>Feature sequence001 <1 1712 gene locus_tag LOCUS_00010 <1 1712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085718.1:efflux RND transporter permease subunit 1702 2883 gene locus_tag LOCUS_00020 1702 2883 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_00020 2885 4297 gene locus_tag LOCUS_00030 2885 4297 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_00030 6025 4397 gene locus_tag LOCUS_00040 6025 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6362 7267 gene locus_tag LOCUS_00050 gene argB 6362 7267 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_00050 7670 7284 gene locus_tag LOCUS_00060 7670 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7880 8632 gene locus_tag LOCUS_00070 gene coq7 7880 8632 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039033.1 protein_id gnl|my_center|LOCUS_00070 10044 8620 gene locus_tag LOCUS_00080 10044 8620 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_00080 11255 10044 gene locus_tag LOCUS_00090 gene tyrS 11255 10044 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957422.1 protein_id gnl|my_center|LOCUS_00090 11298 12641 gene locus_tag LOCUS_00100 11298 12641 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 protein_id gnl|my_center|LOCUS_00100 12670 13752 gene locus_tag LOCUS_00110 12670 13752 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931222.1 protein_id gnl|my_center|LOCUS_00110 14648 13740 gene locus_tag LOCUS_00120 gene xerC 14648 13740 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 protein_id gnl|my_center|LOCUS_00120 15291 14635 gene locus_tag LOCUS_00130 15291 14635 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944790.1 protein_id gnl|my_center|LOCUS_00130 16144 15278 gene locus_tag LOCUS_00140 gene dapF 16144 15278 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073967.1 protein_id gnl|my_center|LOCUS_00140 17094 16195 gene locus_tag LOCUS_00150 17094 16195 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356740.1 protein_id gnl|my_center|LOCUS_00150 17169 18326 gene locus_tag LOCUS_00160 gene metK 17169 18326 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225644.1 protein_id gnl|my_center|LOCUS_00160 18371 19321 gene locus_tag LOCUS_00170 18371 19321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00170 19284 19676 gene locus_tag LOCUS_00180 19284 19676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00180 19297 19306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19681 20526 gene locus_tag LOCUS_00190 gene metF 19681 20526 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_00190 21709 20549 gene locus_tag LOCUS_00200 21709 20549 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566001.1 protein_id gnl|my_center|LOCUS_00200 21788 21973 gene locus_tag LOCUS_00210 21788 21973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21966 22883 gene locus_tag LOCUS_00220 gene ttcA 21966 22883 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126823.1 protein_id gnl|my_center|LOCUS_00220 22924 24162 gene locus_tag LOCUS_00230 22924 24162 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261142.1 protein_id gnl|my_center|LOCUS_00230 25321 24149 gene locus_tag LOCUS_00240 25321 24149 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197240.1 protein_id gnl|my_center|LOCUS_00240 27294 25321 gene locus_tag LOCUS_00250 27294 25321 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995440.1 protein_id gnl|my_center|LOCUS_00250 27367 27903 gene locus_tag LOCUS_00260 27367 27903 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930988.1 protein_id gnl|my_center|LOCUS_00260 27965 29128 gene locus_tag LOCUS_00270 gene sucC 27965 29128 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189251.1 protein_id gnl|my_center|LOCUS_00270 29132 30013 gene locus_tag LOCUS_00280 gene sucD 29132 30013 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550822.1 protein_id gnl|my_center|LOCUS_00280 30443 30003 gene locus_tag LOCUS_00290 gene fur 30443 30003 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_00290 30526 31038 gene locus_tag LOCUS_00300 30526 31038 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400155.1 protein_id gnl|my_center|LOCUS_00300 31035 31838 gene locus_tag LOCUS_00310 gene dapB 31035 31838 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_00310 32004 33152 gene locus_tag LOCUS_00320 gene carA 32004 33152 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037011.1 protein_id gnl|my_center|LOCUS_00320 33155 36391 gene locus_tag LOCUS_00330 gene carB 33155 36391 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_00330 36450 36926 gene locus_tag LOCUS_00340 gene greA 36450 36926 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 protein_id gnl|my_center|LOCUS_00340 37093 37350 gene locus_tag LOCUS_00350 gene yhbY 37093 37350 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650404.1 protein_id gnl|my_center|LOCUS_00350 37347 37979 gene locus_tag LOCUS_00360 gene rlmE 37347 37979 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235573.1 protein_id gnl|my_center|LOCUS_00360 38127 39971 gene locus_tag LOCUS_00370 gene ftsH 38127 39971 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_00370 39990 40868 gene locus_tag LOCUS_00380 gene folP 39990 40868 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193216.1 protein_id gnl|my_center|LOCUS_00380 40868 42223 gene locus_tag LOCUS_00390 gene glmM 40868 42223 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_00390 42684 42220 gene locus_tag LOCUS_00400 gene sixA 42684 42220 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_00400 44765 42681 gene locus_tag LOCUS_00410 gene ppk1 44765 42681 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225804.1 protein_id gnl|my_center|LOCUS_00410 44962 45738 gene locus_tag LOCUS_00420 44962 45738 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_00420 45870 47345 gene locus_tag LOCUS_00430 gene ppx 45870 47345 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_00430 47437 48480 gene locus_tag LOCUS_00440 gene pstS 47437 48480 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930170.1 protein_id gnl|my_center|LOCUS_00440 48697 49605 gene locus_tag LOCUS_00450 gene pstC 48697 49605 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809636.1 protein_id gnl|my_center|LOCUS_00450 49608 50468 gene locus_tag LOCUS_00460 gene pstA 49608 50468 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_00460 50480 51274 gene locus_tag LOCUS_00470 gene pstB 50480 51274 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448479.1 protein_id gnl|my_center|LOCUS_00470 51372 52142 gene locus_tag LOCUS_00480 gene tpiA 51372 52142 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_00480 52142 52477 gene locus_tag LOCUS_00490 gene secG 52142 52477 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417674.1 protein_id gnl|my_center|LOCUS_00490 52518 52602 gene locus_tag LOCUS_t00010 52518 52602 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 52772 53152 gene locus_tag LOCUS_00500 52772 53152 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_00500 53192 53674 gene locus_tag LOCUS_00510 53192 53674 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_00510 53674 54267 gene locus_tag LOCUS_00520 53674 54267 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_00520 54267 55532 gene locus_tag LOCUS_00530 54267 55532 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_00530 >Feature sequence002 421 732 gene locus_tag LOCUS_00540 gene clpS 421 732 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064083.1 protein_id gnl|my_center|LOCUS_00540 729 3002 gene locus_tag LOCUS_00550 gene clpA 729 3002 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_00550 3080 5437 gene locus_tag LOCUS_00560 3080 5437 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_00560 5419 6498 gene locus_tag LOCUS_00570 5419 6498 CDS product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103662.1 protein_id gnl|my_center|LOCUS_00570 6509 7384 gene locus_tag LOCUS_00580 gene atpG 6509 7384 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_00580 7381 7809 gene locus_tag LOCUS_00590 7381 7809 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_00590 7886 10489 gene locus_tag LOCUS_00600 gene alaS 7886 10489 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_00600 11302 10481 gene locus_tag LOCUS_00610 gene panC 11302 10481 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222669.1 protein_id gnl|my_center|LOCUS_00610 11839 11321 gene locus_tag LOCUS_00620 gene folK 11839 11321 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693858.1 protein_id gnl|my_center|LOCUS_00620 13143 11836 gene locus_tag LOCUS_00630 gene pcnB 13143 11836 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065010.1 protein_id gnl|my_center|LOCUS_00630 13813 13145 gene locus_tag LOCUS_00640 13813 13145 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 protein_id gnl|my_center|LOCUS_00640 14477 13824 gene locus_tag LOCUS_00650 gene hda 14477 13824 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929704.1 protein_id gnl|my_center|LOCUS_00650 15664 14477 gene locus_tag LOCUS_00660 15664 14477 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_00660 15646 16710 gene locus_tag LOCUS_00670 gene purM 15646 16710 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_00670 16716 17369 gene locus_tag LOCUS_00680 gene purN 16716 17369 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812554.1 protein_id gnl|my_center|LOCUS_00680 17438 18709 gene locus_tag LOCUS_00690 17438 18709 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222346.1 protein_id gnl|my_center|LOCUS_00690 18713 19966 gene locus_tag LOCUS_00700 18713 19966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 20020 21207 gene locus_tag LOCUS_00710 20020 21207 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_00710 21313 22989 gene locus_tag LOCUS_00720 21313 22989 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064644.1 protein_id gnl|my_center|LOCUS_00720 22982 23479 gene locus_tag LOCUS_00730 22982 23479 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_00730 23481 24185 gene locus_tag LOCUS_00740 23481 24185 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565842.1 protein_id gnl|my_center|LOCUS_00740 24203 25159 gene locus_tag LOCUS_00750 gene cysD 24203 25159 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_00750 25156 26448 gene locus_tag LOCUS_00760 25156 26448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 26519 26728 gene locus_tag LOCUS_00770 26519 26728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 26725 29295 gene locus_tag LOCUS_00780 26725 29295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 29796 29296 gene locus_tag LOCUS_00790 29796 29296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 30262 31017 gene locus_tag LOCUS_00800 30262 31017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 31143 32117 gene locus_tag LOCUS_00810 31143 32117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 32364 33413 gene locus_tag LOCUS_00820 32364 33413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 35059 33815 gene locus_tag LOCUS_00830 35059 33815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 35762 35151 gene locus_tag LOCUS_00840 35762 35151 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089752.1 protein_id gnl|my_center|LOCUS_00840 36776 36135 gene locus_tag LOCUS_00850 36776 36135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 37910 36873 gene locus_tag LOCUS_00860 37910 36873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 38015 37931 gene locus_tag LOCUS_t00020 38015 37931 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 40080 38059 gene locus_tag LOCUS_00870 40080 38059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 41210 40080 gene locus_tag LOCUS_00880 41210 40080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 41549 41283 gene locus_tag LOCUS_00890 41549 41283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 41509 41721 gene locus_tag LOCUS_00900 41509 41721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 41718 41993 gene locus_tag LOCUS_00910 41718 41993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 42411 42004 gene locus_tag LOCUS_00920 42411 42004 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 protein_id gnl|my_center|LOCUS_00920 43061 42408 gene locus_tag LOCUS_00930 43061 42408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 45423 43084 gene locus_tag LOCUS_00940 45423 43084 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933610.1 protein_id gnl|my_center|LOCUS_00940 45575 46843 gene locus_tag LOCUS_00950 45575 46843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 <49526 46901 gene locus_tag LOCUS_00960 <49526 46901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065081.1:Rne/Rng family ribonuclease >Feature sequence003 <1 633 gene locus_tag LOCUS_00970 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003690029.1:phosphatidate cytidylyltransferase 630 1814 gene locus_tag LOCUS_00980 gene ispC 630 1814 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_00980 1808 3172 gene locus_tag LOCUS_00990 gene rseP 1808 3172 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406254.1 protein_id gnl|my_center|LOCUS_00990 3182 5479 gene locus_tag LOCUS_01000 gene bamA 3182 5479 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 protein_id gnl|my_center|LOCUS_01000 5499 6008 gene locus_tag LOCUS_01010 5499 6008 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_01010 6017 7072 gene locus_tag LOCUS_01020 gene lpxD 6017 7072 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_01020 7076 7531 gene locus_tag LOCUS_01030 gene fabZ 7076 7531 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811776.1 protein_id gnl|my_center|LOCUS_01030 7541 8338 gene locus_tag LOCUS_01040 gene lpxA 7541 8338 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811774.1 protein_id gnl|my_center|LOCUS_01040 8341 9480 gene locus_tag LOCUS_01050 gene lpxB 8341 9480 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192608.1 protein_id gnl|my_center|LOCUS_01050 9470 10081 gene locus_tag LOCUS_01060 gene rnhB 9470 10081 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811770.1 protein_id gnl|my_center|LOCUS_01060 10078 10878 gene locus_tag LOCUS_01070 10078 10878 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222468.1 protein_id gnl|my_center|LOCUS_01070 10875 11741 gene locus_tag LOCUS_01080 10875 11741 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967128.1 protein_id gnl|my_center|LOCUS_01080 11846 13531 gene locus_tag LOCUS_01090 11846 13531 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_01090 13551 14792 gene locus_tag LOCUS_01100 gene frc 13551 14792 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226411.1 protein_id gnl|my_center|LOCUS_01100 14789 15721 gene locus_tag LOCUS_01110 gene fmt 14789 15721 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_01110 16731 15718 gene locus_tag LOCUS_01120 gene holA 16731 15718 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_01120 17276 16734 gene locus_tag LOCUS_01130 gene lptE 17276 16734 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687653.1 protein_id gnl|my_center|LOCUS_01130 19697 17277 gene locus_tag LOCUS_01140 gene leuS 19697 17277 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957661.1 protein_id gnl|my_center|LOCUS_01140 19788 21953 gene locus_tag LOCUS_01150 19788 21953 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812546.1 protein_id gnl|my_center|LOCUS_01150 22060 22680 gene locus_tag LOCUS_01160 22060 22680 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_01160 22732 24204 gene locus_tag LOCUS_01170 22732 24204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 24201 24401 gene locus_tag LOCUS_01180 24201 24401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 24902 24435 gene locus_tag LOCUS_01190 24902 24435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 25455 24943 gene locus_tag LOCUS_01200 25455 24943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 25971 25462 gene locus_tag LOCUS_01210 25971 25462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 26552 25974 gene locus_tag LOCUS_01220 26552 25974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 27388 26648 gene locus_tag LOCUS_01230 27388 26648 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039970.1 protein_id gnl|my_center|LOCUS_01230 27814 28119 gene locus_tag LOCUS_01240 27814 28119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 28416 29030 gene locus_tag LOCUS_01250 28416 29030 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_01250 29058 31265 gene locus_tag LOCUS_01260 29058 31265 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937997.1 protein_id gnl|my_center|LOCUS_01260 31267 32115 gene locus_tag LOCUS_01270 31267 32115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 32160 33623 gene locus_tag LOCUS_01280 gene nrfD 32160 33623 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_01280 33623 34150 gene locus_tag LOCUS_01290 33623 34150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 34147 34695 gene locus_tag LOCUS_01300 34147 34695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 34714 35718 gene locus_tag LOCUS_01310 34714 35718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 35904 36179 gene locus_tag LOCUS_01320 35904 36179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 36398 37804 gene locus_tag LOCUS_01330 36398 37804 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_01330 37841 38797 gene locus_tag LOCUS_01340 37841 38797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 38871 39491 gene locus_tag LOCUS_01350 38871 39491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 39735 40016 gene locus_tag LOCUS_01360 39735 40016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 40121 40402 gene locus_tag LOCUS_01370 40121 40402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 40399 40893 gene locus_tag LOCUS_01380 40399 40893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 40890 41399 gene locus_tag LOCUS_01390 40890 41399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 41403 42461 gene locus_tag LOCUS_01400 41403 42461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 42472 42714 gene locus_tag LOCUS_01410 42472 42714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 42711 43103 gene locus_tag LOCUS_01420 42711 43103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 >Feature sequence004 1479 457 gene locus_tag LOCUS_01430 gene nagZ 1479 457 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225592.1 protein_id gnl|my_center|LOCUS_01430 1856 1476 gene locus_tag LOCUS_01440 gene acpS 1856 1476 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 protein_id gnl|my_center|LOCUS_01440 2578 1853 gene locus_tag LOCUS_01450 gene pdxJ 2578 1853 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192885.1 protein_id gnl|my_center|LOCUS_01450 3303 2575 gene locus_tag LOCUS_01460 gene recO 3303 2575 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192953.1 protein_id gnl|my_center|LOCUS_01460 4171 3293 gene locus_tag LOCUS_01470 gene era 4171 3293 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_01470 4845 4174 gene locus_tag LOCUS_01480 gene rnc 4845 4174 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 protein_id gnl|my_center|LOCUS_01480 5839 4862 gene locus_tag LOCUS_01490 5839 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 7632 5839 gene locus_tag LOCUS_01500 gene lepA 7632 5839 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_01500 9137 7755 gene locus_tag LOCUS_01510 9137 7755 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_01510 10156 9137 gene locus_tag LOCUS_01520 10156 9137 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930931.1 protein_id gnl|my_center|LOCUS_01520 10668 10156 gene locus_tag LOCUS_01530 10668 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 11405 10668 gene locus_tag LOCUS_01540 gene rpoE 11405 10668 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_01540 11478 13115 gene locus_tag LOCUS_01550 11478 13115 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689235.1 protein_id gnl|my_center|LOCUS_01550 13735 13112 gene locus_tag LOCUS_01560 13735 13112 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886969.1 protein_id gnl|my_center|LOCUS_01560 14654 13785 gene locus_tag LOCUS_01570 14654 13785 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_01570 16462 14663 gene locus_tag LOCUS_01580 16462 14663 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_01580 17228 16479 gene locus_tag LOCUS_01590 17228 16479 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930119.1 protein_id gnl|my_center|LOCUS_01590 17827 17225 gene locus_tag LOCUS_01600 17827 17225 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_01600 17905 18297 gene locus_tag LOCUS_01610 17905 18297 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_01610 19363 18281 gene locus_tag LOCUS_01620 gene zapE 19363 18281 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447983.1 protein_id gnl|my_center|LOCUS_01620 20754 19372 gene locus_tag LOCUS_01630 gene lpdA 20754 19372 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225317.1 protein_id gnl|my_center|LOCUS_01630 21983 20820 gene locus_tag LOCUS_01640 gene odhB 21983 20820 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225318.1 protein_id gnl|my_center|LOCUS_01640 24738 22000 gene locus_tag LOCUS_01650 24738 22000 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_01650 26043 24745 gene locus_tag LOCUS_01660 gene gltA 26043 24745 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688402.1 protein_id gnl|my_center|LOCUS_01660 26340 26074 gene locus_tag LOCUS_01670 26340 26074 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528990.1 protein_id gnl|my_center|LOCUS_01670 27037 26342 gene locus_tag LOCUS_01680 27037 26342 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_01680 28823 27060 gene locus_tag LOCUS_01690 gene sdhA 28823 27060 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065156.1 protein_id gnl|my_center|LOCUS_01690 29170 28826 gene locus_tag LOCUS_01700 gene sdhD 29170 28826 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_01700 29523 29164 gene locus_tag LOCUS_01710 gene sdhC 29523 29164 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688393.1 protein_id gnl|my_center|LOCUS_01710 29483 29659 gene locus_tag LOCUS_01720 29483 29659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 29698 32373 gene locus_tag LOCUS_01730 gene acnA 29698 32373 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_01730 32391 33374 gene locus_tag LOCUS_01740 32391 33374 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_01740 34344 33454 gene locus_tag LOCUS_01750 gene cysM 34344 33454 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554618.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence005 374 1456 gene locus_tag LOCUS_01760 gene gmd 374 1456 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_01760 3161 4267 gene locus_tag LOCUS_01770 3161 4267 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035843.1 protein_id gnl|my_center|LOCUS_01770 4312 5172 gene locus_tag LOCUS_01780 4312 5172 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035851.1 protein_id gnl|my_center|LOCUS_01780 5580 6320 gene locus_tag LOCUS_01790 5580 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 6317 7483 gene locus_tag LOCUS_01800 gene wbpZ 6317 7483 CDS product D-rhamnosyltransferase WbpZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114105.1 protein_id gnl|my_center|LOCUS_01800 8369 7539 gene locus_tag LOCUS_01810 8369 7539 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535365.1 protein_id gnl|my_center|LOCUS_01810 9385 8369 gene locus_tag LOCUS_01820 9385 8369 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946516.1 protein_id gnl|my_center|LOCUS_01820 9575 11038 gene locus_tag LOCUS_01830 gene wzx 9575 11038 CDS product O13/O129/O135 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022479.1 protein_id gnl|my_center|LOCUS_01830 11031 12092 gene locus_tag LOCUS_01840 11031 12092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 12265 14022 gene locus_tag LOCUS_01850 gene aprD 12265 14022 CDS product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 protein_id gnl|my_center|LOCUS_01850 14019 15371 gene locus_tag LOCUS_01860 14019 15371 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_01860 15376 16755 gene locus_tag LOCUS_01870 15376 16755 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113107.1 protein_id gnl|my_center|LOCUS_01870 17522 16761 gene locus_tag LOCUS_01880 17522 16761 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546542.1 protein_id gnl|my_center|LOCUS_01880 17934 17617 gene locus_tag LOCUS_01890 17934 17617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 18225 19043 gene locus_tag LOCUS_01900 18225 19043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 19043 20287 gene locus_tag LOCUS_01910 19043 20287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 20326 21135 gene locus_tag LOCUS_01920 20326 21135 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186421.1 protein_id gnl|my_center|LOCUS_01920 21125 22492 gene locus_tag LOCUS_01930 21125 22492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387739.1 protein_id gnl|my_center|LOCUS_01930 22485 25472 gene locus_tag LOCUS_01940 22485 25472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 25469 26827 gene locus_tag LOCUS_01950 25469 26827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387739.1 protein_id gnl|my_center|LOCUS_01950 27065 30622 gene locus_tag LOCUS_01960 27065 30622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 30811 33198 gene locus_tag LOCUS_01970 30811 33198 CDS product hemolysin-type calcium-binding region inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387748.1 protein_id gnl|my_center|LOCUS_01970 33311 33523 gene locus_tag LOCUS_01980 33311 33523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 33922 33698 gene locus_tag LOCUS_01990 33922 33698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 >Feature sequence006 24 1565 gene locus_tag LOCUS_02000 gene atpA 24 1565 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_02000 1588 2463 gene locus_tag LOCUS_02010 gene atpG 1588 2463 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_02010 2502 3881 gene locus_tag LOCUS_02020 gene atpD 2502 3881 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185243.1 protein_id gnl|my_center|LOCUS_02020 3894 4319 gene locus_tag LOCUS_02030 3894 4319 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_02030 4379 5692 gene locus_tag LOCUS_02040 gene glmU 4379 5692 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064821.1 protein_id gnl|my_center|LOCUS_02040 6384 5734 gene locus_tag LOCUS_02050 6384 5734 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 protein_id gnl|my_center|LOCUS_02050 6690 6409 gene locus_tag LOCUS_02060 6690 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 8954 7170 gene locus_tag LOCUS_02070 gene argS 8954 7170 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_02070 9140 8958 gene locus_tag LOCUS_02080 9140 8958 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186709.1 protein_id gnl|my_center|LOCUS_02080 9251 10075 gene locus_tag LOCUS_02090 9251 10075 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186397.1 protein_id gnl|my_center|LOCUS_02090 10065 10682 gene locus_tag LOCUS_02100 gene thiE 10065 10682 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040557.1 protein_id gnl|my_center|LOCUS_02100 10744 12024 gene locus_tag LOCUS_02110 gene hemL 10744 12024 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_02110 12021 12677 gene locus_tag LOCUS_02120 gene yihA 12021 12677 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703927.1 protein_id gnl|my_center|LOCUS_02120 13665 12661 gene locus_tag LOCUS_02130 gene hemB 13665 12661 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521908.1 protein_id gnl|my_center|LOCUS_02130 15933 13678 gene locus_tag LOCUS_02140 15933 13678 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110255951.1 protein_id gnl|my_center|LOCUS_02140 17100 15991 gene locus_tag LOCUS_02150 gene aroB 17100 15991 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_02150 17608 17069 gene locus_tag LOCUS_02160 17608 17069 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_02160 17784 22400 gene locus_tag LOCUS_02170 17784 22400 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_02170 22402 23838 gene locus_tag LOCUS_02180 22402 23838 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931634.1 protein_id gnl|my_center|LOCUS_02180 23887 24954 gene locus_tag LOCUS_02190 gene hemE 23887 24954 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222724.1 protein_id gnl|my_center|LOCUS_02190 25212 27203 gene locus_tag LOCUS_02200 25212 27203 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247688.1 protein_id gnl|my_center|LOCUS_02200 28024 27200 gene locus_tag LOCUS_02210 28024 27200 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_02210 29932 28028 gene locus_tag LOCUS_02220 gene thiC 29932 28028 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807441.1 protein_id gnl|my_center|LOCUS_02220 30583 30008 gene locus_tag LOCUS_02230 gene greB 30583 30008 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_02230 31240 30587 gene locus_tag LOCUS_02240 31240 30587 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_02240 31442 31978 gene locus_tag LOCUS_02250 gene bcp 31442 31978 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_02250 33223 31967 gene locus_tag LOCUS_02260 gene waaA 33223 31967 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532247.1 protein_id gnl|my_center|LOCUS_02260 <33913 33220 gene locus_tag LOCUS_02270 <33913 33220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013094906.1:lipopolysaccharide heptosyltransferase RfaC >Feature sequence007 107 937 gene locus_tag LOCUS_02280 gene aroE 107 937 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_02280 943 1656 gene locus_tag LOCUS_02290 gene mtgA 943 1656 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206066.1 protein_id gnl|my_center|LOCUS_02290 2404 1685 gene locus_tag LOCUS_02300 2404 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 3660 2455 gene locus_tag LOCUS_02310 gene lysA 3660 2455 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225849.1 protein_id gnl|my_center|LOCUS_02310 3920 3660 gene locus_tag LOCUS_02320 3920 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 5363 3954 gene locus_tag LOCUS_02330 gene argH 5363 3954 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704829.1 protein_id gnl|my_center|LOCUS_02330 7156 5513 gene locus_tag LOCUS_02340 gene groL 7156 5513 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_02340 7517 7227 gene locus_tag LOCUS_02350 7517 7227 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194371.1 protein_id gnl|my_center|LOCUS_02350 7720 9255 gene locus_tag LOCUS_02360 gene dacB 7720 9255 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 protein_id gnl|my_center|LOCUS_02360 9340 9813 gene locus_tag LOCUS_02370 9340 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 10710 9859 gene locus_tag LOCUS_02380 gene ubiA 10710 9859 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_02380 12762 10717 gene locus_tag LOCUS_02390 gene recG 12762 10717 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446218.1 protein_id gnl|my_center|LOCUS_02390 14739 12766 gene locus_tag LOCUS_02400 14739 12766 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_02400 14810 15811 gene locus_tag LOCUS_02410 14810 15811 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_02410 15821 16357 gene locus_tag LOCUS_02420 15821 16357 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413390.1 protein_id gnl|my_center|LOCUS_02420 16345 16932 gene locus_tag LOCUS_02430 16345 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 16892 17536 gene locus_tag LOCUS_02440 gene lptA 16892 17536 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693464.1 protein_id gnl|my_center|LOCUS_02440 17533 18255 gene locus_tag LOCUS_02450 gene lptB 17533 18255 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815177.1 protein_id gnl|my_center|LOCUS_02450 18259 19674 gene locus_tag LOCUS_02460 18259 19674 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_02460 19700 20026 gene locus_tag LOCUS_02470 gene hpf 19700 20026 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_02470 20033 20506 gene locus_tag LOCUS_02480 20033 20506 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929966.1 protein_id gnl|my_center|LOCUS_02480 20493 21461 gene locus_tag LOCUS_02490 gene hprK 20493 21461 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225452.1 protein_id gnl|my_center|LOCUS_02490 21439 22347 gene locus_tag LOCUS_02500 gene rapZ 21439 22347 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195227.1 protein_id gnl|my_center|LOCUS_02500 25129 22358 gene locus_tag LOCUS_02510 25129 22358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 26170 25157 gene locus_tag LOCUS_02520 gene mutY 26170 25157 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927127.1 protein_id gnl|my_center|LOCUS_02520 26250 26323 gene locus_tag LOCUS_t00030 26250 26323 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 26705 26325 gene locus_tag LOCUS_02530 26705 26325 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_02530 28854 26722 gene locus_tag LOCUS_02540 28854 26722 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194871.1 protein_id gnl|my_center|LOCUS_02540 29065 28865 gene locus_tag LOCUS_02550 gene rpoZ 29065 28865 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_02550 29717 29091 gene locus_tag LOCUS_02560 gene gmk 29717 29091 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070724.1 protein_id gnl|my_center|LOCUS_02560 30583 29714 gene locus_tag LOCUS_02570 30583 29714 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687657.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence008 170 589 gene locus_tag LOCUS_02580 170 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 714 1736 gene locus_tag LOCUS_02590 714 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 1895 2803 gene locus_tag LOCUS_02600 1895 2803 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188583328.1 protein_id gnl|my_center|LOCUS_02600 3386 2961 gene locus_tag LOCUS_02610 3386 2961 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974672.1 protein_id gnl|my_center|LOCUS_02610 3622 3383 gene locus_tag LOCUS_02620 3622 3383 CDS product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812071.1 protein_id gnl|my_center|LOCUS_02620 3811 4002 gene locus_tag LOCUS_02630 3811 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 5253 4075 gene locus_tag LOCUS_02640 5253 4075 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_02640 6467 5253 gene locus_tag LOCUS_02650 6467 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 8285 6471 gene locus_tag LOCUS_02660 8285 6471 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_02660 9619 8453 gene locus_tag LOCUS_02670 9619 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 9812 9564 gene locus_tag LOCUS_02680 9812 9564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 10027 11496 gene locus_tag LOCUS_02690 10027 11496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 11505 12260 gene locus_tag LOCUS_02700 11505 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 12354 13199 gene locus_tag LOCUS_02710 12354 13199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 13199 14059 gene locus_tag LOCUS_02720 13199 14059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02720 14060 15157 gene locus_tag LOCUS_02730 14060 15157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 15178 15909 gene locus_tag LOCUS_02740 15178 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 16070 16966 gene locus_tag LOCUS_02750 16070 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 18207 17056 gene locus_tag LOCUS_02760 18207 17056 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_02760 19757 18207 gene locus_tag LOCUS_02770 gene xrtA 19757 18207 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_02770 20968 19754 gene locus_tag LOCUS_02780 20968 19754 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_02780 21999 20968 gene locus_tag LOCUS_02790 21999 20968 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_02790 22837 21992 gene locus_tag LOCUS_02800 22837 21992 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_02800 24014 22842 gene locus_tag LOCUS_02810 gene wecB 24014 22842 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_02810 25050 24004 gene locus_tag LOCUS_02820 25050 24004 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_02820 26683 25106 gene locus_tag LOCUS_02830 26683 25106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 27617 26688 gene locus_tag LOCUS_02840 27617 26688 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390867.1 protein_id gnl|my_center|LOCUS_02840 29149 27614 gene locus_tag LOCUS_02850 29149 27614 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence009 938 1306 gene locus_tag LOCUS_02860 938 1306 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_02860 2271 1318 gene locus_tag LOCUS_02870 2271 1318 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813337.1 protein_id gnl|my_center|LOCUS_02870 3024 2275 gene locus_tag LOCUS_02880 3024 2275 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_02880 4243 3059 gene locus_tag LOCUS_02890 4243 3059 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189727.1 protein_id gnl|my_center|LOCUS_02890 6638 4257 gene locus_tag LOCUS_02900 6638 4257 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064157.1 protein_id gnl|my_center|LOCUS_02900 6723 8456 gene locus_tag LOCUS_02910 gene pabB 6723 8456 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722110.1 protein_id gnl|my_center|LOCUS_02910 9354 8437 gene locus_tag LOCUS_02920 9354 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 10421 9432 gene locus_tag LOCUS_02930 10421 9432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 10962 10549 gene locus_tag LOCUS_02940 10962 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 11861 10980 gene locus_tag LOCUS_02950 11861 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 13253 12069 gene locus_tag LOCUS_02960 13253 12069 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097455.1 protein_id gnl|my_center|LOCUS_02960 14605 13250 gene locus_tag LOCUS_02970 14605 13250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 15392 14595 gene locus_tag LOCUS_02980 gene panB 15392 14595 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_02980 15901 15404 gene locus_tag LOCUS_02990 15901 15404 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947372.1 protein_id gnl|my_center|LOCUS_02990 16507 15971 gene locus_tag LOCUS_03000 16507 15971 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_03000 17339 16575 gene locus_tag LOCUS_03010 17339 16575 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_03010 18308 17355 gene locus_tag LOCUS_03020 gene holB 18308 17355 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039871.1 protein_id gnl|my_center|LOCUS_03020 18931 18305 gene locus_tag LOCUS_03030 gene tmk 18931 18305 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193022.1 protein_id gnl|my_center|LOCUS_03030 19922 18921 gene locus_tag LOCUS_03040 gene mltG 19922 18921 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191597.1 protein_id gnl|my_center|LOCUS_03040 21178 19937 gene locus_tag LOCUS_03050 gene fabF 21178 19937 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_03050 21487 21248 gene locus_tag LOCUS_03060 gene acpP 21487 21248 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814322.1 protein_id gnl|my_center|LOCUS_03060 22314 21574 gene locus_tag LOCUS_03070 gene fabG 22314 21574 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_03070 23263 22343 gene locus_tag LOCUS_03080 gene fabD 23263 22343 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813821.1 protein_id gnl|my_center|LOCUS_03080 24254 23292 gene locus_tag LOCUS_03090 24254 23292 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225817.1 protein_id gnl|my_center|LOCUS_03090 25282 24251 gene locus_tag LOCUS_03100 gene plsX 25282 24251 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_03100 25483 25304 gene locus_tag LOCUS_03110 gene rpmF 25483 25304 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192741.1 protein_id gnl|my_center|LOCUS_03110 26037 25528 gene locus_tag LOCUS_03120 26037 25528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 26160 26738 gene locus_tag LOCUS_03130 26160 26738 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065087.1 protein_id gnl|my_center|LOCUS_03130 26738 27475 gene locus_tag LOCUS_03140 26738 27475 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_03140 28426 27434 gene locus_tag LOCUS_03150 28426 27434 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence010 514 59 gene locus_tag LOCUS_03160 514 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 591 1163 gene locus_tag LOCUS_03170 591 1163 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688107.1 protein_id gnl|my_center|LOCUS_03170 2437 1160 gene locus_tag LOCUS_03180 gene purD 2437 1160 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 protein_id gnl|my_center|LOCUS_03180 4009 2450 gene locus_tag LOCUS_03190 gene purH 4009 2450 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527723.1 protein_id gnl|my_center|LOCUS_03190 4245 4006 gene locus_tag LOCUS_03200 4245 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 5264 4242 gene locus_tag LOCUS_03210 gene dusB 5264 4242 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_03210 8026 5318 gene locus_tag LOCUS_03220 gene polA 8026 5318 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_03220 8037 8963 gene locus_tag LOCUS_03230 gene hemF 8037 8963 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813191.1 protein_id gnl|my_center|LOCUS_03230 8986 9909 gene locus_tag LOCUS_03240 8986 9909 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820410.1 protein_id gnl|my_center|LOCUS_03240 9906 10952 gene locus_tag LOCUS_03250 9906 10952 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 protein_id gnl|my_center|LOCUS_03250 10949 11716 gene locus_tag LOCUS_03260 10949 11716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_03260 11709 12413 gene locus_tag LOCUS_03270 11709 12413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064071.1 protein_id gnl|my_center|LOCUS_03270 12414 13838 gene locus_tag LOCUS_03280 12414 13838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 13838 14737 gene locus_tag LOCUS_03290 13838 14737 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_03290 14977 14738 gene locus_tag LOCUS_03300 14977 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199309.1 protein_id gnl|my_center|LOCUS_03300 15179 14991 gene locus_tag LOCUS_03310 15179 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 15301 16500 gene locus_tag LOCUS_03320 15301 16500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 16497 18332 gene locus_tag LOCUS_03330 16497 18332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 19502 18342 gene locus_tag LOCUS_03340 gene emrK 19502 18342 CDS product multidrug efflux MFS transporter periplasmic adaptor subunit EmrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438675.1 protein_id gnl|my_center|LOCUS_03340 20899 19490 gene locus_tag LOCUS_03350 20899 19490 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064132.1 protein_id gnl|my_center|LOCUS_03350 22458 20896 gene locus_tag LOCUS_03360 22458 20896 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337338.1 protein_id gnl|my_center|LOCUS_03360 23131 22469 gene locus_tag LOCUS_03370 gene narL 23131 22469 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_03370 25052 23139 gene locus_tag LOCUS_03380 gene narX 25052 23139 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_03380 25272 25634 gene locus_tag LOCUS_03390 25272 25634 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 protein_id gnl|my_center|LOCUS_03390 25718 26698 gene locus_tag LOCUS_03400 25718 26698 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948238.1 protein_id gnl|my_center|LOCUS_03400 <28208 26665 gene locus_tag LOCUS_03410 <28208 26665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194217.1:proline--tRNA ligase >Feature sequence011 1415 120 gene locus_tag LOCUS_03420 1415 120 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_03420 2517 1408 gene locus_tag LOCUS_03430 2517 1408 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145958.1 protein_id gnl|my_center|LOCUS_03430 3195 2527 gene locus_tag LOCUS_03440 gene cbiC 3195 2527 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 protein_id gnl|my_center|LOCUS_03440 4071 3205 gene locus_tag LOCUS_03450 4071 3205 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034944231.1 protein_id gnl|my_center|LOCUS_03450 4865 4068 gene locus_tag LOCUS_03460 gene cobM 4865 4068 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876241.1 protein_id gnl|my_center|LOCUS_03460 5557 4919 gene locus_tag LOCUS_03470 5557 4919 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086058.1 protein_id gnl|my_center|LOCUS_03470 6065 6976 gene locus_tag LOCUS_03480 gene cyoA 6065 6976 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832113.1 protein_id gnl|my_center|LOCUS_03480 6981 9023 gene locus_tag LOCUS_03490 gene cyoB 6981 9023 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190543.1 protein_id gnl|my_center|LOCUS_03490 9020 9640 gene locus_tag LOCUS_03500 9020 9640 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179819.1 protein_id gnl|my_center|LOCUS_03500 9637 9966 gene locus_tag LOCUS_03510 gene cyoD 9637 9966 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192747.1 protein_id gnl|my_center|LOCUS_03510 9970 10869 gene locus_tag LOCUS_03520 gene cyoE 9970 10869 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367961.1 protein_id gnl|my_center|LOCUS_03520 11008 13473 gene locus_tag LOCUS_03530 11008 13473 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_03530 14657 13494 gene locus_tag LOCUS_03540 gene neuC 14657 13494 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289362.1 protein_id gnl|my_center|LOCUS_03540 15684 14641 gene locus_tag LOCUS_03550 gene siaC 15684 14641 CDS product polysialic acid capsule biosynthesis protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215299.1 protein_id gnl|my_center|LOCUS_03550 15911 16855 gene locus_tag LOCUS_03560 15911 16855 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_03560 17264 16740 gene locus_tag LOCUS_03570 17264 16740 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_03570 18787 17264 gene locus_tag LOCUS_03580 18787 17264 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528369.1 protein_id gnl|my_center|LOCUS_03580 20250 18802 gene locus_tag LOCUS_03590 20250 18802 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_03590 20926 20252 gene locus_tag LOCUS_03600 20926 20252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_03600 21876 20929 gene locus_tag LOCUS_03610 21876 20929 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_03610 23894 21873 gene locus_tag LOCUS_03620 gene hyfB 23894 21873 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532947.1 protein_id gnl|my_center|LOCUS_03620 24090 23899 gene locus_tag LOCUS_03630 24090 23899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 24270 25013 gene locus_tag LOCUS_03640 24270 25013 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225227.1 protein_id gnl|my_center|LOCUS_03640 <26091 24989 gene locus_tag LOCUS_03650 <26091 24989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193568.1:DNA repair protein RadA >Feature sequence012 <1 1232 gene locus_tag LOCUS_03660 <1 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197309.1:DEAD/DEAH box helicase 1229 1534 gene locus_tag LOCUS_03670 1229 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1609 3081 gene locus_tag LOCUS_03680 gene glcD 1609 3081 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 protein_id gnl|my_center|LOCUS_03680 3084 4145 gene locus_tag LOCUS_03690 gene glcE 3084 4145 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943100.1 protein_id gnl|my_center|LOCUS_03690 4150 5421 gene locus_tag LOCUS_03700 gene glcF 4150 5421 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268367.1 protein_id gnl|my_center|LOCUS_03700 5494 6192 gene locus_tag LOCUS_03710 5494 6192 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522523.1 protein_id gnl|my_center|LOCUS_03710 6196 6906 gene locus_tag LOCUS_03720 gene sfsA 6196 6906 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_03720 6958 7842 gene locus_tag LOCUS_03730 6958 7842 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_03730 7895 8122 gene locus_tag LOCUS_03740 gene tusA 7895 8122 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_03740 8177 9940 gene locus_tag LOCUS_03750 8177 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 10281 9925 gene locus_tag LOCUS_03760 10281 9925 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184362.1 protein_id gnl|my_center|LOCUS_03760 10434 11504 gene locus_tag LOCUS_03770 10434 11504 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646058.1 protein_id gnl|my_center|LOCUS_03770 11512 14781 gene locus_tag LOCUS_03780 11512 14781 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711674.1 protein_id gnl|my_center|LOCUS_03780 14778 14987 gene locus_tag LOCUS_03790 14778 14987 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 protein_id gnl|my_center|LOCUS_03790 15055 16452 gene locus_tag LOCUS_03800 15055 16452 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_03800 16466 17752 gene locus_tag LOCUS_03810 16466 17752 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_03810 17771 18109 gene locus_tag LOCUS_03820 17771 18109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 18114 18314 gene locus_tag LOCUS_03830 18114 18314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 18307 19863 gene locus_tag LOCUS_03840 18307 19863 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195345.1 protein_id gnl|my_center|LOCUS_03840 19889 21025 gene locus_tag LOCUS_03850 gene cydB 19889 21025 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210731.1 protein_id gnl|my_center|LOCUS_03850 22413 21133 gene locus_tag LOCUS_03860 gene yegQ 22413 21133 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_03860 23084 22410 gene locus_tag LOCUS_03870 23084 22410 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222833.1 protein_id gnl|my_center|LOCUS_03870 23797 23078 gene locus_tag LOCUS_03880 23797 23078 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532296.1 protein_id gnl|my_center|LOCUS_03880 >Feature sequence013 1462 1112 gene locus_tag LOCUS_03890 gene ychN 1462 1112 CDS product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169659.1 protein_id gnl|my_center|LOCUS_03890 1594 2247 gene locus_tag LOCUS_03900 1594 2247 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_03900 3960 2269 gene locus_tag LOCUS_03910 gene merA 3960 2269 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209296.1 protein_id gnl|my_center|LOCUS_03910 4249 3971 gene locus_tag LOCUS_03920 gene merP 4249 3971 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732292.1 protein_id gnl|my_center|LOCUS_03920 4612 4262 gene locus_tag LOCUS_03930 4612 4262 CDS product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294660.1 protein_id gnl|my_center|LOCUS_03930 4683 5177 gene locus_tag LOCUS_03940 gene merR 4683 5177 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_03940 5161 5541 gene locus_tag LOCUS_03950 5161 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 7109 6288 gene locus_tag LOCUS_03960 7109 6288 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114699.1 protein_id gnl|my_center|LOCUS_03960 7935 7597 gene locus_tag LOCUS_03970 7935 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 8290 8000 gene locus_tag LOCUS_03980 8290 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 10017 8800 gene locus_tag LOCUS_03990 gene csx2 10017 8800 CDS product TIGR02221 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582979.1 protein_id gnl|my_center|LOCUS_03990 12424 10133 gene locus_tag LOCUS_04000 12424 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 12933 12427 gene locus_tag LOCUS_04010 12933 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 14438 12930 gene locus_tag LOCUS_04020 14438 12930 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258138.1 protein_id gnl|my_center|LOCUS_04020 15968 14442 gene locus_tag LOCUS_04030 15968 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 16561 15965 gene locus_tag LOCUS_04040 16561 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 18309 16558 gene locus_tag LOCUS_04050 18309 16558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 18742 18425 gene locus_tag LOCUS_04060 18742 18425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 19665 18742 gene locus_tag LOCUS_04070 19665 18742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 20840 19665 gene locus_tag LOCUS_04080 20840 19665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 22030 20885 gene locus_tag LOCUS_04090 22030 20885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 22992 22132 gene locus_tag LOCUS_04100 22992 22132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 23176 23006 gene locus_tag LOCUS_04110 23176 23006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 24146 23331 gene locus_tag LOCUS_04120 24146 23331 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932478.1 protein_id gnl|my_center|LOCUS_04120 24523 24167 gene locus_tag LOCUS_04130 24523 24167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 24647 25163 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatccccttcaggaagtcggggtaatgaaac >Feature sequence014 3458 366 gene locus_tag LOCUS_04140 gene muxB 3458 366 CDS product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_04140 4651 3455 gene locus_tag LOCUS_04150 4651 3455 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214676.1 protein_id gnl|my_center|LOCUS_04150 5543 4734 gene locus_tag LOCUS_04160 5543 4734 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946577.1 protein_id gnl|my_center|LOCUS_04160 5700 9851 gene locus_tag LOCUS_04170 5700 9851 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_04170 11497 9830 gene locus_tag LOCUS_04180 gene ettA 11497 9830 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186903.1 protein_id gnl|my_center|LOCUS_04180 11646 12281 gene locus_tag LOCUS_04190 11646 12281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 12490 13560 gene locus_tag LOCUS_04200 gene rfbB 12490 13560 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_04200 13557 14435 gene locus_tag LOCUS_04210 gene rfbA 13557 14435 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419145.1 protein_id gnl|my_center|LOCUS_04210 15140 14436 gene locus_tag LOCUS_04220 gene ompR 15140 14436 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704310.1 protein_id gnl|my_center|LOCUS_04220 15309 16895 gene locus_tag LOCUS_04230 gene nadB 15309 16895 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_04230 17994 16903 gene locus_tag LOCUS_04240 gene nadA 17994 16903 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112547.1 protein_id gnl|my_center|LOCUS_04240 18871 17981 gene locus_tag LOCUS_04250 gene nadC 18871 17981 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770545.1 protein_id gnl|my_center|LOCUS_04250 19022 19390 gene locus_tag LOCUS_04260 19022 19390 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_04260 20355 19402 gene locus_tag LOCUS_04270 20355 19402 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813337.1 protein_id gnl|my_center|LOCUS_04270 21108 20359 gene locus_tag LOCUS_04280 21108 20359 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_04280 <21893 21143 gene locus_tag LOCUS_04290 <21893 21143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810108.1:acetyl-CoA C-acyltransferase >Feature sequence015 488 563 gene locus_tag LOCUS_t00040 488 563 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 883 722 gene locus_tag LOCUS_04300 883 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 1095 3410 gene locus_tag LOCUS_04310 1095 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3486 4046 gene locus_tag LOCUS_04320 gene rfbC 3486 4046 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015242878.1 protein_id gnl|my_center|LOCUS_04320 4043 5269 gene locus_tag LOCUS_04330 4043 5269 CDS product methyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707820.1 protein_id gnl|my_center|LOCUS_04330 5674 6516 gene locus_tag LOCUS_04340 5674 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 6513 7511 gene locus_tag LOCUS_04350 6513 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 7508 8623 gene locus_tag LOCUS_04360 7508 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 8628 9410 gene locus_tag LOCUS_04370 8628 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 9547 10395 gene locus_tag LOCUS_04380 9547 10395 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976075.1 protein_id gnl|my_center|LOCUS_04380 10379 11131 gene locus_tag LOCUS_04390 10379 11131 CDS product cephalosporin hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526207.1 protein_id gnl|my_center|LOCUS_04390 11190 11963 gene locus_tag LOCUS_04400 gene rfbF 11190 11963 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261038.1 protein_id gnl|my_center|LOCUS_04400 11960 13042 gene locus_tag LOCUS_04410 gene rfbG 11960 13042 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_04410 13422 16421 gene locus_tag LOCUS_04420 13422 16421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 16877 16410 gene locus_tag LOCUS_04430 16877 16410 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 protein_id gnl|my_center|LOCUS_04430 18481 16910 gene locus_tag LOCUS_04440 18481 16910 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_04440 18614 19816 gene locus_tag LOCUS_04450 18614 19816 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085815.1 protein_id gnl|my_center|LOCUS_04450 >Feature sequence016 1527 772 gene locus_tag LOCUS_04460 1527 772 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 protein_id gnl|my_center|LOCUS_04460 2084 1524 gene locus_tag LOCUS_04470 2084 1524 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038173.1 protein_id gnl|my_center|LOCUS_04470 3133 2081 gene locus_tag LOCUS_04480 gene cobT 3133 2081 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112354.1 protein_id gnl|my_center|LOCUS_04480 3666 3130 gene locus_tag LOCUS_04490 gene cobU 3666 3130 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_04490 4537 3656 gene locus_tag LOCUS_04500 4537 3656 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_04500 6071 4587 gene locus_tag LOCUS_04510 gene rmuC 6071 4587 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704261.1 protein_id gnl|my_center|LOCUS_04510 7703 6099 gene locus_tag LOCUS_04520 7703 6099 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440221.1 protein_id gnl|my_center|LOCUS_04520 7787 8005 gene locus_tag LOCUS_04530 7787 8005 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_04530 8286 11957 gene locus_tag LOCUS_04540 8286 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 12927 12019 gene locus_tag LOCUS_04550 12927 12019 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090741.1 protein_id gnl|my_center|LOCUS_04550 13135 13521 gene locus_tag LOCUS_04560 13135 13521 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_04560 15179 13467 gene locus_tag LOCUS_04570 gene pgm 15179 13467 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268077.1 protein_id gnl|my_center|LOCUS_04570 16612 15371 gene locus_tag LOCUS_04580 16612 15371 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535007.1 protein_id gnl|my_center|LOCUS_04580 18337 16709 gene locus_tag LOCUS_04590 18337 16709 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence017 3 773 gene locus_tag LOCUS_04600 3 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 770 1222 gene locus_tag LOCUS_04610 770 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2125 1760 gene locus_tag LOCUS_04620 2125 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2244 2609 gene locus_tag LOCUS_04630 2244 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 2640 3338 gene locus_tag LOCUS_04640 2640 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3342 4352 gene locus_tag LOCUS_04650 gene fliM 3342 4352 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 protein_id gnl|my_center|LOCUS_04650 4349 4807 gene locus_tag LOCUS_04660 gene fliN 4349 4807 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184995.1 protein_id gnl|my_center|LOCUS_04660 4825 5196 gene locus_tag LOCUS_04670 4825 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 5205 5942 gene locus_tag LOCUS_04680 gene fliP 5205 5942 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253411.1 protein_id gnl|my_center|LOCUS_04680 5939 6211 gene locus_tag LOCUS_04690 gene fliQ 5939 6211 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500315.1 protein_id gnl|my_center|LOCUS_04690 6214 7011 gene locus_tag LOCUS_04700 gene fliR 6214 7011 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201278.1 protein_id gnl|my_center|LOCUS_04700 8278 7028 gene locus_tag LOCUS_04710 gene flgL 8278 7028 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200262.1 protein_id gnl|my_center|LOCUS_04710 10200 8290 gene locus_tag LOCUS_04720 gene flgK 10200 8290 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203463.1 protein_id gnl|my_center|LOCUS_04720 10618 10193 gene locus_tag LOCUS_04730 10618 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 11732 10620 gene locus_tag LOCUS_04740 11732 10620 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 protein_id gnl|my_center|LOCUS_04740 12426 11740 gene locus_tag LOCUS_04750 12426 11740 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447174.1 protein_id gnl|my_center|LOCUS_04750 13218 12433 gene locus_tag LOCUS_04760 gene flgG 13218 12433 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625851.1 protein_id gnl|my_center|LOCUS_04760 13995 13234 gene locus_tag LOCUS_04770 gene flgF 13995 13234 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_04770 15280 14012 gene locus_tag LOCUS_04780 gene flgE 15280 14012 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197255.1 protein_id gnl|my_center|LOCUS_04780 16036 15308 gene locus_tag LOCUS_04790 gene flgD 16036 15308 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535718.1 protein_id gnl|my_center|LOCUS_04790 16457 16047 gene locus_tag LOCUS_04800 gene flgC 16457 16047 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367329.1 protein_id gnl|my_center|LOCUS_04800 16867 16463 gene locus_tag LOCUS_04810 gene flgB 16867 16463 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097783.1 protein_id gnl|my_center|LOCUS_04810 16997 17689 gene locus_tag LOCUS_04820 gene flgA 16997 17689 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367331.1 protein_id gnl|my_center|LOCUS_04820 >Feature sequence018 1378 2460 gene locus_tag LOCUS_04830 gene apbC 1378 2460 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_04830 2522 3088 gene locus_tag LOCUS_04840 gene dcd 2522 3088 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_04840 3341 3655 gene locus_tag LOCUS_04850 3341 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 3639 4190 gene locus_tag LOCUS_04860 3639 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 4187 5119 gene locus_tag LOCUS_04870 4187 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 5254 6729 gene locus_tag LOCUS_04880 5254 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 6736 7098 gene locus_tag LOCUS_04890 6736 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 7189 9339 gene locus_tag LOCUS_04900 7189 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 9356 10150 gene locus_tag LOCUS_04910 9356 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 10299 10973 gene locus_tag LOCUS_04920 10299 10973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 11025 11675 gene locus_tag LOCUS_04930 11025 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 12112 11684 gene locus_tag LOCUS_04940 12112 11684 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_04940 12225 14174 gene locus_tag LOCUS_04950 12225 14174 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_04950 14171 14764 gene locus_tag LOCUS_04960 14171 14764 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_04960 14761 15249 gene locus_tag LOCUS_04970 14761 15249 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811409.1 protein_id gnl|my_center|LOCUS_04970 15246 16508 gene locus_tag LOCUS_04980 gene ccmI 15246 16508 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 protein_id gnl|my_center|LOCUS_04980 16523 17128 gene locus_tag LOCUS_04990 gene ccmA 16523 17128 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525573.1 protein_id gnl|my_center|LOCUS_04990 17125 17793 gene locus_tag LOCUS_05000 gene ccmB 17125 17793 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_05000 >Feature sequence019 <1 1065 gene locus_tag LOCUS_05010 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193517.1:transcription termination factor NusA 1082 3907 gene locus_tag LOCUS_05020 gene infB 1082 3907 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025871401.1 protein_id gnl|my_center|LOCUS_05020 3915 4283 gene locus_tag LOCUS_05030 gene rbfA 3915 4283 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095188.1 protein_id gnl|my_center|LOCUS_05030 4261 5211 gene locus_tag LOCUS_05040 gene truB 4261 5211 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_05040 5295 7016 gene locus_tag LOCUS_05050 5295 7016 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_05050 8015 7068 gene locus_tag LOCUS_05060 8015 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 11792 8082 gene locus_tag LOCUS_05070 gene hrpA 11792 8082 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930878.1 protein_id gnl|my_center|LOCUS_05070 13504 11840 gene locus_tag LOCUS_05080 13504 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012729952.1 protein_id gnl|my_center|LOCUS_05080 13769 13563 gene locus_tag LOCUS_05090 gene rpmE 13769 13563 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027123.1 protein_id gnl|my_center|LOCUS_05090 15117 13858 gene locus_tag LOCUS_05100 gene rho 15117 13858 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_05100 15582 15259 gene locus_tag LOCUS_05110 gene trxA 15582 15259 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191795.1 protein_id gnl|my_center|LOCUS_05110 15772 16098 gene locus_tag LOCUS_05120 15772 16098 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205776.1 protein_id gnl|my_center|LOCUS_05120 16743 16126 gene locus_tag LOCUS_05130 16743 16126 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_05130 >Feature sequence020 994 281 gene locus_tag LOCUS_05140 gene pyrH 994 281 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 protein_id gnl|my_center|LOCUS_05140 1892 1008 gene locus_tag LOCUS_05150 gene tsf 1892 1008 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197087.1 protein_id gnl|my_center|LOCUS_05150 2702 1959 gene locus_tag LOCUS_05160 gene rpsB 2702 1959 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_05160 2854 3651 gene locus_tag LOCUS_05170 gene map 2854 3651 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_05170 3654 6212 gene locus_tag LOCUS_05180 3654 6212 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544413.1 protein_id gnl|my_center|LOCUS_05180 6767 6228 gene locus_tag LOCUS_05190 gene def 6767 6228 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814412.1 protein_id gnl|my_center|LOCUS_05190 7637 6768 gene locus_tag LOCUS_05200 gene galU 7637 6768 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225519.1 protein_id gnl|my_center|LOCUS_05200 9655 7634 gene locus_tag LOCUS_05210 gene ligA 9655 7634 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192539.1 protein_id gnl|my_center|LOCUS_05210 10703 9669 gene locus_tag LOCUS_05220 10703 9669 CDS product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813876.1 protein_id gnl|my_center|LOCUS_05220 14220 10714 gene locus_tag LOCUS_05230 gene smc 14220 10714 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198894.1 protein_id gnl|my_center|LOCUS_05230 14288 14716 gene locus_tag LOCUS_05240 14288 14716 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_05240 14656 15909 gene locus_tag LOCUS_05250 gene dapC 14656 15909 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448163.1 protein_id gnl|my_center|LOCUS_05250 15924 16748 gene locus_tag LOCUS_05260 gene dapD 15924 16748 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186643.1 protein_id gnl|my_center|LOCUS_05260 >Feature sequence021 <1 1021 gene locus_tag LOCUS_05270 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705454.1:EAL domain-containing protein 1078 989 gene locus_tag LOCUS_t00050 1078 989 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1760 1125 gene locus_tag LOCUS_05280 1760 1125 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976633.1 protein_id gnl|my_center|LOCUS_05280 3220 1760 gene locus_tag LOCUS_05290 3220 1760 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_05290 4356 3217 gene locus_tag LOCUS_05300 4356 3217 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_05300 7499 4353 gene locus_tag LOCUS_05310 7499 4353 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_05310 8253 7615 gene locus_tag LOCUS_05320 gene leuD 8253 7615 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_05320 9656 8253 gene locus_tag LOCUS_05330 gene leuC 9656 8253 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_05330 9807 10835 gene locus_tag LOCUS_05340 9807 10835 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218953.1 protein_id gnl|my_center|LOCUS_05340 10935 12035 gene locus_tag LOCUS_05350 gene aroC 10935 12035 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534774.1 protein_id gnl|my_center|LOCUS_05350 13378 11999 gene locus_tag LOCUS_05360 13378 11999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 14190 13375 gene locus_tag LOCUS_05370 14190 13375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 14892 14191 gene locus_tag LOCUS_05380 14892 14191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 15063 15650 gene locus_tag LOCUS_05390 15063 15650 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_05390 16460 15651 gene locus_tag LOCUS_05400 16460 15651 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687893.1 protein_id gnl|my_center|LOCUS_05400 >Feature sequence022 <1 628 gene locus_tag LOCUS_05410 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004557316.1:c-type cytochrome 825 2087 gene locus_tag LOCUS_05420 825 2087 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_05420 2078 6160 gene locus_tag LOCUS_05430 2078 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 6728 6324 gene locus_tag LOCUS_05440 6728 6324 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969926.1 protein_id gnl|my_center|LOCUS_05440 6997 6725 gene locus_tag LOCUS_05450 6997 6725 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536345.1 protein_id gnl|my_center|LOCUS_05450 7953 7540 gene locus_tag LOCUS_05460 7953 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 8411 8172 gene locus_tag LOCUS_05470 8411 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 8842 10056 gene locus_tag LOCUS_05480 8842 10056 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963666.1 protein_id gnl|my_center|LOCUS_05480 10053 11093 gene locus_tag LOCUS_05490 10053 11093 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_05490 11293 11135 gene locus_tag LOCUS_05500 11293 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 11493 11290 gene locus_tag LOCUS_05510 11493 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05510 11934 11569 gene locus_tag LOCUS_05520 11934 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 12095 13078 gene locus_tag LOCUS_05530 gene glk 12095 13078 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_05530 13752 13036 gene locus_tag LOCUS_05540 13752 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence023 <1 503 gene locus_tag LOCUS_05550 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267488.1:methyl-accepting chemotaxis protein 600 4112 gene locus_tag LOCUS_05560 600 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 4153 5799 gene locus_tag LOCUS_05570 4153 5799 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_05570 5796 6638 gene locus_tag LOCUS_05580 gene kdsA 5796 6638 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813703.1 protein_id gnl|my_center|LOCUS_05580 6692 7975 gene locus_tag LOCUS_05590 gene eno 6692 7975 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_05590 7991 8308 gene locus_tag LOCUS_05600 7991 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 9141 8302 gene locus_tag LOCUS_05610 9141 8302 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193722.1 protein_id gnl|my_center|LOCUS_05610 9125 10111 gene locus_tag LOCUS_05620 gene rluD 9125 10111 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 protein_id gnl|my_center|LOCUS_05620 10104 10826 gene locus_tag LOCUS_05630 gene pgeF 10104 10826 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_05630 10899 11657 gene locus_tag LOCUS_05640 10899 11657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 12158 11556 gene locus_tag LOCUS_05650 gene phaR 12158 11556 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813585.1 protein_id gnl|my_center|LOCUS_05650 12526 13878 gene locus_tag LOCUS_05660 gene rimO 12526 13878 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521351.1 protein_id gnl|my_center|LOCUS_05660 13865 14755 gene locus_tag LOCUS_05670 13865 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037015.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence024 33 989 gene locus_tag LOCUS_05680 33 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 986 1654 gene locus_tag LOCUS_05690 986 1654 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815073.1 protein_id gnl|my_center|LOCUS_05690 1651 2547 gene locus_tag LOCUS_05700 1651 2547 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040576.1 protein_id gnl|my_center|LOCUS_05700 2600 3472 gene locus_tag LOCUS_05710 gene rpoH 2600 3472 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040728.1 protein_id gnl|my_center|LOCUS_05710 4202 3486 gene locus_tag LOCUS_05720 gene zapD 4202 3486 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_05720 4956 4327 gene locus_tag LOCUS_05730 gene coaE 4956 4327 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540596.1 protein_id gnl|my_center|LOCUS_05730 5633 4953 gene locus_tag LOCUS_05740 5633 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 6928 5633 gene locus_tag LOCUS_05750 6928 5633 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_05750 7748 6921 gene locus_tag LOCUS_05760 gene ccsA 7748 6921 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538773.1 protein_id gnl|my_center|LOCUS_05760 7797 9149 gene locus_tag LOCUS_05770 gene ffh 7797 9149 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929607.1 protein_id gnl|my_center|LOCUS_05770 10867 9167 gene locus_tag LOCUS_05780 10867 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 11421 11110 gene locus_tag LOCUS_05790 11421 11110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 12041 11475 gene locus_tag LOCUS_05800 12041 11475 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_05800 12712 12038 gene locus_tag LOCUS_05810 12712 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 13122 12712 gene locus_tag LOCUS_05820 13122 12712 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380333.1 protein_id gnl|my_center|LOCUS_05820 13817 13137 gene locus_tag LOCUS_05830 13817 13137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence025 <1 534 gene locus_tag LOCUS_05840 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930095.1:DNA gyrase subunit A 540 1619 gene locus_tag LOCUS_05850 gene serC 540 1619 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_05850 1612 2697 gene locus_tag LOCUS_05860 gene pheA 1612 2697 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689394.1 protein_id gnl|my_center|LOCUS_05860 2694 3824 gene locus_tag LOCUS_05870 gene hisC 2694 3824 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_05870 3821 4708 gene locus_tag LOCUS_05880 3821 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 4705 6030 gene locus_tag LOCUS_05890 4705 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05890 6027 6689 gene locus_tag LOCUS_05900 gene cmk 6027 6689 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930100.1 protein_id gnl|my_center|LOCUS_05900 6812 8530 gene locus_tag LOCUS_05910 gene rpsA 6812 8530 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691321.1 protein_id gnl|my_center|LOCUS_05910 8542 8847 gene locus_tag LOCUS_05920 8542 8847 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_05920 8945 9226 gene locus_tag LOCUS_05930 8945 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 9271 10455 gene locus_tag LOCUS_05940 gene lapB 9271 10455 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_05940 10471 11178 gene locus_tag LOCUS_05950 gene pyrF 10471 11178 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481650.1 protein_id gnl|my_center|LOCUS_05950 11175 12497 gene locus_tag LOCUS_05960 11175 12497 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527508.1 protein_id gnl|my_center|LOCUS_05960 12497 13441 gene locus_tag LOCUS_05970 gene rfaE1 12497 13441 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189069.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence026 <1 1220 gene locus_tag LOCUS_05980 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704298.1:murein hydrolase activator EnvC 1266 2702 gene locus_tag LOCUS_05990 gene cptA 1266 2702 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929911.1 protein_id gnl|my_center|LOCUS_05990 2723 3484 gene locus_tag LOCUS_06000 gene moeB 2723 3484 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198009.1 protein_id gnl|my_center|LOCUS_06000 4530 3499 gene locus_tag LOCUS_06010 gene tsaD 4530 3499 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930524.1 protein_id gnl|my_center|LOCUS_06010 4692 5237 gene locus_tag LOCUS_06020 4692 5237 CDS product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266352.1 protein_id gnl|my_center|LOCUS_06020 5248 6003 gene locus_tag LOCUS_06030 5248 6003 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438215.1 protein_id gnl|my_center|LOCUS_06030 6085 7158 gene locus_tag LOCUS_06040 gene leuB 6085 7158 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812648.1 protein_id gnl|my_center|LOCUS_06040 7170 8297 gene locus_tag LOCUS_06050 gene asd 7170 8297 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038629675.1 protein_id gnl|my_center|LOCUS_06050 8301 9071 gene locus_tag LOCUS_06060 gene truA 8301 9071 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 protein_id gnl|my_center|LOCUS_06060 9068 9706 gene locus_tag LOCUS_06070 9068 9706 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_06070 9706 10905 gene locus_tag LOCUS_06080 gene trpB 9706 10905 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 protein_id gnl|my_center|LOCUS_06080 10918 11721 gene locus_tag LOCUS_06090 gene trpA 10918 11721 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_06090 11718 12593 gene locus_tag LOCUS_06100 gene accD 11718 12593 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_06100 12598 13290 gene locus_tag LOCUS_06110 12598 13290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 13862 13284 gene locus_tag LOCUS_06120 13862 13284 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811815.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence027 944 435 gene locus_tag LOCUS_06130 944 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 2004 925 gene locus_tag LOCUS_06140 2004 925 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_06140 2737 2486 gene locus_tag LOCUS_06150 2737 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 2992 3255 gene locus_tag LOCUS_06160 2992 3255 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_06160 3245 3511 gene locus_tag LOCUS_06170 3245 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_06170 3520 3687 gene locus_tag LOCUS_06180 3520 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3972 3742 gene locus_tag LOCUS_06190 3972 3742 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_06190 4166 3990 gene locus_tag LOCUS_06200 4166 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06200 4565 4296 gene locus_tag LOCUS_06210 4565 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 5930 4605 gene locus_tag LOCUS_06220 5930 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 6996 5959 gene locus_tag LOCUS_06230 6996 5959 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933388.1 protein_id gnl|my_center|LOCUS_06230 7641 7096 gene locus_tag LOCUS_06240 7641 7096 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087169.1 protein_id gnl|my_center|LOCUS_06240 8467 8114 gene locus_tag LOCUS_06250 8467 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 9322 8846 gene locus_tag LOCUS_06260 9322 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 9950 9654 gene locus_tag LOCUS_06270 9950 9654 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 protein_id gnl|my_center|LOCUS_06270 10210 9938 gene locus_tag LOCUS_06280 10210 9938 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071642.1 protein_id gnl|my_center|LOCUS_06280 11982 10576 gene locus_tag LOCUS_06290 11982 10576 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130564469.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06290 13852 12203 gene locus_tag LOCUS_06300 13852 12203 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040121148.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence028 <1 3458 gene locus_tag LOCUS_06310 <1 3458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069129909.1:GLUG motif-containing protein 3583 5307 gene locus_tag LOCUS_06320 3583 5307 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 protein_id gnl|my_center|LOCUS_06320 7171 5348 gene locus_tag LOCUS_06330 7171 5348 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_06330 7109 7342 gene locus_tag LOCUS_06340 7109 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 8500 7280 gene locus_tag LOCUS_06350 8500 7280 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence029 79 1029 gene locus_tag LOCUS_06360 79 1029 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_06360 1100 1765 gene locus_tag LOCUS_06370 1100 1765 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_06370 1807 2388 gene locus_tag LOCUS_06380 gene pth 1807 2388 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 protein_id gnl|my_center|LOCUS_06380 2401 3492 gene locus_tag LOCUS_06390 gene ychF 2401 3492 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 protein_id gnl|my_center|LOCUS_06390 3576 4442 gene locus_tag LOCUS_06400 3576 4442 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527983.1 protein_id gnl|my_center|LOCUS_06400 4449 4706 gene locus_tag LOCUS_06410 4449 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 4735 5997 gene locus_tag LOCUS_06420 4735 5997 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387806.1 protein_id gnl|my_center|LOCUS_06420 6074 6442 gene locus_tag LOCUS_06430 6074 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 6420 8702 gene locus_tag LOCUS_06440 6420 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 8749 9876 gene locus_tag LOCUS_06450 8749 9876 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807138.1 protein_id gnl|my_center|LOCUS_06450 9873 10715 gene locus_tag LOCUS_06460 9873 10715 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_06460 10708 10980 gene locus_tag LOCUS_06470 10708 10980 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_06470 10992 11651 gene locus_tag LOCUS_06480 gene lipB 10992 11651 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038550.1 protein_id gnl|my_center|LOCUS_06480 11648 12580 gene locus_tag LOCUS_06490 gene lipA 11648 12580 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522930.1 protein_id gnl|my_center|LOCUS_06490 13138 12584 gene locus_tag LOCUS_06500 13138 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence030 <1 1067 gene locus_tag LOCUS_06510 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037442.1:DNA mismatch repair endonuclease MutL 1046 2005 gene locus_tag LOCUS_06520 gene miaA 1046 2005 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065014.1 protein_id gnl|my_center|LOCUS_06520 3350 2025 gene locus_tag LOCUS_06530 gene xseA 3350 2025 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812887.1 protein_id gnl|my_center|LOCUS_06530 3648 4250 gene locus_tag LOCUS_06540 3648 4250 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_06540 4247 4660 gene locus_tag LOCUS_06550 4247 4660 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_06550 4661 5677 gene locus_tag LOCUS_06560 gene lpxK 4661 5677 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555967.1 protein_id gnl|my_center|LOCUS_06560 5670 5849 gene locus_tag LOCUS_06570 5670 5849 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196455.1 protein_id gnl|my_center|LOCUS_06570 5846 6622 gene locus_tag LOCUS_06580 gene kdsB 5846 6622 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_06580 6662 7318 gene locus_tag LOCUS_06590 gene adk 6662 7318 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_06590 7381 8640 gene locus_tag LOCUS_06600 7381 8640 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_06600 9151 8630 gene locus_tag LOCUS_06610 gene folA 9151 8630 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_06610 10790 9135 gene locus_tag LOCUS_06620 10790 9135 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 protein_id gnl|my_center|LOCUS_06620 12058 10787 gene locus_tag LOCUS_06630 12058 10787 CDS product metabolite/H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529121.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence031 1671 484 gene locus_tag LOCUS_06640 1671 484 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195784.1 protein_id gnl|my_center|LOCUS_06640 1899 2804 gene locus_tag LOCUS_06650 1899 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2826 6224 gene locus_tag LOCUS_06660 gene recC 2826 6224 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 protein_id gnl|my_center|LOCUS_06660 6217 9741 gene locus_tag LOCUS_06670 gene recB 6217 9741 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266564.1 protein_id gnl|my_center|LOCUS_06670 9738 11657 gene locus_tag LOCUS_06680 gene recD 9738 11657 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103277.1 protein_id gnl|my_center|LOCUS_06680 11769 12740 gene locus_tag LOCUS_06690 gene ispB 11769 12740 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807467.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence032 11 973 gene locus_tag LOCUS_06700 11 973 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_06700 948 1940 gene locus_tag LOCUS_06710 948 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2028 2453 gene locus_tag LOCUS_06720 gene ndk 2028 2453 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810689.1 protein_id gnl|my_center|LOCUS_06720 2465 3547 gene locus_tag LOCUS_06730 gene rlmN 2465 3547 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_06730 3544 4197 gene locus_tag LOCUS_06740 3544 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 4194 5435 gene locus_tag LOCUS_06750 gene ispG 4194 5435 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_06750 5432 6700 gene locus_tag LOCUS_06760 gene hisS 5432 6700 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_06760 6705 7337 gene locus_tag LOCUS_06770 6705 7337 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810700.1 protein_id gnl|my_center|LOCUS_06770 7334 8461 gene locus_tag LOCUS_06780 gene bamB 7334 8461 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815787.1 protein_id gnl|my_center|LOCUS_06780 8448 9881 gene locus_tag LOCUS_06790 gene der 8448 9881 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_06790 9893 11809 gene locus_tag LOCUS_06800 gene thrS 9893 11809 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812608.1 protein_id gnl|my_center|LOCUS_06800 11873 12463 gene locus_tag LOCUS_06810 gene infC 11873 12463 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence033 1 399 gene locus_tag LOCUS_06820 1 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 1141 410 gene locus_tag LOCUS_06830 gene dnaQ 1141 410 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_06830 1578 1129 gene locus_tag LOCUS_06840 gene rnhA 1578 1129 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968914.1 protein_id gnl|my_center|LOCUS_06840 2396 1575 gene locus_tag LOCUS_06850 2396 1575 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814735.1 protein_id gnl|my_center|LOCUS_06850 2416 3195 gene locus_tag LOCUS_06860 gene gloB 2416 3195 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939287.1 protein_id gnl|my_center|LOCUS_06860 3189 4610 gene locus_tag LOCUS_06870 3189 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 6262 4592 gene locus_tag LOCUS_06880 6262 4592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_06880 7299 6259 gene locus_tag LOCUS_06890 7299 6259 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206615.1 protein_id gnl|my_center|LOCUS_06890 8250 7306 gene locus_tag LOCUS_06900 8250 7306 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 protein_id gnl|my_center|LOCUS_06900 10032 8263 gene locus_tag LOCUS_06910 10032 8263 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206613.1 protein_id gnl|my_center|LOCUS_06910 10170 10955 gene locus_tag LOCUS_06920 gene fabI 10170 10955 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 protein_id gnl|my_center|LOCUS_06920 <12627 11000 gene locus_tag LOCUS_06930 <12627 11000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063879.1:SurA N-terminal domain-containing protein >Feature sequence034 <1 1339 gene locus_tag LOCUS_06940 <1 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000188255.1:Fe(3+) dicitrate transport protein FecA 1559 1897 gene locus_tag LOCUS_06950 1559 1897 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193987.1 protein_id gnl|my_center|LOCUS_06950 3088 1934 gene locus_tag LOCUS_06960 3088 1934 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230480.1 protein_id gnl|my_center|LOCUS_06960 3582 3085 gene locus_tag LOCUS_06970 gene purE 3582 3085 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_06970 4631 3588 gene locus_tag LOCUS_06980 4631 3588 CDS product bifunctional UDP-4-keto-pentose/UDP-xylose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193921.1 protein_id gnl|my_center|LOCUS_06980 5650 4721 gene locus_tag LOCUS_06990 5650 4721 CDS product formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192441.1 protein_id gnl|my_center|LOCUS_06990 6608 5643 gene locus_tag LOCUS_07000 6608 5643 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191549.1 protein_id gnl|my_center|LOCUS_07000 7744 6605 gene locus_tag LOCUS_07010 7744 6605 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527179.1 protein_id gnl|my_center|LOCUS_07010 8102 7731 gene locus_tag LOCUS_07020 8102 7731 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_07020 9751 8099 gene locus_tag LOCUS_07030 9751 8099 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193449.1 protein_id gnl|my_center|LOCUS_07030 10726 9761 gene locus_tag LOCUS_07040 gene trxB 10726 9761 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186294.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence035 <1 1060 gene locus_tag LOCUS_07050 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189552.1:NADP-dependent isocitrate dehydrogenase 1680 1237 gene locus_tag LOCUS_07060 gene smpB 1680 1237 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_07060 1729 2163 gene locus_tag LOCUS_07070 1729 2163 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_07070 2167 2436 gene locus_tag LOCUS_07080 2167 2436 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112990.1 protein_id gnl|my_center|LOCUS_07080 2888 2406 gene locus_tag LOCUS_07090 2888 2406 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142755.1 protein_id gnl|my_center|LOCUS_07090 2964 3185 gene locus_tag LOCUS_07100 2964 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 3258 4712 gene locus_tag LOCUS_07110 3258 4712 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538218.1 protein_id gnl|my_center|LOCUS_07110 4700 5431 gene locus_tag LOCUS_07120 4700 5431 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_07120 5435 6274 gene locus_tag LOCUS_07130 gene mutM 5435 6274 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522858.1 protein_id gnl|my_center|LOCUS_07130 6932 6240 gene locus_tag LOCUS_07140 gene can 6932 6240 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189176.1 protein_id gnl|my_center|LOCUS_07140 7779 6997 gene locus_tag LOCUS_07150 7779 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 9335 7776 gene locus_tag LOCUS_07160 9335 7776 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_07160 10665 9355 gene locus_tag LOCUS_07170 10665 9355 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941159.1 protein_id gnl|my_center|LOCUS_07170 <11938 10949 gene locus_tag LOCUS_07180 <11938 10949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810103.1:AMP-binding protein >Feature sequence036 1716 463 gene locus_tag LOCUS_07190 1716 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2640 1882 gene locus_tag LOCUS_07200 2640 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 6238 2969 gene locus_tag LOCUS_07210 6238 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 6668 7243 gene locus_tag LOCUS_07220 6668 7243 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689643.1 protein_id gnl|my_center|LOCUS_07220 7495 7256 gene locus_tag LOCUS_07230 7495 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 7791 7492 gene locus_tag LOCUS_07240 7791 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 8773 7946 gene locus_tag LOCUS_07250 gene rsmA 8773 7946 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931413.1 protein_id gnl|my_center|LOCUS_07250 9765 8770 gene locus_tag LOCUS_07260 gene pdxA 9765 8770 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188905.1 protein_id gnl|my_center|LOCUS_07260 11149 9755 gene locus_tag LOCUS_07270 11149 9755 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence037 541 206 gene locus_tag LOCUS_07280 541 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 2314 1898 gene locus_tag LOCUS_07290 2314 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2315 2572 gene locus_tag LOCUS_07300 2315 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 3146 3748 gene locus_tag LOCUS_07310 3146 3748 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_07310 3745 5334 gene locus_tag LOCUS_07320 3745 5334 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103418.1 protein_id gnl|my_center|LOCUS_07320 5324 6583 gene locus_tag LOCUS_07330 5324 6583 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926902.1 protein_id gnl|my_center|LOCUS_07330 6600 8366 gene locus_tag LOCUS_07340 6600 8366 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_07340 8376 11513 gene locus_tag LOCUS_07350 8376 11513 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence038 2 295 gene locus_tag LOCUS_07360 2 295 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 protein_id gnl|my_center|LOCUS_07360 1437 289 gene locus_tag LOCUS_07370 1437 289 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_07370 2993 1437 gene locus_tag LOCUS_07380 gene xrtA 2993 1437 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_07380 4204 2990 gene locus_tag LOCUS_07390 4204 2990 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_07390 3204 3275 gene locus_tag LOCUS_t00060 3204 3275 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5235 4204 gene locus_tag LOCUS_07400 5235 4204 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_07400 6074 5232 gene locus_tag LOCUS_07410 6074 5232 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_07410 7239 6079 gene locus_tag LOCUS_07420 gene wecB 7239 6079 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_07420 8272 7229 gene locus_tag LOCUS_07430 8272 7229 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_07430 9922 8327 gene locus_tag LOCUS_07440 9922 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 10847 9906 gene locus_tag LOCUS_07450 10847 9906 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390867.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence039 84 743 gene locus_tag LOCUS_07460 gene pmrA 84 743 CDS product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 protein_id gnl|my_center|LOCUS_07460 771 2201 gene locus_tag LOCUS_07470 771 2201 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770760.1 protein_id gnl|my_center|LOCUS_07470 2569 2123 gene locus_tag LOCUS_07480 2569 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3585 2566 gene locus_tag LOCUS_07490 gene recA 3585 2566 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_07490 4293 3745 gene locus_tag LOCUS_07500 gene pncC 4293 3745 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478554.1 protein_id gnl|my_center|LOCUS_07500 4768 4280 gene locus_tag LOCUS_07510 4768 4280 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194201.1 protein_id gnl|my_center|LOCUS_07510 5739 4765 gene locus_tag LOCUS_07520 gene thiL 5739 4765 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_07520 6202 5756 gene locus_tag LOCUS_07530 gene nusB 6202 5756 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185707.1 protein_id gnl|my_center|LOCUS_07530 6657 6199 gene locus_tag LOCUS_07540 gene ribH 6657 6199 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064457.1 protein_id gnl|my_center|LOCUS_07540 7789 6674 gene locus_tag LOCUS_07550 gene ribBA 7789 6674 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039073.1 protein_id gnl|my_center|LOCUS_07550 8438 7818 gene locus_tag LOCUS_07560 8438 7818 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_07560 9553 8423 gene locus_tag LOCUS_07570 gene ribD 9553 8423 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113051.1 protein_id gnl|my_center|LOCUS_07570 9986 9543 gene locus_tag LOCUS_07580 gene nrdR 9986 9543 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 protein_id gnl|my_center|LOCUS_07580 <11135 9995 gene locus_tag LOCUS_07590 <11135 9995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522380.1:metalloprotease PmbA >Feature sequence040 2926 266 gene locus_tag LOCUS_07600 2926 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 9110 4200 gene locus_tag LOCUS_07610 9110 4200 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102960.1 protein_id gnl|my_center|LOCUS_07610 9237 9416 gene locus_tag LOCUS_07620 9237 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 9782 9420 gene locus_tag LOCUS_07630 9782 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 9927 10541 gene locus_tag LOCUS_07640 9927 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence041 514 1455 gene locus_tag LOCUS_07650 gene gshB 514 1455 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316740.1 protein_id gnl|my_center|LOCUS_07650 2453 1398 gene locus_tag LOCUS_07660 2453 1398 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_07660 5208 2446 gene locus_tag LOCUS_07670 gene ppc 5208 2446 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085739.1 protein_id gnl|my_center|LOCUS_07670 5236 6207 gene locus_tag LOCUS_07680 gene hemC 5236 6207 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812742.1 protein_id gnl|my_center|LOCUS_07680 6212 6949 gene locus_tag LOCUS_07690 6212 6949 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114032.1 protein_id gnl|my_center|LOCUS_07690 6942 7934 gene locus_tag LOCUS_07700 6942 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 7931 8455 gene locus_tag LOCUS_07710 7931 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 9460 8444 gene locus_tag LOCUS_07720 9460 8444 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_07720 9496 10347 gene locus_tag LOCUS_07730 9496 10347 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204919.1 protein_id gnl|my_center|LOCUS_07730 10406 10840 gene locus_tag LOCUS_07740 gene aroQ 10406 10840 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068810.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence042 2447 3607 gene locus_tag LOCUS_07750 2447 3607 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195190.1 protein_id gnl|my_center|LOCUS_07750 3623 4108 gene locus_tag LOCUS_07760 3623 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 4382 4789 gene locus_tag LOCUS_07770 4382 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 4997 5179 gene locus_tag LOCUS_07780 4997 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 5363 6058 gene locus_tag LOCUS_07790 5363 6058 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_07790 6242 6688 gene locus_tag LOCUS_07800 6242 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550170.1 protein_id gnl|my_center|LOCUS_07800 6685 6987 gene locus_tag LOCUS_07810 6685 6987 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303876.1 protein_id gnl|my_center|LOCUS_07810 8682 7045 gene locus_tag LOCUS_07820 8682 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 10446 8683 gene locus_tag LOCUS_07830 gene aspS 10446 8683 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence043 2674 1958 gene locus_tag LOCUS_07840 2674 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 3091 2696 gene locus_tag LOCUS_07850 3091 2696 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969221.1 protein_id gnl|my_center|LOCUS_07850 3284 4438 gene locus_tag LOCUS_07860 3284 4438 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_07860 5116 4499 gene locus_tag LOCUS_07870 5116 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 5211 5540 gene locus_tag LOCUS_07880 5211 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 6331 5561 gene locus_tag LOCUS_07890 gene hypB 6331 5561 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337668.1 protein_id gnl|my_center|LOCUS_07890 6801 6460 gene locus_tag LOCUS_07900 gene hypA 6801 6460 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_07900 7006 9315 gene locus_tag LOCUS_07910 gene hypF 7006 9315 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258631.1 protein_id gnl|my_center|LOCUS_07910 9361 10365 gene locus_tag LOCUS_07920 gene hypE 9361 10365 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence044 66 500 gene locus_tag LOCUS_07930 66 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 505 783 gene locus_tag LOCUS_07940 505 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 799 1431 gene locus_tag LOCUS_07950 gene parA 799 1431 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 protein_id gnl|my_center|LOCUS_07950 1422 1622 gene locus_tag LOCUS_07960 1422 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 1820 2623 gene locus_tag LOCUS_07970 1820 2623 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_07970 2661 4994 gene locus_tag LOCUS_07980 2661 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 4991 5167 gene locus_tag LOCUS_07990 4991 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 5174 6187 gene locus_tag LOCUS_08000 5174 6187 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809529.1 protein_id gnl|my_center|LOCUS_08000 7223 6168 gene locus_tag LOCUS_08010 7223 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 7423 8409 gene locus_tag LOCUS_08020 7423 8409 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_08020 9006 8431 gene locus_tag LOCUS_08030 9006 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 9872 9018 gene locus_tag LOCUS_08040 9872 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057947.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence045 2306 960 gene locus_tag LOCUS_08050 gene murF 2306 960 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 protein_id gnl|my_center|LOCUS_08050 3817 2303 gene locus_tag LOCUS_08060 3817 2303 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224920.1 protein_id gnl|my_center|LOCUS_08060 5547 3814 gene locus_tag LOCUS_08070 5547 3814 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195138.1 protein_id gnl|my_center|LOCUS_08070 5831 5544 gene locus_tag LOCUS_08080 5831 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 6772 5828 gene locus_tag LOCUS_08090 gene rsmH 6772 5828 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697441.1 protein_id gnl|my_center|LOCUS_08090 7257 6778 gene locus_tag LOCUS_08100 7257 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 7430 7702 gene locus_tag LOCUS_08110 7430 7702 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887863.1 protein_id gnl|my_center|LOCUS_08110 7699 9564 gene locus_tag LOCUS_08120 7699 9564 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence046 561 22 gene locus_tag LOCUS_08130 561 22 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_08130 729 1676 gene locus_tag LOCUS_08140 729 1676 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192001.1 protein_id gnl|my_center|LOCUS_08140 1690 2454 gene locus_tag LOCUS_08150 1690 2454 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448285.1 protein_id gnl|my_center|LOCUS_08150 2471 3433 gene locus_tag LOCUS_08160 2471 3433 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524705.1 protein_id gnl|my_center|LOCUS_08160 5349 3457 gene locus_tag LOCUS_08170 gene htpG 5349 3457 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064608.1 protein_id gnl|my_center|LOCUS_08170 5994 5422 gene locus_tag LOCUS_08180 5994 5422 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040134.1 protein_id gnl|my_center|LOCUS_08180 7453 6002 gene locus_tag LOCUS_08190 gene nuoN 7453 6002 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186468.1 protein_id gnl|my_center|LOCUS_08190 8945 7464 gene locus_tag LOCUS_08200 8945 7464 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247436.1 protein_id gnl|my_center|LOCUS_08200 <9860 8961 gene locus_tag LOCUS_08210 <9860 8961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526462.1:NADH-quinone oxidoreductase subunit L >Feature sequence047 112 1362 gene locus_tag LOCUS_08220 112 1362 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 protein_id gnl|my_center|LOCUS_08220 1359 2615 gene locus_tag LOCUS_08230 1359 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 2612 5791 gene locus_tag LOCUS_08240 2612 5791 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704244.1 protein_id gnl|my_center|LOCUS_08240 5796 6170 gene locus_tag LOCUS_08250 5796 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 6738 6662 gene locus_tag LOCUS_t00070 6738 6662 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6845 6770 gene locus_tag LOCUS_t00080 6845 6770 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7126 6854 gene locus_tag LOCUS_08260 7126 6854 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_08260 9712 7274 gene locus_tag LOCUS_08270 gene lon 9712 7274 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence048 1581 82 gene locus_tag LOCUS_08280 1581 82 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_08280 2130 1594 gene locus_tag LOCUS_08290 2130 1594 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_08290 2884 2123 gene locus_tag LOCUS_08300 2884 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4507 2897 gene locus_tag LOCUS_08310 4507 2897 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_08310 4397 4687 gene locus_tag LOCUS_08320 4397 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 7216 4787 gene locus_tag LOCUS_08330 gene ppsA 7216 4787 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941469.1 protein_id gnl|my_center|LOCUS_08330 8245 7277 gene locus_tag LOCUS_08340 8245 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 8465 8719 gene locus_tag LOCUS_08350 8465 8719 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940976.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence049 2546 1482 gene locus_tag LOCUS_08360 gene fba 2546 1482 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022162.1 protein_id gnl|my_center|LOCUS_08360 3299 2586 gene locus_tag LOCUS_08370 3299 2586 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208197.1 protein_id gnl|my_center|LOCUS_08370 4177 3299 gene locus_tag LOCUS_08380 4177 3299 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_08380 5292 4225 gene locus_tag LOCUS_08390 5292 4225 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035354.1 protein_id gnl|my_center|LOCUS_08390 6657 5818 gene locus_tag LOCUS_08400 6657 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 8231 6663 gene locus_tag LOCUS_08410 8231 6663 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980887.1 protein_id gnl|my_center|LOCUS_08410 9285 8425 gene locus_tag LOCUS_08420 9285 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence050 428 2566 gene locus_tag LOCUS_08430 428 2566 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_08430 2614 3306 gene locus_tag LOCUS_08440 2614 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_08440 3380 4270 gene locus_tag LOCUS_08450 gene trpI 3380 4270 CDS product trpBA operon transcriptional activator TrpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114633.1 protein_id gnl|my_center|LOCUS_08450 4311 4694 gene locus_tag LOCUS_08460 4311 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 4699 5529 gene locus_tag LOCUS_08470 4699 5529 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524357.1 protein_id gnl|my_center|LOCUS_08470 5498 6073 gene locus_tag LOCUS_08480 5498 6073 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919360.1 protein_id gnl|my_center|LOCUS_08480 7512 6067 gene locus_tag LOCUS_08490 7512 6067 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529087.1 protein_id gnl|my_center|LOCUS_08490 8427 7537 gene locus_tag LOCUS_08500 8427 7537 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546070.1 protein_id gnl|my_center|LOCUS_08500 8764 8462 gene locus_tag LOCUS_08510 8764 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence051 503 369 gene locus_tag LOCUS_08520 503 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 3925 557 gene locus_tag LOCUS_08530 3925 557 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946472.1 protein_id gnl|my_center|LOCUS_08530 4475 4056 gene locus_tag LOCUS_08540 4475 4056 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_08540 6356 4500 gene locus_tag LOCUS_08550 gene ilvD 6356 4500 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 protein_id gnl|my_center|LOCUS_08550 7671 6436 gene locus_tag LOCUS_08560 7671 6436 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535007.1 protein_id gnl|my_center|LOCUS_08560 8336 7734 gene locus_tag LOCUS_08570 gene wrbA 8336 7734 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918676.1 protein_id gnl|my_center|LOCUS_08570 8586 8759 gene locus_tag LOCUS_08580 8586 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence052 335 703 gene locus_tag LOCUS_08590 gene tnpA 335 703 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862466.1 protein_id gnl|my_center|LOCUS_08590 1945 737 gene locus_tag LOCUS_08600 1945 737 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815311.1 protein_id gnl|my_center|LOCUS_08600 1835 2320 gene locus_tag LOCUS_08610 1835 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2953 2201 gene locus_tag LOCUS_08620 2953 2201 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815312.1 protein_id gnl|my_center|LOCUS_08620 3283 3990 gene locus_tag LOCUS_08630 3283 3990 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_08630 4300 6411 gene locus_tag LOCUS_08640 4300 6411 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266825.1 protein_id gnl|my_center|LOCUS_08640 6427 7563 gene locus_tag LOCUS_08650 6427 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 8456 7587 gene locus_tag LOCUS_08660 8456 7587 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence053 613 266 gene locus_tag LOCUS_08670 gene rplU 613 266 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_08670 2127 1681 gene locus_tag LOCUS_08680 2127 1681 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525383.1 protein_id gnl|my_center|LOCUS_08680 2483 2689 gene locus_tag LOCUS_08690 2483 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2837 3016 gene locus_tag LOCUS_08700 2837 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3082 3315 gene locus_tag LOCUS_08710 3082 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 4005 3352 gene locus_tag LOCUS_08720 4005 3352 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_08720 4121 4468 gene locus_tag LOCUS_08730 4121 4468 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096245.1 protein_id gnl|my_center|LOCUS_08730 4488 5219 gene locus_tag LOCUS_08740 4488 5219 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190252.1 protein_id gnl|my_center|LOCUS_08740 5231 6547 gene locus_tag LOCUS_08750 5231 6547 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890424.1 protein_id gnl|my_center|LOCUS_08750 8007 6901 gene locus_tag LOCUS_08760 8007 6901 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030522745.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence054 2148 679 gene locus_tag LOCUS_08770 gene gatA 2148 679 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_08770 2451 2158 gene locus_tag LOCUS_08780 gene gatC 2451 2158 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_08780 2525 3568 gene locus_tag LOCUS_08790 2525 3568 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_08790 3591 4505 gene locus_tag LOCUS_08800 gene mreC 3591 4505 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163136.1 protein_id gnl|my_center|LOCUS_08800 4507 5034 gene locus_tag LOCUS_08810 4507 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 5036 6925 gene locus_tag LOCUS_08820 gene mrdA 5036 6925 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08820 6918 8012 gene locus_tag LOCUS_08830 gene rodA 6918 8012 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence055 268 1455 gene locus_tag LOCUS_08840 268 1455 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195784.1 protein_id gnl|my_center|LOCUS_08840 1452 2567 gene locus_tag LOCUS_08850 1452 2567 CDS product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195787.1 protein_id gnl|my_center|LOCUS_08850 2634 3482 gene locus_tag LOCUS_08860 2634 3482 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705198.1 protein_id gnl|my_center|LOCUS_08860 4307 3528 gene locus_tag LOCUS_08870 4307 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 4501 4415 gene locus_tag LOCUS_t00090 4501 4415 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4519 5574 gene locus_tag LOCUS_08880 gene queA 4519 5574 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064321.1 protein_id gnl|my_center|LOCUS_08880 5564 6670 gene locus_tag LOCUS_08890 gene tgt 5564 6670 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194199.1 protein_id gnl|my_center|LOCUS_08890 6712 7029 gene locus_tag LOCUS_08900 gene yajC 6712 7029 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence056 259 786 gene locus_tag LOCUS_08910 259 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 783 3329 gene locus_tag LOCUS_08920 783 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3941 3474 gene locus_tag LOCUS_08930 3941 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 5142 3916 gene locus_tag LOCUS_08940 5142 3916 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459849.1 protein_id gnl|my_center|LOCUS_08940 5386 5117 gene locus_tag LOCUS_08950 5386 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 5549 6373 gene locus_tag LOCUS_08960 5549 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 6384 7106 gene locus_tag LOCUS_08970 6384 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 7099 7821 gene locus_tag LOCUS_08980 7099 7821 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142413611.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence057 96 2741 gene locus_tag LOCUS_08990 96 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2747 3583 gene locus_tag LOCUS_09000 2747 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09000 6008 3588 gene locus_tag LOCUS_09010 gene gyrB 6008 3588 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 protein_id gnl|my_center|LOCUS_09010 7079 6051 gene locus_tag LOCUS_09020 gene dnaN 7079 6051 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_09020 <8288 7378 gene locus_tag LOCUS_09030 <8288 7378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004204805.1:chromosomal replication initiator protein DnaA >Feature sequence058 1102 707 gene locus_tag LOCUS_09040 1102 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6570 1447 gene locus_tag LOCUS_09050 6570 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 <8213 6567 gene locus_tag LOCUS_09060 <8213 6567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388264.1:malto-oligosyltrehalose trehalohydrolase >Feature sequence059 41 116 gene locus_tag LOCUS_t00100 41 116 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 414 223 gene locus_tag LOCUS_09070 414 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 706 368 gene locus_tag LOCUS_09080 706 368 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525420.1 protein_id gnl|my_center|LOCUS_09080 1434 2030 gene locus_tag LOCUS_09090 1434 2030 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526832.1 protein_id gnl|my_center|LOCUS_09090 2023 3045 gene locus_tag LOCUS_09100 2023 3045 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967225.1 protein_id gnl|my_center|LOCUS_09100 3304 4569 gene locus_tag LOCUS_09110 3304 4569 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_09110 4566 5219 gene locus_tag LOCUS_09120 gene nadD 4566 5219 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 protein_id gnl|my_center|LOCUS_09120 5216 5638 gene locus_tag LOCUS_09130 5216 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 5635 6105 gene locus_tag LOCUS_09140 gene rlmH 5635 6105 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_09140 6117 7571 gene locus_tag LOCUS_09150 gene rng 6117 7571 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186679.1 protein_id gnl|my_center|LOCUS_09150 <8065 7564 gene locus_tag LOCUS_09160 <8065 7564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194943.1:YggT family protein >Feature sequence060 3587 1806 gene locus_tag LOCUS_09170 3587 1806 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811551.1 protein_id gnl|my_center|LOCUS_09170 4308 3640 gene locus_tag LOCUS_09180 4308 3640 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039897.1 protein_id gnl|my_center|LOCUS_09180 4219 4443 gene locus_tag LOCUS_09190 4219 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 5393 4410 gene locus_tag LOCUS_09200 5393 4410 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931328.1 protein_id gnl|my_center|LOCUS_09200 5465 7009 gene locus_tag LOCUS_09210 5465 7009 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706228.1 protein_id gnl|my_center|LOCUS_09210 7102 7527 gene locus_tag LOCUS_09220 gene rimP 7102 7527 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence061 <1 791 gene locus_tag LOCUS_09230 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002223072.1:glutamine-hydrolyzing GMP synthase 1352 936 gene locus_tag LOCUS_09240 gene hicB 1352 936 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 protein_id gnl|my_center|LOCUS_09240 1546 1364 gene locus_tag LOCUS_09250 1546 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1924 4479 gene locus_tag LOCUS_09260 1924 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 4999 5074 gene locus_tag LOCUS_t00110 4999 5074 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5318 5860 gene locus_tag LOCUS_09270 5318 5860 CDS product DUF3617 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378325.1 protein_id gnl|my_center|LOCUS_09270 6500 5925 gene locus_tag LOCUS_09280 6500 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 7122 6955 gene locus_tag LOCUS_09290 7122 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence062 885 118 gene locus_tag LOCUS_09300 gene xth 885 118 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_09300 1107 1658 gene locus_tag LOCUS_09310 1107 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2348 1710 gene locus_tag LOCUS_09320 2348 1710 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036208.1 protein_id gnl|my_center|LOCUS_09320 2488 3066 gene locus_tag LOCUS_09330 2488 3066 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_09330 3059 3559 gene locus_tag LOCUS_09340 gene ruvX 3059 3559 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186163.1 protein_id gnl|my_center|LOCUS_09340 3552 4517 gene locus_tag LOCUS_09350 3552 4517 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_09350 4531 5814 gene locus_tag LOCUS_09360 4531 5814 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence063 38 976 gene locus_tag LOCUS_09370 38 976 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530313.1 protein_id gnl|my_center|LOCUS_09370 964 1731 gene locus_tag LOCUS_09380 964 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1849 2622 gene locus_tag LOCUS_09390 1849 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2628 3254 gene locus_tag LOCUS_09400 2628 3254 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819116.1 protein_id gnl|my_center|LOCUS_09400 3354 3482 gene locus_tag LOCUS_09410 3354 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 3605 4129 gene locus_tag LOCUS_09420 3605 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4610 4149 gene locus_tag LOCUS_09430 4610 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4986 4546 gene locus_tag LOCUS_09440 4986 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 6278 4983 gene locus_tag LOCUS_09450 gene ccoG 6278 4983 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707874.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence064 1519 614 gene locus_tag LOCUS_09460 1519 614 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096380.1 protein_id gnl|my_center|LOCUS_09460 4399 1715 gene locus_tag LOCUS_09470 4399 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 5428 4571 gene locus_tag LOCUS_09480 5428 4571 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_09480 6242 5415 gene locus_tag LOCUS_09490 6242 5415 CDS product hydrolase 2, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390871.1 protein_id gnl|my_center|LOCUS_09490 6523 6239 gene locus_tag LOCUS_09500 6523 6239 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_09500 7079 6630 gene locus_tag LOCUS_09510 7079 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence065 1596 991 gene locus_tag LOCUS_09520 1596 991 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_09520 1807 3408 gene locus_tag LOCUS_09530 1807 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3423 4517 gene locus_tag LOCUS_09540 3423 4517 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_09540 6149 4641 gene locus_tag LOCUS_09550 6149 4641 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 protein_id gnl|my_center|LOCUS_09550 6539 6463 gene locus_tag LOCUS_t00120 6539 6463 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7030 6560 gene locus_tag LOCUS_09560 7030 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence066 3016 2420 gene locus_tag LOCUS_09570 3016 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3250 4866 gene locus_tag LOCUS_09580 3250 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 4887 5975 gene locus_tag LOCUS_09590 4887 5975 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence067 29 670 gene locus_tag LOCUS_09600 gene rqpR 29 670 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_09600 2948 750 gene locus_tag LOCUS_09610 2948 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3413 2952 gene locus_tag LOCUS_09620 3413 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3844 3410 gene locus_tag LOCUS_09630 3844 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 4080 5618 gene locus_tag LOCUS_09640 4080 5618 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 protein_id gnl|my_center|LOCUS_09640 5795 5935 gene locus_tag LOCUS_09650 5795 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 <6954 6057 gene locus_tag LOCUS_09660 <6954 6057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201217495.1:EAL domain-containing protein >Feature sequence068 <1 1503 gene locus_tag LOCUS_09670 <1 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192700.1:ATP-dependent DNA helicase 1724 1969 gene locus_tag LOCUS_09680 1724 1969 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010433119.1 protein_id gnl|my_center|LOCUS_09680 1962 2252 gene locus_tag LOCUS_09690 1962 2252 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190833654.1 protein_id gnl|my_center|LOCUS_09690 3644 2298 gene locus_tag LOCUS_09700 3644 2298 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196632.1 protein_id gnl|my_center|LOCUS_09700 4369 3641 gene locus_tag LOCUS_09710 gene ompR 4369 3641 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208914.1 protein_id gnl|my_center|LOCUS_09710 5166 4453 gene locus_tag LOCUS_09720 5166 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 5639 5184 gene locus_tag LOCUS_09730 gene rimI 5639 5184 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191864.1 protein_id gnl|my_center|LOCUS_09730 6331 5636 gene locus_tag LOCUS_09740 6331 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09740 <6885 6328 gene locus_tag LOCUS_09750 <6885 6328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813878.1:lysophospholipid transporter LplT >Feature sequence069 1489 239 gene locus_tag LOCUS_09760 1489 239 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202285.1 protein_id gnl|my_center|LOCUS_09760 1963 2820 gene locus_tag LOCUS_09770 gene birA 1963 2820 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 protein_id gnl|my_center|LOCUS_09770 2822 3559 gene locus_tag LOCUS_09780 2822 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09780 4029 3544 gene locus_tag LOCUS_09790 gene rfaE2 4029 3544 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686901.1 protein_id gnl|my_center|LOCUS_09790 4735 4037 gene locus_tag LOCUS_09800 4735 4037 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524381.1 protein_id gnl|my_center|LOCUS_09800 5343 4732 gene locus_tag LOCUS_09810 5343 4732 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 protein_id gnl|my_center|LOCUS_09810 6255 5371 gene locus_tag LOCUS_09820 gene rsmI 6255 5371 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770442.1 protein_id gnl|my_center|LOCUS_09820 6266 6628 gene locus_tag LOCUS_09830 6266 6628 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024665649.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence070 2015 447 gene locus_tag LOCUS_09840 2015 447 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_09840 3913 2102 gene locus_tag LOCUS_09850 gene typA 3913 2102 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818637.1 protein_id gnl|my_center|LOCUS_09850 4003 4908 gene locus_tag LOCUS_09860 4003 4908 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191750.1 protein_id gnl|my_center|LOCUS_09860 4956 5417 gene locus_tag LOCUS_09870 4956 5417 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence071 1911 445 gene locus_tag LOCUS_09880 1911 445 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267691.1 protein_id gnl|my_center|LOCUS_09880 3138 2641 gene locus_tag LOCUS_09890 3138 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 3429 3238 gene locus_tag LOCUS_09900 3429 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence072 144 620 gene locus_tag LOCUS_09910 144 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 709 1128 gene locus_tag LOCUS_09920 709 1128 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_09920 1145 2476 gene locus_tag LOCUS_09930 1145 2476 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_09930 2478 3062 gene locus_tag LOCUS_09940 2478 3062 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_09940 3142 4971 gene locus_tag LOCUS_09950 gene glmS 3142 4971 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 protein_id gnl|my_center|LOCUS_09950 4968 6101 gene locus_tag LOCUS_09960 gene pyrC 4968 6101 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence073 78 1304 gene locus_tag LOCUS_09970 78 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967751.1 protein_id gnl|my_center|LOCUS_09970 1301 2647 gene locus_tag LOCUS_09980 1301 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971043.1 protein_id gnl|my_center|LOCUS_09980 2775 4010 gene locus_tag LOCUS_09990 2775 4010 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943170.1 protein_id gnl|my_center|LOCUS_09990 4010 4711 gene locus_tag LOCUS_10000 gene queC 4010 4711 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_10000 4708 5751 gene locus_tag LOCUS_10010 4708 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 5755 6402 gene locus_tag LOCUS_10020 gene queE 5755 6402 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810901.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence074 <1 508 gene locus_tag LOCUS_10030 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338272.1:[NiFe]-hydrogenase assembly chaperone HybE 508 1578 gene locus_tag LOCUS_10040 508 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1571 1912 gene locus_tag LOCUS_10050 gene hypA 1571 1912 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_10050 1922 2782 gene locus_tag LOCUS_10060 gene hypB 1922 2782 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338275.1 protein_id gnl|my_center|LOCUS_10060 2734 5091 gene locus_tag LOCUS_10070 gene hypF 2734 5091 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948176.1 protein_id gnl|my_center|LOCUS_10070 5093 5347 gene locus_tag LOCUS_10080 5093 5347 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence075 526 230 gene locus_tag LOCUS_10090 526 230 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807672.1 protein_id gnl|my_center|LOCUS_10090 669 1445 gene locus_tag LOCUS_10100 669 1445 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_10100 1451 2191 gene locus_tag LOCUS_10110 gene trmJ 1451 2191 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_10110 2198 2881 gene locus_tag LOCUS_10120 gene cysE 2198 2881 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_10120 2894 3229 gene locus_tag LOCUS_10130 gene iscA 2894 3229 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence076 1539 970 gene locus_tag LOCUS_10140 1539 970 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_10140 1753 2469 gene locus_tag LOCUS_10150 gene fnr 1753 2469 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 protein_id gnl|my_center|LOCUS_10150 2703 3347 gene locus_tag LOCUS_10160 2703 3347 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173596.1 protein_id gnl|my_center|LOCUS_10160 3558 4961 gene locus_tag LOCUS_10170 gene hemN 3558 4961 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064046.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence077 591 2201 gene locus_tag LOCUS_10180 591 2201 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_10180 2503 2300 gene locus_tag LOCUS_10190 2503 2300 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_10190 2838 3146 gene locus_tag LOCUS_10200 gene clpS 2838 3146 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064083.1 protein_id gnl|my_center|LOCUS_10200 3143 5407 gene locus_tag LOCUS_10210 gene clpA 3143 5407 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence078 967 221 gene locus_tag LOCUS_10220 967 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1364 957 gene locus_tag LOCUS_10230 1364 957 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 protein_id gnl|my_center|LOCUS_10230 2023 1361 gene locus_tag LOCUS_10240 2023 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4275 2038 gene locus_tag LOCUS_10250 4275 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 <6029 4462 gene locus_tag LOCUS_10260 <6029 4462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065081.1:Rne/Rng family ribonuclease >Feature sequence079 1483 482 gene locus_tag LOCUS_10270 1483 482 CDS product pellicle/biofilm biosynthesis protein PelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113953.1 protein_id gnl|my_center|LOCUS_10270 2874 1480 gene locus_tag LOCUS_10280 2874 1480 CDS product PelD GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113952.1 protein_id gnl|my_center|LOCUS_10280 3417 2887 gene locus_tag LOCUS_10290 3417 2887 CDS product pellicle/biofilm biosynthesis outer membrane protein PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091288.1 protein_id gnl|my_center|LOCUS_10290 4395 3481 gene locus_tag LOCUS_10300 4395 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 4503 4512 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence080 339 2006 gene locus_tag LOCUS_10310 gene yidC 339 2006 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524584.1 protein_id gnl|my_center|LOCUS_10310 2077 3357 gene locus_tag LOCUS_10320 gene mnmE 2077 3357 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225859.1 protein_id gnl|my_center|LOCUS_10320 3422 5305 gene locus_tag LOCUS_10330 gene mnmG 3422 5305 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195816.1 protein_id gnl|my_center|LOCUS_10330 5298 5948 gene locus_tag LOCUS_10340 gene rsmG 5298 5948 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690016.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence081 153 3548 gene locus_tag LOCUS_10350 gene recC 153 3548 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence082 370 1884 gene locus_tag LOCUS_10360 370 1884 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049561091.1 protein_id gnl|my_center|LOCUS_10360 1881 2504 gene locus_tag LOCUS_10370 1881 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 4391 2418 gene locus_tag LOCUS_10380 4391 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 <5873 4612 gene locus_tag LOCUS_10390 <5873 4612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005172694.1:two-component system response regulator GlrR >Feature sequence083 872 423 gene locus_tag LOCUS_10400 872 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2702 3736 gene locus_tag LOCUS_10410 2702 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 3891 4466 gene locus_tag LOCUS_10420 3891 4466 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_10420 4649 5806 gene locus_tag LOCUS_10430 4649 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence084 1323 244 gene locus_tag LOCUS_10440 1323 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1796 1320 gene locus_tag LOCUS_10450 1796 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 2755 2546 gene locus_tag LOCUS_10460 2755 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2994 2773 gene locus_tag LOCUS_10470 2994 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 4130 2994 gene locus_tag LOCUS_10480 4130 2994 CDS product RNA ligase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189831439.1 protein_id gnl|my_center|LOCUS_10480 4298 4140 gene locus_tag LOCUS_10490 4298 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 4701 4348 gene locus_tag LOCUS_10500 4701 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence085 <1 1178 gene locus_tag LOCUS_10510 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814951.1:acetyl-CoA carboxylase biotin carboxylase subunit 1184 2077 gene locus_tag LOCUS_10520 gene prmA 1184 2077 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931932.1 protein_id gnl|my_center|LOCUS_10520 2106 2480 gene locus_tag LOCUS_10530 gene gcvH 2106 2480 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723327.1 protein_id gnl|my_center|LOCUS_10530 2530 3030 gene locus_tag LOCUS_10540 gene tpx 2530 3030 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693150.1 protein_id gnl|my_center|LOCUS_10540 3037 3975 gene locus_tag LOCUS_10550 3037 3975 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_10550 3972 4709 gene locus_tag LOCUS_10560 3972 4709 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_10560 5516 4701 gene locus_tag LOCUS_10570 5516 4701 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186146.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence086 1205 249 gene locus_tag LOCUS_10580 1205 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1254 1790 gene locus_tag LOCUS_10590 gene rsmD 1254 1790 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269210.1 protein_id gnl|my_center|LOCUS_10590 1845 2345 gene locus_tag LOCUS_10600 gene coaD 1845 2345 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195249.1 protein_id gnl|my_center|LOCUS_10600 2360 2614 gene locus_tag LOCUS_10610 2360 2614 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_10610 2631 4391 gene locus_tag LOCUS_10620 2631 4391 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_10620 4403 4990 gene locus_tag LOCUS_10630 gene lolB 4403 4990 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768866.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence087 4 1137 gene locus_tag LOCUS_10640 gene dapE 4 1137 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930548.1 protein_id gnl|my_center|LOCUS_10640 1134 2084 gene locus_tag LOCUS_10650 gene prmB 1134 2084 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 protein_id gnl|my_center|LOCUS_10650 2823 1975 gene locus_tag LOCUS_10660 2823 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3364 2801 gene locus_tag LOCUS_10670 3364 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 4185 3361 gene locus_tag LOCUS_10680 4185 3361 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_10680 5384 4182 gene locus_tag LOCUS_10690 5384 4182 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence088 2378 276 gene locus_tag LOCUS_10700 gene pnp 2378 276 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821234.1 protein_id gnl|my_center|LOCUS_10700 2762 2493 gene locus_tag LOCUS_10710 gene rpsO 2762 2493 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217790.1 protein_id gnl|my_center|LOCUS_10710 3158 2859 gene locus_tag LOCUS_10720 3158 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 <5464 3176 gene locus_tag LOCUS_10730 <5464 3176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970965.1:nitric oxide reductase activation protein NorD >Feature sequence089 492 2810 gene locus_tag LOCUS_10740 492 2810 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_10740 2868 5030 gene locus_tag LOCUS_10750 2868 5030 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065079.1 protein_id gnl|my_center|LOCUS_10750 5334 5038 gene locus_tag LOCUS_10760 5334 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence090 1181 276 gene locus_tag LOCUS_10770 gene cyoA 1181 276 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205698.1 protein_id gnl|my_center|LOCUS_10770 1670 2308 gene locus_tag LOCUS_10780 1670 2308 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388217.1 protein_id gnl|my_center|LOCUS_10780 2365 3165 gene locus_tag LOCUS_10790 gene cobM 2365 3165 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876241.1 protein_id gnl|my_center|LOCUS_10790 3155 4021 gene locus_tag LOCUS_10800 3155 4021 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034944231.1 protein_id gnl|my_center|LOCUS_10800 4031 4699 gene locus_tag LOCUS_10810 gene cbiC 4031 4699 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence091 2319 835 gene locus_tag LOCUS_10820 gene rmuC 2319 835 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704261.1 protein_id gnl|my_center|LOCUS_10820 3987 2332 gene locus_tag LOCUS_10830 3987 2332 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440221.1 protein_id gnl|my_center|LOCUS_10830 4076 4294 gene locus_tag LOCUS_10840 4076 4294 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence092 2484 715 gene locus_tag LOCUS_10850 gene arsA 2484 715 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705614.1 protein_id gnl|my_center|LOCUS_10850 2912 2553 gene locus_tag LOCUS_10860 gene arsD 2912 2553 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817072.1 protein_id gnl|my_center|LOCUS_10860 3475 2996 gene locus_tag LOCUS_10870 3475 2996 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095198.1 protein_id gnl|my_center|LOCUS_10870 3831 3472 gene locus_tag LOCUS_10880 3831 3472 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049049137.1 protein_id gnl|my_center|LOCUS_10880 4008 4490 gene locus_tag LOCUS_10890 4008 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 4477 4917 gene locus_tag LOCUS_10900 4477 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence093 158 1489 gene locus_tag LOCUS_10910 158 1489 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_10910 1491 2075 gene locus_tag LOCUS_10920 1491 2075 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_10920 2148 3977 gene locus_tag LOCUS_10930 gene glmS 2148 3977 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 protein_id gnl|my_center|LOCUS_10930 3980 5038 gene locus_tag LOCUS_10940 gene pyrC 3980 5038 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence094 284 895 gene locus_tag LOCUS_10950 284 895 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188999.1 protein_id gnl|my_center|LOCUS_10950 914 1339 gene locus_tag LOCUS_10960 gene hemJ 914 1339 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_10960 1348 2502 gene locus_tag LOCUS_10970 1348 2502 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004465704.1 protein_id gnl|my_center|LOCUS_10970 2573 3304 gene locus_tag LOCUS_10980 gene phoB 2573 3304 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_10980 3375 4694 gene locus_tag LOCUS_10990 gene phoR 3375 4694 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815115.1 protein_id gnl|my_center|LOCUS_10990 4727 4996 gene locus_tag LOCUS_11000 4727 4996 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094362.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence095 1052 117 gene locus_tag LOCUS_11010 1052 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1708 1196 gene locus_tag LOCUS_11020 1708 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2155 1715 gene locus_tag LOCUS_11030 2155 1715 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_11030 3385 2165 gene locus_tag LOCUS_11040 3385 2165 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_11040 4676 3378 gene locus_tag LOCUS_11050 gene sufD 4676 3378 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_11050 5059 4673 gene locus_tag LOCUS_11060 5059 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence096 1418 1152 gene locus_tag LOCUS_11070 1418 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1909 1571 gene locus_tag LOCUS_11080 1909 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2502 2215 gene locus_tag LOCUS_11090 2502 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4200 3118 gene locus_tag LOCUS_11100 4200 3118 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169265.1 protein_id gnl|my_center|LOCUS_11100 4674 4204 gene locus_tag LOCUS_11110 gene cadR 4674 4204 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence097 <1 863 gene locus_tag LOCUS_11120 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958448.1:APC family permease 905 1897 gene locus_tag LOCUS_11130 905 1897 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_11130 3487 1901 gene locus_tag LOCUS_11140 3487 1901 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence098 377 673 gene locus_tag LOCUS_11150 377 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2031 721 gene locus_tag LOCUS_11160 2031 721 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_11160 2249 4855 gene locus_tag LOCUS_11170 gene mutS 2249 4855 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence099 1523 78 gene locus_tag LOCUS_11180 1523 78 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036845.1 protein_id gnl|my_center|LOCUS_11180 3751 1760 gene locus_tag LOCUS_11190 gene tkt 3751 1760 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522066.1 protein_id gnl|my_center|LOCUS_11190 4849 3809 gene locus_tag LOCUS_11200 gene fba 4849 3809 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022162.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence100 2415 346 gene locus_tag LOCUS_11210 gene glyS 2415 346 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951416.1 protein_id gnl|my_center|LOCUS_11210 3302 2412 gene locus_tag LOCUS_11220 gene glyQ 3302 2412 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218046.1 protein_id gnl|my_center|LOCUS_11220 3806 3306 gene locus_tag LOCUS_11230 3806 3306 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_11230 <4781 3803 gene locus_tag LOCUS_11240 <4781 3803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004555980.1:apolipoprotein N-acyltransferase >Feature sequence101 393 1478 gene locus_tag LOCUS_11250 gene queG 393 1478 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_11250 1510 3153 gene locus_tag LOCUS_11260 1510 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3717 3169 gene locus_tag LOCUS_11270 gene orn 3717 3169 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_11270 3800 4753 gene locus_tag LOCUS_11280 gene rsgA 3800 4753 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence102 680 2335 gene locus_tag LOCUS_11290 gene metG 680 2335 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225763.1 protein_id gnl|my_center|LOCUS_11290 2359 2790 gene locus_tag LOCUS_11300 gene tadA 2359 2790 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552523.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence103 2380 2195 gene locus_tag LOCUS_11310 2380 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3551 2634 gene locus_tag LOCUS_11320 3551 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 4212 3793 gene locus_tag LOCUS_11330 gene gloA 4212 3793 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence104 204 1136 gene locus_tag LOCUS_11340 gene prfB 204 1136 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926448.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 1141 2628 gene locus_tag LOCUS_11350 gene lysS 1141 2628 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225120.1 protein_id gnl|my_center|LOCUS_11350 2625 3869 gene locus_tag LOCUS_11360 2625 3869 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_11360 3862 4542 gene locus_tag LOCUS_11370 gene lolD 3862 4542 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688655.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence105 689 2098 gene locus_tag LOCUS_11380 gene glnA 689 2098 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192601.1 protein_id gnl|my_center|LOCUS_11380 2162 3250 gene locus_tag LOCUS_11390 gene ntrB 2162 3250 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_11390 3269 4693 gene locus_tag LOCUS_11400 gene ntrC 3269 4693 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413458.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence106 1043 354 gene locus_tag LOCUS_11410 1043 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1834 1067 gene locus_tag LOCUS_11420 1834 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11420 2183 1947 gene locus_tag LOCUS_11430 2183 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3676 4383 gene locus_tag LOCUS_11440 3676 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence107 301 696 gene locus_tag LOCUS_11450 gene rpsH 301 696 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806920.1 protein_id gnl|my_center|LOCUS_11450 713 1246 gene locus_tag LOCUS_11460 gene rplF 713 1246 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197947.1 protein_id gnl|my_center|LOCUS_11460 1259 1612 gene locus_tag LOCUS_11470 gene rplR 1259 1612 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197946.1 protein_id gnl|my_center|LOCUS_11470 1642 2148 gene locus_tag LOCUS_11480 gene rpsE 1642 2148 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 protein_id gnl|my_center|LOCUS_11480 2154 2342 gene locus_tag LOCUS_11490 gene rpmD 2154 2342 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 protein_id gnl|my_center|LOCUS_11490 2352 2798 gene locus_tag LOCUS_11500 gene rplO 2352 2798 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_11500 2804 4120 gene locus_tag LOCUS_11510 gene secY 2804 4120 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931569.1 protein_id gnl|my_center|LOCUS_11510 4123 4341 gene locus_tag LOCUS_11520 gene infA 4123 4341 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215452.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence108 1262 495 gene locus_tag LOCUS_11530 gene sufC 1262 495 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_11530 2765 1317 gene locus_tag LOCUS_11540 gene sufB 2765 1317 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_11540 3226 2768 gene locus_tag LOCUS_11550 3226 2768 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence109 <1 1838 gene locus_tag LOCUS_11560 <1 1838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004543813.1:NADH-quinone oxidoreductase subunit NuoG 1838 2878 gene locus_tag LOCUS_11570 gene nuoH 1838 2878 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 protein_id gnl|my_center|LOCUS_11570 2888 3376 gene locus_tag LOCUS_11580 gene nuoI 2888 3376 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_11580 3389 3985 gene locus_tag LOCUS_11590 3389 3985 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_11590 3985 4290 gene locus_tag LOCUS_11600 gene nuoK 3985 4290 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence110 2128 443 gene locus_tag LOCUS_11610 2128 443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_11610 3162 2125 gene locus_tag LOCUS_11620 3162 2125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206615.1 protein_id gnl|my_center|LOCUS_11620 4116 3172 gene locus_tag LOCUS_11630 4116 3172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence111 <4292 232 gene locus_tag LOCUS_11640 <4292 232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929573.1:DNA-directed RNA polymerase subunit beta >Feature sequence112 1730 1218 gene locus_tag LOCUS_11650 1730 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2174 1734 gene locus_tag LOCUS_11660 2174 1734 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_11660 3404 2184 gene locus_tag LOCUS_11670 3404 2184 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_11670 <4223 3397 gene locus_tag LOCUS_11680 <4223 3397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946340.1:Fe-S cluster assembly protein SufD >Feature sequence113 <1 2374 gene locus_tag LOCUS_11690 <1 2374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064157.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein 2388 3572 gene locus_tag LOCUS_11700 2388 3572 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189727.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence114 >Feature sequence115 1235 2305 gene locus_tag LOCUS_11710 1235 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 3351 2287 gene locus_tag LOCUS_11720 3351 2287 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184894.1 protein_id gnl|my_center|LOCUS_11720 3487 3563 gene locus_tag LOCUS_t00130 3487 3563 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence116 1245 1000 gene locus_tag LOCUS_11730 1245 1000 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_11730 2035 1277 gene locus_tag LOCUS_11740 2035 1277 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815783.1 protein_id gnl|my_center|LOCUS_11740 2784 2038 gene locus_tag LOCUS_11750 2784 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3080 2790 gene locus_tag LOCUS_11760 3080 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 3712 3077 gene locus_tag LOCUS_11770 3712 3077 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190769.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence117 2001 115 gene locus_tag LOCUS_11780 gene dxs 2001 115 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813105.1 protein_id gnl|my_center|LOCUS_11780 2910 2008 gene locus_tag LOCUS_11790 2910 2008 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525142.1 protein_id gnl|my_center|LOCUS_11790 3158 2907 gene locus_tag LOCUS_11800 3158 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence118 848 216 gene locus_tag LOCUS_11810 gene hisH 848 216 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 protein_id gnl|my_center|LOCUS_11810 1471 866 gene locus_tag LOCUS_11820 gene hisB 1471 866 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_11820 2544 1468 gene locus_tag LOCUS_11830 gene hisC 2544 1468 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_11830 3824 2547 gene locus_tag LOCUS_11840 gene hisD 3824 2547 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185201.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence119 85 621 gene locus_tag LOCUS_11850 gene cobU 85 621 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_11850 618 1670 gene locus_tag LOCUS_11860 gene cobT 618 1670 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112354.1 protein_id gnl|my_center|LOCUS_11860 1667 2227 gene locus_tag LOCUS_11870 1667 2227 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038173.1 protein_id gnl|my_center|LOCUS_11870 2224 2979 gene locus_tag LOCUS_11880 2224 2979 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence120 2665 290 gene locus_tag LOCUS_11890 gene pheT 2665 290 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687684.1 protein_id gnl|my_center|LOCUS_11890 3698 2676 gene locus_tag LOCUS_11900 gene pheS 3698 2676 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence121 2285 888 gene locus_tag LOCUS_11910 2285 888 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_11910 2774 2313 gene locus_tag LOCUS_11920 2774 2313 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_11920 3726 2821 gene locus_tag LOCUS_11930 3726 2821 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191750.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence122 267 398 gene locus_tag LOCUS_11940 267 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 538 1584 gene locus_tag LOCUS_11950 538 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence123 695 1222 gene locus_tag LOCUS_11960 695 1222 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040551.1 protein_id gnl|my_center|LOCUS_11960 1795 1232 gene locus_tag LOCUS_11970 1795 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2459 1872 gene locus_tag LOCUS_11980 2459 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence124 1173 259 gene locus_tag LOCUS_11990 gene xerD 1173 259 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203577.1 protein_id gnl|my_center|LOCUS_11990 1584 1201 gene locus_tag LOCUS_12000 gene rplS 1584 1201 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217809.1 protein_id gnl|my_center|LOCUS_12000 2354 1581 gene locus_tag LOCUS_12010 gene trmD 2354 1581 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189914.1 protein_id gnl|my_center|LOCUS_12010 2836 2354 gene locus_tag LOCUS_12020 gene rimM 2836 2354 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690619.1 protein_id gnl|my_center|LOCUS_12020 3107 2847 gene locus_tag LOCUS_12030 gene rpsP 3107 2847 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071566.1 protein_id gnl|my_center|LOCUS_12030 <3871 3203 gene locus_tag LOCUS_12040 <3871 3203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190814.1:aromatic ring-hydroxylating dioxygenase subunit alpha >Feature sequence125 347 1021 gene locus_tag LOCUS_12050 347 1021 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039970.1 protein_id gnl|my_center|LOCUS_12050 1018 1908 gene locus_tag LOCUS_12060 1018 1908 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930443.1 protein_id gnl|my_center|LOCUS_12060 2005 2589 gene locus_tag LOCUS_12070 2005 2589 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104866.1 protein_id gnl|my_center|LOCUS_12070 <3860 2598 gene locus_tag LOCUS_12080 <3860 2598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085816.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence126 339 13 gene locus_tag LOCUS_12090 339 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12090 999 463 gene locus_tag LOCUS_12100 999 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258560.1 protein_id gnl|my_center|LOCUS_12100 2390 996 gene locus_tag LOCUS_12110 2390 996 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_12110 3099 2515 gene locus_tag LOCUS_12120 3099 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 <3844 3224 gene locus_tag LOCUS_12130 <3844 3224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102960.1:DEAD/DEAH box helicase family protein >Feature sequence127 <1 751 gene locus_tag LOCUS_12140 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064074.1:branched-chain amino acid ABC transporter permease 748 1794 gene locus_tag LOCUS_12150 748 1794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 protein_id gnl|my_center|LOCUS_12150 1791 2561 gene locus_tag LOCUS_12160 1791 2561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_12160 2554 3258 gene locus_tag LOCUS_12170 2554 3258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812846.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence128 85 1908 gene locus_tag LOCUS_12180 85 1908 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_12180 2082 2693 gene locus_tag LOCUS_12190 2082 2693 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089752.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence129 595 1605 gene locus_tag LOCUS_12200 595 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1602 1862 gene locus_tag LOCUS_12210 1602 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2863 1859 gene locus_tag LOCUS_12220 gene waaF 2863 1859 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 protein_id gnl|my_center|LOCUS_12220 3054 2860 gene locus_tag LOCUS_12230 3054 2860 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814195.1 protein_id gnl|my_center|LOCUS_12230 <3620 3058 gene locus_tag LOCUS_12240 <3620 3058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188924.1:branched-chain amino acid transaminase >Feature sequence130 2118 1321 gene locus_tag LOCUS_12250 gene panB 2118 1321 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_12250 2682 2128 gene locus_tag LOCUS_12260 2682 2128 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391430.1 protein_id gnl|my_center|LOCUS_12260 3232 2699 gene locus_tag LOCUS_12270 3232 2699 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_12270 3617 3300 gene locus_tag LOCUS_12280 3617 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence131 721 182 gene locus_tag LOCUS_12290 721 182 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524734.1 protein_id gnl|my_center|LOCUS_12290 2311 761 gene locus_tag LOCUS_12300 gene ubiB 2311 761 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_12300 2892 2311 gene locus_tag LOCUS_12310 2892 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 <3525 2883 gene locus_tag LOCUS_12320 <3525 2883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815111.1:bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE >Feature sequence132 3 422 gene locus_tag LOCUS_12330 3 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1778 543 gene locus_tag LOCUS_12340 1778 543 CDS product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252603.1 protein_id gnl|my_center|LOCUS_12340 2764 1775 gene locus_tag LOCUS_12350 2764 1775 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence133 <1 1067 gene locus_tag LOCUS_12360 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704955.1:flagellar basal-body MS-ring/collar protein FliF 1064 2059 gene locus_tag LOCUS_12370 gene fliG 1064 2059 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_12370 2043 2747 gene locus_tag LOCUS_12380 gene fliH 2043 2747 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197166.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence134 <1 772 gene locus_tag LOCUS_12390 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002244171.1:DNA polymerase III subunit gamma/tau 769 1092 gene locus_tag LOCUS_12400 769 1092 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 protein_id gnl|my_center|LOCUS_12400 1099 1701 gene locus_tag LOCUS_12410 gene recR 1099 1701 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521324.1 protein_id gnl|my_center|LOCUS_12410 1719 2999 gene locus_tag LOCUS_12420 gene serS 1719 2999 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224981.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence135 999 496 gene locus_tag LOCUS_12430 999 496 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence136 657 355 gene locus_tag LOCUS_12440 gene fdxB 657 355 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084559.1 protein_id gnl|my_center|LOCUS_12440 823 659 gene locus_tag LOCUS_12450 823 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1226 816 gene locus_tag LOCUS_12460 gene nifX 1226 816 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084556.1 protein_id gnl|my_center|LOCUS_12460 2490 1249 gene locus_tag LOCUS_12470 gene nifN 2490 1249 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084555.1 protein_id gnl|my_center|LOCUS_12470 3198 2851 gene locus_tag LOCUS_12480 3198 2851 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389669.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence137 3245 1773 gene locus_tag LOCUS_12490 3245 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence138 1632 787 gene locus_tag LOCUS_12500 1632 787 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_12500 2104 1625 gene locus_tag LOCUS_12510 2104 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3068 2097 gene locus_tag LOCUS_12520 3068 2097 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066204.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence139 450 363 gene locus_tag LOCUS_t00140 450 363 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 666 1355 gene locus_tag LOCUS_12530 666 1355 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813772.1 protein_id gnl|my_center|LOCUS_12530 2714 1413 gene locus_tag LOCUS_12540 gene rlmD 2714 1413 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence140 227 700 gene locus_tag LOCUS_12550 gene bcp 227 700 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975630.1 protein_id gnl|my_center|LOCUS_12550 697 1173 gene locus_tag LOCUS_12560 697 1173 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_12560 1645 1178 gene locus_tag LOCUS_12570 1645 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence141 29 1543 gene locus_tag LOCUS_12580 29 1543 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049561091.1 protein_id gnl|my_center|LOCUS_12580 1540 2169 gene locus_tag LOCUS_12590 1540 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 <3131 2083 gene locus_tag LOCUS_12600 <3131 2083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103448.1:glucans biosynthesis glucosyltransferase MdoH >Feature sequence142 185 427 gene locus_tag LOCUS_12610 gene thiS 185 427 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_12610 482 1279 gene locus_tag LOCUS_12620 482 1279 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084517.1 protein_id gnl|my_center|LOCUS_12620 1276 1962 gene locus_tag LOCUS_12630 gene trmB 1276 1962 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222361.1 protein_id gnl|my_center|LOCUS_12630 2082 2888 gene locus_tag LOCUS_12640 2082 2888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence143 1939 1238 gene locus_tag LOCUS_12650 1939 1238 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12650 2694 1936 gene locus_tag LOCUS_12660 2694 1936 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence144 1395 160 gene locus_tag LOCUS_12670 1395 160 CDS product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252603.1 protein_id gnl|my_center|LOCUS_12670 2381 1392 gene locus_tag LOCUS_12680 2381 1392 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence145 1183 86 gene locus_tag LOCUS_12690 1183 86 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence146 <1 838 gene locus_tag LOCUS_12700 <1 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015367956.1:muropeptide MFS transporter AmpG 875 1537 gene locus_tag LOCUS_12710 gene pyrE 875 1537 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_12710 <3034 1527 gene locus_tag LOCUS_12720 <3034 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522912.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence147 390 1019 gene locus_tag LOCUS_12730 390 1019 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_12730 1037 1315 gene locus_tag LOCUS_12740 1037 1315 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_12740 1327 1614 gene locus_tag LOCUS_12750 1327 1614 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 protein_id gnl|my_center|LOCUS_12750 1919 1844 gene locus_tag LOCUS_t00150 1919 1844 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2313 2609 gene locus_tag LOCUS_12760 2313 2609 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528499.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence148 48 1250 gene locus_tag LOCUS_12770 48 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 <2926 1294 gene locus_tag LOCUS_12780 <2926 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942659.1:EAL domain-containing protein >Feature sequence149 1980 682 gene locus_tag LOCUS_12790 gene bioA 1980 682 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525973.1 protein_id gnl|my_center|LOCUS_12790 <2876 1977 gene locus_tag LOCUS_12800 <2876 1977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189736.1:8-amino-7-oxononanoate synthase >Feature sequence150 <1 1459 gene locus_tag LOCUS_12810 <1 1459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_194931144.1:methionine synthase >Feature sequence151 266 862 gene locus_tag LOCUS_12820 266 862 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_12820 862 1167 gene locus_tag LOCUS_12830 gene nuoK 862 1167 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence152 >Feature sequence153 <1 675 gene locus_tag LOCUS_12840 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085815.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence154 2265 352 gene locus_tag LOCUS_12850 2265 352 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence155 959 1282 gene locus_tag LOCUS_12860 gene fliE 959 1282 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185219.1 protein_id gnl|my_center|LOCUS_12860 2032 1283 gene locus_tag LOCUS_12870 2032 1283 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809774.1 protein_id gnl|my_center|LOCUS_12870 2328 2029 gene locus_tag LOCUS_12880 2328 2029 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811829.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence156 <1 589 gene locus_tag LOCUS_12890 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102960.1:DEAD/DEAH box helicase family protein 643 1875 gene locus_tag LOCUS_12900 643 1875 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence157 2 502 gene locus_tag LOCUS_12910 2 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12910 >Feature sequence158 <1 861 gene locus_tag LOCUS_12920 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942881.1:NAD-dependent epimerase 2257 899 gene locus_tag LOCUS_12930 2257 899 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190701.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence159 486 1430 gene locus_tag LOCUS_12940 gene fmt 486 1430 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958586.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence160 <1 1693 gene locus_tag LOCUS_12950 <1 1693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943977.1:glutamine--tRNA ligase/YqeY domain fusion protein 2483 1650 gene locus_tag LOCUS_12960 gene folE2 2483 1650 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence161 2313 1135 gene locus_tag LOCUS_12970 2313 1135 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527722.1 protein_id gnl|my_center|LOCUS_12970