>Feature sequence001 <1 1214 gene locus_tag LOCUS_00010 <1 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103411.1:glycosyltransferase 1290 2147 gene locus_tag LOCUS_00020 1290 2147 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941296.1 protein_id gnl|my_center|LOCUS_00020 2230 3273 gene locus_tag LOCUS_00030 2230 3273 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868306.1 protein_id gnl|my_center|LOCUS_00030 3446 4600 gene locus_tag LOCUS_00040 3446 4600 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 protein_id gnl|my_center|LOCUS_00040 4670 5818 gene locus_tag LOCUS_00050 4670 5818 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930613.1 protein_id gnl|my_center|LOCUS_00050 5815 6771 gene locus_tag LOCUS_00060 5815 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6824 8278 gene locus_tag LOCUS_00070 6824 8278 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 protein_id gnl|my_center|LOCUS_00070 8932 8498 gene locus_tag LOCUS_00080 8932 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9353 8922 gene locus_tag LOCUS_00090 9353 8922 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279139.1 protein_id gnl|my_center|LOCUS_00090 10133 9702 gene locus_tag LOCUS_00100 10133 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10078 11076 gene locus_tag LOCUS_00110 10078 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11266 12795 gene locus_tag LOCUS_00120 11266 12795 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448947.1 protein_id gnl|my_center|LOCUS_00120 12906 14039 gene locus_tag LOCUS_00130 gene aroB 12906 14039 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_00130 14088 15119 gene locus_tag LOCUS_00140 gene xerD 14088 15119 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447733.1 protein_id gnl|my_center|LOCUS_00140 15260 16435 gene locus_tag LOCUS_00150 15260 16435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16468 17196 gene locus_tag LOCUS_00160 16468 17196 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082164.1 protein_id gnl|my_center|LOCUS_00160 17183 21199 gene locus_tag LOCUS_00170 17183 21199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21219 24026 gene locus_tag LOCUS_00180 21219 24026 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_00180 24026 25438 gene locus_tag LOCUS_00190 24026 25438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 25443 27410 gene locus_tag LOCUS_00200 25443 27410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 27400 28206 gene locus_tag LOCUS_00210 27400 28206 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979885.1 protein_id gnl|my_center|LOCUS_00210 28216 29076 gene locus_tag LOCUS_00220 gene cobM 28216 29076 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_00220 29027 30463 gene locus_tag LOCUS_00230 29027 30463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30688 31482 gene locus_tag LOCUS_00240 gene cobJ 30688 31482 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896461.1 protein_id gnl|my_center|LOCUS_00240 31576 32508 gene locus_tag LOCUS_00250 31576 32508 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763529.1 protein_id gnl|my_center|LOCUS_00250 32559 32786 gene locus_tag LOCUS_00260 32559 32786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32917 32992 gene locus_tag LOCUS_t00010 32917 32992 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 33438 33253 gene locus_tag LOCUS_00270 33438 33253 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_00270 33650 33435 gene locus_tag LOCUS_00280 33650 33435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 35619 33925 gene locus_tag LOCUS_00290 35619 33925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 35877 36095 gene locus_tag LOCUS_00300 35877 36095 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147171.1 protein_id gnl|my_center|LOCUS_00300 36092 37024 gene locus_tag LOCUS_00310 36092 37024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37052 38266 gene locus_tag LOCUS_00320 37052 38266 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261163.1 protein_id gnl|my_center|LOCUS_00320 38403 39479 gene locus_tag LOCUS_00330 38403 39479 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_00330 39570 42761 gene locus_tag LOCUS_00340 39570 42761 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_00340 42853 43614 gene locus_tag LOCUS_00350 42853 43614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 43749 44189 gene locus_tag LOCUS_00360 43749 44189 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880218.1 protein_id gnl|my_center|LOCUS_00360 44236 44682 gene locus_tag LOCUS_00370 44236 44682 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880581.1 protein_id gnl|my_center|LOCUS_00370 44685 45695 gene locus_tag LOCUS_00380 44685 45695 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880219.1 protein_id gnl|my_center|LOCUS_00380 45837 47384 gene locus_tag LOCUS_00390 45837 47384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 47410 48555 gene locus_tag LOCUS_00400 47410 48555 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881275.1 protein_id gnl|my_center|LOCUS_00400 48645 49109 gene locus_tag LOCUS_00410 48645 49109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 49226 49384 gene locus_tag LOCUS_00420 49226 49384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 49411 50961 gene locus_tag LOCUS_00430 gene tilS 49411 50961 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_00430 51080 52969 gene locus_tag LOCUS_00440 gene ftsH 51080 52969 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_00440 52984 54207 gene locus_tag LOCUS_00450 gene folP 52984 54207 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391658.1 protein_id gnl|my_center|LOCUS_00450 54251 55072 gene locus_tag LOCUS_00460 gene cdaA 54251 55072 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_00460 55203 55865 gene locus_tag LOCUS_00470 55203 55865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 55881 57245 gene locus_tag LOCUS_00480 gene glmM 55881 57245 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_00480 57273 58019 gene locus_tag LOCUS_00490 gene pdxJ 57273 58019 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095364.1 protein_id gnl|my_center|LOCUS_00490 58031 58402 gene locus_tag LOCUS_00500 gene acpS 58031 58402 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721452.1 protein_id gnl|my_center|LOCUS_00500 58462 60108 gene locus_tag LOCUS_00510 58462 60108 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_00510 60161 60634 gene locus_tag LOCUS_00520 60161 60634 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421362.1 protein_id gnl|my_center|LOCUS_00520 60650 61111 gene locus_tag LOCUS_00530 60650 61111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 61190 62611 gene locus_tag LOCUS_00540 gene lpdA 61190 62611 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582893.1 protein_id gnl|my_center|LOCUS_00540 62666 63892 gene locus_tag LOCUS_00550 62666 63892 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_00550 63914 65530 gene locus_tag LOCUS_00560 gene cimA 63914 65530 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_00560 65530 66174 gene locus_tag LOCUS_00570 65530 66174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 67153 66227 gene locus_tag LOCUS_00580 67153 66227 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960471.1 protein_id gnl|my_center|LOCUS_00580 67488 67237 gene locus_tag LOCUS_00590 67488 67237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 >Feature sequence002 <1 860 gene locus_tag LOCUS_00600 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880416.1:TolC family protein 994 1215 gene locus_tag LOCUS_00610 994 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 2294 1488 gene locus_tag LOCUS_00620 2294 1488 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296671.1 protein_id gnl|my_center|LOCUS_00620 4113 2338 gene locus_tag LOCUS_00630 4113 2338 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_00630 5214 4138 gene locus_tag LOCUS_00640 gene ispG 5214 4138 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_00640 5368 6300 gene locus_tag LOCUS_00650 5368 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 6726 6316 gene locus_tag LOCUS_00660 6726 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 7918 6749 gene locus_tag LOCUS_00670 7918 6749 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_00670 9398 7968 gene locus_tag LOCUS_00680 9398 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 10352 9645 gene locus_tag LOCUS_00690 gene ubiE 10352 9645 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_00690 10531 10455 gene locus_tag LOCUS_t00020 10531 10455 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10695 10771 gene locus_tag LOCUS_t00030 10695 10771 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12681 10858 gene locus_tag LOCUS_00700 12681 10858 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546491.1 protein_id gnl|my_center|LOCUS_00700 13380 12820 gene locus_tag LOCUS_00710 13380 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 13802 13563 gene locus_tag LOCUS_00720 13802 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 14065 13889 gene locus_tag LOCUS_00730 14065 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 14924 14688 gene locus_tag LOCUS_00740 14924 14688 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_00740 16713 15280 gene locus_tag LOCUS_00750 16713 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 17426 17037 gene locus_tag LOCUS_00760 17426 17037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 17978 17460 gene locus_tag LOCUS_00770 17978 17460 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942173.1 protein_id gnl|my_center|LOCUS_00770 19786 18113 gene locus_tag LOCUS_00780 19786 18113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 20778 19789 gene locus_tag LOCUS_00790 20778 19789 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942172.1 protein_id gnl|my_center|LOCUS_00790 21397 20741 gene locus_tag LOCUS_00800 21397 20741 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583746.1 protein_id gnl|my_center|LOCUS_00800 22194 21394 gene locus_tag LOCUS_00810 gene surE 22194 21394 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_00810 22622 22197 gene locus_tag LOCUS_00820 22622 22197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 22911 22591 gene locus_tag LOCUS_00830 22911 22591 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_00830 23297 22947 gene locus_tag LOCUS_00840 gene rplT 23297 22947 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004727974.1 protein_id gnl|my_center|LOCUS_00840 23547 23344 gene locus_tag LOCUS_00850 gene rpmI 23547 23344 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_00850 24132 23626 gene locus_tag LOCUS_00860 gene infC 24132 23626 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895961.1 protein_id gnl|my_center|LOCUS_00860 25078 24344 gene locus_tag LOCUS_00870 25078 24344 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792195.1 protein_id gnl|my_center|LOCUS_00870 26040 25081 gene locus_tag LOCUS_00880 26040 25081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 28742 26037 gene locus_tag LOCUS_00890 gene alaS 28742 26037 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_00890 29312 28821 gene locus_tag LOCUS_00900 29312 28821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 30658 29381 gene locus_tag LOCUS_00910 30658 29381 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_00910 31717 30665 gene locus_tag LOCUS_00920 gene recA 31717 30665 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_00920 33070 31805 gene locus_tag LOCUS_00930 33070 31805 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_00930 33567 33070 gene locus_tag LOCUS_00940 33567 33070 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851418.1 protein_id gnl|my_center|LOCUS_00940 34698 33586 gene locus_tag LOCUS_00950 gene rodA 34698 33586 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_00950 36597 34702 gene locus_tag LOCUS_00960 gene mrdA 36597 34702 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_00960 37647 36613 gene locus_tag LOCUS_00970 37647 36613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 38301 37750 gene locus_tag LOCUS_00980 38301 37750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 39106 38282 gene locus_tag LOCUS_00990 gene mreC 39106 38282 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_00990 40149 39112 gene locus_tag LOCUS_01000 40149 39112 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_01000 40905 40240 gene locus_tag LOCUS_01010 40905 40240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 41791 40970 gene locus_tag LOCUS_01020 41791 40970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 42034 42411 gene locus_tag LOCUS_01030 42034 42411 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392610.1 protein_id gnl|my_center|LOCUS_01030 42466 44217 gene locus_tag LOCUS_01040 42466 44217 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_01040 44567 44175 gene locus_tag LOCUS_01050 44567 44175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 45786 44578 gene locus_tag LOCUS_01060 gene ftsZ 45786 44578 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305686.1 protein_id gnl|my_center|LOCUS_01060 47109 45874 gene locus_tag LOCUS_01070 gene ftsA 47109 45874 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_01070 48014 47148 gene locus_tag LOCUS_01080 48014 47148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 48936 48001 gene locus_tag LOCUS_01090 48936 48001 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_01090 49902 48943 gene locus_tag LOCUS_01100 gene murB 49902 48943 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546287.1 protein_id gnl|my_center|LOCUS_01100 51328 49904 gene locus_tag LOCUS_01110 gene murC 51328 49904 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_01110 52440 51325 gene locus_tag LOCUS_01120 gene murG 52440 51325 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_01120 53570 52440 gene locus_tag LOCUS_01130 gene ftsW 53570 52440 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_01130 54994 53567 gene locus_tag LOCUS_01140 gene murD 54994 53567 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583609.1 protein_id gnl|my_center|LOCUS_01140 >Feature sequence003 <1 732 gene locus_tag LOCUS_01150 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001829380.1:autolysin/adhesin Aae 733 1953 gene locus_tag LOCUS_01160 733 1953 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_01160 1974 3407 gene locus_tag LOCUS_01170 gene gnfM 1974 3407 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_01170 4322 3432 gene locus_tag LOCUS_01180 4322 3432 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_01180 4943 4338 gene locus_tag LOCUS_01190 gene purN 4943 4338 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088589.1 protein_id gnl|my_center|LOCUS_01190 6169 5111 gene locus_tag LOCUS_01200 gene purM 6169 5111 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545739.1 protein_id gnl|my_center|LOCUS_01200 6407 7369 gene locus_tag LOCUS_01210 6407 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 7427 8062 gene locus_tag LOCUS_01220 7427 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 8151 8735 gene locus_tag LOCUS_01230 8151 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 10206 8764 gene locus_tag LOCUS_01240 10206 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 10732 10382 gene locus_tag LOCUS_01250 10732 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 10853 12820 gene locus_tag LOCUS_01260 10853 12820 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880333.1 protein_id gnl|my_center|LOCUS_01260 13217 13005 gene locus_tag LOCUS_01270 13217 13005 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546825.1 protein_id gnl|my_center|LOCUS_01270 13534 13205 gene locus_tag LOCUS_01280 13534 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083794109.1 protein_id gnl|my_center|LOCUS_01280 14053 13775 gene locus_tag LOCUS_01290 14053 13775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 14345 14061 gene locus_tag LOCUS_01300 14345 14061 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_01300 15262 14531 gene locus_tag LOCUS_01310 15262 14531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 16017 15424 gene locus_tag LOCUS_01320 16017 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 16843 16268 gene locus_tag LOCUS_01330 16843 16268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 18090 16864 gene locus_tag LOCUS_01340 18090 16864 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261163.1 protein_id gnl|my_center|LOCUS_01340 19934 18168 gene locus_tag LOCUS_01350 19934 18168 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_01350 20190 20615 gene locus_tag LOCUS_01360 20190 20615 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_01360 21554 20643 gene locus_tag LOCUS_01370 gene ftsY 21554 20643 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_01370 25208 21579 gene locus_tag LOCUS_01380 gene smc 25208 21579 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_01380 25979 25233 gene locus_tag LOCUS_01390 25979 25233 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_01390 26591 25995 gene locus_tag LOCUS_01400 26591 25995 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546603.1 protein_id gnl|my_center|LOCUS_01400 27653 26781 gene locus_tag LOCUS_01410 gene rfbD 27653 26781 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_01410 28679 27663 gene locus_tag LOCUS_01420 gene rfbB 28679 27663 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_01420 30946 28700 gene locus_tag LOCUS_01430 gene lptD 30946 28700 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_01430 32250 30943 gene locus_tag LOCUS_01440 32250 30943 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_01440 33085 32243 gene locus_tag LOCUS_01450 gene accD 33085 32243 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_01450 33907 33089 gene locus_tag LOCUS_01460 gene trpA 33907 33089 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_01460 35120 33909 gene locus_tag LOCUS_01470 gene trpB 35120 33909 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_01470 35796 35107 gene locus_tag LOCUS_01480 35796 35107 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082737.1 protein_id gnl|my_center|LOCUS_01480 36652 35822 gene locus_tag LOCUS_01490 gene trpC 36652 35822 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423144.1 protein_id gnl|my_center|LOCUS_01490 37737 36697 gene locus_tag LOCUS_01500 gene trpD 37737 36697 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_01500 38326 37760 gene locus_tag LOCUS_01510 38326 37760 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 protein_id gnl|my_center|LOCUS_01510 40048 38513 gene locus_tag LOCUS_01520 gene trpE 40048 38513 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 protein_id gnl|my_center|LOCUS_01520 40521 40150 gene locus_tag LOCUS_01530 gene rplQ 40521 40150 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036134.1 protein_id gnl|my_center|LOCUS_01530 41568 40558 gene locus_tag LOCUS_01540 41568 40558 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_01540 42224 41598 gene locus_tag LOCUS_01550 gene rpsD 42224 41598 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_01550 42668 42273 gene locus_tag LOCUS_01560 gene rpsK 42668 42273 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_01560 43078 42704 gene locus_tag LOCUS_01570 gene rpsM 43078 42704 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938621.1 protein_id gnl|my_center|LOCUS_01570 43495 43274 gene locus_tag LOCUS_01580 gene infA 43495 43274 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583256.1 protein_id gnl|my_center|LOCUS_01580 44243 43503 gene locus_tag LOCUS_01590 gene map 44243 43503 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_01590 44899 44252 gene locus_tag LOCUS_01600 44899 44252 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_01600 46230 44932 gene locus_tag LOCUS_01610 gene secY 46230 44932 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_01610 46668 46234 gene locus_tag LOCUS_01620 gene rplO 46668 46234 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_01620 47181 46696 gene locus_tag LOCUS_01630 gene rpsE 47181 46696 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_01630 47561 47205 gene locus_tag LOCUS_01640 gene rplR 47561 47205 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545340.1 protein_id gnl|my_center|LOCUS_01640 48137 47598 gene locus_tag LOCUS_01650 gene rplF 48137 47598 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_01650 48633 48235 gene locus_tag LOCUS_01660 gene rpsH 48633 48235 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919141.1 protein_id gnl|my_center|LOCUS_01660 48862 48677 gene locus_tag LOCUS_01670 48862 48677 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943473.1 protein_id gnl|my_center|LOCUS_01670 49415 48873 gene locus_tag LOCUS_01680 gene rplE 49415 48873 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_01680 49748 49434 gene locus_tag LOCUS_01690 gene rplX 49748 49434 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943475.1 protein_id gnl|my_center|LOCUS_01690 50118 49750 gene locus_tag LOCUS_01700 gene rplN 50118 49750 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_01700 50392 50162 gene locus_tag LOCUS_01710 gene rpsQ 50392 50162 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_01710 >Feature sequence004 <1 1423 gene locus_tag LOCUS_01720 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193111.1:translational GTPase TypA 1514 2341 gene locus_tag LOCUS_01730 1514 2341 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329752.1 protein_id gnl|my_center|LOCUS_01730 2348 2929 gene locus_tag LOCUS_01740 2348 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 2908 4935 gene locus_tag LOCUS_01750 2908 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 4943 6457 gene locus_tag LOCUS_01760 4943 6457 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_01760 6660 8663 gene locus_tag LOCUS_01770 gene uvrB 6660 8663 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_01770 8673 10736 gene locus_tag LOCUS_01780 gene uvrC 8673 10736 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680446.1 protein_id gnl|my_center|LOCUS_01780 11918 10725 gene locus_tag LOCUS_01790 11918 10725 CDS product pyridoxal phosphate-dependent class II aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812326.1 protein_id gnl|my_center|LOCUS_01790 12675 11974 gene locus_tag LOCUS_01800 12675 11974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 12806 13234 gene locus_tag LOCUS_01810 12806 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01810 14107 13661 gene locus_tag LOCUS_01820 14107 13661 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_01820 14292 14855 gene locus_tag LOCUS_01830 14292 14855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 14900 15466 gene locus_tag LOCUS_01840 gene def 14900 15466 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_01840 15453 16553 gene locus_tag LOCUS_01850 gene fmt 15453 16553 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019095.1 protein_id gnl|my_center|LOCUS_01850 16544 17302 gene locus_tag LOCUS_01860 16544 17302 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 protein_id gnl|my_center|LOCUS_01860 18632 17310 gene locus_tag LOCUS_01870 18632 17310 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_01870 19234 18629 gene locus_tag LOCUS_01880 19234 18629 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841930.1 protein_id gnl|my_center|LOCUS_01880 21252 19405 gene locus_tag LOCUS_01890 gene iorA 21252 19405 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_01890 21821 21567 gene locus_tag LOCUS_01900 21821 21567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 21968 22459 gene locus_tag LOCUS_01910 21968 22459 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 protein_id gnl|my_center|LOCUS_01910 22472 24301 gene locus_tag LOCUS_01920 22472 24301 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966358.1 protein_id gnl|my_center|LOCUS_01920 24430 25137 gene locus_tag LOCUS_01930 24430 25137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 25180 25938 gene locus_tag LOCUS_01940 25180 25938 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546717.1 protein_id gnl|my_center|LOCUS_01940 26119 26754 gene locus_tag LOCUS_01950 gene scpB 26119 26754 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_01950 26946 27596 gene locus_tag LOCUS_01960 gene rpe 26946 27596 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_01960 27677 27753 gene locus_tag LOCUS_t00040 27677 27753 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 27925 28000 gene locus_tag LOCUS_t00050 27925 28000 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 28068 28607 gene locus_tag LOCUS_01970 28068 28607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 28674 28901 gene locus_tag LOCUS_01980 28674 28901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 30329 29079 gene locus_tag LOCUS_01990 30329 29079 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_01990 30929 31393 gene locus_tag LOCUS_02000 30929 31393 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430911.1 protein_id gnl|my_center|LOCUS_02000 31536 32399 gene locus_tag LOCUS_02010 gene speE 31536 32399 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227543.1 protein_id gnl|my_center|LOCUS_02010 32409 33293 gene locus_tag LOCUS_02020 gene speB 32409 33293 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209826.1 protein_id gnl|my_center|LOCUS_02020 33389 33862 gene locus_tag LOCUS_02030 33389 33862 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249104.1 protein_id gnl|my_center|LOCUS_02030 34015 35034 gene locus_tag LOCUS_02040 34015 35034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 35031 36098 gene locus_tag LOCUS_02050 35031 36098 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_02050 36138 36884 gene locus_tag LOCUS_02060 36138 36884 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582495.1 protein_id gnl|my_center|LOCUS_02060 36889 37752 gene locus_tag LOCUS_02070 36889 37752 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_02070 37854 38300 gene locus_tag LOCUS_02080 gene nifU 37854 38300 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_02080 38287 38595 gene locus_tag LOCUS_02090 38287 38595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 38665 39849 gene locus_tag LOCUS_02100 38665 39849 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880446.1 protein_id gnl|my_center|LOCUS_02100 39874 40383 gene locus_tag LOCUS_02110 gene tpx 39874 40383 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880278.1 protein_id gnl|my_center|LOCUS_02110 40549 40824 gene locus_tag LOCUS_02120 40549 40824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 40821 41225 gene locus_tag LOCUS_02130 40821 41225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 41357 41431 gene locus_tag LOCUS_t00060 41357 41431 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 41821 44442 gene locus_tag LOCUS_02140 41821 44442 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880933.1 protein_id gnl|my_center|LOCUS_02140 44449 45159 gene locus_tag LOCUS_02150 44449 45159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 45184 46305 gene locus_tag LOCUS_02160 gene cobT 45184 46305 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545250.1 protein_id gnl|my_center|LOCUS_02160 46310 47167 gene locus_tag LOCUS_02170 gene cobS 46310 47167 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948521.1 protein_id gnl|my_center|LOCUS_02170 47177 48841 gene locus_tag LOCUS_02180 47177 48841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 >Feature sequence005 <1 1073 gene locus_tag LOCUS_02190 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941533.1:C40 family peptidase 1146 2021 gene locus_tag LOCUS_02200 gene lgt 1146 2021 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 protein_id gnl|my_center|LOCUS_02200 4071 2200 gene locus_tag LOCUS_02210 4071 2200 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023116.1 protein_id gnl|my_center|LOCUS_02210 4404 4940 gene locus_tag LOCUS_02220 4404 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 4988 5332 gene locus_tag LOCUS_02230 4988 5332 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080550.1 protein_id gnl|my_center|LOCUS_02230 5329 6252 gene locus_tag LOCUS_02240 5329 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 6254 6463 gene locus_tag LOCUS_02250 6254 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 6645 6854 gene locus_tag LOCUS_02260 6645 6854 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142894.1 protein_id gnl|my_center|LOCUS_02260 6856 7254 gene locus_tag LOCUS_02270 6856 7254 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681217.1 protein_id gnl|my_center|LOCUS_02270 8209 7298 gene locus_tag LOCUS_02280 gene purU 8209 7298 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245802.1 protein_id gnl|my_center|LOCUS_02280 8885 8286 gene locus_tag LOCUS_02290 8885 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 9286 8912 gene locus_tag LOCUS_02300 9286 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 9527 12235 gene locus_tag LOCUS_02310 gene glnD 9527 12235 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_02310 12275 12553 gene locus_tag LOCUS_02320 12275 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 12593 13699 gene locus_tag LOCUS_02330 12593 13699 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020862650.1 protein_id gnl|my_center|LOCUS_02330 13852 14421 gene locus_tag LOCUS_02340 gene efp 13852 14421 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938955.1 protein_id gnl|my_center|LOCUS_02340 14486 15001 gene locus_tag LOCUS_02350 gene accB 14486 15001 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472859.1 protein_id gnl|my_center|LOCUS_02350 15078 16418 gene locus_tag LOCUS_02360 gene accC 15078 16418 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_02360 16623 17006 gene locus_tag LOCUS_02370 gene gcvH 16623 17006 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942661.1 protein_id gnl|my_center|LOCUS_02370 17006 17797 gene locus_tag LOCUS_02380 17006 17797 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830993.1 protein_id gnl|my_center|LOCUS_02380 18103 19575 gene locus_tag LOCUS_02390 18103 19575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 19668 20006 gene locus_tag LOCUS_02400 19668 20006 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_02400 20068 21498 gene locus_tag LOCUS_02410 20068 21498 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545822.1 protein_id gnl|my_center|LOCUS_02410 23373 21580 gene locus_tag LOCUS_02420 gene pilB 23373 21580 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_02420 23599 24996 gene locus_tag LOCUS_02430 23599 24996 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480136.1 protein_id gnl|my_center|LOCUS_02430 25064 25264 gene locus_tag LOCUS_02440 25064 25264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 25265 25618 gene locus_tag LOCUS_02450 25265 25618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 25694 27322 gene locus_tag LOCUS_02460 25694 27322 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889593.1 protein_id gnl|my_center|LOCUS_02460 27434 29161 gene locus_tag LOCUS_02470 27434 29161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 29204 29734 gene locus_tag LOCUS_02480 29204 29734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 31079 29757 gene locus_tag LOCUS_02490 31079 29757 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_02490 32079 31165 gene locus_tag LOCUS_02500 gene ccsB 32079 31165 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_02500 33470 32115 gene locus_tag LOCUS_02510 33470 32115 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_02510 33716 34798 gene locus_tag LOCUS_02520 gene hrcA 33716 34798 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_02520 34868 35545 gene locus_tag LOCUS_02530 gene grpE 34868 35545 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546170.1 protein_id gnl|my_center|LOCUS_02530 35657 37582 gene locus_tag LOCUS_02540 gene dnaK 35657 37582 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_02540 37685 38785 gene locus_tag LOCUS_02550 gene dnaJ 37685 38785 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_02550 39136 38810 gene locus_tag LOCUS_02560 39136 38810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 39207 39800 gene locus_tag LOCUS_02570 39207 39800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 >Feature sequence006 1597 329 gene locus_tag LOCUS_02580 1597 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 1822 2745 gene locus_tag LOCUS_02590 1822 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3270 2710 gene locus_tag LOCUS_02600 gene pgsA 3270 2710 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_02600 3894 3295 gene locus_tag LOCUS_02610 3894 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4572 3904 gene locus_tag LOCUS_02620 4572 3904 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870444.1 protein_id gnl|my_center|LOCUS_02620 4695 5741 gene locus_tag LOCUS_02630 gene rlmN 4695 5741 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583788.1 protein_id gnl|my_center|LOCUS_02630 6983 5715 gene locus_tag LOCUS_02640 6983 5715 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941270.1 protein_id gnl|my_center|LOCUS_02640 7912 6968 gene locus_tag LOCUS_02650 gene selD 7912 6968 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L4E1 protein_id gnl|my_center|LOCUS_02650 9826 8249 gene locus_tag LOCUS_02660 9826 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 10597 9854 gene locus_tag LOCUS_02670 10597 9854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_02670 11548 10760 gene locus_tag LOCUS_02680 11548 10760 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_02680 12193 11594 gene locus_tag LOCUS_02690 12193 11594 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_02690 13840 12401 gene locus_tag LOCUS_02700 gene selA 13840 12401 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 protein_id gnl|my_center|LOCUS_02700 14686 13889 gene locus_tag LOCUS_02710 14686 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 15099 14731 gene locus_tag LOCUS_02720 15099 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 16631 15150 gene locus_tag LOCUS_02730 16631 15150 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964280.1 protein_id gnl|my_center|LOCUS_02730 19277 16830 gene locus_tag LOCUS_02740 19277 16830 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_02740 20237 19359 gene locus_tag LOCUS_02750 gene murI 20237 19359 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_02750 20346 20759 gene locus_tag LOCUS_02760 gene queF 20346 20759 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_02760 21728 20961 gene locus_tag LOCUS_02770 21728 20961 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948177.1 protein_id gnl|my_center|LOCUS_02770 21976 23163 gene locus_tag LOCUS_02780 gene bioF 21976 23163 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_02780 23208 23987 gene locus_tag LOCUS_02790 gene bioC 23208 23987 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063017.1 protein_id gnl|my_center|LOCUS_02790 24590 24045 gene locus_tag LOCUS_02800 gene pal 24590 24045 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940363.1 protein_id gnl|my_center|LOCUS_02800 24772 25680 gene locus_tag LOCUS_02810 24772 25680 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_02810 25708 26067 gene locus_tag LOCUS_02820 25708 26067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 26085 27089 gene locus_tag LOCUS_02830 gene bioB 26085 27089 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_02830 27099 27572 gene locus_tag LOCUS_02840 gene ruvX 27099 27572 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872440.1 protein_id gnl|my_center|LOCUS_02840 27625 28662 gene locus_tag LOCUS_02850 gene mltG 27625 28662 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545006.1 protein_id gnl|my_center|LOCUS_02850 28790 29539 gene locus_tag LOCUS_02860 28790 29539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 30800 29622 gene locus_tag LOCUS_02870 30800 29622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437017.1 protein_id gnl|my_center|LOCUS_02870 31427 30816 gene locus_tag LOCUS_02880 gene modB 31427 30816 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932140.1 protein_id gnl|my_center|LOCUS_02880 31528 31722 gene locus_tag LOCUS_02890 31528 31722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 32608 31775 gene locus_tag LOCUS_02900 gene modA 32608 31775 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031846.1 protein_id gnl|my_center|LOCUS_02900 34258 32888 gene locus_tag LOCUS_02910 gene xseA 34258 32888 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_02910 35875 34328 gene locus_tag LOCUS_02920 35875 34328 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202972.1 protein_id gnl|my_center|LOCUS_02920 36493 35888 gene locus_tag LOCUS_02930 36493 35888 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817154.1 protein_id gnl|my_center|LOCUS_02930 37232 36672 gene locus_tag LOCUS_02940 37232 36672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 38708 37467 gene locus_tag LOCUS_02950 38708 37467 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_02950 <39652 38705 gene locus_tag LOCUS_02960 <39652 38705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041914012.1:polyribonucleotide nucleotidyltransferase >Feature sequence007 1371 1012 gene locus_tag LOCUS_02970 1371 1012 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880271.1 protein_id gnl|my_center|LOCUS_02970 2232 1390 gene locus_tag LOCUS_02980 2232 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2598 2242 gene locus_tag LOCUS_02990 2598 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 4174 2687 gene locus_tag LOCUS_03000 gene glpK 4174 2687 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880244.1 protein_id gnl|my_center|LOCUS_03000 5073 4189 gene locus_tag LOCUS_03010 gene rsmA 5073 4189 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016282.1 protein_id gnl|my_center|LOCUS_03010 6132 5083 gene locus_tag LOCUS_03020 gene tsaD 6132 5083 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964219.1 protein_id gnl|my_center|LOCUS_03020 6996 6142 gene locus_tag LOCUS_03030 gene cpoB 6996 6142 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097557.1 protein_id gnl|my_center|LOCUS_03030 8386 7043 gene locus_tag LOCUS_03040 gene tolB 8386 7043 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_03040 9268 8492 gene locus_tag LOCUS_03050 9268 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 9732 9277 gene locus_tag LOCUS_03060 gene tolR 9732 9277 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932318.1 protein_id gnl|my_center|LOCUS_03060 10483 9746 gene locus_tag LOCUS_03070 gene tolQ 10483 9746 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_03070 10673 13120 gene locus_tag LOCUS_03080 10673 13120 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545329.1 protein_id gnl|my_center|LOCUS_03080 13505 13984 gene locus_tag LOCUS_03090 13505 13984 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_03090 14055 14594 gene locus_tag LOCUS_03100 14055 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 15878 14622 gene locus_tag LOCUS_03110 15878 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880562.1 protein_id gnl|my_center|LOCUS_03110 16261 15953 gene locus_tag LOCUS_03120 16261 15953 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118979.1 protein_id gnl|my_center|LOCUS_03120 17080 16427 gene locus_tag LOCUS_03130 17080 16427 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957597.1 protein_id gnl|my_center|LOCUS_03130 17437 17512 gene locus_tag LOCUS_t00070 17437 17512 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18719 17691 gene locus_tag LOCUS_03140 18719 17691 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870969.1 protein_id gnl|my_center|LOCUS_03140 20422 18842 gene locus_tag LOCUS_03150 20422 18842 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682204.1 protein_id gnl|my_center|LOCUS_03150 20690 20481 gene locus_tag LOCUS_03160 20690 20481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 21965 20730 gene locus_tag LOCUS_03170 21965 20730 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_03170 22772 22125 gene locus_tag LOCUS_03180 22772 22125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 22970 24529 gene locus_tag LOCUS_03190 22970 24529 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058331.1 protein_id gnl|my_center|LOCUS_03190 25195 24731 gene locus_tag LOCUS_03200 25195 24731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 25625 25188 gene locus_tag LOCUS_03210 25625 25188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 26254 26580 gene locus_tag LOCUS_03220 26254 26580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03220 26762 26688 gene locus_tag LOCUS_t00080 26762 26688 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27558 26830 gene locus_tag LOCUS_03230 27558 26830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 28289 27597 gene locus_tag LOCUS_03240 28289 27597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 28543 28467 gene locus_tag LOCUS_t00090 28543 28467 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 29181 28615 gene locus_tag LOCUS_03250 29181 28615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 29841 29308 gene locus_tag LOCUS_03260 29841 29308 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228871.1 protein_id gnl|my_center|LOCUS_03260 30404 29922 gene locus_tag LOCUS_03270 gene smpB 30404 29922 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_03270 30845 30493 gene locus_tag LOCUS_tm00010 30845 30493 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 31955 30981 gene locus_tag LOCUS_03280 31955 30981 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_03280 33430 31973 gene locus_tag LOCUS_03290 33430 31973 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545153.1 protein_id gnl|my_center|LOCUS_03290 35013 33445 gene locus_tag LOCUS_03300 gene metG 35013 33445 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_03300 35834 35103 gene locus_tag LOCUS_03310 35834 35103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 >Feature sequence008 2570 69 gene locus_tag LOCUS_03320 2570 69 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599517.1 protein_id gnl|my_center|LOCUS_03320 2643 4196 gene locus_tag LOCUS_03330 2643 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4284 4598 gene locus_tag LOCUS_03340 4284 4598 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_03340 4610 5215 gene locus_tag LOCUS_03350 gene recR 4610 5215 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 protein_id gnl|my_center|LOCUS_03350 5217 7508 gene locus_tag LOCUS_03360 5217 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 7652 9028 gene locus_tag LOCUS_03370 gene ffh 7652 9028 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_03370 9019 9261 gene locus_tag LOCUS_03380 gene rpsP 9019 9261 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720111.1 protein_id gnl|my_center|LOCUS_03380 9258 9761 gene locus_tag LOCUS_03390 9258 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 9766 10467 gene locus_tag LOCUS_03400 gene trmD 9766 10467 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_03400 10512 10871 gene locus_tag LOCUS_03410 gene rplS 10512 10871 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_03410 10999 11394 gene locus_tag LOCUS_03420 10999 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 11445 11723 gene locus_tag LOCUS_03430 11445 11723 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081975.1 protein_id gnl|my_center|LOCUS_03430 12419 11715 gene locus_tag LOCUS_03440 gene rsmI 12419 11715 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583798.1 protein_id gnl|my_center|LOCUS_03440 13300 12425 gene locus_tag LOCUS_03450 13300 12425 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_03450 14203 13313 gene locus_tag LOCUS_03460 14203 13313 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_03460 14613 14200 gene locus_tag LOCUS_03470 14613 14200 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094547338.1 protein_id gnl|my_center|LOCUS_03470 15266 14703 gene locus_tag LOCUS_03480 15266 14703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 16754 15288 gene locus_tag LOCUS_03490 gene gltX 16754 15288 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858284.1 protein_id gnl|my_center|LOCUS_03490 17698 16877 gene locus_tag LOCUS_03500 gene amrB 17698 16877 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545930.1 protein_id gnl|my_center|LOCUS_03500 19643 17742 gene locus_tag LOCUS_03510 gene oadA 19643 17742 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545036.1 protein_id gnl|my_center|LOCUS_03510 21095 19671 gene locus_tag LOCUS_03520 21095 19671 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546372.1 protein_id gnl|my_center|LOCUS_03520 22047 21301 gene locus_tag LOCUS_03530 22047 21301 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_03530 23469 22120 gene locus_tag LOCUS_03540 gene hisS 23469 22120 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_03540 23800 23471 gene locus_tag LOCUS_03550 23800 23471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 24657 23869 gene locus_tag LOCUS_03560 gene tpiA 24657 23869 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880184.1 protein_id gnl|my_center|LOCUS_03560 27622 24824 gene locus_tag LOCUS_03570 gene ileS 27622 24824 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_03570 28743 27757 gene locus_tag LOCUS_03580 gene gyaR 28743 27757 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_03580 29178 28804 gene locus_tag LOCUS_03590 29178 28804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 29321 29707 gene locus_tag LOCUS_03600 gene gloA 29321 29707 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216418.1 protein_id gnl|my_center|LOCUS_03600 29864 29791 gene locus_tag LOCUS_t00100 29864 29791 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 31022 29970 gene locus_tag LOCUS_03610 gene amrS 31022 29970 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881217.1 protein_id gnl|my_center|LOCUS_03610 31235 32065 gene locus_tag LOCUS_03620 31235 32065 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_03620 32140 32388 gene locus_tag LOCUS_03630 32140 32388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 <33550 32704 gene locus_tag LOCUS_03640 <33550 32704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943734.1:ribonuclease J >Feature sequence009 2211 274 gene locus_tag LOCUS_03650 2211 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 2291 3067 gene locus_tag LOCUS_03660 2291 3067 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_03660 4168 3068 gene locus_tag LOCUS_03670 4168 3068 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227909.1 protein_id gnl|my_center|LOCUS_03670 5259 4171 gene locus_tag LOCUS_03680 5259 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 5410 6936 gene locus_tag LOCUS_03690 5410 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 6948 7802 gene locus_tag LOCUS_03700 gene nadC 6948 7802 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_03700 7928 8740 gene locus_tag LOCUS_03710 7928 8740 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545308.1 protein_id gnl|my_center|LOCUS_03710 8749 9537 gene locus_tag LOCUS_03720 8749 9537 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519040.1 protein_id gnl|my_center|LOCUS_03720 10904 9654 gene locus_tag LOCUS_03730 gene ahcY 10904 9654 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_03730 12129 10936 gene locus_tag LOCUS_03740 gene metK 12129 10936 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_03740 13155 12262 gene locus_tag LOCUS_03750 gene rapZ 13155 12262 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138459.1 protein_id gnl|my_center|LOCUS_03750 13740 13210 gene locus_tag LOCUS_03760 gene raiA 13740 13210 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546709.1 protein_id gnl|my_center|LOCUS_03760 15242 13773 gene locus_tag LOCUS_03770 gene rpoN 15242 13773 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546561.1 protein_id gnl|my_center|LOCUS_03770 16096 15374 gene locus_tag LOCUS_03780 gene lptB 16096 15374 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_03780 16650 16093 gene locus_tag LOCUS_03790 16650 16093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 17235 16675 gene locus_tag LOCUS_03800 17235 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 17760 17245 gene locus_tag LOCUS_03810 17760 17245 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 protein_id gnl|my_center|LOCUS_03810 18731 17757 gene locus_tag LOCUS_03820 18731 17757 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_03820 19581 18739 gene locus_tag LOCUS_03830 gene kdsA 19581 18739 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_03830 21401 19632 gene locus_tag LOCUS_03840 21401 19632 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_03840 22239 21394 gene locus_tag LOCUS_03850 gene dapB 22239 21394 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_03850 23114 22239 gene locus_tag LOCUS_03860 gene dapA 23114 22239 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_03860 24475 23219 gene locus_tag LOCUS_03870 gene lysA 24475 23219 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_03870 25447 24479 gene locus_tag LOCUS_03880 25447 24479 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_03880 26873 25515 gene locus_tag LOCUS_03890 gene radA 26873 25515 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293096.1 protein_id gnl|my_center|LOCUS_03890 28182 27121 gene locus_tag LOCUS_03900 28182 27121 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880019.1 protein_id gnl|my_center|LOCUS_03900 29337 28189 gene locus_tag LOCUS_03910 29337 28189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 <30513 29840 gene locus_tag LOCUS_03920 <30513 29840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546455.1:argininosuccinate lyase >Feature sequence010 583 104 gene locus_tag LOCUS_03930 gene rimP 583 104 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958225.1 protein_id gnl|my_center|LOCUS_03930 1461 691 gene locus_tag LOCUS_03940 gene truA 1461 691 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553118.1 protein_id gnl|my_center|LOCUS_03940 2998 1472 gene locus_tag LOCUS_03950 2998 1472 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_03950 4743 3025 gene locus_tag LOCUS_03960 4743 3025 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_03960 5966 4740 gene locus_tag LOCUS_03970 5966 4740 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_03970 7170 5983 gene locus_tag LOCUS_03980 7170 5983 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_03980 9117 7267 gene locus_tag LOCUS_03990 gene pilB 9117 7267 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_03990 10105 9206 gene locus_tag LOCUS_04000 10105 9206 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880549.1 protein_id gnl|my_center|LOCUS_04000 11055 10102 gene locus_tag LOCUS_04010 11055 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 11477 11142 gene locus_tag LOCUS_04020 11477 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 11687 11950 gene locus_tag LOCUS_04030 11687 11950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 11947 12861 gene locus_tag LOCUS_04040 11947 12861 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545645.1 protein_id gnl|my_center|LOCUS_04040 12892 14838 gene locus_tag LOCUS_04050 gene dxs 12892 14838 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_04050 14888 15544 gene locus_tag LOCUS_04060 14888 15544 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880470.1 protein_id gnl|my_center|LOCUS_04060 15484 17202 gene locus_tag LOCUS_04070 15484 17202 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_04070 18608 17199 gene locus_tag LOCUS_04080 18608 17199 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_04080 19595 18642 gene locus_tag LOCUS_04090 19595 18642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 20646 19702 gene locus_tag LOCUS_04100 20646 19702 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546739.1 protein_id gnl|my_center|LOCUS_04100 22395 20713 gene locus_tag LOCUS_04110 22395 20713 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545510.1 protein_id gnl|my_center|LOCUS_04110 24681 22474 gene locus_tag LOCUS_04120 gene rnr 24681 22474 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_04120 24804 24890 gene locus_tag LOCUS_t00110 24804 24890 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25031 26941 gene locus_tag LOCUS_04130 25031 26941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 26931 27524 gene locus_tag LOCUS_04140 gene cobO 26931 27524 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_04140 27674 28606 gene locus_tag LOCUS_04150 27674 28606 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082418.1 protein_id gnl|my_center|LOCUS_04150 29163 28603 gene locus_tag LOCUS_04160 29163 28603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence011 672 124 gene locus_tag LOCUS_04170 672 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 2070 826 gene locus_tag LOCUS_04180 2070 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 2758 2060 gene locus_tag LOCUS_04190 2758 2060 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853168.1 protein_id gnl|my_center|LOCUS_04190 2972 3205 gene locus_tag LOCUS_04200 2972 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 3823 3200 gene locus_tag LOCUS_04210 3823 3200 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022642.1 protein_id gnl|my_center|LOCUS_04210 4399 5283 gene locus_tag LOCUS_04220 4399 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 5323 6861 gene locus_tag LOCUS_04230 5323 6861 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943196.1 protein_id gnl|my_center|LOCUS_04230 6858 8390 gene locus_tag LOCUS_04240 6858 8390 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 protein_id gnl|my_center|LOCUS_04240 8383 10410 gene locus_tag LOCUS_04250 8383 10410 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913524.1 protein_id gnl|my_center|LOCUS_04250 10582 10848 gene locus_tag LOCUS_04260 10582 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 11004 11207 gene locus_tag LOCUS_04270 11004 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 11348 11518 gene locus_tag LOCUS_04280 11348 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 12064 13515 gene locus_tag LOCUS_04290 12064 13515 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957528.1 protein_id gnl|my_center|LOCUS_04290 13620 14336 gene locus_tag LOCUS_04300 13620 14336 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258853.1 protein_id gnl|my_center|LOCUS_04300 14826 14359 gene locus_tag LOCUS_04310 14826 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 15202 14819 gene locus_tag LOCUS_04320 15202 14819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 15486 16127 gene locus_tag LOCUS_04330 15486 16127 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965953.1 protein_id gnl|my_center|LOCUS_04330 16187 17563 gene locus_tag LOCUS_04340 16187 17563 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_04340 17763 19238 gene locus_tag LOCUS_04350 17763 19238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 20179 19241 gene locus_tag LOCUS_04360 20179 19241 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545034.1 protein_id gnl|my_center|LOCUS_04360 20370 21599 gene locus_tag LOCUS_04370 20370 21599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 21577 22686 gene locus_tag LOCUS_04380 21577 22686 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583661.1 protein_id gnl|my_center|LOCUS_04380 22715 23350 gene locus_tag LOCUS_04390 22715 23350 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941525.1 protein_id gnl|my_center|LOCUS_04390 23375 24094 gene locus_tag LOCUS_04400 23375 24094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 24113 26116 gene locus_tag LOCUS_04410 gene iorA 24113 26116 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868411.1 protein_id gnl|my_center|LOCUS_04410 26131 26748 gene locus_tag LOCUS_04420 26131 26748 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_04420 26796 27530 gene locus_tag LOCUS_04430 26796 27530 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_04430 27577 28026 gene locus_tag LOCUS_04440 27577 28026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 28129 28899 gene locus_tag LOCUS_04450 28129 28899 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932478.1 protein_id gnl|my_center|LOCUS_04450 >Feature sequence012 115 1515 gene locus_tag LOCUS_04460 115 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 2210 1452 gene locus_tag LOCUS_04470 2210 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3673 2696 gene locus_tag LOCUS_04480 3673 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4579 3728 gene locus_tag LOCUS_04490 4579 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107095.1 protein_id gnl|my_center|LOCUS_04490 5763 4996 gene locus_tag LOCUS_04500 5763 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6812 5784 gene locus_tag LOCUS_04510 6812 5784 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_04510 7017 6941 gene locus_tag LOCUS_t00120 7017 6941 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7361 7074 gene locus_tag LOCUS_04520 7361 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 7504 7428 gene locus_tag LOCUS_t00130 7504 7428 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7876 7595 gene locus_tag LOCUS_04530 7876 7595 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_04530 9432 8047 gene locus_tag LOCUS_04540 gene clpX 9432 8047 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770751.1 protein_id gnl|my_center|LOCUS_04540 10070 9471 gene locus_tag LOCUS_04550 gene clpP 10070 9471 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_04550 11322 10087 gene locus_tag LOCUS_04560 gene tig 11322 10087 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545152.1 protein_id gnl|my_center|LOCUS_04560 13505 11568 gene locus_tag LOCUS_04570 13505 11568 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878055.1 protein_id gnl|my_center|LOCUS_04570 14332 13508 gene locus_tag LOCUS_04580 14332 13508 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_04580 15414 14392 gene locus_tag LOCUS_04590 15414 14392 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940764.1 protein_id gnl|my_center|LOCUS_04590 16347 15442 gene locus_tag LOCUS_04600 16347 15442 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_04600 16841 16359 gene locus_tag LOCUS_04610 16841 16359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 18840 16858 gene locus_tag LOCUS_04620 18840 16858 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927008.1 protein_id gnl|my_center|LOCUS_04620 19813 18935 gene locus_tag LOCUS_04630 19813 18935 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_04630 20396 19848 gene locus_tag LOCUS_04640 20396 19848 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_04640 21896 20544 gene locus_tag LOCUS_04650 gene rimO 21896 20544 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_04650 22094 23443 gene locus_tag LOCUS_04660 22094 23443 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545697.1 protein_id gnl|my_center|LOCUS_04660 23454 24644 gene locus_tag LOCUS_04670 23454 24644 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_04670 24690 25412 gene locus_tag LOCUS_04680 24690 25412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_04680 25409 26644 gene locus_tag LOCUS_04690 25409 26644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_04690 26822 27472 gene locus_tag LOCUS_04700 gene cysE 26822 27472 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_04700 27476 27913 gene locus_tag LOCUS_04710 27476 27913 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943207.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence013 299 1276 gene locus_tag LOCUS_04720 299 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 2829 1273 gene locus_tag LOCUS_04730 gene murJ 2829 1273 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_04730 3882 2839 gene locus_tag LOCUS_04740 3882 2839 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_04740 5018 3939 gene locus_tag LOCUS_04750 gene leuB 5018 3939 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_04750 5518 5021 gene locus_tag LOCUS_04760 gene leuD 5518 5021 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_04760 6837 5560 gene locus_tag LOCUS_04770 gene leuC 6837 5560 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583552.1 protein_id gnl|my_center|LOCUS_04770 8509 6950 gene locus_tag LOCUS_04780 8509 6950 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_04780 9337 8531 gene locus_tag LOCUS_04790 gene pssA 9337 8531 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_04790 9782 9321 gene locus_tag LOCUS_04800 9782 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 11096 10080 gene locus_tag LOCUS_04810 gene ilvC 11096 10080 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_04810 11660 11169 gene locus_tag LOCUS_04820 gene ilvN 11660 11169 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_04820 13524 11794 gene locus_tag LOCUS_04830 gene ilvB 13524 11794 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_04830 15197 13527 gene locus_tag LOCUS_04840 gene ilvD 15197 13527 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942557.1 protein_id gnl|my_center|LOCUS_04840 15490 15257 gene locus_tag LOCUS_04850 15490 15257 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546280.1 protein_id gnl|my_center|LOCUS_04850 16245 15541 gene locus_tag LOCUS_04860 16245 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 17351 16254 gene locus_tag LOCUS_04870 gene rseP 17351 16254 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_04870 19900 17468 gene locus_tag LOCUS_04880 gene pheT 19900 17468 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 protein_id gnl|my_center|LOCUS_04880 20991 19999 gene locus_tag LOCUS_04890 20991 19999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 21596 20991 gene locus_tag LOCUS_04900 21596 20991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 21671 23743 gene locus_tag LOCUS_04910 21671 23743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 24774 23740 gene locus_tag LOCUS_04920 gene pheS 24774 23740 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence014 1062 1286 gene locus_tag LOCUS_04930 1062 1286 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024015.1 protein_id gnl|my_center|LOCUS_04930 1283 1513 gene locus_tag LOCUS_04940 1283 1513 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391841.1 protein_id gnl|my_center|LOCUS_04940 2036 2347 gene locus_tag LOCUS_04950 2036 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 2351 2590 gene locus_tag LOCUS_04960 2351 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3280 4398 gene locus_tag LOCUS_04970 3280 4398 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428856.1 protein_id gnl|my_center|LOCUS_04970 5030 4428 gene locus_tag LOCUS_04980 5030 4428 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393334.1 protein_id gnl|my_center|LOCUS_04980 7368 5143 gene locus_tag LOCUS_04990 7368 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 7560 8042 gene locus_tag LOCUS_05000 7560 8042 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_05000 9893 8265 gene locus_tag LOCUS_05010 9893 8265 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_05010 10437 10030 gene locus_tag LOCUS_05020 10437 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 11885 10524 gene locus_tag LOCUS_05030 11885 10524 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943097.1 protein_id gnl|my_center|LOCUS_05030 13328 11901 gene locus_tag LOCUS_05040 13328 11901 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545210.1 protein_id gnl|my_center|LOCUS_05040 13481 14650 gene locus_tag LOCUS_05050 gene alr 13481 14650 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_05050 14949 14719 gene locus_tag LOCUS_05060 14949 14719 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015102.1 protein_id gnl|my_center|LOCUS_05060 15523 15038 gene locus_tag LOCUS_05070 gene greA 15523 15038 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920688.1 protein_id gnl|my_center|LOCUS_05070 18884 15558 gene locus_tag LOCUS_05080 gene carB 18884 15558 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_05080 19989 19006 gene locus_tag LOCUS_05090 19989 19006 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_05090 21041 19977 gene locus_tag LOCUS_05100 gene carA 21041 19977 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931760.1 protein_id gnl|my_center|LOCUS_05100 22386 21100 gene locus_tag LOCUS_05110 22386 21100 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_05110 23317 22379 gene locus_tag LOCUS_05120 23317 22379 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_05120 23841 23314 gene locus_tag LOCUS_05130 gene pyrR 23841 23314 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546345.1 protein_id gnl|my_center|LOCUS_05130 24500 23847 gene locus_tag LOCUS_05140 gene lepB 24500 23847 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence015 174 1697 gene locus_tag LOCUS_05150 gene dgt 174 1697 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020534.1 protein_id gnl|my_center|LOCUS_05150 2328 1750 gene locus_tag LOCUS_05160 2328 1750 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_05160 3125 2349 gene locus_tag LOCUS_05170 3125 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 4281 3142 gene locus_tag LOCUS_05180 4281 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 6162 4297 gene locus_tag LOCUS_05190 6162 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 6786 6295 gene locus_tag LOCUS_05200 gene purE 6786 6295 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769750.1 protein_id gnl|my_center|LOCUS_05200 7913 7026 gene locus_tag LOCUS_05210 gene mtnP 7913 7026 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_05210 8845 8180 gene locus_tag LOCUS_05220 8845 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 9401 8913 gene locus_tag LOCUS_05230 9401 8913 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259618.1 protein_id gnl|my_center|LOCUS_05230 10846 9554 gene locus_tag LOCUS_05240 gene purD 10846 9554 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047939.1 protein_id gnl|my_center|LOCUS_05240 12485 10893 gene locus_tag LOCUS_05250 gene purH 12485 10893 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385254.1 protein_id gnl|my_center|LOCUS_05250 12628 12789 gene locus_tag LOCUS_05260 12628 12789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 12901 13812 gene locus_tag LOCUS_05270 12901 13812 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_05270 13892 14692 gene locus_tag LOCUS_05280 13892 14692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 14704 15480 gene locus_tag LOCUS_05290 14704 15480 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545129.1 protein_id gnl|my_center|LOCUS_05290 16347 15607 gene locus_tag LOCUS_05300 16347 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 16513 16746 gene locus_tag LOCUS_05310 gene tusA 16513 16746 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_05310 17006 17878 gene locus_tag LOCUS_05320 gene tatC 17006 17878 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942132.1 protein_id gnl|my_center|LOCUS_05320 19825 17900 gene locus_tag LOCUS_05330 19825 17900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 20771 19860 gene locus_tag LOCUS_05340 gene secF 20771 19860 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943254.1 protein_id gnl|my_center|LOCUS_05340 22381 20804 gene locus_tag LOCUS_05350 gene secD 22381 20804 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_05350 22881 22516 gene locus_tag LOCUS_05360 22881 22516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 24056 22953 gene locus_tag LOCUS_05370 gene tgt 24056 22953 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583954.1 protein_id gnl|my_center|LOCUS_05370 <24690 24090 gene locus_tag LOCUS_05380 <24690 24090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002248769.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA >Feature sequence016 188 1612 gene locus_tag LOCUS_05390 188 1612 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942701.1 protein_id gnl|my_center|LOCUS_05390 1633 4284 gene locus_tag LOCUS_05400 gene secA 1633 4284 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966131.1 protein_id gnl|my_center|LOCUS_05400 4268 5473 gene locus_tag LOCUS_05410 gene argJ 4268 5473 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_05410 5486 6187 gene locus_tag LOCUS_05420 5486 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 6388 7206 gene locus_tag LOCUS_05430 gene rpsB 6388 7206 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546300.1 protein_id gnl|my_center|LOCUS_05430 7307 7912 gene locus_tag LOCUS_05440 gene tsf 7307 7912 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082052.1 protein_id gnl|my_center|LOCUS_05440 7909 8640 gene locus_tag LOCUS_05450 gene pyrH 7909 8640 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_05450 8657 9217 gene locus_tag LOCUS_05460 gene frr 8657 9217 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_05460 9214 9921 gene locus_tag LOCUS_05470 9214 9921 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_05470 9908 10720 gene locus_tag LOCUS_05480 9908 10720 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_05480 10764 11927 gene locus_tag LOCUS_05490 10764 11927 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_05490 12160 12672 gene locus_tag LOCUS_05500 12160 12672 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_05500 12677 13621 gene locus_tag LOCUS_05510 12677 13621 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_05510 13650 15107 gene locus_tag LOCUS_05520 gene guaB 13650 15107 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_05520 15111 16652 gene locus_tag LOCUS_05530 gene guaA 15111 16652 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_05530 16803 20708 gene locus_tag LOCUS_05540 gene dnaE 16803 20708 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_05540 20802 21746 gene locus_tag LOCUS_05550 20802 21746 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_05550 21783 23576 gene locus_tag LOCUS_05560 21783 23576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 >Feature sequence017 844 1260 gene locus_tag LOCUS_05570 844 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 1282 1650 gene locus_tag LOCUS_05580 1282 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 1823 2158 gene locus_tag LOCUS_05590 1823 2158 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_05590 2195 2521 gene locus_tag LOCUS_05600 gene arsD 2195 2521 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455950.1 protein_id gnl|my_center|LOCUS_05600 2559 4313 gene locus_tag LOCUS_05610 gene arsA 2559 4313 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890458.1 protein_id gnl|my_center|LOCUS_05610 4349 5668 gene locus_tag LOCUS_05620 gene arsB 4349 5668 CDS product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455949.1 protein_id gnl|my_center|LOCUS_05620 5683 6624 gene locus_tag LOCUS_05630 5683 6624 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546572.1 protein_id gnl|my_center|LOCUS_05630 6710 7093 gene locus_tag LOCUS_05640 6710 7093 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880408.1 protein_id gnl|my_center|LOCUS_05640 7206 8186 gene locus_tag LOCUS_05650 7206 8186 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103809.1 protein_id gnl|my_center|LOCUS_05650 8305 8526 gene locus_tag LOCUS_05660 8305 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 8621 8845 gene locus_tag LOCUS_05670 8621 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 9364 9534 gene locus_tag LOCUS_05680 9364 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 9967 10197 gene locus_tag LOCUS_05690 9967 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 10194 10538 gene locus_tag LOCUS_05700 10194 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 11744 10623 gene locus_tag LOCUS_05710 11744 10623 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_05710 11969 11894 gene locus_tag LOCUS_t00140 11969 11894 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12455 12186 gene locus_tag LOCUS_05720 12455 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 12805 12509 gene locus_tag LOCUS_05730 12805 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 13143 14045 gene locus_tag LOCUS_05740 13143 14045 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174491.1 protein_id gnl|my_center|LOCUS_05740 14190 14405 gene locus_tag LOCUS_05750 14190 14405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 16503 14371 gene locus_tag LOCUS_05760 16503 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 16817 17029 gene locus_tag LOCUS_05770 16817 17029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 19449 17182 gene locus_tag LOCUS_05780 19449 17182 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_05780 19661 19470 gene locus_tag LOCUS_05790 gene rpoZ 19661 19470 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_05790 20419 19751 gene locus_tag LOCUS_05800 gene gmk 20419 19751 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546551.1 protein_id gnl|my_center|LOCUS_05800 20707 20456 gene locus_tag LOCUS_05810 20707 20456 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583796.1 protein_id gnl|my_center|LOCUS_05810 21757 20744 gene locus_tag LOCUS_05820 gene rfaE1 21757 20744 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_05820 22899 21775 gene locus_tag LOCUS_05830 22899 21775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence018 2691 1345 gene locus_tag LOCUS_05840 2691 1345 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546113.1 protein_id gnl|my_center|LOCUS_05840 3900 2746 gene locus_tag LOCUS_05850 3900 2746 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880095.1 protein_id gnl|my_center|LOCUS_05850 5195 3930 gene locus_tag LOCUS_05860 gene rho 5195 3930 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_05860 6224 5220 gene locus_tag LOCUS_05870 6224 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 7075 6455 gene locus_tag LOCUS_05880 gene coaE 7075 6455 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881297.1 protein_id gnl|my_center|LOCUS_05880 7957 7199 gene locus_tag LOCUS_05890 7957 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 8901 7954 gene locus_tag LOCUS_05900 8901 7954 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943100.1 protein_id gnl|my_center|LOCUS_05900 10439 8892 gene locus_tag LOCUS_05910 gene gpmI 10439 8892 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964031.1 protein_id gnl|my_center|LOCUS_05910 11870 10500 gene locus_tag LOCUS_05920 11870 10500 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546863.1 protein_id gnl|my_center|LOCUS_05920 12386 11994 gene locus_tag LOCUS_05930 gene rsfS 12386 11994 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633572.1 protein_id gnl|my_center|LOCUS_05930 13026 12379 gene locus_tag LOCUS_05940 gene nadD 13026 12379 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_05940 14520 13237 gene locus_tag LOCUS_05950 14520 13237 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_05950 15683 14532 gene locus_tag LOCUS_05960 gene proB 15683 14532 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546492.1 protein_id gnl|my_center|LOCUS_05960 16903 15872 gene locus_tag LOCUS_05970 gene obgE 16903 15872 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_05970 17555 17298 gene locus_tag LOCUS_05980 gene rpmA 17555 17298 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_05980 18005 17691 gene locus_tag LOCUS_05990 gene rplU 18005 17691 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_05990 18931 18104 gene locus_tag LOCUS_06000 gene thiM 18931 18104 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092692.1 protein_id gnl|my_center|LOCUS_06000 20646 19000 gene locus_tag LOCUS_06010 20646 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 22605 20662 gene locus_tag LOCUS_06020 22605 20662 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence019 1816 746 gene locus_tag LOCUS_06030 1816 746 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_06030 2251 2176 gene locus_tag LOCUS_t00150 2251 2176 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2417 2330 gene locus_tag LOCUS_t00160 2417 2330 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3908 2493 gene locus_tag LOCUS_06040 gene gltA 3908 2493 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_06040 4787 3942 gene locus_tag LOCUS_06050 4787 3942 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583429.1 protein_id gnl|my_center|LOCUS_06050 4913 4839 gene locus_tag LOCUS_t00170 4913 4839 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6085 4985 gene locus_tag LOCUS_06060 6085 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7215 6127 gene locus_tag LOCUS_06070 7215 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 7669 7286 gene locus_tag LOCUS_06080 gene queD 7669 7286 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_06080 8261 7689 gene locus_tag LOCUS_06090 8261 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 8357 9622 gene locus_tag LOCUS_06100 8357 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 10481 9597 gene locus_tag LOCUS_06110 10481 9597 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_06110 10722 10498 gene locus_tag LOCUS_06120 10722 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 12212 11127 gene locus_tag LOCUS_06130 gene galT 12212 11127 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_06130 13931 12249 gene locus_tag LOCUS_06140 13931 12249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 14707 13934 gene locus_tag LOCUS_06150 14707 13934 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_06150 15478 14729 gene locus_tag LOCUS_06160 15478 14729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 16875 15583 gene locus_tag LOCUS_06170 16875 15583 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_06170 18156 16894 gene locus_tag LOCUS_06180 18156 16894 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943919.1 protein_id gnl|my_center|LOCUS_06180 19733 18156 gene locus_tag LOCUS_06190 gene serA 19733 18156 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_06190 20977 19835 gene locus_tag LOCUS_06200 20977 19835 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545576.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence020 969 499 gene locus_tag LOCUS_06210 969 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1086 1427 gene locus_tag LOCUS_06220 1086 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 1473 3806 gene locus_tag LOCUS_06230 1473 3806 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_06230 3799 4242 gene locus_tag LOCUS_06240 3799 4242 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123553.1 protein_id gnl|my_center|LOCUS_06240 4262 6874 gene locus_tag LOCUS_06250 gene clpB 4262 6874 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_06250 7081 8574 gene locus_tag LOCUS_06260 7081 8574 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_06260 8723 10681 gene locus_tag LOCUS_06270 gene selB 8723 10681 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_06270 10779 12230 gene locus_tag LOCUS_06280 10779 12230 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_06280 12223 13110 gene locus_tag LOCUS_06290 12223 13110 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_06290 13134 13871 gene locus_tag LOCUS_06300 13134 13871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 13861 14943 gene locus_tag LOCUS_06310 gene mqnE 13861 14943 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_06310 15000 15527 gene locus_tag LOCUS_06320 15000 15527 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_06320 15573 16688 gene locus_tag LOCUS_06330 15573 16688 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919677.1 protein_id gnl|my_center|LOCUS_06330 17628 16825 gene locus_tag LOCUS_06340 gene ispD 17628 16825 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583828.1 protein_id gnl|my_center|LOCUS_06340 18328 17819 gene locus_tag LOCUS_06350 gene ispF 18328 17819 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_06350 18519 19586 gene locus_tag LOCUS_06360 18519 19586 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256728.1 protein_id gnl|my_center|LOCUS_06360 19746 19973 gene locus_tag LOCUS_06370 19746 19973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 20358 20044 gene locus_tag LOCUS_06380 20358 20044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 20531 20343 gene locus_tag LOCUS_06390 20531 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 20817 20623 gene locus_tag LOCUS_06400 20817 20623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 21043 20807 gene locus_tag LOCUS_06410 21043 20807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 21765 21166 gene locus_tag LOCUS_06420 21765 21166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 21878 22084 gene locus_tag LOCUS_06430 21878 22084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence021 3817 3428 gene locus_tag LOCUS_06440 3817 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4537 3881 gene locus_tag LOCUS_06450 4537 3881 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401225.1 protein_id gnl|my_center|LOCUS_06450 4948 4553 gene locus_tag LOCUS_06460 4948 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5150 4935 gene locus_tag LOCUS_06470 5150 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 6808 5276 gene locus_tag LOCUS_06480 6808 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 7934 6828 gene locus_tag LOCUS_06490 7934 6828 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_06490 8455 7934 gene locus_tag LOCUS_06500 8455 7934 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_06500 8720 9718 gene locus_tag LOCUS_06510 8720 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 12215 9777 gene locus_tag LOCUS_06520 12215 9777 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496762.1 protein_id gnl|my_center|LOCUS_06520 15400 12584 gene locus_tag LOCUS_06530 gene uvrA 15400 12584 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_06530 16413 15385 gene locus_tag LOCUS_06540 gene pdxA 16413 15385 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545509.1 protein_id gnl|my_center|LOCUS_06540 17443 16430 gene locus_tag LOCUS_06550 17443 16430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 18498 17581 gene locus_tag LOCUS_06560 18498 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 <21653 18558 gene locus_tag LOCUS_06570 <21653 18558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048383.1:transcription-repair coupling factor >Feature sequence022 112 38 gene locus_tag LOCUS_t00180 112 38 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 448 185 gene locus_tag LOCUS_06580 gene spoVG 448 185 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 protein_id gnl|my_center|LOCUS_06580 1380 487 gene locus_tag LOCUS_06590 gene ispE 1380 487 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_06590 2921 1368 gene locus_tag LOCUS_06600 2921 1368 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_06600 4473 2914 gene locus_tag LOCUS_06610 4473 2914 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_06610 6415 4532 gene locus_tag LOCUS_06620 gene nuoL 6415 4532 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_06620 6729 6436 gene locus_tag LOCUS_06630 gene nuoK 6729 6436 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579761.1 protein_id gnl|my_center|LOCUS_06630 7262 6759 gene locus_tag LOCUS_06640 7262 6759 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_06640 7796 7281 gene locus_tag LOCUS_06650 gene nuoI 7796 7281 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258756.1 protein_id gnl|my_center|LOCUS_06650 8786 7800 gene locus_tag LOCUS_06660 gene nuoH 8786 7800 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_06660 10924 8801 gene locus_tag LOCUS_06670 10924 8801 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941012.1 protein_id gnl|my_center|LOCUS_06670 12841 10934 gene locus_tag LOCUS_06680 12841 10934 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088555170.1 protein_id gnl|my_center|LOCUS_06680 14045 12846 gene locus_tag LOCUS_06690 gene nuoD 14045 12846 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_06690 14602 14069 gene locus_tag LOCUS_06700 14602 14069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 15133 14639 gene locus_tag LOCUS_06710 15133 14639 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_06710 15504 15124 gene locus_tag LOCUS_06720 15504 15124 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_06720 17361 15796 gene locus_tag LOCUS_06730 17361 15796 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930810.1 protein_id gnl|my_center|LOCUS_06730 19478 17571 gene locus_tag LOCUS_06740 gene acs 19478 17571 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_06740 <20214 19522 gene locus_tag LOCUS_06750 <20214 19522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546778.1:methyl-accepting chemotaxis protein >Feature sequence023 2176 683 gene locus_tag LOCUS_06760 2176 683 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_06760 5001 2389 gene locus_tag LOCUS_06770 gene clpB 5001 2389 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_06770 5457 5023 gene locus_tag LOCUS_06780 5457 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 5965 5450 gene locus_tag LOCUS_06790 5965 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06790 7611 6013 gene locus_tag LOCUS_06800 7611 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06800 6069 6078 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7998 7657 gene locus_tag LOCUS_06810 7998 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 8115 8585 gene locus_tag LOCUS_06820 8115 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 9323 8589 gene locus_tag LOCUS_06830 9323 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 10422 9313 gene locus_tag LOCUS_06840 gene hflX 10422 9313 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583443.1 protein_id gnl|my_center|LOCUS_06840 11351 10419 gene locus_tag LOCUS_06850 gene miaA 11351 10419 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_06850 12735 11380 gene locus_tag LOCUS_06860 12735 11380 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081585.1 protein_id gnl|my_center|LOCUS_06860 14227 12761 gene locus_tag LOCUS_06870 14227 12761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 14469 14224 gene locus_tag LOCUS_06880 14469 14224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 14947 14489 gene locus_tag LOCUS_06890 14947 14489 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524404.1 protein_id gnl|my_center|LOCUS_06890 15925 14999 gene locus_tag LOCUS_06900 gene sppA 15925 14999 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_06900 17544 15928 gene locus_tag LOCUS_06910 17544 15928 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_06910 18501 17635 gene locus_tag LOCUS_06920 gene ispH 18501 17635 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_06920 <19266 18536 gene locus_tag LOCUS_06930 <19266 18536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545275.1:3-phosphoshikimate 1-carboxyvinyltransferase >Feature sequence024 1848 763 gene locus_tag LOCUS_06940 1848 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 3297 1975 gene locus_tag LOCUS_06950 3297 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 3963 3301 gene locus_tag LOCUS_06960 3963 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 5224 4007 gene locus_tag LOCUS_06970 5224 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 6561 5428 gene locus_tag LOCUS_06980 6561 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 9308 6729 gene locus_tag LOCUS_06990 9308 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 9627 9319 gene locus_tag LOCUS_07000 9627 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 10276 9761 gene locus_tag LOCUS_07010 10276 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 10974 10468 gene locus_tag LOCUS_07020 10974 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 11341 10964 gene locus_tag LOCUS_07030 11341 10964 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_07030 14352 11386 gene locus_tag LOCUS_07040 14352 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 14876 14472 gene locus_tag LOCUS_07050 14876 14472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 15311 14949 gene locus_tag LOCUS_07060 gene dksA 15311 14949 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_07060 16567 15524 gene locus_tag LOCUS_07070 gene mqnC 16567 15524 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545015.1 protein_id gnl|my_center|LOCUS_07070 17945 16623 gene locus_tag LOCUS_07080 gene fliI 17945 16623 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244825.1 protein_id gnl|my_center|LOCUS_07080 <18910 18039 gene locus_tag LOCUS_07090 <18910 18039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886480.1:transglycosylase SLT domain-containing protein >Feature sequence025 2778 1273 gene locus_tag LOCUS_07100 gene gatA 2778 1273 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965958.1 protein_id gnl|my_center|LOCUS_07100 3211 2852 gene locus_tag LOCUS_07110 3211 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 5568 3406 gene locus_tag LOCUS_07120 5568 3406 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926840.1 protein_id gnl|my_center|LOCUS_07120 7513 5579 gene locus_tag LOCUS_07130 gene glmS 7513 5579 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545099.1 protein_id gnl|my_center|LOCUS_07130 9043 7550 gene locus_tag LOCUS_07140 gene glmU 9043 7550 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545497.1 protein_id gnl|my_center|LOCUS_07140 10863 9214 gene locus_tag LOCUS_07150 10863 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 12266 10860 gene locus_tag LOCUS_07160 12266 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 14386 12329 gene locus_tag LOCUS_07170 gene ligA 14386 12329 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_07170 16431 14395 gene locus_tag LOCUS_07180 16431 14395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 17357 16434 gene locus_tag LOCUS_07190 gene dapF 17357 16434 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_07190 17767 17354 gene locus_tag LOCUS_07200 17767 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 18815 17979 gene locus_tag LOCUS_07210 18815 17979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence026 134 472 gene locus_tag LOCUS_07220 134 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 486 713 gene locus_tag LOCUS_07230 486 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 994 740 gene locus_tag LOCUS_07240 994 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 2174 1146 gene locus_tag LOCUS_07250 2174 1146 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_07250 3448 2393 gene locus_tag LOCUS_07260 3448 2393 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_07260 3679 3458 gene locus_tag LOCUS_07270 3679 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 4013 3762 gene locus_tag LOCUS_07280 4013 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 5439 4039 gene locus_tag LOCUS_07290 5439 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 6550 5441 gene locus_tag LOCUS_07300 6550 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 7036 6563 gene locus_tag LOCUS_07310 7036 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 10226 7479 gene locus_tag LOCUS_07320 10226 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 10635 10312 gene locus_tag LOCUS_07330 10635 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 11382 10792 gene locus_tag LOCUS_07340 11382 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 11619 11407 gene locus_tag LOCUS_07350 11619 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 12370 11534 gene locus_tag LOCUS_07360 12370 11534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 13613 12336 gene locus_tag LOCUS_07370 gene dnaB 13613 12336 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721677.1 protein_id gnl|my_center|LOCUS_07370 13785 13603 gene locus_tag LOCUS_07380 13785 13603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 13935 14603 gene locus_tag LOCUS_07390 13935 14603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 14720 15277 gene locus_tag LOCUS_07400 14720 15277 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106480813.1 protein_id gnl|my_center|LOCUS_07400 15537 15674 gene locus_tag LOCUS_07410 15537 15674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 15686 15895 gene locus_tag LOCUS_07420 15686 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 17170 16421 gene locus_tag LOCUS_07430 gene istB 17170 16421 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391832.1 protein_id gnl|my_center|LOCUS_07430 <18157 17170 gene locus_tag LOCUS_07440 <18157 17170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392192.1:IS21 family transposase >Feature sequence027 916 197 gene locus_tag LOCUS_07450 916 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1294 956 gene locus_tag LOCUS_07460 1294 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1501 2277 gene locus_tag LOCUS_07470 gene flgF 1501 2277 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_07470 2321 3106 gene locus_tag LOCUS_07480 gene flgG 2321 3106 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_07480 3253 4014 gene locus_tag LOCUS_07490 3253 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4166 4891 gene locus_tag LOCUS_07500 4166 4891 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937821.1 protein_id gnl|my_center|LOCUS_07500 5058 6131 gene locus_tag LOCUS_07510 5058 6131 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173283.1 protein_id gnl|my_center|LOCUS_07510 6296 6592 gene locus_tag LOCUS_07520 6296 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 6638 7114 gene locus_tag LOCUS_07530 6638 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 7118 9283 gene locus_tag LOCUS_07540 7118 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 9303 10298 gene locus_tag LOCUS_07550 9303 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 10485 10808 gene locus_tag LOCUS_07560 10485 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 10824 11381 gene locus_tag LOCUS_07570 10824 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 12555 11545 gene locus_tag LOCUS_07580 12555 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 13483 12581 gene locus_tag LOCUS_07590 13483 12581 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_07590 13860 13480 gene locus_tag LOCUS_07600 13860 13480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 14009 14368 gene locus_tag LOCUS_07610 14009 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 14402 15379 gene locus_tag LOCUS_07620 14402 15379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 16168 15374 gene locus_tag LOCUS_07630 16168 15374 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943655.1 protein_id gnl|my_center|LOCUS_07630 16953 16171 gene locus_tag LOCUS_07640 16953 16171 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943654.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence028 1180 809 gene locus_tag LOCUS_07650 1180 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1955 1248 gene locus_tag LOCUS_07660 1955 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3672 1966 gene locus_tag LOCUS_07670 gene recN 3672 1966 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678799.1 protein_id gnl|my_center|LOCUS_07670 4591 3737 gene locus_tag LOCUS_07680 4591 3737 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546443.1 protein_id gnl|my_center|LOCUS_07680 6541 4607 gene locus_tag LOCUS_07690 6541 4607 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_07690 8373 6727 gene locus_tag LOCUS_07700 gene glgA 8373 6727 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679256.1 protein_id gnl|my_center|LOCUS_07700 10660 8492 gene locus_tag LOCUS_07710 10660 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 12483 10672 gene locus_tag LOCUS_07720 12483 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 14214 12520 gene locus_tag LOCUS_07730 14214 12520 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144137.1 protein_id gnl|my_center|LOCUS_07730 15656 14265 gene locus_tag LOCUS_07740 15656 14265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 16589 15759 gene locus_tag LOCUS_07750 gene panC 16589 15759 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881396.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence029 681 1598 gene locus_tag LOCUS_07760 681 1598 CDS product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_07760 1644 2213 gene locus_tag LOCUS_07770 1644 2213 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 protein_id gnl|my_center|LOCUS_07770 3588 2269 gene locus_tag LOCUS_07780 3588 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4460 3663 gene locus_tag LOCUS_07790 gene cmr6 4460 3663 CDS product type III-B CRISPR module RAMP protein Cmr6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986670.1 protein_id gnl|my_center|LOCUS_07790 4854 4447 gene locus_tag LOCUS_07800 4854 4447 CDS product type III-B CRISPR module-associated protein Cmr5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986671.1 protein_id gnl|my_center|LOCUS_07800 5723 4851 gene locus_tag LOCUS_07810 gene cmr4 5723 4851 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986672.1 protein_id gnl|my_center|LOCUS_07810 6807 5746 gene locus_tag LOCUS_07820 6807 5746 CDS product type III-B CRISPR module-associated Cmr3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986673.1 protein_id gnl|my_center|LOCUS_07820 8257 6800 gene locus_tag LOCUS_07830 gene cas10 8257 6800 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986674.1 protein_id gnl|my_center|LOCUS_07830 9506 8250 gene locus_tag LOCUS_07840 9506 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986675.1 protein_id gnl|my_center|LOCUS_07840 12023 9552 gene locus_tag LOCUS_07850 12023 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 12871 12104 gene locus_tag LOCUS_07860 12871 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 13705 13088 gene locus_tag LOCUS_07870 13705 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 14049 13702 gene locus_tag LOCUS_07880 14049 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 14283 14927 gene locus_tag LOCUS_07890 14283 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 15105 16277 gene locus_tag LOCUS_07900 gene csm6 15105 16277 CDS product CRISPR-associated ring nuclease Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546577.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence030 455 1441 gene locus_tag LOCUS_07910 455 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1438 4503 gene locus_tag LOCUS_07920 1438 4503 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_07920 5029 6300 gene locus_tag LOCUS_07930 5029 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 6297 7490 gene locus_tag LOCUS_07940 6297 7490 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946829.1 protein_id gnl|my_center|LOCUS_07940 7508 10636 gene locus_tag LOCUS_07950 7508 10636 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_07950 10774 11406 gene locus_tag LOCUS_07960 10774 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 11964 11515 gene locus_tag LOCUS_07970 gene mscL 11964 11515 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_07970 12141 11971 gene locus_tag LOCUS_07980 12141 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 12311 12235 gene locus_tag LOCUS_t00190 12311 12235 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13079 12429 gene locus_tag LOCUS_07990 gene rpe 13079 12429 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545731.1 protein_id gnl|my_center|LOCUS_07990 14025 13162 gene locus_tag LOCUS_08000 gene htpX 14025 13162 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_08000 14933 14163 gene locus_tag LOCUS_08010 14933 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 15798 15040 gene locus_tag LOCUS_08020 15798 15040 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546717.1 protein_id gnl|my_center|LOCUS_08020 <16468 15822 gene locus_tag LOCUS_08030 <16468 15822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245443.1:methyl-accepting chemotaxis protein McpC >Feature sequence031 1230 895 gene locus_tag LOCUS_08040 1230 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2144 1269 gene locus_tag LOCUS_08050 gene sucD 2144 1269 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115177.1 protein_id gnl|my_center|LOCUS_08050 3355 2192 gene locus_tag LOCUS_08060 gene sucC 3355 2192 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_08060 3958 3395 gene locus_tag LOCUS_08070 3958 3395 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 protein_id gnl|my_center|LOCUS_08070 4865 4026 gene locus_tag LOCUS_08080 4865 4026 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437062.1 protein_id gnl|my_center|LOCUS_08080 5982 4954 gene locus_tag LOCUS_08090 5982 4954 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544946.1 protein_id gnl|my_center|LOCUS_08090 6284 7492 gene locus_tag LOCUS_08100 6284 7492 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_08100 7537 8391 gene locus_tag LOCUS_08110 gene proC 7537 8391 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512658.1 protein_id gnl|my_center|LOCUS_08110 9125 8526 gene locus_tag LOCUS_08120 9125 8526 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_08120 9839 9132 gene locus_tag LOCUS_08130 9839 9132 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_08130 10666 9836 gene locus_tag LOCUS_08140 10666 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 13098 10765 gene locus_tag LOCUS_08150 gene topA 13098 10765 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_08150 14168 13095 gene locus_tag LOCUS_08160 14168 13095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 14299 15567 gene locus_tag LOCUS_08170 14299 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 15570 16226 gene locus_tag LOCUS_08180 15570 16226 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090522.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence032 1377 379 gene locus_tag LOCUS_08190 1377 379 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142938.1 protein_id gnl|my_center|LOCUS_08190 3072 1396 gene locus_tag LOCUS_08200 gene sdhA 3072 1396 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930843.1 protein_id gnl|my_center|LOCUS_08200 3723 3232 gene locus_tag LOCUS_08210 gene moaC 3723 3232 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986478.1 protein_id gnl|my_center|LOCUS_08210 5564 3912 gene locus_tag LOCUS_08220 5564 3912 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_08220 6729 5617 gene locus_tag LOCUS_08230 gene argC 6729 5617 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082328.1 protein_id gnl|my_center|LOCUS_08230 7147 6752 gene locus_tag LOCUS_08240 gene rpsI 7147 6752 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_08240 7614 7198 gene locus_tag LOCUS_08250 gene rplM 7614 7198 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770421.1 protein_id gnl|my_center|LOCUS_08250 8312 7764 gene locus_tag LOCUS_08260 8312 7764 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_08260 8959 8354 gene locus_tag LOCUS_08270 8959 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 10194 9073 gene locus_tag LOCUS_08280 10194 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 11161 10169 gene locus_tag LOCUS_08290 gene dusB 11161 10169 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_08290 11700 11158 gene locus_tag LOCUS_08300 11700 11158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 11857 14190 gene locus_tag LOCUS_08310 11857 14190 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_08310 14630 14436 gene locus_tag LOCUS_08320 14630 14436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence033 <1 715 gene locus_tag LOCUS_08330 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851778.1:chemotaxis protein 799 1128 gene locus_tag LOCUS_08340 799 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1268 1990 gene locus_tag LOCUS_08350 gene bioD 1268 1990 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545503.1 protein_id gnl|my_center|LOCUS_08350 2045 3205 gene locus_tag LOCUS_08360 2045 3205 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546563.1 protein_id gnl|my_center|LOCUS_08360 3202 3882 gene locus_tag LOCUS_08370 3202 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 4286 3879 gene locus_tag LOCUS_08380 gene speD 4286 3879 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545906.1 protein_id gnl|my_center|LOCUS_08380 4512 4862 gene locus_tag LOCUS_08390 4512 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5107 5313 gene locus_tag LOCUS_08400 5107 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5638 6627 gene locus_tag LOCUS_08410 5638 6627 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_08410 6620 7228 gene locus_tag LOCUS_08420 6620 7228 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_08420 7282 7680 gene locus_tag LOCUS_08430 7282 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 7758 9050 gene locus_tag LOCUS_08440 gene purB 7758 9050 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080360.1 protein_id gnl|my_center|LOCUS_08440 9083 9337 gene locus_tag LOCUS_08450 gene purS 9083 9337 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337254.1 protein_id gnl|my_center|LOCUS_08450 9353 10069 gene locus_tag LOCUS_08460 gene purQ 9353 10069 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021958.1 protein_id gnl|my_center|LOCUS_08460 10113 12371 gene locus_tag LOCUS_08470 gene purL 10113 12371 CDS product phosphoribosylformylglycinamidine synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055546.1 protein_id gnl|my_center|LOCUS_08470 12559 13971 gene locus_tag LOCUS_08480 gene purF 12559 13971 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_08480 13989 14579 gene locus_tag LOCUS_08490 gene pyrE 13989 14579 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence034 2910 1504 gene locus_tag LOCUS_08500 gene mnmE 2910 1504 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016067.1 protein_id gnl|my_center|LOCUS_08500 4497 2929 gene locus_tag LOCUS_08510 gene yidC 4497 2929 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_08510 5119 4781 gene locus_tag LOCUS_08520 5119 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 5299 5150 gene locus_tag LOCUS_08530 gene rpmH 5299 5150 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718062.1 protein_id gnl|my_center|LOCUS_08530 5667 7046 gene locus_tag LOCUS_08540 gene dnaA 5667 7046 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_08540 7261 8481 gene locus_tag LOCUS_08550 gene dnaN 7261 8481 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_08550 8505 10949 gene locus_tag LOCUS_08560 gene gyrB 8505 10949 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_08560 11324 10956 gene locus_tag LOCUS_08570 11324 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 11545 12180 gene locus_tag LOCUS_08580 11545 12180 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_08580 12804 12172 gene locus_tag LOCUS_08590 gene nth 12804 12172 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387915.1 protein_id gnl|my_center|LOCUS_08590 13237 12821 gene locus_tag LOCUS_08600 gene ndk 13237 12821 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545240.1 protein_id gnl|my_center|LOCUS_08600 13814 13263 gene locus_tag LOCUS_08610 13814 13263 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_08610 <14697 13839 gene locus_tag LOCUS_08620 <14697 13839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942115.1:2-oxoacid:ferredoxin oxidoreductase subunit beta >Feature sequence035 1217 327 gene locus_tag LOCUS_08630 1217 327 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_08630 1297 2160 gene locus_tag LOCUS_08640 1297 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 2257 4029 gene locus_tag LOCUS_08650 gene aspS 2257 4029 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546812.1 protein_id gnl|my_center|LOCUS_08650 4055 5548 gene locus_tag LOCUS_08660 4055 5548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948370.1 protein_id gnl|my_center|LOCUS_08660 5581 7365 gene locus_tag LOCUS_08670 5581 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 7372 7974 gene locus_tag LOCUS_08680 7372 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 8456 7971 gene locus_tag LOCUS_08690 8456 7971 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_08690 11504 8514 gene locus_tag LOCUS_08700 11504 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 12175 11489 gene locus_tag LOCUS_08710 gene moaD 12175 11489 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417290.1 protein_id gnl|my_center|LOCUS_08710 12745 12218 gene locus_tag LOCUS_08720 12745 12218 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117124.1 protein_id gnl|my_center|LOCUS_08720 <14480 13153 gene locus_tag LOCUS_08730 <14480 13153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943952.1:chaperonin GroEL >Feature sequence036 <1 952 gene locus_tag LOCUS_08740 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000442341.1:class II fructose-bisphosphatase 965 1882 gene locus_tag LOCUS_08750 965 1882 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_08750 2319 1987 gene locus_tag LOCUS_08760 2319 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3004 2916 gene locus_tag LOCUS_t00200 3004 2916 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4445 3195 gene locus_tag LOCUS_08770 gene hemW 4445 3195 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013191.1 protein_id gnl|my_center|LOCUS_08770 4703 5953 gene locus_tag LOCUS_08780 4703 5953 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933933.1 protein_id gnl|my_center|LOCUS_08780 6068 7258 gene locus_tag LOCUS_08790 6068 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 7368 9395 gene locus_tag LOCUS_08800 7368 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 9488 10000 gene locus_tag LOCUS_08810 9488 10000 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146717.1 protein_id gnl|my_center|LOCUS_08810 10203 10532 gene locus_tag LOCUS_08820 10203 10532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 10545 11486 gene locus_tag LOCUS_08830 10545 11486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 11497 12294 gene locus_tag LOCUS_08840 gene panB 11497 12294 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881288.1 protein_id gnl|my_center|LOCUS_08840 12363 12704 gene locus_tag LOCUS_08850 12363 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence037 <1 943 gene locus_tag LOCUS_08860 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583867.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPA 936 2453 gene locus_tag LOCUS_08870 gene gcvPB 936 2453 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082890.1 protein_id gnl|my_center|LOCUS_08870 2562 3191 gene locus_tag LOCUS_08880 2562 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 3220 4419 gene locus_tag LOCUS_08890 3220 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4500 5579 gene locus_tag LOCUS_08900 gene pheA 4500 5579 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_08900 5582 6454 gene locus_tag LOCUS_08910 5582 6454 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_08910 6596 7165 gene locus_tag LOCUS_08920 6596 7165 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_08920 7155 7418 gene locus_tag LOCUS_08930 gene porD 7155 7418 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020092.1 protein_id gnl|my_center|LOCUS_08930 7466 8638 gene locus_tag LOCUS_08940 gene porA 7466 8638 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_08940 8763 9659 gene locus_tag LOCUS_08950 gene porB 8763 9659 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_08950 9659 10543 gene locus_tag LOCUS_08960 gene folD 9659 10543 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_08960 10608 11264 gene locus_tag LOCUS_08970 10608 11264 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941525.1 protein_id gnl|my_center|LOCUS_08970 11492 12598 gene locus_tag LOCUS_08980 gene hisC 11492 12598 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546009.1 protein_id gnl|my_center|LOCUS_08980 12762 12953 gene locus_tag LOCUS_08990 12762 12953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence038 <1 647 gene locus_tag LOCUS_09000 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943006.1:tryptophan synthase subunit alpha 651 1493 gene locus_tag LOCUS_09010 gene accD 651 1493 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_09010 1486 2790 gene locus_tag LOCUS_09020 1486 2790 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_09020 2791 5049 gene locus_tag LOCUS_09030 gene lptD 2791 5049 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277601.1 protein_id gnl|my_center|LOCUS_09030 5070 6089 gene locus_tag LOCUS_09040 gene rfbB 5070 6089 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_09040 6099 6971 gene locus_tag LOCUS_09050 gene rfbD 6099 6971 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_09050 7030 7626 gene locus_tag LOCUS_09060 7030 7626 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546603.1 protein_id gnl|my_center|LOCUS_09060 7642 8397 gene locus_tag LOCUS_09070 7642 8397 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_09070 8413 12042 gene locus_tag LOCUS_09080 gene smc 8413 12042 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence039 1017 535 gene locus_tag LOCUS_09090 1017 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2094 1108 gene locus_tag LOCUS_09100 2094 1108 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_09100 3171 2962 gene locus_tag LOCUS_09110 3171 2962 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_09110 3367 3173 gene locus_tag LOCUS_09120 3367 3173 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_09120 4022 3417 gene locus_tag LOCUS_09130 4022 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 5263 6258 gene locus_tag LOCUS_09140 5263 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 6261 6632 gene locus_tag LOCUS_09150 6261 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 6754 6900 gene locus_tag LOCUS_09160 6754 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 7631 8650 gene locus_tag LOCUS_09170 7631 8650 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_09170 8643 11210 gene locus_tag LOCUS_09180 8643 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 <12666 11332 gene locus_tag LOCUS_09190 <12666 11332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477318.1:AAA family ATPase >Feature sequence040 74 406 gene locus_tag LOCUS_09200 74 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 3046 437 gene locus_tag LOCUS_09210 3046 437 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930590.1 protein_id gnl|my_center|LOCUS_09210 3796 3119 gene locus_tag LOCUS_09220 3796 3119 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118253.1 protein_id gnl|my_center|LOCUS_09220 4001 3786 gene locus_tag LOCUS_09230 4001 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4458 4024 gene locus_tag LOCUS_09240 gene dut 4458 4024 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964734.1 protein_id gnl|my_center|LOCUS_09240 4890 4815 gene locus_tag LOCUS_t00210 4890 4815 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5407 4976 gene locus_tag LOCUS_09250 5407 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 5594 5959 gene locus_tag LOCUS_09260 5594 5959 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023353.1 protein_id gnl|my_center|LOCUS_09260 6014 7171 gene locus_tag LOCUS_09270 6014 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 7316 9256 gene locus_tag LOCUS_09280 7316 9256 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582597.1 protein_id gnl|my_center|LOCUS_09280 11008 9506 gene locus_tag LOCUS_09290 gene zwf 11008 9506 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_09290 11660 11034 gene locus_tag LOCUS_09300 11660 11034 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583290.1 protein_id gnl|my_center|LOCUS_09300 <12430 11714 gene locus_tag LOCUS_09310 <12430 11714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256404.1:decarboxylating 6-phosphogluconate dehydrogenase >Feature sequence041 1467 268 gene locus_tag LOCUS_09320 1467 268 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546465.1 protein_id gnl|my_center|LOCUS_09320 2373 1525 gene locus_tag LOCUS_09330 gene argB 2373 1525 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544977.1 protein_id gnl|my_center|LOCUS_09330 3981 2527 gene locus_tag LOCUS_09340 gene hslU 3981 2527 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_09340 4543 3989 gene locus_tag LOCUS_09350 gene hslV 4543 3989 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_09350 5571 4585 gene locus_tag LOCUS_09360 5571 4585 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728395.1 protein_id gnl|my_center|LOCUS_09360 6515 5670 gene locus_tag LOCUS_09370 6515 5670 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521810.1 protein_id gnl|my_center|LOCUS_09370 6720 7505 gene locus_tag LOCUS_09380 6720 7505 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_09380 7556 9103 gene locus_tag LOCUS_09390 7556 9103 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202972.1 protein_id gnl|my_center|LOCUS_09390 9190 10914 gene locus_tag LOCUS_09400 gene glgP 9190 10914 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584150.1 protein_id gnl|my_center|LOCUS_09400 11944 10922 gene locus_tag LOCUS_09410 11944 10922 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence042 428 913 gene locus_tag LOCUS_09420 gene ribE 428 913 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545200.1 protein_id gnl|my_center|LOCUS_09420 932 1393 gene locus_tag LOCUS_09430 gene nusB 932 1393 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_09430 1717 2445 gene locus_tag LOCUS_09440 gene rph 1717 2445 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583693.1 protein_id gnl|my_center|LOCUS_09440 2930 2448 gene locus_tag LOCUS_09450 2930 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3517 3305 gene locus_tag LOCUS_09460 3517 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3399 4121 gene locus_tag LOCUS_09470 3399 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4124 4798 gene locus_tag LOCUS_09480 4124 4798 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_09480 4816 6309 gene locus_tag LOCUS_09490 4816 6309 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181950125.1 protein_id gnl|my_center|LOCUS_09490 6342 7490 gene locus_tag LOCUS_09500 6342 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 7555 8361 gene locus_tag LOCUS_09510 7555 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 8358 10466 gene locus_tag LOCUS_09520 gene hyfB 8358 10466 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_09520 12018 10756 gene locus_tag LOCUS_09530 12018 10756 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence043 29 2776 gene locus_tag LOCUS_09540 gene bamA 29 2776 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_09540 2854 3381 gene locus_tag LOCUS_09550 2854 3381 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930568.1 protein_id gnl|my_center|LOCUS_09550 3511 4548 gene locus_tag LOCUS_09560 gene lpxD 3511 4548 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_09560 4554 5036 gene locus_tag LOCUS_09570 gene fabZ 4554 5036 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942905.1 protein_id gnl|my_center|LOCUS_09570 5174 5944 gene locus_tag LOCUS_09580 gene lpxA 5174 5944 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_09580 6046 6858 gene locus_tag LOCUS_09590 gene lpxI 6046 6858 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_09590 6839 8053 gene locus_tag LOCUS_09600 gene lpxB 6839 8053 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212586.1 protein_id gnl|my_center|LOCUS_09600 8079 10094 gene locus_tag LOCUS_09610 8079 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 10199 11542 gene locus_tag LOCUS_09620 10199 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence044 403 783 gene locus_tag LOCUS_09630 403 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 788 1441 gene locus_tag LOCUS_09640 788 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1496 1768 gene locus_tag LOCUS_09650 1496 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1916 2176 gene locus_tag LOCUS_09660 1916 2176 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_09660 3410 2247 gene locus_tag LOCUS_09670 3410 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3977 4207 gene locus_tag LOCUS_09680 3977 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 4366 4291 gene locus_tag LOCUS_t00220 4366 4291 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4731 5657 gene locus_tag LOCUS_09690 4731 5657 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546572.1 protein_id gnl|my_center|LOCUS_09690 7196 5799 gene locus_tag LOCUS_09700 7196 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 7309 8754 gene locus_tag LOCUS_09710 7309 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 8879 9556 gene locus_tag LOCUS_09720 8879 9556 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880210.1 protein_id gnl|my_center|LOCUS_09720 9602 10804 gene locus_tag LOCUS_09730 9602 10804 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence045 2765 1575 gene locus_tag LOCUS_09740 2765 1575 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946829.1 protein_id gnl|my_center|LOCUS_09740 4103 2814 gene locus_tag LOCUS_09750 4103 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 4741 4304 gene locus_tag LOCUS_09760 4741 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 6099 4870 gene locus_tag LOCUS_09770 6099 4870 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_09770 6809 6156 gene locus_tag LOCUS_09780 6809 6156 CDS product DUF5752 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978371.1 protein_id gnl|my_center|LOCUS_09780 7800 6781 gene locus_tag LOCUS_09790 7800 6781 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978840.1 protein_id gnl|my_center|LOCUS_09790 9375 7825 gene locus_tag LOCUS_09800 9375 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 9506 10402 gene locus_tag LOCUS_09810 9506 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 11090 10392 gene locus_tag LOCUS_09820 11090 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence046 3242 264 gene locus_tag LOCUS_09830 3242 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 4676 3255 gene locus_tag LOCUS_09840 4676 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 4887 4696 gene locus_tag LOCUS_09850 4887 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5269 4910 gene locus_tag LOCUS_09860 5269 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 5728 5555 gene locus_tag LOCUS_09870 5728 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6081 6392 gene locus_tag LOCUS_09880 6081 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 6430 6813 gene locus_tag LOCUS_09890 6430 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 6816 7337 gene locus_tag LOCUS_09900 6816 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8444 7698 gene locus_tag LOCUS_09910 8444 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 9694 8441 gene locus_tag LOCUS_09920 9694 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 10635 9691 gene locus_tag LOCUS_09930 10635 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 10986 11312 gene locus_tag LOCUS_09940 10986 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence047 <1 617 gene locus_tag LOCUS_09950 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167441465.1:isoprenyl transferase 702 1859 gene locus_tag LOCUS_09960 702 1859 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880778.1 protein_id gnl|my_center|LOCUS_09960 1968 2627 gene locus_tag LOCUS_09970 1968 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2839 3024 gene locus_tag LOCUS_09980 2839 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 4635 3064 gene locus_tag LOCUS_09990 4635 3064 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246447.1 protein_id gnl|my_center|LOCUS_09990 4802 5716 gene locus_tag LOCUS_10000 gene trxB 4802 5716 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065103.1 protein_id gnl|my_center|LOCUS_10000 6245 5868 gene locus_tag LOCUS_10010 6245 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 7328 6288 gene locus_tag LOCUS_10020 gene trpS 7328 6288 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393419.1 protein_id gnl|my_center|LOCUS_10020 7564 8505 gene locus_tag LOCUS_10030 gene nadA 7564 8505 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_10030 8682 9452 gene locus_tag LOCUS_10040 8682 9452 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546794.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence048 560 2173 gene locus_tag LOCUS_10050 560 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2261 3499 gene locus_tag LOCUS_10060 2261 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 5181 6113 gene locus_tag LOCUS_10070 5181 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 6143 6355 gene locus_tag LOCUS_10080 6143 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 8166 7324 gene locus_tag LOCUS_10090 8166 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 8815 9327 gene locus_tag LOCUS_10100 8815 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 9324 9866 gene locus_tag LOCUS_10110 9324 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence049 <1 1085 gene locus_tag LOCUS_10120 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368424.1:DEAD/DEAH box helicase family protein 2773 1553 gene locus_tag LOCUS_10130 2773 1553 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938989.1 protein_id gnl|my_center|LOCUS_10130 3702 2848 gene locus_tag LOCUS_10140 3702 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 4615 3782 gene locus_tag LOCUS_10150 4615 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5763 4885 gene locus_tag LOCUS_10160 5763 4885 CDS product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862398.1 protein_id gnl|my_center|LOCUS_10160 7097 6684 gene locus_tag LOCUS_10170 7097 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 8483 7110 gene locus_tag LOCUS_10180 8483 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 9376 8483 gene locus_tag LOCUS_10190 9376 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 9602 9411 gene locus_tag LOCUS_10200 9602 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9669 10520 gene locus_tag LOCUS_10210 9669 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence050 383 120 gene locus_tag LOCUS_10220 gene porD 383 120 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020092.1 protein_id gnl|my_center|LOCUS_10220 942 373 gene locus_tag LOCUS_10230 942 373 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_10230 1885 1007 gene locus_tag LOCUS_10240 1885 1007 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_10240 3109 2030 gene locus_tag LOCUS_10250 gene pheA 3109 2030 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_10250 4714 3536 gene locus_tag LOCUS_10260 4714 3536 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932765.1 protein_id gnl|my_center|LOCUS_10260 6205 5012 gene locus_tag LOCUS_10270 6205 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 6838 6233 gene locus_tag LOCUS_10280 6838 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 8696 7107 gene locus_tag LOCUS_10290 gene gcvPB 8696 7107 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679310.1 protein_id gnl|my_center|LOCUS_10290 10206 8689 gene locus_tag LOCUS_10300 10206 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence051 1089 610 gene locus_tag LOCUS_10310 1089 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 989 1207 gene locus_tag LOCUS_10320 989 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1970 1422 gene locus_tag LOCUS_10330 1970 1422 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_10330 2616 2011 gene locus_tag LOCUS_10340 2616 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3856 2708 gene locus_tag LOCUS_10350 3856 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 4808 3831 gene locus_tag LOCUS_10360 gene dusB 4808 3831 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966475.1 protein_id gnl|my_center|LOCUS_10360 5363 4821 gene locus_tag LOCUS_10370 5363 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 5245 5499 gene locus_tag LOCUS_10380 5245 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5552 7885 gene locus_tag LOCUS_10390 5552 7885 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065536.1 protein_id gnl|my_center|LOCUS_10390 8145 7951 gene locus_tag LOCUS_10400 8145 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 9568 8243 gene locus_tag LOCUS_10410 9568 8243 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence052 352 128 gene locus_tag LOCUS_10420 352 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 324 512 gene locus_tag LOCUS_10430 324 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 723 1151 gene locus_tag LOCUS_10440 723 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1162 1623 gene locus_tag LOCUS_10450 1162 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 2005 2208 gene locus_tag LOCUS_10460 2005 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2213 2734 gene locus_tag LOCUS_10470 2213 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2792 3052 gene locus_tag LOCUS_10480 2792 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 3388 3146 gene locus_tag LOCUS_10490 3388 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 3682 3470 gene locus_tag LOCUS_10500 3682 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 4485 3697 gene locus_tag LOCUS_10510 4485 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4921 4475 gene locus_tag LOCUS_10520 4921 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5095 5262 gene locus_tag LOCUS_10530 5095 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5314 5643 gene locus_tag LOCUS_10540 5314 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 5679 6455 gene locus_tag LOCUS_10550 5679 6455 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 protein_id gnl|my_center|LOCUS_10550 6580 6957 gene locus_tag LOCUS_10560 6580 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 7230 7598 gene locus_tag LOCUS_10570 7230 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 7617 8087 gene locus_tag LOCUS_10580 7617 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 8249 8788 gene locus_tag LOCUS_10590 8249 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 <9854 8855 gene locus_tag LOCUS_10600 <9854 8855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853241.1:ArsS family sensor histidine kinase >Feature sequence053 83 1300 gene locus_tag LOCUS_10610 83 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1464 3398 gene locus_tag LOCUS_10620 1464 3398 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_10620 3414 4268 gene locus_tag LOCUS_10630 3414 4268 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679270.1 protein_id gnl|my_center|LOCUS_10630 4312 4467 gene locus_tag LOCUS_10640 4312 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 4506 6218 gene locus_tag LOCUS_10650 gene recN 4506 6218 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_10650 6225 6950 gene locus_tag LOCUS_10660 6225 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 7024 7395 gene locus_tag LOCUS_10670 7024 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 7427 8236 gene locus_tag LOCUS_10680 7427 8236 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869807.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence054 858 1562 gene locus_tag LOCUS_10690 858 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2500 2799 gene locus_tag LOCUS_10700 2500 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 2796 2999 gene locus_tag LOCUS_10710 2796 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2950 3126 gene locus_tag LOCUS_10720 2950 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3394 3591 gene locus_tag LOCUS_10730 3394 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3584 3949 gene locus_tag LOCUS_10740 3584 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4006 4233 gene locus_tag LOCUS_10750 4006 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 4261 4788 gene locus_tag LOCUS_10760 4261 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 5032 4850 gene locus_tag LOCUS_10770 5032 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 5947 5072 gene locus_tag LOCUS_10780 5947 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6657 5986 gene locus_tag LOCUS_10790 6657 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 6903 6718 gene locus_tag LOCUS_10800 6903 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 7160 7474 gene locus_tag LOCUS_10810 7160 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 8765 7953 gene locus_tag LOCUS_10820 8765 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence055 <1 548 gene locus_tag LOCUS_10830 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940943.1:glutamine--fructose-6-phosphate transaminase (isomerizing) 559 2715 gene locus_tag LOCUS_10840 gene pcrA 559 2715 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225356248.1 protein_id gnl|my_center|LOCUS_10840 2754 3113 gene locus_tag LOCUS_10850 2754 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3152 4654 gene locus_tag LOCUS_10860 gene gatA 3152 4654 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965958.1 protein_id gnl|my_center|LOCUS_10860 4723 6192 gene locus_tag LOCUS_10870 gene gatB 4723 6192 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_10870 6224 7282 gene locus_tag LOCUS_10880 gene mtnA 6224 7282 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_10880 7459 8418 gene locus_tag LOCUS_10890 7459 8418 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence056 1019 27 gene locus_tag LOCUS_10900 1019 27 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_10900 2528 1251 gene locus_tag LOCUS_10910 2528 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4231 2852 gene locus_tag LOCUS_10920 4231 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 4735 4821 gene locus_tag LOCUS_t00230 4735 4821 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4978 6009 gene locus_tag LOCUS_10930 4978 6009 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_10930 6137 6691 gene locus_tag LOCUS_10940 6137 6691 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388878.1 protein_id gnl|my_center|LOCUS_10940 7155 6718 gene locus_tag LOCUS_10950 7155 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 8403 7285 gene locus_tag LOCUS_10960 8403 7285 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence057 1382 51 gene locus_tag LOCUS_10970 gene tyrS 1382 51 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546544.1 protein_id gnl|my_center|LOCUS_10970 2214 1414 gene locus_tag LOCUS_10980 2214 1414 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545500.1 protein_id gnl|my_center|LOCUS_10980 3766 2204 gene locus_tag LOCUS_10990 gene rny 3766 2204 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_10990 4367 3792 gene locus_tag LOCUS_11000 4367 3792 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_11000 4903 4628 gene locus_tag LOCUS_11010 4903 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 5154 4900 gene locus_tag LOCUS_11020 5154 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 5937 5194 gene locus_tag LOCUS_11030 5937 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941891.1 protein_id gnl|my_center|LOCUS_11030 7513 5993 gene locus_tag LOCUS_11040 7513 5993 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941895.1 protein_id gnl|my_center|LOCUS_11040 <8338 7510 gene locus_tag LOCUS_11050 <8338 7510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582452.1:glutamine amidotransferase family protein >Feature sequence058 306 1217 gene locus_tag LOCUS_11060 306 1217 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779466.1 protein_id gnl|my_center|LOCUS_11060 1456 2016 gene locus_tag LOCUS_11070 1456 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3519 2119 gene locus_tag LOCUS_11080 3519 2119 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978673.1 protein_id gnl|my_center|LOCUS_11080 3899 6478 gene locus_tag LOCUS_11090 3899 6478 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460426.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence059 54 1064 gene locus_tag LOCUS_11100 54 1064 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880868.1 protein_id gnl|my_center|LOCUS_11100 1051 3369 gene locus_tag LOCUS_11110 1051 3369 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_11110 3284 3850 gene locus_tag LOCUS_11120 gene ybeY 3284 3850 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047996.1 protein_id gnl|my_center|LOCUS_11120 3855 4565 gene locus_tag LOCUS_11130 3855 4565 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416641.1 protein_id gnl|my_center|LOCUS_11130 4716 5558 gene locus_tag LOCUS_11140 4716 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 5561 7156 gene locus_tag LOCUS_11150 gene lnt 5561 7156 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence060 81 1697 gene locus_tag LOCUS_11160 81 1697 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948601.1 protein_id gnl|my_center|LOCUS_11160 2453 1716 gene locus_tag LOCUS_11170 2453 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 3237 2596 gene locus_tag LOCUS_11180 gene ftsE 3237 2596 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_11180 3908 3249 gene locus_tag LOCUS_11190 gene thiE 3908 3249 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879566.1 protein_id gnl|my_center|LOCUS_11190 4016 4261 gene locus_tag LOCUS_11200 4016 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 4686 5693 gene locus_tag LOCUS_11210 4686 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6001 6225 gene locus_tag LOCUS_11220 6001 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 6422 7060 gene locus_tag LOCUS_11230 6422 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence061 <1 880 gene locus_tag LOCUS_11240 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940408.1:30S ribosomal protein S1 883 1809 gene locus_tag LOCUS_11250 gene sppA 883 1809 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_11250 1863 2321 gene locus_tag LOCUS_11260 1863 2321 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524404.1 protein_id gnl|my_center|LOCUS_11260 2341 2586 gene locus_tag LOCUS_11270 2341 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 2583 4049 gene locus_tag LOCUS_11280 2583 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 4075 5430 gene locus_tag LOCUS_11290 4075 5430 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081585.1 protein_id gnl|my_center|LOCUS_11290 5493 6425 gene locus_tag LOCUS_11300 gene miaA 5493 6425 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_11300 6422 7531 gene locus_tag LOCUS_11310 gene hflX 6422 7531 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583443.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence062 2212 1157 gene locus_tag LOCUS_11320 gene mraY 2212 1157 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651824.1 protein_id gnl|my_center|LOCUS_11320 3741 2206 gene locus_tag LOCUS_11330 3741 2206 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_11330 5390 3747 gene locus_tag LOCUS_11340 5390 3747 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_11340 <7561 5396 gene locus_tag LOCUS_11350 <7561 5396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943700.1:penicillin-binding protein >Feature sequence063 133 441 gene locus_tag LOCUS_11360 133 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 468 1682 gene locus_tag LOCUS_11370 468 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1795 2361 gene locus_tag LOCUS_11380 gene efp 1795 2361 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938955.1 protein_id gnl|my_center|LOCUS_11380 2426 2932 gene locus_tag LOCUS_11390 gene accB 2426 2932 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472859.1 protein_id gnl|my_center|LOCUS_11390 3088 4428 gene locus_tag LOCUS_11400 gene accC 3088 4428 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_11400 4678 5064 gene locus_tag LOCUS_11410 gene gcvH 4678 5064 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942661.1 protein_id gnl|my_center|LOCUS_11410 5148 6002 gene locus_tag LOCUS_11420 5148 6002 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436933.1 protein_id gnl|my_center|LOCUS_11420 6346 6421 gene locus_tag LOCUS_t00240 6346 6421 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence064 1783 422 gene locus_tag LOCUS_11430 1783 422 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943097.1 protein_id gnl|my_center|LOCUS_11430 3225 1795 gene locus_tag LOCUS_11440 3225 1795 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545210.1 protein_id gnl|my_center|LOCUS_11440 3370 4539 gene locus_tag LOCUS_11450 gene alr 3370 4539 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658168.1 protein_id gnl|my_center|LOCUS_11450 4846 4616 gene locus_tag LOCUS_11460 4846 4616 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015102.1 protein_id gnl|my_center|LOCUS_11460 5420 4935 gene locus_tag LOCUS_11470 gene greA 5420 4935 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941932.1 protein_id gnl|my_center|LOCUS_11470 <7476 5455 gene locus_tag LOCUS_11480 <7476 5455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878769.1:carbamoyl-phosphate synthase large subunit >Feature sequence065 848 267 gene locus_tag LOCUS_11490 848 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 982 3501 gene locus_tag LOCUS_11500 982 3501 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943866.1 protein_id gnl|my_center|LOCUS_11500 3654 5189 gene locus_tag LOCUS_11510 3654 5189 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140391.1 protein_id gnl|my_center|LOCUS_11510 5253 5900 gene locus_tag LOCUS_11520 5253 5900 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_11520 6030 7262 gene locus_tag LOCUS_11530 gene coaBC 6030 7262 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965027.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence066 843 1376 gene locus_tag LOCUS_11540 843 1376 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544998.1 protein_id gnl|my_center|LOCUS_11540 2091 1363 gene locus_tag LOCUS_11550 2091 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3089 2088 gene locus_tag LOCUS_11560 gene fliG 3089 2088 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037091.1 protein_id gnl|my_center|LOCUS_11560 4697 3090 gene locus_tag LOCUS_11570 gene fliF 4697 3090 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_11570 5220 4870 gene locus_tag LOCUS_11580 gene fliE 5220 4870 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185219.1 protein_id gnl|my_center|LOCUS_11580 5792 5400 gene locus_tag LOCUS_11590 gene flgC 5792 5400 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965463.1 protein_id gnl|my_center|LOCUS_11590 6382 5951 gene locus_tag LOCUS_11600 gene flgB 6382 5951 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037116.1 protein_id gnl|my_center|LOCUS_11600 <7419 6659 gene locus_tag LOCUS_11610 <7419 6659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545659.1:ATP-binding protein >Feature sequence067 <1 631 gene locus_tag LOCUS_11620 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072711.1:3-oxoacyl-ACP reductase FabG 691 924 gene locus_tag LOCUS_11630 gene acpP 691 924 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942249.1 protein_id gnl|my_center|LOCUS_11630 962 2218 gene locus_tag LOCUS_11640 gene fabF 962 2218 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_11640 2226 2675 gene locus_tag LOCUS_11650 gene rpiB 2226 2675 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_11650 2700 3950 gene locus_tag LOCUS_11660 2700 3950 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986909.1 protein_id gnl|my_center|LOCUS_11660 3947 4405 gene locus_tag LOCUS_11670 gene nrdR 3947 4405 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_11670 4374 5552 gene locus_tag LOCUS_11680 gene ribD 4374 5552 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880032.1 protein_id gnl|my_center|LOCUS_11680 5648 6349 gene locus_tag LOCUS_11690 5648 6349 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence068 1632 559 gene locus_tag LOCUS_11700 gene ispG 1632 559 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_11700 1810 2769 gene locus_tag LOCUS_11710 1810 2769 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942953.1 protein_id gnl|my_center|LOCUS_11710 3283 2867 gene locus_tag LOCUS_11720 3283 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 4472 3306 gene locus_tag LOCUS_11730 4472 3306 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_11730 6005 4575 gene locus_tag LOCUS_11740 6005 4575 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880659.1 protein_id gnl|my_center|LOCUS_11740 6931 6227 gene locus_tag LOCUS_11750 gene ubiE 6931 6227 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889031.1 protein_id gnl|my_center|LOCUS_11750 7106 7030 gene locus_tag LOCUS_t00250 7106 7030 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7257 7333 gene locus_tag LOCUS_t00260 7257 7333 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence069 1611 1174 gene locus_tag LOCUS_11760 1611 1174 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 protein_id gnl|my_center|LOCUS_11760 2393 1683 gene locus_tag LOCUS_11770 2393 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 3183 2482 gene locus_tag LOCUS_11780 3183 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5606 3282 gene locus_tag LOCUS_11790 5606 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6412 5663 gene locus_tag LOCUS_11800 6412 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence070 2366 987 gene locus_tag LOCUS_11810 2366 987 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924851.1 protein_id gnl|my_center|LOCUS_11810 2473 3939 gene locus_tag LOCUS_11820 2473 3939 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266478.1 protein_id gnl|my_center|LOCUS_11820 3936 4955 gene locus_tag LOCUS_11830 3936 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence071 <1 962 gene locus_tag LOCUS_11840 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545721.1:site-specific integrase 2088 1456 gene locus_tag LOCUS_11850 2088 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3627 2107 gene locus_tag LOCUS_11860 3627 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 4927 3632 gene locus_tag LOCUS_11870 4927 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 5825 4929 gene locus_tag LOCUS_11880 5825 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 6335 5835 gene locus_tag LOCUS_11890 gene pilS 6335 5835 CDS product type 4a pilus major pilin PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203188.1 protein_id gnl|my_center|LOCUS_11890 <6956 6352 gene locus_tag LOCUS_11900 <6956 6352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187516.1:type II secretion system F family protein >Feature sequence072 1964 888 gene locus_tag LOCUS_11910 1964 888 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_11910 2150 1989 gene locus_tag LOCUS_11920 2150 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3284 2574 gene locus_tag LOCUS_11930 3284 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3447 3262 gene locus_tag LOCUS_11940 3447 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3745 3479 gene locus_tag LOCUS_11950 3745 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 4122 3904 gene locus_tag LOCUS_11960 4122 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 5200 4112 gene locus_tag LOCUS_11970 5200 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 5496 5197 gene locus_tag LOCUS_11980 5496 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5691 5509 gene locus_tag LOCUS_11990 5691 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 6675 5740 gene locus_tag LOCUS_12000 6675 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence073 761 99 gene locus_tag LOCUS_12010 761 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2941 758 gene locus_tag LOCUS_12020 2941 758 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965118.1 protein_id gnl|my_center|LOCUS_12020 4208 2943 gene locus_tag LOCUS_12030 gene serS 4208 2943 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_12030 4521 4279 gene locus_tag LOCUS_12040 4521 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 5931 4525 gene locus_tag LOCUS_12050 gene atpD 5931 4525 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_12050 <6793 5967 gene locus_tag LOCUS_12060 <6793 5967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005693686.1:F0F1 ATP synthase subunit gamma >Feature sequence074 1042 218 gene locus_tag LOCUS_12070 1042 218 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598029.1 protein_id gnl|my_center|LOCUS_12070 2060 1134 gene locus_tag LOCUS_12080 2060 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2416 2099 gene locus_tag LOCUS_12090 2416 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3622 2426 gene locus_tag LOCUS_12100 3622 2426 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986780.1 protein_id gnl|my_center|LOCUS_12100 4142 3606 gene locus_tag LOCUS_12110 gene coaD 4142 3606 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_12110 4608 6683 gene locus_tag LOCUS_12120 4608 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence075 <1 957 gene locus_tag LOCUS_12130 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161944420.1:glycosyltransferase family 4 protein 954 2366 gene locus_tag LOCUS_12140 954 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 2608 3687 gene locus_tag LOCUS_12150 2608 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 3726 5342 gene locus_tag LOCUS_12160 3726 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 5433 5816 gene locus_tag LOCUS_12170 5433 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence076 1858 1298 gene locus_tag LOCUS_12180 gene atpH 1858 1298 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056289.1 protein_id gnl|my_center|LOCUS_12180 2330 1836 gene locus_tag LOCUS_12190 2330 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2755 2327 gene locus_tag LOCUS_12200 2755 2327 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_12200 3694 2789 gene locus_tag LOCUS_12210 3694 2789 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048450.1 protein_id gnl|my_center|LOCUS_12210 4481 3714 gene locus_tag LOCUS_12220 gene soj 4481 3714 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_12220 5390 4680 gene locus_tag LOCUS_12230 5390 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 <6630 5391 gene locus_tag LOCUS_12240 <6630 5391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583633.1:glutamate--tRNA ligase >Feature sequence077 <1 546 gene locus_tag LOCUS_12250 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425513.1:2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase 543 1343 gene locus_tag LOCUS_12260 gene ispD 543 1343 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583828.1 protein_id gnl|my_center|LOCUS_12260 2589 1483 gene locus_tag LOCUS_12270 2589 1483 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287448.1 protein_id gnl|my_center|LOCUS_12270 3174 2647 gene locus_tag LOCUS_12280 3174 2647 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_12280 4316 3231 gene locus_tag LOCUS_12290 gene mqnE 4316 3231 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_12290 5037 4303 gene locus_tag LOCUS_12300 5037 4303 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545244.1 protein_id gnl|my_center|LOCUS_12300 6564 5050 gene locus_tag LOCUS_12310 6564 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5954 5963 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence078 290 1126 gene locus_tag LOCUS_12320 290 1126 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_12320 1458 1718 gene locus_tag LOCUS_12330 1458 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3700 2030 gene locus_tag LOCUS_12340 3700 2030 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_12340 4505 3741 gene locus_tag LOCUS_12350 4505 3741 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933691.1 protein_id gnl|my_center|LOCUS_12350 4925 4545 gene locus_tag LOCUS_12360 4925 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 <6439 5000 gene locus_tag LOCUS_12370 <6439 5000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:PilC/PilY family type IV pilus protein >Feature sequence079 1115 567 gene locus_tag LOCUS_12380 1115 567 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083227.1 protein_id gnl|my_center|LOCUS_12380 2099 1146 gene locus_tag LOCUS_12390 2099 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2608 2123 gene locus_tag LOCUS_12400 2608 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3477 2632 gene locus_tag LOCUS_12410 gene moaA 3477 2632 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061083.1 protein_id gnl|my_center|LOCUS_12410 4803 3490 gene locus_tag LOCUS_12420 4803 3490 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_12420 5094 4849 gene locus_tag LOCUS_12430 5094 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 5803 5147 gene locus_tag LOCUS_12440 5803 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 6022 5840 gene locus_tag LOCUS_12450 6022 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence080 30 315 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atctacaacagtagaaattgtatataacgattcaag 3973 431 gene locus_tag LOCUS_12460 3973 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 4279 4049 gene locus_tag LOCUS_12470 4279 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 4684 4337 gene locus_tag LOCUS_12480 4684 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 4980 4750 gene locus_tag LOCUS_12490 4980 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 5656 5009 gene locus_tag LOCUS_12500 5656 5009 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890570.1 protein_id gnl|my_center|LOCUS_12500 6034 5672 gene locus_tag LOCUS_12510 6034 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence081 1521 280 gene locus_tag LOCUS_12520 1521 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1962 3131 gene locus_tag LOCUS_12530 1962 3131 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268353.1 protein_id gnl|my_center|LOCUS_12530 3787 3134 gene locus_tag LOCUS_12540 3787 3134 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851887.1 protein_id gnl|my_center|LOCUS_12540 6142 3836 gene locus_tag LOCUS_12550 6142 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence082 <1 618 gene locus_tag LOCUS_12560 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924829.1:sigma-54 dependent transcriptional regulator 1050 1334 gene locus_tag LOCUS_12570 1050 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1367 1906 gene locus_tag LOCUS_12580 1367 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1963 2292 gene locus_tag LOCUS_12590 gene soxZ 1963 2292 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881177.1 protein_id gnl|my_center|LOCUS_12590 2308 2802 gene locus_tag LOCUS_12600 2308 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 2823 4532 gene locus_tag LOCUS_12610 gene soxB 2823 4532 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881174.1 protein_id gnl|my_center|LOCUS_12610 4572 5042 gene locus_tag LOCUS_12620 4572 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 5101 5574 gene locus_tag LOCUS_12630 5101 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence083 1297 143 gene locus_tag LOCUS_12640 1297 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1710 1339 gene locus_tag LOCUS_12650 1710 1339 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023353.1 protein_id gnl|my_center|LOCUS_12650 1866 2297 gene locus_tag LOCUS_12660 1866 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2369 2444 gene locus_tag LOCUS_t00270 2369 2444 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2614 3657 gene locus_tag LOCUS_12670 2614 3657 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_12670 4613 4197 gene locus_tag LOCUS_12680 4613 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 4889 5098 gene locus_tag LOCUS_12690 4889 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence084 273 407 gene locus_tag LOCUS_12700 273 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 850 701 gene locus_tag LOCUS_12710 850 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1155 847 gene locus_tag LOCUS_12720 1155 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1915 1493 gene locus_tag LOCUS_12730 1915 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2434 1928 gene locus_tag LOCUS_12740 2434 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 2763 2431 gene locus_tag LOCUS_12750 2763 2431 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249913.1 protein_id gnl|my_center|LOCUS_12750 3546 2884 gene locus_tag LOCUS_12760 3546 2884 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881085.1 protein_id gnl|my_center|LOCUS_12760 3836 3585 gene locus_tag LOCUS_12770 3836 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4074 3856 gene locus_tag LOCUS_12780 4074 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4783 4262 gene locus_tag LOCUS_12790 4783 4262 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_12790 5857 4823 gene locus_tag LOCUS_12800 5857 4823 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_12800 6100 6025 gene locus_tag LOCUS_t00280 6100 6025 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 <1 1089 gene locus_tag LOCUS_12810 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942384.1:indolepyruvate ferredoxin oxidoreductase subunit alpha 1115 1750 gene locus_tag LOCUS_12820 1115 1750 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841930.1 protein_id gnl|my_center|LOCUS_12820 1722 3053 gene locus_tag LOCUS_12830 1722 3053 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_12830 3825 3037 gene locus_tag LOCUS_12840 3825 3037 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 protein_id gnl|my_center|LOCUS_12840 4946 3816 gene locus_tag LOCUS_12850 gene fmt 4946 3816 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373209.1 protein_id gnl|my_center|LOCUS_12850 5543 4962 gene locus_tag LOCUS_12860 gene def 5543 4962 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_12860 6033 5560 gene locus_tag LOCUS_12870 6033 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence086 1609 641 gene locus_tag LOCUS_12880 1609 641 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_12880 3035 1677 gene locus_tag LOCUS_12890 gene radA 3035 1677 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293096.1 protein_id gnl|my_center|LOCUS_12890 4235 3174 gene locus_tag LOCUS_12900 4235 3174 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880019.1 protein_id gnl|my_center|LOCUS_12900 5373 4240 gene locus_tag LOCUS_12910 5373 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 5745 5416 gene locus_tag LOCUS_12920 5745 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence087 570 2063 gene locus_tag LOCUS_12930 570 2063 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_12930 2138 2782 gene locus_tag LOCUS_12940 2138 2782 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_12940 2895 4187 gene locus_tag LOCUS_12950 gene coaBC 2895 4187 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222148.1 protein_id gnl|my_center|LOCUS_12950 4680 5423 gene locus_tag LOCUS_12960 4680 5423 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939740.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence088 375 611 gene locus_tag LOCUS_12970 375 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 975 1556 gene locus_tag LOCUS_12980 975 1556 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_12980 1784 2851 gene locus_tag LOCUS_12990 1784 2851 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256728.1 protein_id gnl|my_center|LOCUS_12990 3123 3287 gene locus_tag LOCUS_13000 3123 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3742 3479 gene locus_tag LOCUS_13010 3742 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 4221 4093 gene locus_tag LOCUS_13020 4221 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence089 1360 359 gene locus_tag LOCUS_13030 gene fliG 1360 359 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037091.1 protein_id gnl|my_center|LOCUS_13030 2962 1361 gene locus_tag LOCUS_13040 gene fliF 2962 1361 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546552.1 protein_id gnl|my_center|LOCUS_13040 3372 3025 gene locus_tag LOCUS_13050 3372 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 3853 3461 gene locus_tag LOCUS_13060 gene flgC 3853 3461 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965463.1 protein_id gnl|my_center|LOCUS_13060 4473 4042 gene locus_tag LOCUS_13070 gene flgB 4473 4042 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037116.1 protein_id gnl|my_center|LOCUS_13070 <5783 4603 gene locus_tag LOCUS_13080 <5783 4603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545659.1:ATP-binding protein >Feature sequence090 186 746 gene locus_tag LOCUS_13090 186 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13090 732 741 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1165 3495 gene locus_tag LOCUS_13100 1165 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3485 4444 gene locus_tag LOCUS_13110 3485 4444 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 protein_id gnl|my_center|LOCUS_13110 <5695 4450 gene locus_tag LOCUS_13120 <5695 4450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546182.1:replicative DNA helicase >Feature sequence091 <1 737 gene locus_tag LOCUS_13130 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000342347.1:chemotaxis histidine kinase/response regulator CheAY2 note possible pseudo, internal stop codon, frameshifted 803 1888 gene locus_tag LOCUS_13140 803 1888 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_13140 1938 2447 gene locus_tag LOCUS_13150 1938 2447 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_13150 2453 3268 gene locus_tag LOCUS_13160 2453 3268 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705294.1 protein_id gnl|my_center|LOCUS_13160 3265 4062 gene locus_tag LOCUS_13170 3265 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 4085 4381 gene locus_tag LOCUS_13180 4085 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 4378 5496 gene locus_tag LOCUS_13190 4378 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence092 163 1287 gene locus_tag LOCUS_13200 gene mnmA 163 1287 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965531.1 protein_id gnl|my_center|LOCUS_13200 1299 2666 gene locus_tag LOCUS_13210 gene mtaB 1299 2666 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_13210 2656 3348 gene locus_tag LOCUS_13220 gene rnc 2656 3348 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851153.1 protein_id gnl|my_center|LOCUS_13220 3335 4681 gene locus_tag LOCUS_13230 gene der 3335 4681 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599524.1 protein_id gnl|my_center|LOCUS_13230 4992 4699 gene locus_tag LOCUS_13240 4992 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 <5650 5018 gene locus_tag LOCUS_13250 <5650 5018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933695.1:CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein >Feature sequence093 33 108 gene locus_tag LOCUS_t00290 33 108 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 446 123 gene locus_tag LOCUS_13260 446 123 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_13260 688 437 gene locus_tag LOCUS_13270 688 437 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_13270 999 1172 gene locus_tag LOCUS_13280 999 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1689 1255 gene locus_tag LOCUS_13290 gene rnhA 1689 1255 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_13290 2059 2394 gene locus_tag LOCUS_13300 2059 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 2396 2608 gene locus_tag LOCUS_13310 2396 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 2745 3086 gene locus_tag LOCUS_13320 2745 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3175 3402 gene locus_tag LOCUS_13330 3175 3402 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080917.1 protein_id gnl|my_center|LOCUS_13330 3967 4518 gene locus_tag LOCUS_13340 3967 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence094 1019 780 gene locus_tag LOCUS_13350 1019 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1484 3199 gene locus_tag LOCUS_13360 1484 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3304 3942 gene locus_tag LOCUS_13370 3304 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 4000 4875 gene locus_tag LOCUS_13380 4000 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence095 2584 1025 gene locus_tag LOCUS_13390 2584 1025 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889593.1 protein_id gnl|my_center|LOCUS_13390 2874 2617 gene locus_tag LOCUS_13400 2874 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13400 3145 2831 gene locus_tag LOCUS_13410 3145 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 4527 3190 gene locus_tag LOCUS_13420 4527 3190 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480136.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence096 367 549 gene locus_tag LOCUS_13430 367 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 760 1089 gene locus_tag LOCUS_13440 760 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1137 1517 gene locus_tag LOCUS_13450 1137 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1701 1895 gene locus_tag LOCUS_13460 1701 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2504 2860 gene locus_tag LOCUS_13470 2504 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2885 3106 gene locus_tag LOCUS_13480 2885 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3090 4532 gene locus_tag LOCUS_13490 3090 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence097 591 295 gene locus_tag LOCUS_13500 591 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 858 1067 gene locus_tag LOCUS_13510 858 1067 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_13510 1338 2243 gene locus_tag LOCUS_13520 1338 2243 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930722.1 protein_id gnl|my_center|LOCUS_13520 2289 2609 gene locus_tag LOCUS_13530 2289 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 2882 2655 gene locus_tag LOCUS_13540 2882 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3444 2860 gene locus_tag LOCUS_13550 3444 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846617.1 protein_id gnl|my_center|LOCUS_13550 <5458 3565 gene locus_tag LOCUS_13560 <5458 3565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005803351.1:efflux RND transporter permease subunit >Feature sequence098 772 1743 gene locus_tag LOCUS_13570 772 1743 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_13570 1747 2421 gene locus_tag LOCUS_13580 1747 2421 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816453.1 protein_id gnl|my_center|LOCUS_13580 2428 3909 gene locus_tag LOCUS_13590 2428 3909 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181950125.1 protein_id gnl|my_center|LOCUS_13590 3938 5110 gene locus_tag LOCUS_13600 3938 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence099 1406 579 gene locus_tag LOCUS_13610 gene ccsB 1406 579 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_13610 2047 1403 gene locus_tag LOCUS_13620 2047 1403 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811192.1 protein_id gnl|my_center|LOCUS_13620 2619 2047 gene locus_tag LOCUS_13630 gene amrA 2619 2047 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_13630 3068 2646 gene locus_tag LOCUS_13640 3068 2646 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257691.1 protein_id gnl|my_center|LOCUS_13640 3464 3126 gene locus_tag LOCUS_13650 3464 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13650 4144 3593 gene locus_tag LOCUS_13660 4144 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13660 3607 3616 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <5375 4137 gene locus_tag LOCUS_13670 <5375 4137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940682.1:DNA gyrase subunit A >Feature sequence100 720 43 gene locus_tag LOCUS_13680 720 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1993 800 gene locus_tag LOCUS_13690 1993 800 CDS product RES domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339587.1 protein_id gnl|my_center|LOCUS_13690 2620 2315 gene locus_tag LOCUS_13700 2620 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 2955 3143 gene locus_tag LOCUS_13710 2955 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 3278 4294 gene locus_tag LOCUS_13720 3278 4294 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_13720 4384 4310 gene locus_tag LOCUS_t00300 4384 4310 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <5344 4549 gene locus_tag LOCUS_13730 <5344 4549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545608.1:TIGR03960 family B12-binding radical SAM protein >Feature sequence101 802 545 gene locus_tag LOCUS_13740 802 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1176 937 gene locus_tag LOCUS_13750 1176 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2049 1213 gene locus_tag LOCUS_13760 2049 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3013 2054 gene locus_tag LOCUS_13770 3013 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 4329 3079 gene locus_tag LOCUS_13780 4329 3079 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157499.1 protein_id gnl|my_center|LOCUS_13780 <5338 4340 gene locus_tag LOCUS_13790 <5338 4340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294596.1:RtcB family protein >Feature sequence102 496 1137 gene locus_tag LOCUS_13800 496 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1138 2112 gene locus_tag LOCUS_13810 1138 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2115 2726 gene locus_tag LOCUS_13820 gene cysC 2115 2726 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence103 162 1049 gene locus_tag LOCUS_13830 gene mtnP 162 1049 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_13830 1086 1571 gene locus_tag LOCUS_13840 gene purE 1086 1571 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769750.1 protein_id gnl|my_center|LOCUS_13840 1603 2202 gene locus_tag LOCUS_13850 gene gmhA2 1603 2202 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857991.1 protein_id gnl|my_center|LOCUS_13850 3713 2199 gene locus_tag LOCUS_13860 gene dgt 3713 2199 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774969.1 protein_id gnl|my_center|LOCUS_13860 4009 4488 gene locus_tag LOCUS_13870 4009 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 <5306 4469 gene locus_tag LOCUS_13880 <5306 4469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000544125.1:ABC transporter ATP-binding protein >Feature sequence104 405 3050 gene locus_tag LOCUS_13890 405 3050 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880933.1 protein_id gnl|my_center|LOCUS_13890 3088 3798 gene locus_tag LOCUS_13900 3088 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3999 5120 gene locus_tag LOCUS_13910 gene cobT 3999 5120 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545250.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence105 187 459 gene locus_tag LOCUS_13920 187 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 967 671 gene locus_tag LOCUS_13930 967 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1247 960 gene locus_tag LOCUS_13940 1247 960 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249913.1 protein_id gnl|my_center|LOCUS_13940 1561 1346 gene locus_tag LOCUS_13950 1561 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3050 1620 gene locus_tag LOCUS_13960 3050 1620 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868347.1 protein_id gnl|my_center|LOCUS_13960 4516 3200 gene locus_tag LOCUS_13970 4516 3200 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_13970 5132 4776 gene locus_tag LOCUS_13980 5132 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence106 516 441 gene locus_tag LOCUS_t00310 516 441 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 750 1676 gene locus_tag LOCUS_13990 750 1676 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546572.1 protein_id gnl|my_center|LOCUS_13990 3099 1732 gene locus_tag LOCUS_14000 3099 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3205 4650 gene locus_tag LOCUS_14010 3205 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence107 1297 965 gene locus_tag LOCUS_14020 1297 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1582 1304 gene locus_tag LOCUS_14030 1582 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1979 1593 gene locus_tag LOCUS_14040 1979 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 2867 2055 gene locus_tag LOCUS_14050 2867 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3708 2929 gene locus_tag LOCUS_14060 3708 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 4054 3740 gene locus_tag LOCUS_14070 4054 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 4842 4132 gene locus_tag LOCUS_14080 4842 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4989 5139 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaataattacccagtaaaac >Feature sequence108 1494 265 gene locus_tag LOCUS_14090 1494 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1691 2629 gene locus_tag LOCUS_14100 1691 2629 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545034.1 protein_id gnl|my_center|LOCUS_14100 4040 2703 gene locus_tag LOCUS_14110 4040 2703 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943909.1 protein_id gnl|my_center|LOCUS_14110 <5131 4148 gene locus_tag LOCUS_14120 <5131 4148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943908.1:FAD-linked oxidase C-terminal domain-containing protein >Feature sequence109 651 1481 gene locus_tag LOCUS_14130 651 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1653 2549 gene locus_tag LOCUS_14140 1653 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 <5128 2587 gene locus_tag LOCUS_14150 <5128 2587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085920.1:formate dehydrogenase subunit alpha >Feature sequence110 131 841 gene locus_tag LOCUS_14160 gene thyX 131 841 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546288.1 protein_id gnl|my_center|LOCUS_14160 1042 2118 gene locus_tag LOCUS_14170 gene prfA 1042 2118 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947982.1 protein_id gnl|my_center|LOCUS_14170 2120 3049 gene locus_tag LOCUS_14180 gene prmC 2120 3049 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_14180 3042 4385 gene locus_tag LOCUS_14190 gene murA 3042 4385 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence111 2544 331 gene locus_tag LOCUS_14200 2544 331 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879233.1 protein_id gnl|my_center|LOCUS_14200 3328 2552 gene locus_tag LOCUS_14210 gene lsrF 3328 2552 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 protein_id gnl|my_center|LOCUS_14210 3571 3383 gene locus_tag LOCUS_14220 3571 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3851 3573 gene locus_tag LOCUS_14230 3851 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence112 1016 555 gene locus_tag LOCUS_14240 1016 555 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_14240 1280 1017 gene locus_tag LOCUS_14250 1280 1017 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249168.1 protein_id gnl|my_center|LOCUS_14250 1693 3387 gene locus_tag LOCUS_14260 1693 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 4914 4839 gene locus_tag LOCUS_t00320 4914 4839 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence113 941 234 gene locus_tag LOCUS_14270 941 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1861 1028 gene locus_tag LOCUS_14280 1861 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2913 2059 gene locus_tag LOCUS_14290 2913 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 4768 2900 gene locus_tag LOCUS_14300 4768 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence114 529 2874 gene locus_tag LOCUS_14310 gene priA 529 2874 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_14310 3021 3299 gene locus_tag LOCUS_14320 3021 3299 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_14320 3340 4473 gene locus_tag LOCUS_14330 gene miaB 3340 4473 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence115 872 2452 gene locus_tag LOCUS_14340 872 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2457 3311 gene locus_tag LOCUS_14350 gene nadC 2457 3311 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_14350 3420 4232 gene locus_tag LOCUS_14360 3420 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence116 524 1078 gene locus_tag LOCUS_14370 524 1078 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_14370 1188 1604 gene locus_tag LOCUS_14380 gene ndk 1188 1604 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545240.1 protein_id gnl|my_center|LOCUS_14380 1622 2272 gene locus_tag LOCUS_14390 gene nth 1622 2272 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387915.1 protein_id gnl|my_center|LOCUS_14390 2320 2742 gene locus_tag LOCUS_14400 2320 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 3382 2750 gene locus_tag LOCUS_14410 3382 2750 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_14410 3616 3975 gene locus_tag LOCUS_14420 3616 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 <4783 4001 gene locus_tag LOCUS_14430 <4783 4001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004597896.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence117 439 1056 gene locus_tag LOCUS_14440 439 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1046 2566 gene locus_tag LOCUS_14450 gene hyfF 1046 2566 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122577.1 protein_id gnl|my_center|LOCUS_14450 2567 4072 gene locus_tag LOCUS_14460 2567 4072 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024251.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence118 1216 554 gene locus_tag LOCUS_14470 1216 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2198 1209 gene locus_tag LOCUS_14480 gene fliM 2198 1209 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_14480 2781 2236 gene locus_tag LOCUS_14490 2781 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 3367 2957 gene locus_tag LOCUS_14500 3367 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 3854 3423 gene locus_tag LOCUS_14510 3854 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence119 <1 1105 gene locus_tag LOCUS_14520 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942233.1:translation initiation factor IF-2 1126 1479 gene locus_tag LOCUS_14530 gene rbfA 1126 1479 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694530.1 protein_id gnl|my_center|LOCUS_14530 1501 2637 gene locus_tag LOCUS_14540 1501 2637 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_14540 2643 3410 gene locus_tag LOCUS_14550 gene truB 2643 3410 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547805.1 protein_id gnl|my_center|LOCUS_14550 3454 3723 gene locus_tag LOCUS_14560 gene rpsO 3454 3723 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence120 389 964 gene locus_tag LOCUS_14570 389 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 971 1384 gene locus_tag LOCUS_14580 971 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1510 2349 gene locus_tag LOCUS_14590 1510 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 2342 2857 gene locus_tag LOCUS_14600 2342 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2870 3235 gene locus_tag LOCUS_14610 2870 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3232 4047 gene locus_tag LOCUS_14620 3232 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3685 3694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4074 4304 gene locus_tag LOCUS_14630 4074 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence121 1559 576 gene locus_tag LOCUS_14640 1559 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 2338 1556 gene locus_tag LOCUS_14650 2338 1556 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_14650 2671 2468 gene locus_tag LOCUS_14660 2671 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3848 2745 gene locus_tag LOCUS_14670 gene cofH 3848 2745 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878301.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence122 749 931 gene locus_tag LOCUS_14680 749 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 942 1151 gene locus_tag LOCUS_14690 942 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1295 1564 gene locus_tag LOCUS_14700 1295 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1577 1816 gene locus_tag LOCUS_14710 1577 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1816 2562 gene locus_tag LOCUS_14720 1816 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3010 3201 gene locus_tag LOCUS_14730 3010 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 3224 4318 gene locus_tag LOCUS_14740 3224 4318 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_14740 4409 4334 gene locus_tag LOCUS_t00330 4409 4334 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence123 386 1600 gene locus_tag LOCUS_14750 gene ftsZ 386 1600 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094113.1 protein_id gnl|my_center|LOCUS_14750 1625 2017 gene locus_tag LOCUS_14760 1625 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3771 1975 gene locus_tag LOCUS_14770 3771 1975 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_14770 4156 3779 gene locus_tag LOCUS_14780 4156 3779 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392610.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence124 1230 2114 gene locus_tag LOCUS_14790 1230 2114 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361991.1 protein_id gnl|my_center|LOCUS_14790 2244 3440 gene locus_tag LOCUS_14800 2244 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence125 369 1403 gene locus_tag LOCUS_14810 369 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1419 3314 gene locus_tag LOCUS_14820 gene mrdA 1419 3314 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence126 4039 1592 gene locus_tag LOCUS_14830 4039 1592 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence127 2849 1866 gene locus_tag LOCUS_14840 2849 1866 CDS product protein rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222005.1 protein_id gnl|my_center|LOCUS_14840 3174 3362 gene locus_tag LOCUS_14850 3174 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3589 3377 gene locus_tag LOCUS_14860 3589 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 3870 3532 gene locus_tag LOCUS_14870 3870 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence128 528 130 gene locus_tag LOCUS_14880 528 130 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681217.1 protein_id gnl|my_center|LOCUS_14880 739 530 gene locus_tag LOCUS_14890 739 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2145 850 gene locus_tag LOCUS_14900 2145 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3084 2167 gene locus_tag LOCUS_14910 3084 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 3425 3081 gene locus_tag LOCUS_14920 3425 3081 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080550.1 protein_id gnl|my_center|LOCUS_14920 3945 3427 gene locus_tag LOCUS_14930 3945 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence129 294 127 gene locus_tag LOCUS_14940 294 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 499 1671 gene locus_tag LOCUS_14950 499 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1664 2419 gene locus_tag LOCUS_14960 gene hddC 1664 2419 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857908.1 protein_id gnl|my_center|LOCUS_14960 2416 3462 gene locus_tag LOCUS_14970 2416 3462 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766012.1 protein_id gnl|my_center|LOCUS_14970 3502 4245 gene locus_tag LOCUS_14980 3502 4245 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence130 943 629 gene locus_tag LOCUS_14990 943 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 2149 950 gene locus_tag LOCUS_15000 2149 950 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986780.1 protein_id gnl|my_center|LOCUS_15000 2684 2130 gene locus_tag LOCUS_15010 gene coaD 2684 2130 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_15010 2855 3121 gene locus_tag LOCUS_15020 gene rpsT 2855 3121 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_15020 4097 3108 gene locus_tag LOCUS_15030 gene holA 4097 3108 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229987.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence131 457 173 gene locus_tag LOCUS_15040 457 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1643 474 gene locus_tag LOCUS_15050 1643 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2257 1640 gene locus_tag LOCUS_15060 2257 1640 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890570.1 protein_id gnl|my_center|LOCUS_15060 3265 2312 gene locus_tag LOCUS_15070 3265 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3453 3914 gene locus_tag LOCUS_15080 3453 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence132 1020 565 gene locus_tag LOCUS_15090 gene tolR 1020 565 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932318.1 protein_id gnl|my_center|LOCUS_15090 1768 1031 gene locus_tag LOCUS_15100 gene tolQ 1768 1031 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence133 1853 504 gene locus_tag LOCUS_15110 1853 504 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480136.1 protein_id gnl|my_center|LOCUS_15110 2022 3788 gene locus_tag LOCUS_15120 gene pilB 2022 3788 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence134 2468 1485 gene locus_tag LOCUS_15130 2468 1485 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_15130 3553 2456 gene locus_tag LOCUS_15140 gene carA 3553 2456 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931760.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence135 2021 258 gene locus_tag LOCUS_15150 gene pilB 2021 258 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_15150 2322 3527 gene locus_tag LOCUS_15160 2322 3527 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480136.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence136 1823 1440 gene locus_tag LOCUS_15170 1823 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 3033 1816 gene locus_tag LOCUS_15180 3033 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 3257 3036 gene locus_tag LOCUS_15190 3257 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 <4018 3261 gene locus_tag LOCUS_15200 <4018 3261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034353519.1:ParB/RepB/Spo0J family partition protein >Feature sequence137 139 597 gene locus_tag LOCUS_15210 139 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 881 1318 gene locus_tag LOCUS_15220 881 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1355 2167 gene locus_tag LOCUS_15230 1355 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2170 3243 gene locus_tag LOCUS_15240 2170 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 3233 3799 gene locus_tag LOCUS_15250 gene bapC 3233 3799 CDS product type 3 secretion system effector BapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188424.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence138 2204 1344 gene locus_tag LOCUS_15260 gene cobS 2204 1344 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948521.1 protein_id gnl|my_center|LOCUS_15260 3436 2309 gene locus_tag LOCUS_15270 gene cobT 3436 2309 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545250.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence139 <1 1749 gene locus_tag LOCUS_15280 <1 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963751.1:glycosyltransferase >Feature sequence140 281 1102 gene locus_tag LOCUS_15290 281 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2030 2129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2464 2377 gene locus_tag LOCUS_t00340 2464 2377 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3772 2534 gene locus_tag LOCUS_15300 gene hemW 3772 2534 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013191.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence141 407 1183 gene locus_tag LOCUS_15310 407 1183 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_15310 2913 1204 gene locus_tag LOCUS_15320 2913 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence142 2402 258 gene locus_tag LOCUS_15330 2402 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3432 2689 gene locus_tag LOCUS_15340 3432 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3521 3793 gene locus_tag LOCUS_15350 3521 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence143 776 174 gene locus_tag LOCUS_15360 776 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1981 866 gene locus_tag LOCUS_15370 1981 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 2538 1987 gene locus_tag LOCUS_15380 2538 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 3551 2562 gene locus_tag LOCUS_15390 gene dusB 3551 2562 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966475.1 protein_id gnl|my_center|LOCUS_15390 3814 3578 gene locus_tag LOCUS_15400 3814 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence144 485 970 gene locus_tag LOCUS_15410 485 970 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_15410 1126 1464 gene locus_tag LOCUS_15420 1126 1464 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384997.1 protein_id gnl|my_center|LOCUS_15420 1605 3017 gene locus_tag LOCUS_15430 gene glnA 1605 3017 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_15430 3659 3165 gene locus_tag LOCUS_15440 3659 3165 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence145 245 1675 gene locus_tag LOCUS_15450 gene bioA 245 1675 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939829.1 protein_id gnl|my_center|LOCUS_15450 1710 2333 gene locus_tag LOCUS_15460 1710 2333 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence146 <1 722 gene locus_tag LOCUS_15470 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096890.1:GDP-mannose 4,6-dehydratase 753 2066 gene locus_tag LOCUS_15480 753 2066 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_15480 2056 3189 gene locus_tag LOCUS_15490 2056 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence147 403 1503 gene locus_tag LOCUS_15500 403 1503 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227909.1 protein_id gnl|my_center|LOCUS_15500 2310 1534 gene locus_tag LOCUS_15510 2310 1534 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence148 3762 1690 gene locus_tag LOCUS_15520 3762 1690 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399552.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence149 429 136 gene locus_tag LOCUS_15530 gene hgcB 429 136 CDS product mercury methylation ferredoxin HgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_15530 1493 426 gene locus_tag LOCUS_15540 gene hgcA 1493 426 CDS product mercury methylation corrinoid protein HgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_15540 3334 1580 gene locus_tag LOCUS_15550 gene arsA 3334 1580 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890458.1 protein_id gnl|my_center|LOCUS_15550 3695 3369 gene locus_tag LOCUS_15560 gene arsD 3695 3369 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455950.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence150 2862 1417 gene locus_tag LOCUS_15570 2862 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 3064 2846 gene locus_tag LOCUS_15580 3064 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3446 3090 gene locus_tag LOCUS_15590 3446 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence151 <1 866 gene locus_tag LOCUS_15600 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545399.1:ABC transporter permease 3177 2392 gene locus_tag LOCUS_15610 3177 2392 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682206.1 protein_id gnl|my_center|LOCUS_15610 <3799 3181 gene locus_tag LOCUS_15620 <3799 3181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682204.1:DNA methyltransferase >Feature sequence152 475 401 gene locus_tag LOCUS_t00350 475 401 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1441 614 gene locus_tag LOCUS_15630 1441 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 2328 1510 gene locus_tag LOCUS_15640 2328 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 2673 2434 gene locus_tag LOCUS_15650 2673 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence153 1745 309 gene locus_tag LOCUS_15660 1745 309 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_15660 2774 1746 gene locus_tag LOCUS_15670 2774 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 <3776 2829 gene locus_tag LOCUS_15680 <3776 2829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546739.1:bifunctional riboflavin kinase/FAD synthetase >Feature sequence154 <1 1810 gene locus_tag LOCUS_15690 <1 1810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943552.1:homocysteine S-methyltransferase family protein 2070 3434 gene locus_tag LOCUS_15700 2070 3434 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964280.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence155 543 2165 gene locus_tag LOCUS_15710 543 2165 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546101.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence156 1951 23 gene locus_tag LOCUS_15720 gene rpoD 1951 23 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_15720 <3750 1958 gene locus_tag LOCUS_15730 <3750 1958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964611.1:DNA primase >Feature sequence157 <1 1330 gene locus_tag LOCUS_15740 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583045.1:glucodextranase DOMON-like domain-containing protein 1342 3504 gene locus_tag LOCUS_15750 1342 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence158 1137 445 gene locus_tag LOCUS_15760 1137 445 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545776.1 protein_id gnl|my_center|LOCUS_15760 1975 1151 gene locus_tag LOCUS_15770 gene trpC 1975 1151 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221930.1 protein_id gnl|my_center|LOCUS_15770 3026 1992 gene locus_tag LOCUS_15780 gene trpD 3026 1992 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880074.1 protein_id gnl|my_center|LOCUS_15780 3603 3037 gene locus_tag LOCUS_15790 3603 3037 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence159 824 1792 gene locus_tag LOCUS_15800 gene selD 824 1792 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051345820.1 protein_id gnl|my_center|LOCUS_15800 1835 3103 gene locus_tag LOCUS_15810 1835 3103 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941270.1 protein_id gnl|my_center|LOCUS_15810 <3674 3077 gene locus_tag LOCUS_15820 <3674 3077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583788.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN >Feature sequence160 296 66 gene locus_tag LOCUS_15830 gene rpsQ 296 66 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_15830 493 299 gene locus_tag LOCUS_15840 gene rpmC 493 299 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 protein_id gnl|my_center|LOCUS_15840 913 500 gene locus_tag LOCUS_15850 gene rplP 913 500 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_15850 1479 937 gene locus_tag LOCUS_15860 gene rpsC 1479 937 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_15860 1889 1548 gene locus_tag LOCUS_15870 gene rplV 1889 1548 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_15870 1568 1577 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2216 1920 gene locus_tag LOCUS_15880 gene rpsS 2216 1920 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_15880 3117 2290 gene locus_tag LOCUS_15890 gene rplB 3117 2290 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_15890 3418 3131 gene locus_tag LOCUS_15900 gene rplW 3418 3131 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213423.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence161 332 441 gene locus_tag LOCUS_r00010 332 441 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 565 1446 gene locus_tag LOCUS_15910 565 1446 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_15910 1820 3481 gene locus_tag LOCUS_15920 1820 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3539 3615 gene locus_tag LOCUS_t00360 3539 3615 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence162 194 763 gene locus_tag LOCUS_15930 gene efp 194 763 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938955.1 protein_id gnl|my_center|LOCUS_15930 828 1343 gene locus_tag LOCUS_15940 gene accB 828 1343 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472859.1 protein_id gnl|my_center|LOCUS_15940 1419 2759 gene locus_tag LOCUS_15950 gene accC 1419 2759 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_15950 2966 3349 gene locus_tag LOCUS_15960 gene gcvH 2966 3349 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942661.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence163 466 269 gene locus_tag LOCUS_15970 466 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 672 463 gene locus_tag LOCUS_15980 672 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 859 1059 gene locus_tag LOCUS_15990 859 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1398 1323 gene locus_tag LOCUS_t00370 1398 1323 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2536 1466 gene locus_tag LOCUS_16000 2536 1466 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_16000 2801 2589 gene locus_tag LOCUS_16010 2801 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence164 779 219 gene locus_tag LOCUS_16020 779 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1326 835 gene locus_tag LOCUS_16030 1326 835 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930675.1 protein_id gnl|my_center|LOCUS_16030 2193 1375 gene locus_tag LOCUS_16040 2193 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2799 2272 gene locus_tag LOCUS_16050 2799 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 <3590 2917 gene locus_tag LOCUS_16060 <3590 2917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228666.1:thiosulfohydrolase SoxB >Feature sequence165 2313 679 gene locus_tag LOCUS_16070 gene hyfB 2313 679 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_16070 2417 2602 gene locus_tag LOCUS_16080 2417 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 <3569 2713 gene locus_tag LOCUS_16090 <3569 2713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527789.1:molybdopterin oxidoreductase family protein >Feature sequence166 2311 98 gene locus_tag LOCUS_16100 2311 98 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948731.1 protein_id gnl|my_center|LOCUS_16100 3196 2420 gene locus_tag LOCUS_16110 gene lsrF 3196 2420 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 protein_id gnl|my_center|LOCUS_16110 3439 3251 gene locus_tag LOCUS_16120 3439 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence167 149 2575 gene locus_tag LOCUS_16130 149 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 2980 2582 gene locus_tag LOCUS_16140 2980 2582 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_16140 3207 2977 gene locus_tag LOCUS_16150 3207 2977 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence168 1975 641 gene locus_tag LOCUS_16160 1975 641 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454161.1 protein_id gnl|my_center|LOCUS_16160 2150 3211 gene locus_tag LOCUS_16170 2150 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence169 586 332 gene locus_tag LOCUS_16180 586 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 861 568 gene locus_tag LOCUS_16190 861 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1346 861 gene locus_tag LOCUS_16200 1346 861 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082186.1 protein_id gnl|my_center|LOCUS_16200 3372 1324 gene locus_tag LOCUS_16210 3372 1324 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267044.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence170 2841 1216 gene locus_tag LOCUS_16220 2841 1216 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546101.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence171 1126 1377 gene locus_tag LOCUS_16230 1126 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1370 1768 gene locus_tag LOCUS_16240 1370 1768 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958096.1 protein_id gnl|my_center|LOCUS_16240 2252 1854 gene locus_tag LOCUS_16250 2252 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2529 2278 gene locus_tag LOCUS_16260 2529 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence172 2677 17 gene locus_tag LOCUS_16270 gene ppdK 2677 17 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_16270 <3451 2741 gene locus_tag LOCUS_16280 <3451 2741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002244319.1:glycine--tRNA ligase subunit beta >Feature sequence173 1037 1243 gene locus_tag LOCUS_16290 1037 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1535 1260 gene locus_tag LOCUS_16300 1535 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1846 1613 gene locus_tag LOCUS_16310 1846 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2357 1884 gene locus_tag LOCUS_16320 2357 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3085 2375 gene locus_tag LOCUS_16330 3085 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence174 1150 398 gene locus_tag LOCUS_16340 1150 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2046 1261 gene locus_tag LOCUS_16350 gene flgG 2046 1261 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_16350 2896 2120 gene locus_tag LOCUS_16360 gene flgF 2896 2120 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence175 262 1374 gene locus_tag LOCUS_16370 262 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1625 1428 gene locus_tag LOCUS_16380 gene rpmB 1625 1428 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_16380 1876 2091 gene locus_tag LOCUS_16390 1876 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 <3383 2141 gene locus_tag LOCUS_16400 <3383 2141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942876.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence176 711 3275 gene locus_tag LOCUS_16410 711 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence177 2178 2777 gene locus_tag LOCUS_16420 2178 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2870 3064 gene locus_tag LOCUS_16430 2870 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence178 2149 557 gene locus_tag LOCUS_16440 gene glgA 2149 557 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence179 1168 2043 gene locus_tag LOCUS_16450 1168 2043 CDS product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862398.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence180 556 170 gene locus_tag LOCUS_16460 556 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1473 637 gene locus_tag LOCUS_16470 1473 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1819 1505 gene locus_tag LOCUS_16480 1819 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2610 1900 gene locus_tag LOCUS_16490 2610 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2919 2743 gene locus_tag LOCUS_16500 2919 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence181 168 950 gene locus_tag LOCUS_16510 gene rfbF 168 950 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648803.1 protein_id gnl|my_center|LOCUS_16510 1015 1233 gene locus_tag LOCUS_16520 1015 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1230 2918 gene locus_tag LOCUS_16530 1230 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence182 1642 239 gene locus_tag LOCUS_16540 1642 239 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_16540 2677 1649 gene locus_tag LOCUS_16550 2677 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2947 2956 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence183 1952 192 gene locus_tag LOCUS_16560 1952 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 3018 2158 gene locus_tag LOCUS_16570 gene cobS 3018 2158 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016745.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence184 517 867 gene locus_tag LOCUS_16580 517 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1397 1014 gene locus_tag LOCUS_16590 1397 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2000 1407 gene locus_tag LOCUS_16600 2000 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2183 2398 gene locus_tag LOCUS_16610 2183 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2389 2823 gene locus_tag LOCUS_16620 2389 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2836 3156 gene locus_tag LOCUS_16630 2836 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence185 12 761 gene locus_tag LOCUS_16640 12 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 783 2543 gene locus_tag LOCUS_16650 783 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence186 134 745 gene locus_tag LOCUS_16660 gene hisH 134 745 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_16660 775 1497 gene locus_tag LOCUS_16670 gene hisA 775 1497 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436675.1 protein_id gnl|my_center|LOCUS_16670 1502 2257 gene locus_tag LOCUS_16680 gene hisF 1502 2257 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_16680 2254 3009 gene locus_tag LOCUS_16690 gene hisIE 2254 3009 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583489.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence187 1324 785 gene locus_tag LOCUS_16700 1324 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 2406 1351 gene locus_tag LOCUS_16710 2406 1351 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880019.1 protein_id gnl|my_center|LOCUS_16710 <3078 2437 gene locus_tag LOCUS_16720 <3078 2437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000545443.1:NHL repeat-containing protein >Feature sequence188 451 179 gene locus_tag LOCUS_16730 451 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2075 975 gene locus_tag LOCUS_16740 2075 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 2995 2078 gene locus_tag LOCUS_16750 2995 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence189 883 218 gene locus_tag LOCUS_16760 883 218 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762300.1 protein_id gnl|my_center|LOCUS_16760 1207 2220 gene locus_tag LOCUS_16770 gene gap 1207 2220 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence190 772 161 gene locus_tag LOCUS_16780 772 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 <3038 800 gene locus_tag LOCUS_16790 <3038 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082796.1:leucine--tRNA ligase >Feature sequence191 1815 1618 gene locus_tag LOCUS_16800 1815 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2134 1826 gene locus_tag LOCUS_16810 2134 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 2676 2236 gene locus_tag LOCUS_16820 2676 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence192 2406 619 gene locus_tag LOCUS_16830 2406 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 <3027 2508 gene locus_tag LOCUS_16840 <3027 2508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546113.1:sigma-54 dependent transcriptional regulator >Feature sequence193 452 2665 gene locus_tag LOCUS_16850 452 2665 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948731.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence194 1329 691 gene locus_tag LOCUS_16860 1329 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1605 2003 gene locus_tag LOCUS_16870 1605 2003 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 protein_id gnl|my_center|LOCUS_16870 2267 2010 gene locus_tag LOCUS_16880 2267 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence195 <1 570 gene locus_tag LOCUS_16890 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704214.1:DNA polymerase I 851 2254 gene locus_tag LOCUS_16900 851 2254 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942285.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence196 1151 381 gene locus_tag LOCUS_16910 gene cobI 1151 381 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870276.1 protein_id gnl|my_center|LOCUS_16910 2712 1144 gene locus_tag LOCUS_16920 2712 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence197 1283 300 gene locus_tag LOCUS_16930 1283 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2655 1294 gene locus_tag LOCUS_16940 2655 1294 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250670.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence198 1563 235 gene locus_tag LOCUS_16950 gene mtaB 1563 235 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_16950 2753 1575 gene locus_tag LOCUS_16960 gene mnmA 2753 1575 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence199 304 816 gene locus_tag LOCUS_16970 304 816 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122322.1 protein_id gnl|my_center|LOCUS_16970 820 1416 gene locus_tag LOCUS_16980 820 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1413 1940 gene locus_tag LOCUS_16990 1413 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1937 2659 gene locus_tag LOCUS_17000 gene lptB 1937 2659 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404114.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence200 <2871 888 gene locus_tag LOCUS_17010 <2871 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546286.1:PBP1A family penicillin-binding protein >Feature sequence201 <1 988 gene locus_tag LOCUS_17020 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392192.1:IS21 family transposase 988 1737 gene locus_tag LOCUS_17030 gene istB 988 1737 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391832.1 protein_id gnl|my_center|LOCUS_17030 2574 2182 gene locus_tag LOCUS_17040 2574 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence202 46 594 gene locus_tag LOCUS_17050 46 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 651 1256 gene locus_tag LOCUS_17060 651 1256 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817154.1 protein_id gnl|my_center|LOCUS_17060 1271 2815 gene locus_tag LOCUS_17070 1271 2815 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202972.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence203 477 1928 gene locus_tag LOCUS_17080 477 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence204 2 343 gene locus_tag LOCUS_17090 2 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 560 635 gene locus_tag LOCUS_t00380 560 635 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2540 1014 gene locus_tag LOCUS_17100 2540 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence205 <1 678 gene locus_tag LOCUS_17110 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583806.1:glycosyltransferase family 2 protein 675 1721 gene locus_tag LOCUS_17120 675 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence206 2079 595 gene locus_tag LOCUS_17130 gene gltX 2079 595 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583633.1 protein_id gnl|my_center|LOCUS_17130 2664 2470 gene locus_tag LOCUS_17140 2664 2470 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015098.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence207 375 1853 gene locus_tag LOCUS_17150 375 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence208 2293 77 gene locus_tag LOCUS_17160 2293 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence209 210 7 gene locus_tag LOCUS_17170 gene cspC 210 7 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_17170 1119 355 gene locus_tag LOCUS_17180 gene rlmB 1119 355 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_17180 1952 1116 gene locus_tag LOCUS_17190 gene pyrF 1952 1116 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072377.1 protein_id gnl|my_center|LOCUS_17190 <2725 1953 gene locus_tag LOCUS_17200 <2725 1953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942416.1:S41 family peptidase >Feature sequence210 443 171 gene locus_tag LOCUS_17210 443 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 604 1392 gene locus_tag LOCUS_17220 604 1392 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943654.1 protein_id gnl|my_center|LOCUS_17220 1389 2180 gene locus_tag LOCUS_17230 1389 2180 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460802.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence211 665 1783 gene locus_tag LOCUS_17240 665 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 2275 2544 gene locus_tag LOCUS_17250 2275 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence212 <1 813 gene locus_tag LOCUS_17260 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545015.1:cyclic dehypoxanthinyl futalosine synthase 906 1265 gene locus_tag LOCUS_17270 gene dksA 906 1265 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_17270 1341 1742 gene locus_tag LOCUS_17280 1341 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence213 1080 283 gene locus_tag LOCUS_17290 1080 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1607 1086 gene locus_tag LOCUS_17300 1607 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1965 1615 gene locus_tag LOCUS_17310 1965 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence214 361 125 gene locus_tag LOCUS_17320 361 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1349 366 gene locus_tag LOCUS_17330 1349 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1614 1474 gene locus_tag LOCUS_17340 1614 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2513 1920 gene locus_tag LOCUS_17350 2513 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence215 282 1304 gene locus_tag LOCUS_17360 282 1304 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_17360 1769 1320 gene locus_tag LOCUS_17370 1769 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1978 1766 gene locus_tag LOCUS_17380 1978 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence216 1726 371 gene locus_tag LOCUS_17390 1726 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17390 2230 1739 gene locus_tag LOCUS_17400 2230 1739 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence217 <1 787 gene locus_tag LOCUS_17410 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544929.1:GDP-L-fucose synthase 765 1400 gene locus_tag LOCUS_17420 gene cysC 765 1400 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643136.1 protein_id gnl|my_center|LOCUS_17420 1429 2223 gene locus_tag LOCUS_17430 gene cysQ 1429 2223 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence218 303 1310 gene locus_tag LOCUS_17440 gene rfbB 303 1310 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_17440 1320 2192 gene locus_tag LOCUS_17450 gene rfbD 1320 2192 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_17450 2211 2220 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence219 1606 635 gene locus_tag LOCUS_17460 1606 635 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938190.1 protein_id gnl|my_center|LOCUS_17460 1635 1644 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <2578 1834 gene locus_tag LOCUS_17470 <2578 1834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036892525.1:lipoyl synthase >Feature sequence220 856 179 gene locus_tag LOCUS_17480 gene hisB 856 179 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546516.1 protein_id gnl|my_center|LOCUS_17480 2023 938 gene locus_tag LOCUS_17490 gene hisC 2023 938 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889400.1 protein_id gnl|my_center|LOCUS_17490 <2575 2026 gene locus_tag LOCUS_17500 <2575 2026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943721.1:histidinol dehydrogenase >Feature sequence221 916 665 gene locus_tag LOCUS_17510 916 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1413 1069 gene locus_tag LOCUS_17520 1413 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 <2568 1520 gene locus_tag LOCUS_17530 <2568 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011183219.1:AAA family ATPase >Feature sequence222 449 228 gene locus_tag LOCUS_17540 gene rpmE 449 228 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_17540 1258 485 gene locus_tag LOCUS_17550 gene kdsB 1258 485 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_17550 2063 1293 gene locus_tag LOCUS_17560 2063 1293 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924852.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence223 <1 1520 gene locus_tag LOCUS_17570 <1 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545423.1:DNA gyrase subunit A 1513 2535 gene locus_tag LOCUS_17580 1513 2535 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690430.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence224 1203 277 gene locus_tag LOCUS_17590 gene nuoH 1203 277 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence225 233 586 gene locus_tag LOCUS_17600 233 586 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_17600 577 1071 gene locus_tag LOCUS_17610 577 1071 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_17610 1106 1636 gene locus_tag LOCUS_17620 1106 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence226 <2510 1089 gene locus_tag LOCUS_17630 <2510 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880955.1:GspE/PulE family protein >Feature sequence227 414 1364 gene locus_tag LOCUS_17640 414 1364 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361991.1 protein_id gnl|my_center|LOCUS_17640 1379 2284 gene locus_tag LOCUS_17650 1379 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650