protein >Feature sequence469 989 81 gene locus_tag LOCUS_26260 989 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 3556 1130 gene locus_tag LOCUS_26270 3556 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence470 1386 1144 gene locus_tag LOCUS_26280 1386 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 1689 1495 gene locus_tag LOCUS_26290 1689 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 >Feature sequence471 3070 608 gene locus_tag LOCUS_26300 3070 608 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_26300 3928 3143 gene locus_tag LOCUS_26310 3928 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26310 >Feature sequence472 447 28 gene locus_tag LOCUS_26320 447 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 679 1128 gene locus_tag LOCUS_26330 679 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1554 1309 gene locus_tag LOCUS_26340 1554 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 2555 1746 gene locus_tag LOCUS_26350 2555 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 4069 2588 gene locus_tag LOCUS_26360 4069 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence473 373 2238 gene locus_tag LOCUS_26370 373 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2925 2323 gene locus_tag LOCUS_26380 2925 2323 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789900.1 protein_id gnl|my_center|LOCUS_26380 3164 3955 gene locus_tag LOCUS_26390 3164 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence474 608 1510 gene locus_tag LOCUS_26400 608 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2144 1548 gene locus_tag LOCUS_26410 gene aat 2144 1548 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141036.1 protein_id gnl|my_center|LOCUS_26410 3838 2192 gene locus_tag LOCUS_26420 3838 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence475 1138 3213 gene locus_tag LOCUS_26430 1138 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence476 1533 940 gene locus_tag LOCUS_26440 1533 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2405 1536 gene locus_tag LOCUS_26450 2405 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 4074 2428 gene locus_tag LOCUS_26460 4074 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence477 298 687 gene locus_tag LOCUS_26470 298 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 696 1553 gene locus_tag LOCUS_26480 696 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1550 1858 gene locus_tag LOCUS_26490 1550 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1917 2876 gene locus_tag LOCUS_26500 1917 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 2931 3446 gene locus_tag LOCUS_26510 2931 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 3493 3948 gene locus_tag LOCUS_26520 3493 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence478 783 1487 gene locus_tag LOCUS_26530 783 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 1515 2435 gene locus_tag LOCUS_26540 1515 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 3302 2445 gene locus_tag LOCUS_26550 3302 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 <4058 3407 gene locus_tag LOCUS_26560 <4058 3407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742064.1:SAM-dependent methyltransferase >Feature sequence479 2005 1151 gene locus_tag LOCUS_26570 2005 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 2213 2806 gene locus_tag LOCUS_26580 2213 2806 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222250.1 protein_id gnl|my_center|LOCUS_26580 2824 3270 gene locus_tag LOCUS_26590 2824 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 <4054 3267 gene locus_tag LOCUS_26600 <4054 3267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003355958.1:CBS domain-containing protein >Feature sequence480 855 1841 gene locus_tag LOCUS_26610 855 1841 CDS product DUF346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948130.1 protein_id gnl|my_center|LOCUS_26610 1968 2456 gene locus_tag LOCUS_26620 1968 2456 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_26620 2745 2584 gene locus_tag LOCUS_26630 2745 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence481 272 1204 gene locus_tag LOCUS_26640 272 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1462 2475 gene locus_tag LOCUS_26650 gene gap 1462 2475 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_26650 2578 3771 gene locus_tag LOCUS_26660 2578 3771 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence482 824 147 gene locus_tag LOCUS_26670 824 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1481 1170 gene locus_tag LOCUS_26680 1481 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1880 1563 gene locus_tag LOCUS_26690 1880 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 2145 1897 gene locus_tag LOCUS_26700 2145 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2487 2155 gene locus_tag LOCUS_26710 2487 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2927 2547 gene locus_tag LOCUS_26720 2927 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 3336 2815 gene locus_tag LOCUS_26730 3336 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence483 >Feature sequence484 1768 416 gene locus_tag LOCUS_26740 1768 416 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259400.1 protein_id gnl|my_center|LOCUS_26740 2167 1850 gene locus_tag LOCUS_26750 2167 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 3673 2303 gene locus_tag LOCUS_26760 3673 2303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932623.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence485 2146 755 gene locus_tag LOCUS_26770 2146 755 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460075.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence486 <1 1475 gene locus_tag LOCUS_26780 <1 1475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205769.1:cytochrome P450 1629 3047 gene locus_tag LOCUS_26790 1629 3047 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839029.1 protein_id gnl|my_center|LOCUS_26790 3863 3273 gene locus_tag LOCUS_26800 3863 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence487 1241 546 gene locus_tag LOCUS_26810 1241 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3037 1436 gene locus_tag LOCUS_26820 3037 1436 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_26820 3626 3222 gene locus_tag LOCUS_26830 3626 3222 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525746.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence488 1982 2662 gene locus_tag LOCUS_26840 1982 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 2695 3474 gene locus_tag LOCUS_26850 2695 3474 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_26850 3622 3512 gene locus_tag LOCUS_r00020 3622 3512 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3742 3668 gene locus_tag LOCUS_t00170 3742 3668 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3859 3782 gene locus_tag LOCUS_t00180 3859 3782 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence489 77 697 gene locus_tag LOCUS_26860 77 697 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_26860 986 1621 gene locus_tag LOCUS_26870 986 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2029 2655 gene locus_tag LOCUS_26880 2029 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 3062 2784 gene locus_tag LOCUS_26890 3062 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence490 613 341 gene locus_tag LOCUS_26900 613 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1688 1110 gene locus_tag LOCUS_26910 1688 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2679 1777 gene locus_tag LOCUS_26920 2679 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 <3997 2676 gene locus_tag LOCUS_26930 <3997 2676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258102.1:MurT ligase domain-containing protein >Feature sequence491 446 455 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 743 1963 gene locus_tag LOCUS_26940 743 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3236 1989 gene locus_tag LOCUS_26950 3236 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence492 135 890 gene locus_tag LOCUS_26960 gene rplD 135 890 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966411.1 protein_id gnl|my_center|LOCUS_26960 931 1227 gene locus_tag LOCUS_26970 gene rplW 931 1227 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_26970 1242 2075 gene locus_tag LOCUS_26980 gene rplB 1242 2075 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258234.1 protein_id gnl|my_center|LOCUS_26980 2079 2366 gene locus_tag LOCUS_26990 gene rpsS 2079 2366 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933838.1 protein_id gnl|my_center|LOCUS_26990 2474 2824 gene locus_tag LOCUS_27000 gene rplV 2474 2824 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence493 1722 1015 gene locus_tag LOCUS_27010 1722 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 1972 3075 gene locus_tag LOCUS_27020 gene hppD 1972 3075 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence494 <1 928 gene locus_tag LOCUS_27030 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256342.1:folylpolyglutamate synthase/dihydrofolate synthase family protein 2790 925 gene locus_tag LOCUS_27040 2790 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 3009 3485 gene locus_tag LOCUS_27050 3009 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence495 1701 2603 gene locus_tag LOCUS_27060 1701 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3060 2755 gene locus_tag LOCUS_27070 3060 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 3476 3153 gene locus_tag LOCUS_27080 3476 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 3876 3469 gene locus_tag LOCUS_27090 3876 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence496 620 2872 gene locus_tag LOCUS_27100 620 2872 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391709.1 protein_id gnl|my_center|LOCUS_27100 3656 3021 gene locus_tag LOCUS_27110 3656 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence497 1876 572 gene locus_tag LOCUS_27120 1876 572 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_27120 2671 1907 gene locus_tag LOCUS_27130 2671 1907 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_27130 <3939 2734 gene locus_tag LOCUS_27140 <3939 2734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531072.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence498 2607 1087 gene locus_tag LOCUS_27150 gene hpaE 2607 1087 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173038.1 protein_id gnl|my_center|LOCUS_27150 3388 2618 gene locus_tag LOCUS_27160 3388 2618 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889485.1 protein_id gnl|my_center|LOCUS_27160 <3930 3403 gene locus_tag LOCUS_27170 <3930 3403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144460629.1:2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase >Feature sequence499 333 467 gene locus_tag LOCUS_27180 333 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 1188 595 gene locus_tag LOCUS_27190 1188 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 <3919 1369 gene locus_tag LOCUS_27200 <3919 1369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906004.1:alpha-mannosidase >Feature sequence500 >Feature sequence501 1342 686 gene locus_tag LOCUS_27210 1342 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 1660 1421 gene locus_tag LOCUS_27220 1660 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 1884 1660 gene locus_tag LOCUS_27230 1884 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 2169 1930 gene locus_tag LOCUS_27240 2169 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 2719 2135 gene locus_tag LOCUS_27250 2719 2135 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_27250 3292 2750 gene locus_tag LOCUS_27260 3292 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 >Feature sequence502 1253 381 gene locus_tag LOCUS_27270 1253 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 1935 1456 gene locus_tag LOCUS_27280 1935 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 3526 3849 gene locus_tag LOCUS_27290 3526 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence503 226 567 gene locus_tag LOCUS_27300 226 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 1584 604 gene locus_tag LOCUS_27310 1584 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 2131 1577 gene locus_tag LOCUS_27320 2131 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 3771 2344 gene locus_tag LOCUS_27330 3771 2344 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259723.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence504 279 1052 gene locus_tag LOCUS_27340 279 1052 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_27340 1288 2421 gene locus_tag LOCUS_27350 1288 2421 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142948.1 protein_id gnl|my_center|LOCUS_27350 2489 2743 gene locus_tag LOCUS_27360 2489 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence505 1391 2329 gene locus_tag LOCUS_27370 gene miaA 1391 2329 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_27370 2378 2599 gene locus_tag LOCUS_27380 2378 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 2636 2893 gene locus_tag LOCUS_27390 2636 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2939 3181 gene locus_tag LOCUS_27400 2939 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 3510 3259 gene locus_tag LOCUS_27410 3510 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence506 140 12 gene locus_tag LOCUS_27420 140 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 244 110 gene locus_tag LOCUS_27430 244 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1466 486 gene locus_tag LOCUS_27440 1466 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 1800 2228 gene locus_tag LOCUS_27450 1800 2228 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217080.1 protein_id gnl|my_center|LOCUS_27450 2393 3055 gene locus_tag LOCUS_27460 gene recX 2393 3055 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243354.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence507 405 1079 gene locus_tag LOCUS_27470 405 1079 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733273.1 protein_id gnl|my_center|LOCUS_27470 1403 1095 gene locus_tag LOCUS_27480 1403 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 1843 1502 gene locus_tag LOCUS_27490 1843 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence508 <1 794 gene locus_tag LOCUS_27500 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808140.1:FAD-dependent oxidoreductase 1923 934 gene locus_tag LOCUS_27510 1923 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 2383 2135 gene locus_tag LOCUS_27520 2383 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 2890 2387 gene locus_tag LOCUS_27530 2890 2387 CDS product glycine/sarcosine/betaine reductase selenoprotein B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255959.1 protein_id gnl|my_center|LOCUS_27530 3332 2913 gene locus_tag LOCUS_27540 3332 2913 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence509 1592 801 gene locus_tag LOCUS_27550 1592 801 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226684.1 protein_id gnl|my_center|LOCUS_27550 2895 1702 gene locus_tag LOCUS_27560 2895 1702 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226683.1 protein_id gnl|my_center|LOCUS_27560 3676 3044 gene locus_tag LOCUS_27570 3676 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence510 349 1092 gene locus_tag LOCUS_27580 349 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 1089 1781 gene locus_tag LOCUS_27590 1089 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 2683 3258 gene locus_tag LOCUS_27600 2683 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence511 311 1018 gene locus_tag LOCUS_27610 311 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 1040 2902 gene locus_tag LOCUS_27620 1040 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 3066 3851 gene locus_tag LOCUS_27630 3066 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence512 >Feature sequence513 1568 1975 gene locus_tag LOCUS_27640 1568 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 2813 2115 gene locus_tag LOCUS_27650 2813 2115 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258485.1 protein_id gnl|my_center|LOCUS_27650 3660 3076 gene locus_tag LOCUS_27660 3660 3076 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257926.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence514 1481 684 gene locus_tag LOCUS_27670 1481 684 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805028.1 protein_id gnl|my_center|LOCUS_27670 1748 2932 gene locus_tag LOCUS_27680 1748 2932 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024453.1 protein_id gnl|my_center|LOCUS_27680 <3851 3046 gene locus_tag LOCUS_27690 <3851 3046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392987.1:ATP-binding protein >Feature sequence515 2267 333 gene locus_tag LOCUS_27700 2267 333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_27700 2693 2280 gene locus_tag LOCUS_27710 2693 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 <3848 2856 gene locus_tag LOCUS_27720 <3848 2856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003892203.1:glucose-6-phosphate dehydrogenase (coenzyme-F420) >Feature sequence516 1405 917 gene locus_tag LOCUS_27730 gene leuD 1405 917 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_27730 2683 1436 gene locus_tag LOCUS_27740 gene hacA 2683 1436 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061104.1 protein_id gnl|my_center|LOCUS_27740 <3840 2892 gene locus_tag LOCUS_27750 <3840 2892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173924.1:homocitrate synthase >Feature sequence517 <1 857 gene locus_tag LOCUS_27760 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258698.1:tRNA guanosine(34) transglycosylase Tgt 832 1671 gene locus_tag LOCUS_27770 832 1671 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258699.1 protein_id gnl|my_center|LOCUS_27770 1754 2728 gene locus_tag LOCUS_27780 1754 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence518 753 1337 gene locus_tag LOCUS_27790 753 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 1353 1901 gene locus_tag LOCUS_27800 1353 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2142 1849 gene locus_tag LOCUS_27810 2142 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2303 2932 gene locus_tag LOCUS_27820 2303 2932 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_27820 3452 3021 gene locus_tag LOCUS_27830 3452 3021 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence519 957 1811 gene locus_tag LOCUS_27840 957 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1915 2592 gene locus_tag LOCUS_27850 1915 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 <3813 2624 gene locus_tag LOCUS_27860 <3813 2624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201626303.1:AAA domain-containing protein >Feature sequence520 1023 406 gene locus_tag LOCUS_27870 gene coaE 1023 406 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_27870 1210 2979 gene locus_tag LOCUS_27880 1210 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 <3812 2988 gene locus_tag LOCUS_27890 <3812 2988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256937.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence521 534 22 gene locus_tag LOCUS_27900 534 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 1132 536 gene locus_tag LOCUS_27910 1132 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 1944 1363 gene locus_tag LOCUS_27920 1944 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 <3810 2079 gene locus_tag LOCUS_27930 <3810 2079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169337322.1:IPT/TIG domain-containing protein >Feature sequence522 <1 810 gene locus_tag LOCUS_27940 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811376.1:cell division protein FtsZ 1662 892 gene locus_tag LOCUS_27950 1662 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 2727 1861 gene locus_tag LOCUS_27960 2727 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 3754 2753 gene locus_tag LOCUS_27970 3754 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 >Feature sequence523 <1 1278 gene locus_tag LOCUS_27980 <1 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002485168.1:DHA2 family efflux MFS transporter permease subunit 1646 2818 gene locus_tag LOCUS_27990 1646 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 2868 3266 gene locus_tag LOCUS_28000 2868 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence524 830 1498 gene locus_tag LOCUS_28010 830 1498 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030391327.1 protein_id gnl|my_center|LOCUS_28010 1513 2403 gene locus_tag LOCUS_28020 1513 2403 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 protein_id gnl|my_center|LOCUS_28020 2528 3613 gene locus_tag LOCUS_28030 2528 3613 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825317.1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence525 2004 2804 gene locus_tag LOCUS_28040 2004 2804 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031318.1 protein_id gnl|my_center|LOCUS_28040 3356 2808 gene locus_tag LOCUS_28050 3356 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence526 1177 875 gene locus_tag LOCUS_28060 1177 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 1968 1243 gene locus_tag LOCUS_28070 1968 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 2324 1959 gene locus_tag LOCUS_28080 2324 1959 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151756315.1 protein_id gnl|my_center|LOCUS_28080 <3793 2439 gene locus_tag LOCUS_28090 <3793 2439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258512.1:Stp1/IreP family PP2C-type Ser/Thr phosphatase >Feature sequence527 2065 344 gene locus_tag LOCUS_28100 2065 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2890 2084 gene locus_tag LOCUS_28110 2890 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 3376 3008 gene locus_tag LOCUS_28120 3376 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence528 1891 1136 gene locus_tag LOCUS_28130 1891 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 2075 2818 gene locus_tag LOCUS_28140 2075 2818 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_28140 <3785 2895 gene locus_tag LOCUS_28150 <3785 2895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257858.1:DUF3662 and FHA domain-containing protein >Feature sequence529 298 795 gene locus_tag LOCUS_28160 gene mscL 298 795 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_28160 1010 1543 gene locus_tag LOCUS_28170 1010 1543 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256182.1 protein_id gnl|my_center|LOCUS_28170 2239 1706 gene locus_tag LOCUS_28180 2239 1706 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224353.1 protein_id gnl|my_center|LOCUS_28180 2331 2194 gene locus_tag LOCUS_28190 2331 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 2995 2405 gene locus_tag LOCUS_28200 2995 2405 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_28200 <3782 2998 gene locus_tag LOCUS_28210 <3782 2998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142927.1:argininosuccinate synthase >Feature sequence530 468 1892 gene locus_tag LOCUS_28220 gene der 468 1892 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_28220 2163 3062 gene locus_tag LOCUS_28230 2163 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 >Feature sequence531 >Feature sequence532 73 3411 gene locus_tag LOCUS_28240 73 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence533 7 582 gene locus_tag LOCUS_28250 7 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 579 1187 gene locus_tag LOCUS_28260 579 1187 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205719408.1 protein_id gnl|my_center|LOCUS_28260 1551 2066 gene locus_tag LOCUS_28270 1551 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2246 2094 gene locus_tag LOCUS_28280 2246 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 2437 3462 gene locus_tag LOCUS_28290 2437 3462 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence534 1254 481 gene locus_tag LOCUS_28300 1254 481 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_28300 2085 1570 gene locus_tag LOCUS_28310 2085 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 3516 2275 gene locus_tag LOCUS_28320 3516 2275 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966748.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence535 2 628 gene locus_tag LOCUS_28330 2 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 644 1303 gene locus_tag LOCUS_28340 644 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 1500 2210 gene locus_tag LOCUS_28350 1500 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence536 1414 533 gene locus_tag LOCUS_28360 1414 533 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978567.1 protein_id gnl|my_center|LOCUS_28360 2596 1709 gene locus_tag LOCUS_28370 2596 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 2959 3546 gene locus_tag LOCUS_28380 2959 3546 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964725.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence537 1544 183 gene locus_tag LOCUS_28390 1544 183 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257562.1 protein_id gnl|my_center|LOCUS_28390 2561 1572 gene locus_tag LOCUS_28400 2561 1572 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_28400 3631 2558 gene locus_tag LOCUS_28410 3631 2558 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_28410 >Feature sequence538 2248 2042 gene locus_tag LOCUS_28420 2248 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 2301 3401 gene locus_tag LOCUS_28430 2301 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence539 <1 1286 gene locus_tag LOCUS_28440 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254505.1:peptidylprolyl isomerase 1376 2608 gene locus_tag LOCUS_28450 gene hemW 1376 2608 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence540 729 2183 gene locus_tag LOCUS_28460 729 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 2180 3424 gene locus_tag LOCUS_28470 2180 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence541 1486 437 gene locus_tag LOCUS_28480 gene trpS 1486 437 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057831.1 protein_id gnl|my_center|LOCUS_28480 2916 1978 gene locus_tag LOCUS_28490 2916 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 <3735 3058 gene locus_tag LOCUS_28500 <3735 3058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902312.1:oxidoreductase >Feature sequence542 13 888 gene locus_tag LOCUS_28510 13 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 963 2783 gene locus_tag LOCUS_28520 963 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence543 961 41 gene locus_tag LOCUS_28530 961 41 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483384.1 protein_id gnl|my_center|LOCUS_28530 2434 965 gene locus_tag LOCUS_28540 2434 965 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_28540 3399 2443 gene locus_tag LOCUS_28550 3399 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence544 <1 1255 gene locus_tag LOCUS_28560 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259719.1:isocitrate lyase 1442 3049 gene locus_tag LOCUS_28570 gene aceB 1442 3049 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258821.1 protein_id gnl|my_center|LOCUS_28570 <3687 3108 gene locus_tag LOCUS_28580 <3687 3108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393260.1:threonine--tRNA ligase >Feature sequence545 429 653 gene locus_tag LOCUS_28590 429 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 659 1075 gene locus_tag LOCUS_28600 659 1075 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_28600 1610 1083 gene locus_tag LOCUS_28610 1610 1083 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891579.1 protein_id gnl|my_center|LOCUS_28610 2953 1625 gene locus_tag LOCUS_28620 2953 1625 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_28620 >Feature sequence546 308 1942 gene locus_tag LOCUS_28630 308 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3213 1960 gene locus_tag LOCUS_28640 3213 1960 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence547 537 172 gene locus_tag LOCUS_28650 537 172 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877101.1 protein_id gnl|my_center|LOCUS_28650 944 1885 gene locus_tag LOCUS_28660 944 1885 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144407.1 protein_id gnl|my_center|LOCUS_28660 2025 3107 gene locus_tag LOCUS_28670 gene gap 2025 3107 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861329.1 protein_id gnl|my_center|LOCUS_28670 3346 3636 gene locus_tag LOCUS_28680 3346 3636 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422948.1 protein_id gnl|my_center|LOCUS_28680 >Feature sequence548 822 1892 gene locus_tag LOCUS_28690 822 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 1923 2861 gene locus_tag LOCUS_28700 1923 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 3007 2879 gene locus_tag LOCUS_28710 3007 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 <3676 3004 gene locus_tag LOCUS_28720 <3676 3004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454735.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence549 116 838 gene locus_tag LOCUS_28730 116 838 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_28730 1127 2275 gene locus_tag LOCUS_28740 1127 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2341 3405 gene locus_tag LOCUS_28750 gene ltaE 2341 3405 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258446.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence550 >Feature sequence551 2681 1341 gene locus_tag LOCUS_28760 2681 1341 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 protein_id gnl|my_center|LOCUS_28760 <3656 2873 gene locus_tag LOCUS_28770 <3656 2873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972914.1:ROK family transcriptional regulator >Feature sequence552 1867 194 gene locus_tag LOCUS_28780 1867 194 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_28780 2718 2068 gene locus_tag LOCUS_28790 2718 2068 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_28790 3521 2871 gene locus_tag LOCUS_28800 3521 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence553 867 1154 gene locus_tag LOCUS_28810 867 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1805 1341 gene locus_tag LOCUS_28820 gene ndk 1805 1341 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_28820 2229 1882 gene locus_tag LOCUS_28830 2229 1882 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256591.1 protein_id gnl|my_center|LOCUS_28830 3628 2384 gene locus_tag LOCUS_28840 3628 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 >Feature sequence554 1689 31 gene locus_tag LOCUS_28850 gene glpD 1689 31 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_28850 2852 1869 gene locus_tag LOCUS_28860 2852 1869 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668747.1 protein_id gnl|my_center|LOCUS_28860 <3642 2855 gene locus_tag LOCUS_28870 <3642 2855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012896469.1:glycerol kinase GlpK >Feature sequence555 2242 3399 gene locus_tag LOCUS_28880 2242 3399 CDS product methionine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257764.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence556 1 2406 gene locus_tag LOCUS_28890 gene purL 1 2406 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259203.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence557 948 58 gene locus_tag LOCUS_28900 948 58 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972375.1 protein_id gnl|my_center|LOCUS_28900 1916 945 gene locus_tag LOCUS_28910 1916 945 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031035.1 protein_id gnl|my_center|LOCUS_28910 3370 2015 gene locus_tag LOCUS_28920 3370 2015 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence558 450 1217 gene locus_tag LOCUS_28930 450 1217 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 protein_id gnl|my_center|LOCUS_28930 1286 3274 gene locus_tag LOCUS_28940 1286 3274 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence559 250 1239 gene locus_tag LOCUS_28950 250 1239 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_28950 1269 1946 gene locus_tag LOCUS_28960 1269 1946 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_28960 1943 3403 gene locus_tag LOCUS_28970 1943 3403 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392987.1 protein_id gnl|my_center|LOCUS_28970 >Feature sequence560 1060 461 gene locus_tag LOCUS_28980 1060 461 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_28980 1611 1060 gene locus_tag LOCUS_28990 gene atpF 1611 1060 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787487.1 protein_id gnl|my_center|LOCUS_28990 1999 1739 gene locus_tag LOCUS_29000 1999 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 3037 2123 gene locus_tag LOCUS_29010 gene atpB 3037 2123 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258899.1 protein_id gnl|my_center|LOCUS_29010 3325 3113 gene locus_tag LOCUS_29020 3325 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence561 219 911 gene locus_tag LOCUS_29030 219 911 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880210.1 protein_id gnl|my_center|LOCUS_29030 962 2176 gene locus_tag LOCUS_29040 962 2176 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_29040 2166 3257 gene locus_tag LOCUS_29050 2166 3257 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979941.1 protein_id gnl|my_center|LOCUS_29050 >Feature sequence562 <3619 973 gene locus_tag LOCUS_29060 <3619 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055983.1:SMC family ATPase >Feature sequence563 89 793 gene locus_tag LOCUS_29070 89 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 1715 2668 gene locus_tag LOCUS_29080 1715 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 2878 3114 gene locus_tag LOCUS_29090 2878 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence564 <3614 1397 gene locus_tag LOCUS_29100 <3614 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020572.1:DNA mismatch repair protein MutS >Feature sequence565 >Feature sequence566 3 443 gene locus_tag LOCUS_29110 3 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 2276 462 gene locus_tag LOCUS_29120 2276 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 2913 2269 gene locus_tag LOCUS_29130 2913 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence567 1843 971 gene locus_tag LOCUS_29140 1843 971 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_29140 1950 2933 gene locus_tag LOCUS_29150 1950 2933 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence568 212 475 gene locus_tag LOCUS_29160 212 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 1080 592 gene locus_tag LOCUS_29170 1080 592 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_29170 1285 2712 gene locus_tag LOCUS_29180 1285 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 <3610 2820 gene locus_tag LOCUS_29190 <3610 2820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000783220.1:NAD(P)-dependent oxidoreductase >Feature sequence569 2365 965 gene locus_tag LOCUS_29200 2365 965 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272601.1 protein_id gnl|my_center|LOCUS_29200 3539 2586 gene locus_tag LOCUS_29210 3539 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence570 3508 3320 gene locus_tag LOCUS_29220 3508 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 >Feature sequence571 >Feature sequence572 <1 542 gene locus_tag LOCUS_29230 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525849.1:D-2-hydroxyacid dehydrogenase family protein 547 1617 gene locus_tag LOCUS_29240 gene add 547 1617 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256408.1 protein_id gnl|my_center|LOCUS_29240 1707 1991 gene locus_tag LOCUS_29250 1707 1991 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141965.1 protein_id gnl|my_center|LOCUS_29250 3015 2128 gene locus_tag LOCUS_29260 3015 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 <3591 3035 gene locus_tag LOCUS_29270 <3591 3035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027281.1:diacylglycerol kinase family protein >Feature sequence573 2106 3191 gene locus_tag LOCUS_29280 gene argC 2106 3191 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence574 201 971 gene locus_tag LOCUS_29290 201 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228944.1 protein_id gnl|my_center|LOCUS_29290 1925 1041 gene locus_tag LOCUS_29300 1925 1041 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731143.1 protein_id gnl|my_center|LOCUS_29300 2043 2903 gene locus_tag LOCUS_29310 2043 2903 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768263.1 protein_id gnl|my_center|LOCUS_29310 2907 3425 gene locus_tag LOCUS_29320 2907 3425 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence575 522 1040 gene locus_tag LOCUS_29330 gene accB 522 1040 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259570.1 protein_id gnl|my_center|LOCUS_29330 1041 2309 gene locus_tag LOCUS_29340 gene xseA 1041 2309 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393024.1 protein_id gnl|my_center|LOCUS_29340 2318 2542 gene locus_tag LOCUS_29350 2318 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 2561 3004 gene locus_tag LOCUS_29360 2561 3004 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_29360 3025 3486 gene locus_tag LOCUS_29370 3025 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence576 2 790 gene locus_tag LOCUS_29380 2 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 863 2080 gene locus_tag LOCUS_29390 863 2080 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898850.1 protein_id gnl|my_center|LOCUS_29390 2077 3453 gene locus_tag LOCUS_29400 2077 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence577 1202 459 gene locus_tag LOCUS_29410 1202 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29410 1881 1219 gene locus_tag LOCUS_29420 1881 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29420 1357 1366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2103 3410 gene locus_tag LOCUS_29430 2103 3410 CDS product uracil/xanthine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484506.1 protein_id gnl|my_center|LOCUS_29430 >Feature sequence578 2248 989 gene locus_tag LOCUS_29440 gene rho 2248 989 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_29440 3112 2645 gene locus_tag LOCUS_29450 3112 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence579 2074 3132 gene locus_tag LOCUS_29460 2074 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence580 2309 39 gene locus_tag LOCUS_29470 2309 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence581 1351 527 gene locus_tag LOCUS_29480 1351 527 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_29480 1495 2706 gene locus_tag LOCUS_29490 1495 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 3540 3049 gene locus_tag LOCUS_29500 3540 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 >Feature sequence582 <1 794 gene locus_tag LOCUS_29510 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230385.1:peptidase S8 1110 868 gene locus_tag LOCUS_29520 1110 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 2550 1213 gene locus_tag LOCUS_29530 2550 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038124.1 protein_id gnl|my_center|LOCUS_29530 3374 2547 gene locus_tag LOCUS_29540 3374 2547 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037580.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence583 296 739 gene locus_tag LOCUS_29550 296 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2634 826 gene locus_tag LOCUS_29560 2634 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 2929 3480 gene locus_tag LOCUS_29570 2929 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence584 538 365 gene locus_tag LOCUS_29580 538 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 807 535 gene locus_tag LOCUS_29590 807 535 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_29590 1438 881 gene locus_tag LOCUS_29600 1438 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 1665 3092 gene locus_tag LOCUS_29610 gene gabD 1665 3092 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772866.1 protein_id gnl|my_center|LOCUS_29610 3144 3479 gene locus_tag LOCUS_29620 3144 3479 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_29620 >Feature sequence585 583 795 gene locus_tag LOCUS_29630 583 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 890 1936 gene locus_tag LOCUS_29640 890 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 1940 2791 gene locus_tag LOCUS_29650 1940 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence586 346 1152 gene locus_tag LOCUS_29660 346 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29660 1226 2026 gene locus_tag LOCUS_29670 1226 2026 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890403.1 protein_id gnl|my_center|LOCUS_29670 2399 3352 gene locus_tag LOCUS_29680 2399 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence587 2012 1059 gene locus_tag LOCUS_29690 2012 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence588 337 927 gene locus_tag LOCUS_29700 337 927 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_29700 968 1480 gene locus_tag LOCUS_29710 968 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 1515 1844 gene locus_tag LOCUS_29720 1515 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 3073 1847 gene locus_tag LOCUS_29730 3073 1847 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258538.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence589 809 513 gene locus_tag LOCUS_29740 809 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 1030 1977 gene locus_tag LOCUS_29750 1030 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3308 2091 gene locus_tag LOCUS_29760 3308 2091 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_29760 >Feature sequence590 >Feature sequence591 <3523 185 gene locus_tag LOCUS_29770 <3523 185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257223.1:DUF2298 domain-containing protein >Feature sequence592 2109 916 gene locus_tag LOCUS_29780 2109 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 2931 2149 gene locus_tag LOCUS_29790 2931 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence593 422 1588 gene locus_tag LOCUS_29800 422 1588 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_29800 3075 1570 gene locus_tag LOCUS_29810 3075 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence594 493 930 gene locus_tag LOCUS_29820 493 930 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633552.1 protein_id gnl|my_center|LOCUS_29820 1098 1658 gene locus_tag LOCUS_29830 1098 1658 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615831.1 protein_id gnl|my_center|LOCUS_29830 2277 1711 gene locus_tag LOCUS_29840 gene efp 2277 1711 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258741.1 protein_id gnl|my_center|LOCUS_29840 3374 2325 gene locus_tag LOCUS_29850 3374 2325 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259167.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence595 1301 2455 gene locus_tag LOCUS_29860 1301 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 2577 3158 gene locus_tag LOCUS_29870 2577 3158 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258858.1 protein_id gnl|my_center|LOCUS_29870 >Feature sequence596 740 174 gene locus_tag LOCUS_29880 740 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence597 310 20 gene locus_tag LOCUS_29890 310 20 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257144.1 protein_id gnl|my_center|LOCUS_29890 630 1916 gene locus_tag LOCUS_29900 630 1916 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_29900 2118 2747 gene locus_tag LOCUS_29910 2118 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 2766 3500 gene locus_tag LOCUS_29920 2766 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence598 730 500 gene locus_tag LOCUS_29930 730 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 1795 857 gene locus_tag LOCUS_29940 gene pstA 1795 857 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230103.1 protein_id gnl|my_center|LOCUS_29940 2733 1792 gene locus_tag LOCUS_29950 gene pstC 2733 1792 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398935.1 protein_id gnl|my_center|LOCUS_29950 <3498 2806 gene locus_tag LOCUS_29960 <3498 2806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398774.1:phosphate ABC transporter substrate-binding protein >Feature sequence599 1239 2147 gene locus_tag LOCUS_29970 1239 2147 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_29970 3239 2187 gene locus_tag LOCUS_29980 3239 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 >Feature sequence600 917 15 gene locus_tag LOCUS_29990 gene ftsY 917 15 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_29990 1472 1257 gene locus_tag LOCUS_30000 1472 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 2241 3266 gene locus_tag LOCUS_30010 gene rpoD 2241 3266 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_30010 >Feature sequence601 119 1273 gene locus_tag LOCUS_30020 119 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 2468 1419 gene locus_tag LOCUS_30030 gene ccpA 2468 1419 CDS product LacI family transcriptional regulator CcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888871.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence602 >Feature sequence603 2058 427 gene locus_tag LOCUS_30040 2058 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 3091 2249 gene locus_tag LOCUS_30050 3091 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 >Feature sequence604 2150 1563 gene locus_tag LOCUS_30060 2150 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 2542 2934 gene locus_tag LOCUS_30070 gene sdhC 2542 2934 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727812.1 protein_id gnl|my_center|LOCUS_30070 2961 3383 gene locus_tag LOCUS_30080 2961 3383 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632977.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence605 535 263 gene locus_tag LOCUS_30090 535 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 2031 757 gene locus_tag LOCUS_30100 gene aroA 2031 757 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479628.1 protein_id gnl|my_center|LOCUS_30100 >Feature sequence606 <1 938 gene locus_tag LOCUS_30110 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259448.1:ABC transporter ATP-binding protein 935 1906 gene locus_tag LOCUS_30120 935 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 1926 3086 gene locus_tag LOCUS_30130 gene queG 1926 3086 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245522.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence607 <1 1183 gene locus_tag LOCUS_30140 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460167.1:nickel pincer cofactor biosynthesis protein LarC 1226 1795 gene locus_tag LOCUS_30150 1226 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2146 2607 gene locus_tag LOCUS_30160 2146 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 2638 3108 gene locus_tag LOCUS_30170 2638 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3219 3146 gene locus_tag LOCUS_t00190 3219 3146 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence608 499 1182 gene locus_tag LOCUS_30180 499 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 1331 1864 gene locus_tag LOCUS_30190 1331 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 1929 2117 gene locus_tag LOCUS_30200 gene rpmF 1929 2117 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_30200 2238 3281 gene locus_tag LOCUS_30210 gene fabD 2238 3281 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258269.1 protein_id gnl|my_center|LOCUS_30210 >Feature sequence609 590 336 gene locus_tag LOCUS_30220 590 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 1255 503 gene locus_tag LOCUS_30230 1255 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30230 <3440 1292 gene locus_tag LOCUS_30240 <3440 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246556.1:Tex family protein >Feature sequence610 2016 625 gene locus_tag LOCUS_30250 2016 625 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964170.1 protein_id gnl|my_center|LOCUS_30250 3356 2013 gene locus_tag LOCUS_30260 3356 2013 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948912.1 protein_id gnl|my_center|LOCUS_30260 >Feature sequence611 301 747 gene locus_tag LOCUS_30270 301 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 819 1424 gene locus_tag LOCUS_30280 819 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 1421 3214 gene locus_tag LOCUS_30290 1421 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence612 521 318 gene locus_tag LOCUS_30300 521 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 1766 771 gene locus_tag LOCUS_30310 gene moaA 1766 771 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119704.1 protein_id gnl|my_center|LOCUS_30310 2226 2825 gene locus_tag LOCUS_30320 2226 2825 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393845.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence613 610 404 gene locus_tag LOCUS_30330 610 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 876 1316 gene locus_tag LOCUS_30340 876 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 1388 1316 gene locus_tag LOCUS_t00200 1388 1316 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence614 <1 1217 gene locus_tag LOCUS_30350 <1 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_187263000.1:cytochrome ubiquinol oxidase subunit I 1214 2257 gene locus_tag LOCUS_30360 1214 2257 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_30360 2296 2577 gene locus_tag LOCUS_30370 2296 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 2638 2874 gene locus_tag LOCUS_30380 2638 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence615 2 169 gene locus_tag LOCUS_30390 2 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 865 242 gene locus_tag LOCUS_30400 865 242 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258667.1 protein_id gnl|my_center|LOCUS_30400 1458 877 gene locus_tag LOCUS_30410 1458 877 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582545.1 protein_id gnl|my_center|LOCUS_30410 1672 2268 gene locus_tag LOCUS_30420 1672 2268 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049765998.1 protein_id gnl|my_center|LOCUS_30420 >Feature sequence616 1773 862 gene locus_tag LOCUS_30430 1773 862 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170031.1 protein_id gnl|my_center|LOCUS_30430 3312 1960 gene locus_tag LOCUS_30440 3312 1960 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582573.1 protein_id gnl|my_center|LOCUS_30440 >Feature sequence617 1057 647 gene locus_tag LOCUS_30450 1057 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 1234 2271 gene locus_tag LOCUS_30460 1234 2271 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122968.1 protein_id gnl|my_center|LOCUS_30460 2608 2333 gene locus_tag LOCUS_30470 2608 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 <3396 2704 gene locus_tag LOCUS_30480 <3396 2704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002355137.1:response regulator transcription factor >Feature sequence618 1336 101 gene locus_tag LOCUS_30490 1336 101 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966466.1 protein_id gnl|my_center|LOCUS_30490 2409 1507 gene locus_tag LOCUS_30500 2409 1507 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085464.1 protein_id gnl|my_center|LOCUS_30500 <3391 2545 gene locus_tag LOCUS_30510 <3391 2545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976168.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence619 2786 1053 gene locus_tag LOCUS_30520 2786 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 >Feature sequence620 1271 300 gene locus_tag LOCUS_30530 1271 300 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257127.1 protein_id gnl|my_center|LOCUS_30530 1898 1353 gene locus_tag LOCUS_30540 1898 1353 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_30540 <3388 2020 gene locus_tag LOCUS_30550 <3388 2020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389632.1:pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase >Feature sequence621 2200 584 gene locus_tag LOCUS_30560 2200 584 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660601.1 protein_id gnl|my_center|LOCUS_30560 2524 3246 gene locus_tag LOCUS_30570 2524 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 >Feature sequence622 1675 206 gene locus_tag LOCUS_30580 1675 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 2031 1672 gene locus_tag LOCUS_30590 2031 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 3373 2042 gene locus_tag LOCUS_30600 3373 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence623 439 1350 gene locus_tag LOCUS_30610 439 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 >Feature sequence624 171 503 gene locus_tag LOCUS_30620 171 503 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_30620 670 960 gene locus_tag LOCUS_30630 670 960 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_30630 957 1310 gene locus_tag LOCUS_30640 957 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 1461 2597 gene locus_tag LOCUS_30650 gene coxB 1461 2597 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525141.1 protein_id gnl|my_center|LOCUS_30650 >Feature sequence625 384 1358 gene locus_tag LOCUS_30660 384 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 1549 1944 gene locus_tag LOCUS_30670 1549 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 2176 3291 gene locus_tag LOCUS_30680 2176 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence626 1153 2343 gene locus_tag LOCUS_30690 1153 2343 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_30690 <3369 2548 gene locus_tag LOCUS_30700 <3369 2548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256474.1:FAD/NAD(P)-binding oxidoreductase >Feature sequence627 3301 1082 gene locus_tag LOCUS_30710 3301 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 >Feature sequence628 508 933 gene locus_tag LOCUS_30720 508 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1077 1754 gene locus_tag LOCUS_30730 1077 1754 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_30730 1779 3080 gene locus_tag LOCUS_30740 1779 3080 CDS product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089287.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence629 1604 540 gene locus_tag LOCUS_30750 1604 540 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727242.1 protein_id gnl|my_center|LOCUS_30750 2348 1695 gene locus_tag LOCUS_30760 2348 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 2809 2345 gene locus_tag LOCUS_30770 2809 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence630 1601 2863 gene locus_tag LOCUS_30780 1601 2863 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259674.1 protein_id gnl|my_center|LOCUS_30780 >Feature sequence631 87 2930 gene locus_tag LOCUS_30790 87 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence632 <1 1440 gene locus_tag LOCUS_30800 <1 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257057.1:ATP-binding protein 2569 1544 gene locus_tag LOCUS_30810 2569 1544 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 protein_id gnl|my_center|LOCUS_30810 >Feature sequence633 604 356 gene locus_tag LOCUS_30820 604 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 920 2089 gene locus_tag LOCUS_30830 920 2089 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence634 1334 663 gene locus_tag LOCUS_30840 1334 663 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225648.1 protein_id gnl|my_center|LOCUS_30840 1627 1343 gene locus_tag LOCUS_30850 1627 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 2238 1624 gene locus_tag LOCUS_30860 2238 1624 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225650.1 protein_id gnl|my_center|LOCUS_30860 2653 2381 gene locus_tag LOCUS_30870 2653 2381 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225640.1 protein_id gnl|my_center|LOCUS_30870 <3332 2693 gene locus_tag LOCUS_30880 <3332 2693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258631.1:carbamoyltransferase HypF >Feature sequence635 59 1360 gene locus_tag LOCUS_30890 59 1360 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257976.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence636 <1 883 gene locus_tag LOCUS_30900 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972382.1:flavin-dependent monooxygenase 896 1927 gene locus_tag LOCUS_30910 896 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 1996 2523 gene locus_tag LOCUS_30920 1996 2523 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257236.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence637 1090 2130 gene locus_tag LOCUS_30930 1090 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 2499 2200 gene locus_tag LOCUS_30940 2499 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence638 371 1861 gene locus_tag LOCUS_30950 gene yjeM 371 1861 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986430.1 protein_id gnl|my_center|LOCUS_30950 <3312 1988 gene locus_tag LOCUS_30960 <3312 1988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945999.1:aldehyde dehydrogenase family protein >Feature sequence639 2920 2489 gene locus_tag LOCUS_30970 2920 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 >Feature sequence640 477 749 gene locus_tag LOCUS_30980 477 749 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559268.1 protein_id gnl|my_center|LOCUS_30980 774 1709 gene locus_tag LOCUS_30990 774 1709 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896302.1 protein_id gnl|my_center|LOCUS_30990 1703 2140 gene locus_tag LOCUS_31000 1703 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence641 163 762 gene locus_tag LOCUS_31010 163 762 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113775.1 protein_id gnl|my_center|LOCUS_31010 1755 853 gene locus_tag LOCUS_31020 1755 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 3138 1864 gene locus_tag LOCUS_31030 3138 1864 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence642 1071 2069 gene locus_tag LOCUS_31040 1071 2069 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279153.1 protein_id gnl|my_center|LOCUS_31040 2543 2073 gene locus_tag LOCUS_31050 2543 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 <3283 2633 gene locus_tag LOCUS_31060 <3283 2633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257179.1:DUF92 domain-containing protein >Feature sequence643 1567 578 gene locus_tag LOCUS_31070 1567 578 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460185.1 protein_id gnl|my_center|LOCUS_31070 2720 1776 gene locus_tag LOCUS_31080 2720 1776 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence644 1381 314 gene locus_tag LOCUS_31090 1381 314 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_31090 3000 1483 gene locus_tag LOCUS_31100 3000 1483 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015563.1 protein_id gnl|my_center|LOCUS_31100 >Feature sequence645 2850 1381 gene locus_tag LOCUS_31110 2850 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 >Feature sequence646 <1 714 gene locus_tag LOCUS_31120 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111053.1:catalase 1428 775 gene locus_tag LOCUS_31130 1428 775 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080706.1 protein_id gnl|my_center|LOCUS_31130 2884 1523 gene locus_tag LOCUS_31140 2884 1523 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972472.1 protein_id gnl|my_center|LOCUS_31140 >Feature sequence647 1 213 gene locus_tag LOCUS_31150 1 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 260 583 gene locus_tag LOCUS_31160 260 583 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225569.1 protein_id gnl|my_center|LOCUS_31160 767 2155 gene locus_tag LOCUS_31170 767 2155 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_31170 >Feature sequence648 <1 1956 gene locus_tag LOCUS_31180 <1 1956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258810.1:serine/threonine-protein kinase 2199 2681 gene locus_tag LOCUS_31190 2199 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence649 2725 2090 gene locus_tag LOCUS_31200 2725 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence650 261 854 gene locus_tag LOCUS_31210 261 854 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941226.1 protein_id gnl|my_center|LOCUS_31210 919 1740 gene locus_tag LOCUS_31220 919 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 2667 1735 gene locus_tag LOCUS_31230 2667 1735 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861204.1 protein_id gnl|my_center|LOCUS_31230 3141 2680 gene locus_tag LOCUS_31240 3141 2680 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948159.1 protein_id gnl|my_center|LOCUS_31240 >Feature sequence651 2628 259 gene locus_tag LOCUS_31250 2628 259 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112431835.1 protein_id gnl|my_center|LOCUS_31250 >Feature sequence652 78 905 gene locus_tag LOCUS_31260 78 905 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258918.1 protein_id gnl|my_center|LOCUS_31260 1637 978 gene locus_tag LOCUS_31270 1637 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 1800 2339 gene locus_tag LOCUS_31280 1800 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 <3233 2351 gene locus_tag LOCUS_31290 <3233 2351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228090.1:FAD-dependent thymidylate synthase >Feature sequence653 203 1090 gene locus_tag LOCUS_31300 203 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 1229 1555 gene locus_tag LOCUS_31310 1229 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 1811 2296 gene locus_tag LOCUS_31320 1811 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 <3232 2298 gene locus_tag LOCUS_31330 <3232 2298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020242.1:DUF1786 domain-containing protein >Feature sequence654 852 433 gene locus_tag LOCUS_31340 852 433 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_31340 2791 845 gene locus_tag LOCUS_31350 2791 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 3228 2908 gene locus_tag LOCUS_31360 3228 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence655 553 8 gene locus_tag LOCUS_31370 553 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 1096 863 gene locus_tag LOCUS_31380 1096 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 1419 1126 gene locus_tag LOCUS_31390 1419 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 1730 1416 gene locus_tag LOCUS_31400 1730 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 2092 1733 gene locus_tag LOCUS_31410 2092 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 2407 2111 gene locus_tag LOCUS_31420 2407 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 3033 2431 gene locus_tag LOCUS_31430 3033 2431 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411331.1 protein_id gnl|my_center|LOCUS_31430 >Feature sequence656 <1 894 gene locus_tag LOCUS_31440 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142714.1:ABC transporter ATP-binding protein 1318 1028 gene locus_tag LOCUS_31450 1318 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 2464 1376 gene locus_tag LOCUS_31460 2464 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 >Feature sequence657 547 801 gene locus_tag LOCUS_31470 547 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 782 1759 gene locus_tag LOCUS_31480 782 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2119 1907 gene locus_tag LOCUS_31490 2119 1907 CDS product KGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437768.1 protein_id gnl|my_center|LOCUS_31490 2966 2559 gene locus_tag LOCUS_31500 2966 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 3176 3024 gene locus_tag LOCUS_31510 3176 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence658 116 1036 gene locus_tag LOCUS_31520 116 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 1417 1761 gene locus_tag LOCUS_31530 1417 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 1761 2351 gene locus_tag LOCUS_31540 1761 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 >Feature sequence659 <1 1009 gene locus_tag LOCUS_31550 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203121.1:DUF262 and DUF1524 domain-containing protein 1107 1526 gene locus_tag LOCUS_31560 1107 1526 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975376.1 protein_id gnl|my_center|LOCUS_31560 1682 2617 gene locus_tag LOCUS_31570 1682 2617 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_31570 2874 2722 gene locus_tag LOCUS_31580 2874 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 >Feature sequence660 <1 1422 gene locus_tag LOCUS_31590 <1 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227410.1:glycoside hydrolase N-terminal domain-containing protein 1608 1480 gene locus_tag LOCUS_31600 1608 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 2190 1744 gene locus_tag LOCUS_31610 2190 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 2953 2360 gene locus_tag LOCUS_31620 2953 2360 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071717481.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence661 203 2518 gene locus_tag LOCUS_31630 203 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence662 230 664 gene locus_tag LOCUS_31640 230 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 1047 661 gene locus_tag LOCUS_31650 1047 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 1332 2201 gene locus_tag LOCUS_31660 gene galU 1332 2201 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941523.1 protein_id gnl|my_center|LOCUS_31660 2373 2798 gene locus_tag LOCUS_31670 2373 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 >Feature sequence663 1149 2672 gene locus_tag LOCUS_31680 1149 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 2690 3142 gene locus_tag LOCUS_31690 2690 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence664 2201 816 gene locus_tag LOCUS_31700 2201 816 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486252.1 protein_id gnl|my_center|LOCUS_31700 >Feature sequence665 876 619 gene locus_tag LOCUS_31710 876 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 1439 879 gene locus_tag LOCUS_31720 1439 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 1727 1509 gene locus_tag LOCUS_31730 1727 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 1747 2154 gene locus_tag LOCUS_31740 1747 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 <3187 2194 gene locus_tag LOCUS_31750 <3187 2194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258461.1:amidohydrolase >Feature sequence666 1709 2044 gene locus_tag LOCUS_31760 1709 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 >Feature sequence667 97 657 gene locus_tag LOCUS_31770 97 657 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140313.1 protein_id gnl|my_center|LOCUS_31770 805 1587 gene locus_tag LOCUS_31780 805 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 1747 2445 gene locus_tag LOCUS_31790 1747 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 2470 2760 gene locus_tag LOCUS_31800 2470 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 >Feature sequence668 313 1296 gene locus_tag LOCUS_31810 313 1296 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776936.1 protein_id gnl|my_center|LOCUS_31810 1303 2196 gene locus_tag LOCUS_31820 1303 2196 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532486.1 protein_id gnl|my_center|LOCUS_31820 2238 3095 gene locus_tag LOCUS_31830 2238 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 >Feature sequence669 2985 349 gene locus_tag LOCUS_31840 2985 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 >Feature sequence670 69 989 gene locus_tag LOCUS_31850 69 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 1481 1293 gene locus_tag LOCUS_31860 1481 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 1973 1578 gene locus_tag LOCUS_31870 1973 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 2147 3019 gene locus_tag LOCUS_31880 2147 3019 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence671 2680 554 gene locus_tag LOCUS_31890 2680 554 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018338.1 protein_id gnl|my_center|LOCUS_31890 2993 2721 gene locus_tag LOCUS_31900 2993 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence672 568 1551 gene locus_tag LOCUS_31910 568 1551 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_31910 1563 2456 gene locus_tag LOCUS_31920 1563 2456 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257889.1 protein_id gnl|my_center|LOCUS_31920 >Feature sequence673 <1 1322 gene locus_tag LOCUS_31930 <1 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:type I polyketide synthase >Feature sequence674 <3151 1255 gene locus_tag LOCUS_31940 <3151 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257971.1:molybdopterin-dependent oxidoreductase >Feature sequence675 2124 400 gene locus_tag LOCUS_31950 2124 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence676 979 53 gene locus_tag LOCUS_31960 979 53 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_31960 1801 1151 gene locus_tag LOCUS_31970 1801 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 2904 1804 gene locus_tag LOCUS_31980 2904 1804 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_31980 >Feature sequence677 585 31 gene locus_tag LOCUS_31990 585 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 1756 782 gene locus_tag LOCUS_32000 1756 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 1983 2056 gene locus_tag LOCUS_t00210 1983 2056 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2157 2166 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence678 641 2482 gene locus_tag LOCUS_32010 gene ftsH 641 2482 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_32010 2479 3057 gene locus_tag LOCUS_32020 2479 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 >Feature sequence679 51 371 gene locus_tag LOCUS_32030 51 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 448 735 gene locus_tag LOCUS_32040 448 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 921 1487 gene locus_tag LOCUS_32050 921 1487 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144143.1 protein_id gnl|my_center|LOCUS_32050 2258 1722 gene locus_tag LOCUS_32060 2258 1722 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080322.1 protein_id gnl|my_center|LOCUS_32060 <3135 2554 gene locus_tag LOCUS_32070 <3135 2554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978556.1:TetR/AcrR family transcriptional regulator >Feature sequence680 919 368 gene locus_tag LOCUS_32080 919 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 2809 932 gene locus_tag LOCUS_32090 2809 932 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894103.1 protein_id gnl|my_center|LOCUS_32090 >Feature sequence681 433 1524 gene locus_tag LOCUS_32100 gene mtnA 433 1524 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_32100 1585 2223 gene locus_tag LOCUS_32110 1585 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 >Feature sequence682 1170 1934 gene locus_tag LOCUS_32120 1170 1934 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225182.1 protein_id gnl|my_center|LOCUS_32120 1942 2388 gene locus_tag LOCUS_32130 1942 2388 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_32130 2385 3095 gene locus_tag LOCUS_32140 2385 3095 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_32140 >Feature sequence683 2029 227 gene locus_tag LOCUS_32150 2029 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence684 1324 1620 gene locus_tag LOCUS_32160 1324 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 3065 1809 gene locus_tag LOCUS_32170 3065 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 >Feature sequence685 <1 1079 gene locus_tag LOCUS_32180 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056513.1:dihydroorotase 1083 1751 gene locus_tag LOCUS_32190 1083 1751 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259756.1 protein_id gnl|my_center|LOCUS_32190 >Feature sequence686 <1 692 gene locus_tag LOCUS_32200 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003660783.1:single-stranded-DNA-specific exonuclease RecJ 829 2010 gene locus_tag LOCUS_32210 829 2010 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence687 1329 526 gene locus_tag LOCUS_32220 1329 526 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731477.1 protein_id gnl|my_center|LOCUS_32220 2166 1507 gene locus_tag LOCUS_32230 2166 1507 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225351.1 protein_id gnl|my_center|LOCUS_32230 <3112 2346 gene locus_tag LOCUS_32240 <3112 2346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730159.1:LLM class F420-dependent oxidoreductase >Feature sequence688 682 1122 gene locus_tag LOCUS_32250 682 1122 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970835.1 protein_id gnl|my_center|LOCUS_32250 1167 1955 gene locus_tag LOCUS_32260 1167 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 2025 2888 gene locus_tag LOCUS_32270 2025 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 >Feature sequence689 2331 2786 gene locus_tag LOCUS_32280 2331 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 >Feature sequence690 2429 639 gene locus_tag LOCUS_32290 2429 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 >Feature sequence691 >Feature sequence692 1484 1173 gene locus_tag LOCUS_32300 1484 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32300 1808 1506 gene locus_tag LOCUS_32310 gene ureA 1808 1506 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186513.1 protein_id gnl|my_center|LOCUS_32310 2732 1830 gene locus_tag LOCUS_32320 2732 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 >Feature sequence693 <1 621 gene locus_tag LOCUS_32330 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975929.1:carbohydrate ABC transporter permease >Feature sequence694 2458 2691 gene locus_tag LOCUS_32340 2458 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence695 <1 676 gene locus_tag LOCUS_32350 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202887107.1:sulfatase 743 2134 gene locus_tag LOCUS_32360 743 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence696 382 1632 gene locus_tag LOCUS_32370 382 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 <3084 1867 gene locus_tag LOCUS_32380 <3084 1867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257770.1:PBP1A family penicillin-binding protein >Feature sequence697 334 2319 gene locus_tag LOCUS_32390 334 2319 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992488.1 protein_id gnl|my_center|LOCUS_32390 >Feature sequence698 <1 536 gene locus_tag LOCUS_32400 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391955.1:IclR family transcriptional regulator 580 1062 gene locus_tag LOCUS_32410 580 1062 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_32410 >Feature sequence699 1160 483 gene locus_tag LOCUS_32420 1160 483 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371795.1 protein_id gnl|my_center|LOCUS_32420 2453 1206 gene locus_tag LOCUS_32430 2453 1206 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244857.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence700 2192 228 gene locus_tag LOCUS_32440 2192 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 2327 2494 gene locus_tag LOCUS_32450 2327 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence701 1817 1017 gene locus_tag LOCUS_32460 1817 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 2521 1862 gene locus_tag LOCUS_32470 2521 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence702 119 1393 gene locus_tag LOCUS_32480 119 1393 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142821.1 protein_id gnl|my_center|LOCUS_32480 1958 1503 gene locus_tag LOCUS_32490 1958 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 <3065 2299 gene locus_tag LOCUS_32500 <3065 2299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963630.1:DUF1501 domain-containing protein >Feature sequence703 195 830 gene locus_tag LOCUS_32510 195 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 856 1803 gene locus_tag LOCUS_32520 856 1803 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257878.1 protein_id gnl|my_center|LOCUS_32520 2169 1825 gene locus_tag LOCUS_32530 2169 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 2744 2166 gene locus_tag LOCUS_32540 2744 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 2853 2731 gene locus_tag LOCUS_32550 2853 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 >Feature sequence704 189 755 gene locus_tag LOCUS_32560 189 755 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020192.1 protein_id gnl|my_center|LOCUS_32560 1064 1882 gene locus_tag LOCUS_32570 gene map 1064 1882 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_32570 2259 1879 gene locus_tag LOCUS_32580 2259 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 2800 2321 gene locus_tag LOCUS_32590 2800 2321 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905176.1 protein_id gnl|my_center|LOCUS_32590 >Feature sequence705 90 458 gene locus_tag LOCUS_32600 90 458 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640343.1 protein_id gnl|my_center|LOCUS_32600 3023 552 gene locus_tag LOCUS_32610 gene gyrA 3023 552 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_32610 >Feature sequence706 1154 366 gene locus_tag LOCUS_32620 1154 366 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933138.1 protein_id gnl|my_center|LOCUS_32620 1462 1983 gene locus_tag LOCUS_32630 1462 1983 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405869.1 protein_id gnl|my_center|LOCUS_32630 2468 2055 gene locus_tag LOCUS_32640 2468 2055 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 protein_id gnl|my_center|LOCUS_32640 >Feature sequence707 179 1309 gene locus_tag LOCUS_32650 179 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 1974 1306 gene locus_tag LOCUS_32660 1974 1306 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021298.1 protein_id gnl|my_center|LOCUS_32660 2923 1964 gene locus_tag LOCUS_32670 2923 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence708 1004 1810 gene locus_tag LOCUS_32680 1004 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 2057 2824 gene locus_tag LOCUS_32690 2057 2824 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660871.1 protein_id gnl|my_center|LOCUS_32690 >Feature sequence709 2261 1491 gene locus_tag LOCUS_32700 2261 1491 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257145.1 protein_id gnl|my_center|LOCUS_32700 <3015 2267 gene locus_tag LOCUS_32710 <3015 2267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678769.1:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence710 1315 1142 gene locus_tag LOCUS_32720 1315 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 2836 1565 gene locus_tag LOCUS_32730 gene ahcY 2836 1565 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_32730 >Feature sequence711 631 38 gene locus_tag LOCUS_32740 631 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 868 1620 gene locus_tag LOCUS_32750 868 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 1686 2642 gene locus_tag LOCUS_32760 1686 2642 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397899.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence712 272 1093 gene locus_tag LOCUS_32770 272 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 2094 1315 gene locus_tag LOCUS_32780 2094 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 2805 2344 gene locus_tag LOCUS_32790 2805 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 >Feature sequence713 910 269 gene locus_tag LOCUS_32800 910 269 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978560.1 protein_id gnl|my_center|LOCUS_32800 1398 2141 gene locus_tag LOCUS_32810 1398 2141 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190909.1 protein_id gnl|my_center|LOCUS_32810 2672 2163 gene locus_tag LOCUS_32820 2672 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 >Feature sequence714 1564 680 gene locus_tag LOCUS_32830 1564 680 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_32830 2503 1697 gene locus_tag LOCUS_32840 gene kdgR 2503 1697 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705934.1 protein_id gnl|my_center|LOCUS_32840 >Feature sequence715 <1 550 gene locus_tag LOCUS_32850 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000072134.1:ATP-binding cassette domain-containing protein 551 1354 gene locus_tag LOCUS_32860 gene lieB 551 1354 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_32860 1471 1396 gene locus_tag LOCUS_t00220 1471 1396 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1648 1737 gene locus_tag LOCUS_t00230 1648 1737 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1752 1823 gene locus_tag LOCUS_t00240 1752 1823 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2361 1861 gene locus_tag LOCUS_32870 2361 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 2514 2765 gene locus_tag LOCUS_32880 2514 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 2987 2775 gene locus_tag LOCUS_32890 2987 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence716 2199 424 gene locus_tag LOCUS_32900 2199 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 >Feature sequence717 1559 762 gene locus_tag LOCUS_32910 1559 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 1733 2365 gene locus_tag LOCUS_32920 1733 2365 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_32920 >Feature sequence718 1748 930 gene locus_tag LOCUS_32930 1748 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 <2975 1748 gene locus_tag LOCUS_32940 <2975 1748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942896.1:lipopolysaccharide heptosyltransferase II >Feature sequence719 1650 520 gene locus_tag LOCUS_32950 1650 520 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266227.1 protein_id gnl|my_center|LOCUS_32950 1786 2463 gene locus_tag LOCUS_32960 1786 2463 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_32960 >Feature sequence720 2050 407 gene locus_tag LOCUS_32970 2050 407 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_32970 <2968 2215 gene locus_tag LOCUS_32980 <2968 2215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020995.1:disaggregatase related repeat-containing protein >Feature sequence721 205 399 gene locus_tag LOCUS_32990 205 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 400 696 gene locus_tag LOCUS_33000 400 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 753 1595 gene locus_tag LOCUS_33010 gene ribD 753 1595 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413854.1 protein_id gnl|my_center|LOCUS_33010 2362 1592 gene locus_tag LOCUS_33020 2362 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 >Feature sequence722 2009 867 gene locus_tag LOCUS_33030 2009 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 <2962 2092 gene locus_tag LOCUS_33040 <2962 2092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207301211.1:transketolase >Feature sequence723 <1 1025 gene locus_tag LOCUS_33050 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226215.1:MFS transporter 1107 2333 gene locus_tag LOCUS_33060 1107 2333 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_33060 >Feature sequence724 1027 2775 gene locus_tag LOCUS_33070 1027 2775 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_33070 >Feature sequence725 <1 2618 gene locus_tag LOCUS_33080 <1 2618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392112.1:DNA internalization-related competence protein ComEC/Rec2 >Feature sequence726 1802 687 gene locus_tag LOCUS_33090 1802 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 2184 2600 gene locus_tag LOCUS_33100 2184 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 >Feature sequence727 510 1841 gene locus_tag LOCUS_33110 510 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 2919 2050 gene locus_tag LOCUS_33120 2919 2050 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_33120 >Feature sequence728 1977 616 gene locus_tag LOCUS_33130 1977 616 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_33130 2539 1952 gene locus_tag LOCUS_33140 2539 1952 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627261.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence729 <1 909 gene locus_tag LOCUS_33150 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056910.1:ABC transporter substrate-binding protein 1151 1816 gene locus_tag LOCUS_33160 1151 1816 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799684.1 protein_id gnl|my_center|LOCUS_33160 1842 2747 gene locus_tag LOCUS_33170 1842 2747 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255158.1 protein_id gnl|my_center|LOCUS_33170 >Feature sequence730 2134 1886 gene locus_tag LOCUS_33180 2134 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 >Feature sequence731 1056 2297 gene locus_tag LOCUS_33190 1056 2297 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259616.1 protein_id gnl|my_center|LOCUS_33190 >Feature sequence732 1982 603 gene locus_tag LOCUS_33200 1982 603 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839765.1 protein_id gnl|my_center|LOCUS_33200 >Feature sequence733 449 1312 gene locus_tag LOCUS_33210 449 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence734 799 356 gene locus_tag LOCUS_33220 799 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 >Feature sequence735 1954 1328 gene locus_tag LOCUS_33230 1954 1328 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098519.1 protein_id gnl|my_center|LOCUS_33230 >Feature sequence736 329 1117 gene locus_tag LOCUS_33240 329 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 1710 1165 gene locus_tag LOCUS_33250 1710 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 2379 1786 gene locus_tag LOCUS_33260 2379 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 >Feature sequence737 1683 253 gene locus_tag LOCUS_33270 1683 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 >Feature sequence738 1427 2287 gene locus_tag LOCUS_33280 1427 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 >Feature sequence739 568 71 gene locus_tag LOCUS_33290 568 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 1740 1195 gene locus_tag LOCUS_33300 1740 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 <2907 1804 gene locus_tag LOCUS_33310 <2907 1804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000828208.1:PrsW family intramembrane metalloprotease >Feature sequence740 910 128 gene locus_tag LOCUS_33320 910 128 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_33320 1417 2052 gene locus_tag LOCUS_33330 1417 2052 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259017.1 protein_id gnl|my_center|LOCUS_33330 >Feature sequence741 1714 806 gene locus_tag LOCUS_33340 1714 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 <2903 1816 gene locus_tag LOCUS_33350 <2903 1816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888996.1:dihydrolipoyl dehydrogenase >Feature sequence742 >Feature sequence743 <1 783 gene locus_tag LOCUS_33360 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973189.1:citrate synthase/methylcitrate synthase 820 1992 gene locus_tag LOCUS_33370 820 1992 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403266.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33370 <2889 2015 gene locus_tag LOCUS_33380 <2889 2015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804444.1:2-hydroxy-3-oxopropionate reductase >Feature sequence744 134 1030 gene locus_tag LOCUS_33390 134 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 1114 1404 gene locus_tag LOCUS_33400 1114 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 2133 2489 gene locus_tag LOCUS_33410 2133 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 >Feature sequence745 >Feature sequence746 >Feature sequence747 802 41 gene locus_tag LOCUS_33420 gene kduD 802 41 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 protein_id gnl|my_center|LOCUS_33420 2385 958 gene locus_tag LOCUS_33430 2385 958 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777024.1 protein_id gnl|my_center|LOCUS_33430 >Feature sequence748 1517 1762 gene locus_tag LOCUS_33440 1517 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 2438 1770 gene locus_tag LOCUS_33450 2438 1770 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090289.1 protein_id gnl|my_center|LOCUS_33450 >Feature sequence749 874 308 gene locus_tag LOCUS_33460 874 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 1554 973 gene locus_tag LOCUS_33470 1554 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 <2873 1741 gene locus_tag LOCUS_33480 <2873 1741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994167.1:serine hydrolase domain-containing protein >Feature sequence750 1652 153 gene locus_tag LOCUS_33490 1652 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 <2873 1739 gene locus_tag LOCUS_33500 <2873 1739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104155.1:hybrid sensor histidine kinase/response regulator >Feature sequence751 1272 154 gene locus_tag LOCUS_33510 1272 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 >Feature sequence752 783 574 gene locus_tag LOCUS_33520 783 574 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_33520 988 785 gene locus_tag LOCUS_33530 988 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 1321 1737 gene locus_tag LOCUS_33540 1321 1737 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224900.1 protein_id gnl|my_center|LOCUS_33540 2392 1814 gene locus_tag LOCUS_33550 2392 1814 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069765.1 protein_id gnl|my_center|LOCUS_33550 >Feature sequence753 <1 518 gene locus_tag LOCUS_33560 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975841.1:xanthine dehydrogenase family protein subunit M >Feature sequence754 35 412 gene locus_tag LOCUS_33570 35 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 869 1159 gene locus_tag LOCUS_33580 869 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 1474 2154 gene locus_tag LOCUS_33590 1474 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence755 2 745 gene locus_tag LOCUS_33600 2 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 1021 815 gene locus_tag LOCUS_33610 1021 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 1805 2278 gene locus_tag LOCUS_33620 1805 2278 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392867.1 protein_id gnl|my_center|LOCUS_33620 >Feature sequence756 414 19 gene locus_tag LOCUS_33630 414 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 577 918 gene locus_tag LOCUS_33640 577 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 1816 926 gene locus_tag LOCUS_33650 1816 926 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200770.1 protein_id gnl|my_center|LOCUS_33650 2599 1832 gene locus_tag LOCUS_33660 2599 1832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522663.1 protein_id gnl|my_center|LOCUS_33660 >Feature sequence757 227 1021 gene locus_tag LOCUS_33670 227 1021 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809359.1 protein_id gnl|my_center|LOCUS_33670 1064 2215 gene locus_tag LOCUS_33680 1064 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence758 <2840 1608 gene locus_tag LOCUS_33690 <2840 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259302.1:methionine--tRNA ligase >Feature sequence759 1143 499 gene locus_tag LOCUS_33700 1143 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence760 2371 494 gene locus_tag LOCUS_33710 2371 494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_33710 2828 2574 gene locus_tag LOCUS_33720 2828 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 >Feature sequence761 1211 1636 gene locus_tag LOCUS_33730 1211 1636 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728622.1 protein_id gnl|my_center|LOCUS_33730 2239 1769 gene locus_tag LOCUS_33740 2239 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 >Feature sequence762 637 1545 gene locus_tag LOCUS_33750 637 1545 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_33750 1808 2413 gene locus_tag LOCUS_33760 1808 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 2435 2647 gene locus_tag LOCUS_33770 2435 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 >Feature sequence763 324 686 gene locus_tag LOCUS_33780 324 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 1343 942 gene locus_tag LOCUS_33790 1343 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 1501 2151 gene locus_tag LOCUS_33800 1501 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33800 2008 2017 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2123 2431 gene locus_tag LOCUS_33810 2123 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 >Feature sequence764 1234 2460 gene locus_tag LOCUS_33820 1234 2460 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_33820 2558 2633 gene locus_tag LOCUS_t00250 2558 2633 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence765 53 1030 gene locus_tag LOCUS_33830 53 1030 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_33830 1224 1694 gene locus_tag LOCUS_33840 1224 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 >Feature sequence766 258 1091 gene locus_tag LOCUS_33850 258 1091 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224911.1 protein_id gnl|my_center|LOCUS_33850 1048 1590 gene locus_tag LOCUS_33860 gene ispF 1048 1590 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459082.1 protein_id gnl|my_center|LOCUS_33860 >Feature sequence767 1188 160 gene locus_tag LOCUS_33870 1188 160 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_33870 1836 1216 gene locus_tag LOCUS_33880 gene cobO 1836 1216 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258439.1 protein_id gnl|my_center|LOCUS_33880 2131 2550 gene locus_tag LOCUS_33890 2131 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 >Feature sequence768 1251 2390 gene locus_tag LOCUS_33900 1251 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 >Feature sequence769 19 1947 gene locus_tag LOCUS_33910 19 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 >Feature sequence770 >Feature sequence771 >Feature sequence772 1582 266 gene locus_tag LOCUS_33920 1582 266 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226511.1 protein_id gnl|my_center|LOCUS_33920 <2799 1874 gene locus_tag LOCUS_33930 <2799 1874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009930784.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence773 >Feature sequence774 1498 1884 gene locus_tag LOCUS_33940 1498 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 2144 1932 gene locus_tag LOCUS_33950 2144 1932 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_33950 2347 2141 gene locus_tag LOCUS_33960 2347 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 >Feature sequence775 <2797 208 gene locus_tag LOCUS_33970 <2797 208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_177221404.1:preprotein translocase subunit SecA >Feature sequence776 <2794 637 gene locus_tag LOCUS_33980 <2794 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123515.1:type I polyketide synthase >Feature sequence777 1010 147 gene locus_tag LOCUS_33990 1010 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 1367 1570 gene locus_tag LOCUS_34000 1367 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 1542 1551 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1721 1888 gene locus_tag LOCUS_34010 1721 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 1900 2286 gene locus_tag LOCUS_34020 1900 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 >Feature sequence778 367 1713 gene locus_tag LOCUS_34030 367 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 >Feature sequence779 1323 550 gene locus_tag LOCUS_34040 1323 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 2140 1460 gene locus_tag LOCUS_34050 gene lepB 2140 1460 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257166.1 protein_id gnl|my_center|LOCUS_34050 >Feature sequence780 568 2019 gene locus_tag LOCUS_34060 568 2019 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226681.1 protein_id gnl|my_center|LOCUS_34060 2634 2047 gene locus_tag LOCUS_34070 2634 2047 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_34070 >Feature sequence781 <1 826 gene locus_tag LOCUS_34080 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054935954.1:RNA polymerase sigma factor RpoD 1544 774 gene locus_tag LOCUS_34090 1544 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 >Feature sequence782 377 1780 gene locus_tag LOCUS_34100 gene leuC 377 1780 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067266.1 protein_id gnl|my_center|LOCUS_34100 1881 2504 gene locus_tag LOCUS_34110 gene leuD 1881 2504 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_34110 >Feature sequence783 946 299 gene locus_tag LOCUS_34120 946 299 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973517.1 protein_id gnl|my_center|LOCUS_34120 1709 1041 gene locus_tag LOCUS_34130 1709 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 2384 1743 gene locus_tag LOCUS_34140 2384 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 >Feature sequence784 559 825 gene locus_tag LOCUS_34150 559 825 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_34150 822 1235 gene locus_tag LOCUS_34160 822 1235 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545852.1 protein_id gnl|my_center|LOCUS_34160 2215 1367 gene locus_tag LOCUS_34170 2215 1367 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838531.1 protein_id gnl|my_center|LOCUS_34170 >Feature sequence785 623 1834 gene locus_tag LOCUS_34180 623 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 >Feature sequence786 208 1983 gene locus_tag LOCUS_34190 208 1983 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468324.1 protein_id gnl|my_center|LOCUS_34190 <2755 2071 gene locus_tag LOCUS_34200 <2755 2071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258810.1:serine/threonine-protein kinase >Feature sequence787 708 319 gene locus_tag LOCUS_34210 708 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 2002 740 gene locus_tag LOCUS_34220 2002 740 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_34220 2671 2090 gene locus_tag LOCUS_34230 2671 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 >Feature sequence788 319 92 gene locus_tag LOCUS_34240 319 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 333 1523 gene locus_tag LOCUS_34250 333 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 1520 2359 gene locus_tag LOCUS_34260 1520 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 >Feature sequence789 289 1014 gene locus_tag LOCUS_34270 gene trmD 289 1014 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_34270 1961 1098 gene locus_tag LOCUS_34280 1961 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 >Feature sequence790 138 1580 gene locus_tag LOCUS_34290 gene galK 138 1580 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_34290 2386 1562 gene locus_tag LOCUS_34300 2386 1562 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_34300 >Feature sequence791 1290 496 gene locus_tag LOCUS_34310 1290 496 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_34310 1576 2436 gene locus_tag LOCUS_34320 gene aroE 1576 2436 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257813.1 protein_id gnl|my_center|LOCUS_34320 >Feature sequence792 667 146 gene locus_tag LOCUS_34330 667 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 1769 1065 gene locus_tag LOCUS_34340 1769 1065 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216585.1 protein_id gnl|my_center|LOCUS_34340 1991 1860 gene locus_tag LOCUS_34350 1991 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 2324 2725 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatctcaaccgagatgcctgtcctacctcaac >Feature sequence793 682 1398 gene locus_tag LOCUS_34360 682 1398 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941604.1 protein_id gnl|my_center|LOCUS_34360 1557 2498 gene locus_tag LOCUS_34370 1557 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 >Feature sequence794 756 4 gene locus_tag LOCUS_34380 756 4 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_34380 972 1238 gene locus_tag LOCUS_34390 972 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 >Feature sequence795 <1 796 gene locus_tag LOCUS_34400 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020640552.1:LLM class F420-dependent oxidoreductase 1823 921 gene locus_tag LOCUS_34410 1823 921 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090907.1 protein_id gnl|my_center|LOCUS_34410 2092 1820 gene locus_tag LOCUS_34420 2092 1820 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897230.1 protein_id gnl|my_center|LOCUS_34420 2319 2104 gene locus_tag LOCUS_34430 2319 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 >Feature sequence796 <2711 537 gene locus_tag LOCUS_34440 <2711 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258514.1:FHA domain-containing protein >Feature sequence797 1705 272 gene locus_tag LOCUS_34450 1705 272 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528142.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence798 2309 786 gene locus_tag LOCUS_34460 gene murA 2309 786 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723459.1 protein_id gnl|my_center|LOCUS_34460 >Feature sequence799 123 1922 gene locus_tag LOCUS_34470 gene murJ 123 1922 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_34470 >Feature sequence800 1590 1435 gene locus_tag LOCUS_34480 1590 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 1854 2231 gene locus_tag LOCUS_34490 1854 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 2653 2336 gene locus_tag LOCUS_34500 2653 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 >Feature sequence801 2142 1288 gene locus_tag LOCUS_34510 2142 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 <2705 2205 gene locus_tag LOCUS_34520 <2705 2205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048147030.1:glycosyltransferase family 2 protein >Feature sequence802 1083 325 gene locus_tag LOCUS_34530 1083 325 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_34530 1287 1682 gene locus_tag LOCUS_34540 1287 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 >Feature sequence803 900 94 gene locus_tag LOCUS_34550 900 94 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582765.1 protein_id gnl|my_center|LOCUS_34550 1968 994 gene locus_tag LOCUS_34560 1968 994 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114399.1 protein_id gnl|my_center|LOCUS_34560 >Feature sequence804 1188 295 gene locus_tag LOCUS_34570 1188 295 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_34570 2126 1209 gene locus_tag LOCUS_34580 2126 1209 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 protein_id gnl|my_center|LOCUS_34580 >Feature sequence805 510 1901 gene locus_tag LOCUS_34590 510 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 <2694 1821 gene locus_tag LOCUS_34600 <2694 1821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043688023.1:EamA family transporter >Feature sequence806 1073 1375 gene locus_tag LOCUS_34610 1073 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 1434 1709 gene locus_tag LOCUS_34620 1434 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 2570 1746 gene locus_tag LOCUS_34630 2570 1746 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189857.1 protein_id gnl|my_center|LOCUS_34630 >Feature sequence807 900 19 gene locus_tag LOCUS_34640 900 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 1093 2232 gene locus_tag LOCUS_34650 1093 2232 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023900.1 protein_id gnl|my_center|LOCUS_34650 >Feature sequence808 431 1537 gene locus_tag LOCUS_34660 431 1537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_34660 1549 2571 gene locus_tag LOCUS_34670 1549 2571 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_34670 >Feature sequence809 2313 1585 gene locus_tag LOCUS_34680 2313 1585 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_34680 >Feature sequence810 >Feature sequence811 1306 470 gene locus_tag LOCUS_34690 1306 470 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259072.1 protein_id gnl|my_center|LOCUS_34690 1839 1318 gene locus_tag LOCUS_34700 1839 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 2593 1853 gene locus_tag LOCUS_34710 2593 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 >Feature sequence812 933 307 gene locus_tag LOCUS_34720 933 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 1416 967 gene locus_tag LOCUS_34730 1416 967 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810818.1 protein_id gnl|my_center|LOCUS_34730 1619 1404 gene locus_tag LOCUS_34740 1619 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 1968 1684 gene locus_tag LOCUS_34750 1968 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 2670 2014 gene locus_tag LOCUS_34760 2670 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 >Feature sequence813 1012 23 gene locus_tag LOCUS_34770 1012 23 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_34770 2035 1025 gene locus_tag LOCUS_34780 2035 1025 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803848.1 protein_id gnl|my_center|LOCUS_34780 2192 2266 gene locus_tag LOCUS_t00260 2192 2266 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2410 2655 gene locus_tag LOCUS_34790 2410 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 >Feature sequence814 <1 1631 gene locus_tag LOCUS_34800 <1 1631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522436.1:potassium-transporting ATPase subunit KdpB 1768 2532 gene locus_tag LOCUS_34810 gene kdpC 1768 2532 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388912.1 protein_id gnl|my_center|LOCUS_34810 >Feature sequence815 <1 601 gene locus_tag LOCUS_34820 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259135.1:dihydroxyacetone kinase subunit DhaK 772 1401 gene locus_tag LOCUS_34830 gene dhaL 772 1401 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257203.1 protein_id gnl|my_center|LOCUS_34830 1456 1863 gene locus_tag LOCUS_34840 gene dhaM 1456 1863 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257204.1 protein_id gnl|my_center|LOCUS_34840 1912 2187 gene locus_tag LOCUS_34850 1912 2187 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_34850 >Feature sequence816 570 181 gene locus_tag LOCUS_34860 570 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence817 573 1574 gene locus_tag LOCUS_34870 573 1574 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 protein_id gnl|my_center|LOCUS_34870 1422 1431 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1820 1551 gene locus_tag LOCUS_34880 1820 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 1955 2146 gene locus_tag LOCUS_34890 1955 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 >Feature sequence818 998 603 gene locus_tag LOCUS_34900 998 603 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112247.1 protein_id gnl|my_center|LOCUS_34900 >Feature sequence819 199 1311 gene locus_tag LOCUS_34910 199 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 2192 1383 gene locus_tag LOCUS_34920 2192 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 >Feature sequence820 1529 738 gene locus_tag LOCUS_34930 1529 738 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815002.1 protein_id gnl|my_center|LOCUS_34930 >Feature sequence821 <1 770 gene locus_tag LOCUS_34940 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000470745.1:DNA replication/repair protein RecF 842 1537 gene locus_tag LOCUS_34950 842 1537 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_34950 1574 2068 gene locus_tag LOCUS_34960 1574 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 2099 2377 gene locus_tag LOCUS_34970 2099 2377 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925455.1 protein_id gnl|my_center|LOCUS_34970 >Feature sequence822 553 419 gene locus_tag LOCUS_34980 553 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 1825 560 gene locus_tag LOCUS_34990 1825 560 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106909.1 protein_id gnl|my_center|LOCUS_34990 2263 1937 gene locus_tag LOCUS_35000 2263 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35000 >Feature sequence823 <1 619 gene locus_tag LOCUS_35010 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003235019.1:2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase 1098 1517 gene locus_tag LOCUS_35020 gene gutM 1098 1517 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098448.1 protein_id gnl|my_center|LOCUS_35020 1758 2381 gene locus_tag LOCUS_35030 1758 2381 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257215.1 protein_id gnl|my_center|LOCUS_35030 >Feature sequence824 267 803 gene locus_tag LOCUS_35040 267 803 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761066.1 protein_id gnl|my_center|LOCUS_35040 >Feature sequence825 782 2485 gene locus_tag LOCUS_35050 782 2485 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467774.1 protein_id gnl|my_center|LOCUS_35050 >Feature sequence826 712 5 gene locus_tag LOCUS_35060 712 5 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228693.1 protein_id gnl|my_center|LOCUS_35060 2463 727 gene locus_tag LOCUS_35070 gene sdhA 2463 727 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 protein_id gnl|my_center|LOCUS_35070 >Feature sequence827 1497 1315 gene locus_tag LOCUS_35080 1497 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 2062 2382 gene locus_tag LOCUS_35090 2062 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 >Feature sequence828 307 837 gene locus_tag LOCUS_35100 307 837 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_35100 >Feature sequence829 797 84 gene locus_tag LOCUS_35110 797 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 2313 973 gene locus_tag LOCUS_35120 2313 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence830 1656 112 gene locus_tag LOCUS_35130 1656 112 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088589.1 protein_id gnl|my_center|LOCUS_35130 2342 1689 gene locus_tag LOCUS_35140 2342 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 >Feature sequence831 3 1199 gene locus_tag LOCUS_35150 3 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 1421 1771 gene locus_tag LOCUS_35160 1421 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 2595 1966 gene locus_tag LOCUS_35170 2595 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 >Feature sequence832 208 8 gene locus_tag LOCUS_35180 208 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 529 227 gene locus_tag LOCUS_35190 529 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 880 1233 gene locus_tag LOCUS_35200 880 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 1227 1838 gene locus_tag LOCUS_35210 1227 1838 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090717.1 protein_id gnl|my_center|LOCUS_35210 >Feature sequence833 <1 892 gene locus_tag LOCUS_35220 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973074.1:carboxyl transferase domain-containing protein 904 1692 gene locus_tag LOCUS_35230 904 1692 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257438.1 protein_id gnl|my_center|LOCUS_35230 >Feature sequence834 108 974 gene locus_tag LOCUS_35240 108 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 1067 1897 gene locus_tag LOCUS_35250 1067 1897 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542174.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence835 1928 174 gene locus_tag LOCUS_35260 1928 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 >Feature sequence836 1819 1409 gene locus_tag LOCUS_35270 1819 1409 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_35270 <2582 1827 gene locus_tag LOCUS_35280 <2582 1827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808213.1:thiolase >Feature sequence837 88 519 gene locus_tag LOCUS_35290 88 519 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532393.1 protein_id gnl|my_center|LOCUS_35290 1363 575 gene locus_tag LOCUS_35300 1363 575 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480238.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence838 1498 752 gene locus_tag LOCUS_35310 1498 752 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_35310 2193 1498 gene locus_tag LOCUS_35320 2193 1498 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 protein_id gnl|my_center|LOCUS_35320 >Feature sequence839 1515 22 gene locus_tag LOCUS_35330 gene ffh 1515 22 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_35330 1890 2477 gene locus_tag LOCUS_35340 1890 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 >Feature sequence840 >Feature sequence841 2367 2089 gene locus_tag LOCUS_35350 2367 2089 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105450.1 protein_id gnl|my_center|LOCUS_35350 >Feature sequence842 1507 284 gene locus_tag LOCUS_35360 1507 284 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257201.1 protein_id gnl|my_center|LOCUS_35360 2516 1671 gene locus_tag LOCUS_35370 2516 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence843 <1 1042 gene locus_tag LOCUS_35380 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009994674.1:L,D-transpeptidase 1220 1984 gene locus_tag LOCUS_35390 1220 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 <2576 2012 gene locus_tag LOCUS_35400 <2576 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002379340.1:cell wall metabolism sensor histidine kinase WalK >Feature sequence844 413 1537 gene locus_tag LOCUS_35410 413 1537 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_35410 >Feature sequence845 1468 1477 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2528 2103 gene locus_tag LOCUS_35420 2528 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 >Feature sequence846 <1 2009 gene locus_tag LOCUS_35430 <1 2009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048290.1:sigma-54-dependent transcriptional regulator 2187 2495 gene locus_tag LOCUS_35440 2187 2495 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003741107.1 protein_id gnl|my_center|LOCUS_35440 >Feature sequence847 2240 1080 gene locus_tag LOCUS_35450 2240 1080 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_35450 >Feature sequence848 1845 886 gene locus_tag LOCUS_35460 1845 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 >Feature sequence849 704 1213 gene locus_tag LOCUS_35470 gene def 704 1213 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583792.1 protein_id gnl|my_center|LOCUS_35470 1568 1269 gene locus_tag LOCUS_35480 1568 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 2305 1745 gene locus_tag LOCUS_35490 2305 1745 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818608.1 protein_id gnl|my_center|LOCUS_35490 >Feature sequence850 2168 1098 gene locus_tag LOCUS_35500 2168 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 >Feature sequence851 1570 2502 gene locus_tag LOCUS_35510 1570 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 >Feature sequence852 <2551 1781 gene locus_tag LOCUS_35520 <2551 1781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965644.1:glycosyltransferase family 2 protein >Feature sequence853 346 711 gene locus_tag LOCUS_35530 346 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 715 1641 gene locus_tag LOCUS_35540 715 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 2505 1693 gene locus_tag LOCUS_35550 2505 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence854 667 443 gene locus_tag LOCUS_35560 667 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 707 973 gene locus_tag LOCUS_35570 707 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 1444 2094 gene locus_tag LOCUS_35580 gene coxH3 1444 2094 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_35580 >Feature sequence855 1936 323 gene locus_tag LOCUS_35590 1936 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 2368 1940 gene locus_tag LOCUS_35600 2368 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 >Feature sequence856 <1 786 gene locus_tag LOCUS_35610 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229346.1:alkaline phosphatase family protein 987 2063 gene locus_tag LOCUS_35620 987 2063 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532944.1 protein_id gnl|my_center|LOCUS_35620 >Feature sequence857 316 1026 gene locus_tag LOCUS_35630 316 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 1035 1880 gene locus_tag LOCUS_35640 1035 1880 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250995.1 protein_id gnl|my_center|LOCUS_35640 >Feature sequence858 2111 1689 gene locus_tag LOCUS_35650 2111 1689 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_35650 >Feature sequence859 2124 607 gene locus_tag LOCUS_35660 2124 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 >Feature sequence860 1408 1776 gene locus_tag LOCUS_35670 1408 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 1905 2432 gene locus_tag LOCUS_35680 1905 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 >Feature sequence861 122 1816 gene locus_tag LOCUS_35690 122 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 >Feature sequence862 <1 879 gene locus_tag LOCUS_35700 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228946.1:VOC family protein 944 1963 gene locus_tag LOCUS_35710 gene hpaD 944 1963 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392282.1 protein_id gnl|my_center|LOCUS_35710 >Feature sequence863 120 755 gene locus_tag LOCUS_35720 120 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 782 2053 gene locus_tag LOCUS_35730 782 2053 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_35730 >Feature sequence864 >Feature sequence865 108 413 gene locus_tag LOCUS_35740 108 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 613 771 gene locus_tag LOCUS_35750 613 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 926 1648 gene locus_tag LOCUS_35760 926 1648 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095848.1 protein_id gnl|my_center|LOCUS_35760 1900 2250 gene locus_tag LOCUS_35770 gene trxA 1900 2250 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258400.1 protein_id gnl|my_center|LOCUS_35770 >Feature sequence866 559 2388 gene locus_tag LOCUS_35780 559 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 >Feature sequence867 3 824 gene locus_tag LOCUS_35790 3 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 1147 2331 gene locus_tag LOCUS_35800 1147 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 >Feature sequence868 3 836 gene locus_tag LOCUS_35810 3 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 903 1163 gene locus_tag LOCUS_35820 903 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 1648 1346 gene locus_tag LOCUS_35830 1648 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 2314 1661 gene locus_tag LOCUS_35840 2314 1661 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_35840 >Feature sequence869 319 1344 gene locus_tag LOCUS_35850 gene mgrA 319 1344 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227010.1 protein_id gnl|my_center|LOCUS_35850 >Feature sequence870 1622 1152 gene locus_tag LOCUS_35860 gene rpsG 1622 1152 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385326.1 protein_id gnl|my_center|LOCUS_35860 2372 1920 gene locus_tag LOCUS_35870 gene rpsL 2372 1920 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_35870 >Feature sequence871 365 1531 gene locus_tag LOCUS_35880 365 1531 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257396.1 protein_id gnl|my_center|LOCUS_35880 2500 1793 gene locus_tag LOCUS_35890 2500 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890