>Feature sequence001 1763 975 gene locus_tag LOCUS_00010 1763 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2070 2630 gene locus_tag LOCUS_00020 2070 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2692 3228 gene locus_tag LOCUS_00030 2692 3228 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_00030 3413 4228 gene locus_tag LOCUS_00040 3413 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4575 4997 gene locus_tag LOCUS_00050 gene mraZ 4575 4997 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060894.1 protein_id gnl|my_center|LOCUS_00050 4994 5938 gene locus_tag LOCUS_00060 gene rsmH 4994 5938 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_00060 5944 6465 gene locus_tag LOCUS_00070 5944 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6469 8301 gene locus_tag LOCUS_00080 6469 8301 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467433.1 protein_id gnl|my_center|LOCUS_00080 8304 9746 gene locus_tag LOCUS_00090 8304 9746 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_00090 9748 10791 gene locus_tag LOCUS_00100 gene mraY 9748 10791 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228040.1 protein_id gnl|my_center|LOCUS_00100 10800 12248 gene locus_tag LOCUS_00110 gene murD 10800 12248 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948316.1 protein_id gnl|my_center|LOCUS_00110 12245 13435 gene locus_tag LOCUS_00120 12245 13435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13468 14754 gene locus_tag LOCUS_00130 gene murG 13468 14754 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403336.1 protein_id gnl|my_center|LOCUS_00130 14751 16169 gene locus_tag LOCUS_00140 gene murC 14751 16169 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529126.1 protein_id gnl|my_center|LOCUS_00140 16156 17202 gene locus_tag LOCUS_00150 gene murB 16156 17202 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_00150 17168 17332 gene locus_tag LOCUS_00160 17168 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17351 18478 gene locus_tag LOCUS_00170 gene ftsZ 17351 18478 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_00170 18475 19257 gene locus_tag LOCUS_00180 18475 19257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19401 19982 gene locus_tag LOCUS_00190 19401 19982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20322 20591 gene locus_tag LOCUS_00200 20322 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20718 21701 gene locus_tag LOCUS_00210 20718 21701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22099 21755 gene locus_tag LOCUS_00220 22099 21755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22167 22994 gene locus_tag LOCUS_00230 22167 22994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 >Feature sequence002 948 487 gene locus_tag LOCUS_00240 948 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 1467 1150 gene locus_tag LOCUS_00250 1467 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 2036 1464 gene locus_tag LOCUS_00260 2036 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 3191 2514 gene locus_tag LOCUS_00270 gene udg 3191 2514 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980322.1 protein_id gnl|my_center|LOCUS_00270 4345 3284 gene locus_tag LOCUS_00280 4345 3284 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208036286.1 protein_id gnl|my_center|LOCUS_00280 4541 5140 gene locus_tag LOCUS_00290 4541 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 5142 6137 gene locus_tag LOCUS_00300 5142 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 6191 6724 gene locus_tag LOCUS_00310 gene rimI 6191 6724 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_00310 6750 7796 gene locus_tag LOCUS_00320 gene tsaD 6750 7796 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071502.1 protein_id gnl|my_center|LOCUS_00320 8158 8451 gene locus_tag LOCUS_00330 gene groES 8158 8451 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892970.1 protein_id gnl|my_center|LOCUS_00330 8503 10113 gene locus_tag LOCUS_00340 gene groL 8503 10113 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_00340 10276 11079 gene locus_tag LOCUS_00350 10276 11079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 11398 12561 gene locus_tag LOCUS_00360 11398 12561 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_00360 12558 14120 gene locus_tag LOCUS_00370 gene guaA 12558 14120 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_00370 14294 16210 gene locus_tag LOCUS_00380 gene pcrA 14294 16210 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_00380 16364 16792 gene locus_tag LOCUS_00390 16364 16792 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_00390 17182 18339 gene locus_tag LOCUS_00400 gene sucC 17182 18339 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730595.1 protein_id gnl|my_center|LOCUS_00400 18389 19273 gene locus_tag LOCUS_00410 gene sucD 18389 19273 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_00410 19273 20940 gene locus_tag LOCUS_00420 gene purH 19273 20940 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070798.1 protein_id gnl|my_center|LOCUS_00420 21006 21863 gene locus_tag LOCUS_00430 21006 21863 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222732.1 protein_id gnl|my_center|LOCUS_00430 21870 22733 gene locus_tag LOCUS_00440 gene metF 21870 22733 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_00440 >Feature sequence003 1656 325 gene locus_tag LOCUS_00450 1656 325 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_00450 3087 1813 gene locus_tag LOCUS_00460 gene clpX 3087 1813 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562779.1 protein_id gnl|my_center|LOCUS_00460 3794 3162 gene locus_tag LOCUS_00470 gene clpP 3794 3162 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_00470 5495 3909 gene locus_tag LOCUS_00480 gene tig 5495 3909 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730000.1 protein_id gnl|my_center|LOCUS_00480 6093 9299 gene locus_tag LOCUS_00490 6093 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 9265 11124 gene locus_tag LOCUS_00500 9265 11124 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093091.1 protein_id gnl|my_center|LOCUS_00500 11516 13258 gene locus_tag LOCUS_00510 11516 13258 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140397.1 protein_id gnl|my_center|LOCUS_00510 13255 14922 gene locus_tag LOCUS_00520 13255 14922 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140397.1 protein_id gnl|my_center|LOCUS_00520 15123 15728 gene locus_tag LOCUS_00530 15123 15728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 15728 17470 gene locus_tag LOCUS_00540 15728 17470 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_00540 17470 19002 gene locus_tag LOCUS_00550 17470 19002 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846891.1 protein_id gnl|my_center|LOCUS_00550 19771 19169 gene locus_tag LOCUS_00560 19771 19169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 >Feature sequence004 367 534 gene locus_tag LOCUS_00570 367 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 1060 743 gene locus_tag LOCUS_00580 1060 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00580 1902 1675 gene locus_tag LOCUS_00590 1902 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 3980 3255 gene locus_tag LOCUS_00600 3980 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 3980 4378 gene locus_tag LOCUS_00610 3980 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 4599 4748 gene locus_tag LOCUS_00620 4599 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 7576 6587 gene locus_tag LOCUS_00630 7576 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 9106 7616 gene locus_tag LOCUS_00640 9106 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 9469 9116 gene locus_tag LOCUS_00650 9469 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 11976 10675 gene locus_tag LOCUS_00660 11976 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 12451 11996 gene locus_tag LOCUS_00670 12451 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 13369 12605 gene locus_tag LOCUS_00680 13369 12605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 14804 14208 gene locus_tag LOCUS_00690 14804 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 16182 15691 gene locus_tag LOCUS_00700 16182 15691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 16566 16375 gene locus_tag LOCUS_00710 16566 16375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00710 >Feature sequence005 246 401 gene locus_tag LOCUS_00720 246 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 422 1462 gene locus_tag LOCUS_00730 422 1462 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620874.1 protein_id gnl|my_center|LOCUS_00730 4486 1577 gene locus_tag LOCUS_00740 4486 1577 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141534.1 protein_id gnl|my_center|LOCUS_00740 5549 4503 gene locus_tag LOCUS_00750 5549 4503 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222468.1 protein_id gnl|my_center|LOCUS_00750 5666 6877 gene locus_tag LOCUS_00760 gene disA 5666 6877 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015293.1 protein_id gnl|my_center|LOCUS_00760 7176 7652 gene locus_tag LOCUS_00770 7176 7652 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_00770 8046 9233 gene locus_tag LOCUS_00780 gene ispD 8046 9233 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 protein_id gnl|my_center|LOCUS_00780 9379 10254 gene locus_tag LOCUS_00790 gene rlmB 9379 10254 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724085.1 protein_id gnl|my_center|LOCUS_00790 11873 10251 gene locus_tag LOCUS_00800 11873 10251 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877518.1 protein_id gnl|my_center|LOCUS_00800 13507 12014 gene locus_tag LOCUS_00810 13507 12014 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957755.1 protein_id gnl|my_center|LOCUS_00810 13985 14076 gene locus_tag LOCUS_t00010 13985 14076 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14155 15711 gene locus_tag LOCUS_00820 gene rimO 14155 15711 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922374.1 protein_id gnl|my_center|LOCUS_00820 15711 16358 gene locus_tag LOCUS_00830 15711 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 >Feature sequence006 1 975 gene locus_tag LOCUS_00840 1 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 1254 1421 gene locus_tag LOCUS_00850 1254 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 2590 1553 gene locus_tag LOCUS_00860 2590 1553 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_00860 2696 3568 gene locus_tag LOCUS_00870 2696 3568 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229247.1 protein_id gnl|my_center|LOCUS_00870 4163 3777 gene locus_tag LOCUS_00880 4163 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 4343 5341 gene locus_tag LOCUS_00890 4343 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 5507 6487 gene locus_tag LOCUS_00900 5507 6487 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_00900 6926 8842 gene locus_tag LOCUS_00910 6926 8842 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992286.1 protein_id gnl|my_center|LOCUS_00910 8950 11298 gene locus_tag LOCUS_00920 8950 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 11389 12111 gene locus_tag LOCUS_00930 11389 12111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 12267 12752 gene locus_tag LOCUS_00940 gene coaD 12267 12752 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728327.1 protein_id gnl|my_center|LOCUS_00940 12749 13852 gene locus_tag LOCUS_00950 12749 13852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 13871 14473 gene locus_tag LOCUS_00960 13871 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 14710 15726 gene locus_tag LOCUS_00970 gene plsX 14710 15726 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_00970 >Feature sequence007 344 1210 gene locus_tag LOCUS_00980 344 1210 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892028.1 protein_id gnl|my_center|LOCUS_00980 1569 1892 gene locus_tag LOCUS_00990 1569 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 1927 5235 gene locus_tag LOCUS_01000 1927 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 6213 5368 gene locus_tag LOCUS_01010 6213 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 6840 7760 gene locus_tag LOCUS_01020 6840 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 7765 8517 gene locus_tag LOCUS_01030 7765 8517 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262393.1 protein_id gnl|my_center|LOCUS_01030 8511 9905 gene locus_tag LOCUS_01040 8511 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 9905 10714 gene locus_tag LOCUS_01050 9905 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 10853 12994 gene locus_tag LOCUS_01060 10853 12994 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_01060 >Feature sequence008 <1 864 gene locus_tag LOCUS_01070 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027782.1:acyl-CoA dehydrogenase 1011 2717 gene locus_tag LOCUS_01080 1011 2717 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_01080 2743 3201 gene locus_tag LOCUS_01090 2743 3201 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_01090 3201 5417 gene locus_tag LOCUS_01100 3201 5417 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_01100 5419 7944 gene locus_tag LOCUS_01110 5419 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 8504 8112 gene locus_tag LOCUS_01120 8504 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 9164 8724 gene locus_tag LOCUS_01130 9164 8724 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029173.1 protein_id gnl|my_center|LOCUS_01130 9779 9267 gene locus_tag LOCUS_01140 9779 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 11016 9889 gene locus_tag LOCUS_01150 gene dnaN 11016 9889 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803666.1 protein_id gnl|my_center|LOCUS_01150 12688 11243 gene locus_tag LOCUS_01160 gene dnaA 12688 11243 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_01160 13422 13129 gene locus_tag LOCUS_01170 13422 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 13623 13910 gene locus_tag LOCUS_01180 13623 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 13923 15206 gene locus_tag LOCUS_01190 gene yidC 13923 15206 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029289.1 protein_id gnl|my_center|LOCUS_01190 >Feature sequence009 800 1822 gene locus_tag LOCUS_01200 800 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 1809 2522 gene locus_tag LOCUS_01210 1809 2522 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_01210 3152 2694 gene locus_tag LOCUS_01220 gene rplI 3152 2694 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_01220 3751 3149 gene locus_tag LOCUS_01230 3751 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 4260 3754 gene locus_tag LOCUS_01240 4260 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 4644 4261 gene locus_tag LOCUS_01250 4644 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 5810 5010 gene locus_tag LOCUS_01260 gene panB 5810 5010 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028153345.1 protein_id gnl|my_center|LOCUS_01260 6436 5885 gene locus_tag LOCUS_01270 6436 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 6539 7219 gene locus_tag LOCUS_01280 6539 7219 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_01280 7243 8328 gene locus_tag LOCUS_01290 7243 8328 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_01290 9792 8392 gene locus_tag LOCUS_01300 9792 8392 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_01300 10269 10069 gene locus_tag LOCUS_01310 10269 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 10716 10552 gene locus_tag LOCUS_01320 10716 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 11778 11581 gene locus_tag LOCUS_01330 11778 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 12454 14040 gene locus_tag LOCUS_01340 12454 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 >Feature sequence010 <1 949 gene locus_tag LOCUS_01350 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977073.1:glycosyltransferase family 39 protein 2334 1210 gene locus_tag LOCUS_01360 2334 1210 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_01360 2669 5809 gene locus_tag LOCUS_01370 2669 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 5926 7185 gene locus_tag LOCUS_01380 5926 7185 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_01380 7203 8225 gene locus_tag LOCUS_01390 7203 8225 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257437.1 protein_id gnl|my_center|LOCUS_01390 8222 9130 gene locus_tag LOCUS_01400 8222 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 9141 11669 gene locus_tag LOCUS_01410 9141 11669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 11666 12277 gene locus_tag LOCUS_01420 11666 12277 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_01420 12441 13049 gene locus_tag LOCUS_01430 12441 13049 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_01430 <14333 13255 gene locus_tag LOCUS_01440 <14333 13255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005098433.1:o-succinylbenzoate--CoA ligase >Feature sequence011 3 1259 gene locus_tag LOCUS_01450 3 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 1313 3715 gene locus_tag LOCUS_01460 1313 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5185 3800 gene locus_tag LOCUS_01470 5185 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 6549 5278 gene locus_tag LOCUS_01480 6549 5278 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727188.1 protein_id gnl|my_center|LOCUS_01480 9104 6723 gene locus_tag LOCUS_01490 9104 6723 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729203.1 protein_id gnl|my_center|LOCUS_01490 9499 12891 gene locus_tag LOCUS_01500 9499 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 12910 13782 gene locus_tag LOCUS_01510 12910 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 >Feature sequence012 109 810 gene locus_tag LOCUS_01520 109 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 1527 1345 gene locus_tag LOCUS_01530 1527 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 1629 2732 gene locus_tag LOCUS_01540 1629 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 2744 3055 gene locus_tag LOCUS_01550 2744 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 4547 3213 gene locus_tag LOCUS_01560 4547 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 6050 4560 gene locus_tag LOCUS_01570 6050 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 6317 7342 gene locus_tag LOCUS_01580 gene gap 6317 7342 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_01580 7355 8491 gene locus_tag LOCUS_01590 7355 8491 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545367.1 protein_id gnl|my_center|LOCUS_01590 8488 9252 gene locus_tag LOCUS_01600 gene tpiA 8488 9252 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014466.1 protein_id gnl|my_center|LOCUS_01600 9373 9600 gene locus_tag LOCUS_01610 9373 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 12268 9653 gene locus_tag LOCUS_01620 12268 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 13370 12333 gene locus_tag LOCUS_01630 gene pheS 13370 12333 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_01630 >Feature sequence013 926 36 gene locus_tag LOCUS_01640 gene ftsX 926 36 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645021.1 protein_id gnl|my_center|LOCUS_01640 1678 932 gene locus_tag LOCUS_01650 gene ftsE 1678 932 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_01650 2909 1749 gene locus_tag LOCUS_01660 gene prfB 2909 1749 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082004.1 protein_id gnl|my_center|LOCUS_01660 5634 2851 gene locus_tag LOCUS_01670 gene secA 5634 2851 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080888.1 protein_id gnl|my_center|LOCUS_01670 7081 5717 gene locus_tag LOCUS_01680 gene ahcY 7081 5717 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258873.1 protein_id gnl|my_center|LOCUS_01680 8106 7084 gene locus_tag LOCUS_01690 8106 7084 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_01690 8385 8149 gene locus_tag LOCUS_01700 8385 8149 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408362.1 protein_id gnl|my_center|LOCUS_01700 9865 8378 gene locus_tag LOCUS_01710 9865 8378 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_01710 12061 9899 gene locus_tag LOCUS_01720 12061 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 >Feature sequence014 1724 984 gene locus_tag LOCUS_01730 1724 984 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_01730 4165 1721 gene locus_tag LOCUS_01740 4165 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 5089 4337 gene locus_tag LOCUS_01750 5089 4337 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869672.1 protein_id gnl|my_center|LOCUS_01750 5928 5155 gene locus_tag LOCUS_01760 5928 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 6869 5943 gene locus_tag LOCUS_01770 gene pdxS 6869 5943 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939476.1 protein_id gnl|my_center|LOCUS_01770 7704 6967 gene locus_tag LOCUS_01780 7704 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 9454 8117 gene locus_tag LOCUS_01790 gene pimA 9454 8117 CDS product phosphatidyl-myo-inositol alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728703.1 protein_id gnl|my_center|LOCUS_01790 10469 9594 gene locus_tag LOCUS_01800 10469 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 11374 10505 gene locus_tag LOCUS_01810 11374 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 >Feature sequence015 314 487 gene locus_tag LOCUS_01820 314 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 770 991 gene locus_tag LOCUS_01830 770 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 991 1563 gene locus_tag LOCUS_01840 991 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 1693 3219 gene locus_tag LOCUS_01850 gene secD 1693 3219 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805000.1 protein_id gnl|my_center|LOCUS_01850 3273 4880 gene locus_tag LOCUS_01860 3273 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 5024 7354 gene locus_tag LOCUS_01870 gene relA 5024 7354 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_01870 7401 8678 gene locus_tag LOCUS_01880 gene hisS 7401 8678 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_01880 8651 10567 gene locus_tag LOCUS_01890 gene aspS 8651 10567 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969102.1 protein_id gnl|my_center|LOCUS_01890 10651 11439 gene locus_tag LOCUS_01900 10651 11439 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_01900 >Feature sequence016 79 798 gene locus_tag LOCUS_01910 gene rplA 79 798 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_01910 869 1657 gene locus_tag LOCUS_01920 869 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 1882 2289 gene locus_tag LOCUS_01930 gene rplL 1882 2289 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053002.1 protein_id gnl|my_center|LOCUS_01930 2616 6248 gene locus_tag LOCUS_01940 gene rpoB 2616 6248 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_01940 6248 10336 gene locus_tag LOCUS_01950 6248 10336 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_01950 10320 11048 gene locus_tag LOCUS_01960 10320 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 12106 11189 gene locus_tag LOCUS_01970 12106 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 <12958 12280 gene locus_tag LOCUS_01980 <12958 12280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056253.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence017 1783 509 gene locus_tag LOCUS_01990 gene eno 1783 509 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856756.1 protein_id gnl|my_center|LOCUS_01990 2977 1898 gene locus_tag LOCUS_02000 2977 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 4778 3060 gene locus_tag LOCUS_02010 4778 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 5705 4782 gene locus_tag LOCUS_02020 5705 4782 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467188.1 protein_id gnl|my_center|LOCUS_02020 5964 9758 gene locus_tag LOCUS_02030 5964 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 12044 10116 gene locus_tag LOCUS_02040 gene ftsH 12044 10116 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_02040 >Feature sequence018 1032 595 gene locus_tag LOCUS_02050 1032 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 1877 1107 gene locus_tag LOCUS_02060 gene gpmA 1877 1107 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940195.1 protein_id gnl|my_center|LOCUS_02060 2389 2033 gene locus_tag LOCUS_02070 2389 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 3051 4886 gene locus_tag LOCUS_02080 gene dnaK 3051 4886 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_02080 4883 5725 gene locus_tag LOCUS_02090 4883 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 5739 7037 gene locus_tag LOCUS_02100 gene dnaJ 5739 7037 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401821.1 protein_id gnl|my_center|LOCUS_02100 7054 7425 gene locus_tag LOCUS_02110 7054 7425 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_02110 7484 9979 gene locus_tag LOCUS_02120 gene clpB 7484 9979 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401905.1 protein_id gnl|my_center|LOCUS_02120 10187 11467 gene locus_tag LOCUS_02130 10187 11467 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_02130 >Feature sequence019 1743 259 gene locus_tag LOCUS_02140 gene dop 1743 259 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_02140 2051 2578 gene locus_tag LOCUS_02150 2051 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 3235 2588 gene locus_tag LOCUS_02160 3235 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 3509 3246 gene locus_tag LOCUS_02170 3509 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 6072 4870 gene locus_tag LOCUS_02180 gene metK 6072 4870 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_02180 7418 6084 gene locus_tag LOCUS_02190 gene coaBC 7418 6084 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805084.1 protein_id gnl|my_center|LOCUS_02190 7770 7402 gene locus_tag LOCUS_02200 7770 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 8508 7882 gene locus_tag LOCUS_02210 gene gmk 8508 7882 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124620.1 protein_id gnl|my_center|LOCUS_02210 9014 8697 gene locus_tag LOCUS_02220 gene mihF 9014 8697 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907783.1 protein_id gnl|my_center|LOCUS_02220 9843 9148 gene locus_tag LOCUS_02230 gene pyrF 9843 9148 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460654.1 protein_id gnl|my_center|LOCUS_02230 10898 9903 gene locus_tag LOCUS_02240 10898 9903 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_02240 <12434 10953 gene locus_tag LOCUS_02250 <12434 10953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141767.1:carbamoyl-phosphate synthase large subunit >Feature sequence020 1747 2808 gene locus_tag LOCUS_02260 1747 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 2898 3161 gene locus_tag LOCUS_02270 2898 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 7130 4065 gene locus_tag LOCUS_02280 7130 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 10114 8111 gene locus_tag LOCUS_02290 10114 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 10239 10487 gene locus_tag LOCUS_02300 10239 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 11793 11972 gene locus_tag LOCUS_02310 11793 11972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence021 803 333 gene locus_tag LOCUS_02320 gene rpsG 803 333 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403456.1 protein_id gnl|my_center|LOCUS_02320 958 803 gene locus_tag LOCUS_02330 958 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 1326 955 gene locus_tag LOCUS_02340 gene rpsL 1326 955 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102113.1 protein_id gnl|my_center|LOCUS_02340 2240 3757 gene locus_tag LOCUS_02350 2240 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 4315 3839 gene locus_tag LOCUS_02360 gene folK 4315 3839 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984757.1 protein_id gnl|my_center|LOCUS_02360 4752 4390 gene locus_tag LOCUS_02370 gene folB 4752 4390 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230465.1 protein_id gnl|my_center|LOCUS_02370 5344 4757 gene locus_tag LOCUS_02380 5344 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 6308 5406 gene locus_tag LOCUS_02390 gene folP 6308 5406 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_02390 6867 6292 gene locus_tag LOCUS_02400 gene folE 6867 6292 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014794265.1 protein_id gnl|my_center|LOCUS_02400 7544 6993 gene locus_tag LOCUS_02410 gene hpt 7544 6993 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_02410 8853 7630 gene locus_tag LOCUS_02420 8853 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 8960 9970 gene locus_tag LOCUS_02430 8960 9970 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230475.1 protein_id gnl|my_center|LOCUS_02430 11260 9992 gene locus_tag LOCUS_02440 11260 9992 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_02440 <12073 11436 gene locus_tag LOCUS_02450 <12073 11436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001291837.1:NADP-dependent isocitrate dehydrogenase >Feature sequence022 <1 917 gene locus_tag LOCUS_02460 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053050.1:tRNA pseudouridine(38-40) synthase TruA 1070 1603 gene locus_tag LOCUS_02470 gene rplM 1070 1603 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_02470 1603 2013 gene locus_tag LOCUS_02480 gene rpsI 1603 2013 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_02480 2051 3439 gene locus_tag LOCUS_02490 gene glmM 2051 3439 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_02490 4605 3715 gene locus_tag LOCUS_02500 4605 3715 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681313.1 protein_id gnl|my_center|LOCUS_02500 4803 6230 gene locus_tag LOCUS_02510 4803 6230 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_02510 6220 7473 gene locus_tag LOCUS_02520 gene alr 6220 7473 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182683.1 protein_id gnl|my_center|LOCUS_02520 8181 7534 gene locus_tag LOCUS_02530 8181 7534 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_02530 8307 9635 gene locus_tag LOCUS_02540 8307 9635 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_02540 11289 9754 gene locus_tag LOCUS_02550 gene thiC 11289 9754 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814466.1 protein_id gnl|my_center|LOCUS_02550 >Feature sequence023 <1 811 gene locus_tag LOCUS_02560 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229824.1:mycothiol conjugate amidase Mca 2705 801 gene locus_tag LOCUS_02570 2705 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 5790 2740 gene locus_tag LOCUS_02580 5790 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 6311 6691 gene locus_tag LOCUS_02590 6311 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 7335 6943 gene locus_tag LOCUS_02600 gene rplS 7335 6943 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_02600 8420 7494 gene locus_tag LOCUS_02610 gene trmD 8420 7494 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_02610 8977 8423 gene locus_tag LOCUS_02620 8977 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 9357 9028 gene locus_tag LOCUS_02630 9357 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 9644 9354 gene locus_tag LOCUS_02640 gene rpsP 9644 9354 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 protein_id gnl|my_center|LOCUS_02640 11267 9681 gene locus_tag LOCUS_02650 gene ffh 11267 9681 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014851.1 protein_id gnl|my_center|LOCUS_02650 >Feature sequence024 50 1378 gene locus_tag LOCUS_02660 50 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 1921 1505 gene locus_tag LOCUS_02670 1921 1505 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980328.1 protein_id gnl|my_center|LOCUS_02670 2400 1924 gene locus_tag LOCUS_02680 2400 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 3037 2438 gene locus_tag LOCUS_02690 3037 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3700 3158 gene locus_tag LOCUS_02700 3700 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 5489 3816 gene locus_tag LOCUS_02710 5489 3816 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883384.1 protein_id gnl|my_center|LOCUS_02710 6349 5573 gene locus_tag LOCUS_02720 gene tatC 6349 5573 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410764.1 protein_id gnl|my_center|LOCUS_02720 7082 6444 gene locus_tag LOCUS_02730 7082 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 7995 7327 gene locus_tag LOCUS_02740 7995 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 9417 8059 gene locus_tag LOCUS_02750 gene pafA 9417 8059 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_02750 10261 9545 gene locus_tag LOCUS_02760 gene prcA 10261 9545 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_02760 11145 10258 gene locus_tag LOCUS_02770 gene prcB 11145 10258 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_02770 >Feature sequence025 70 795 gene locus_tag LOCUS_02780 70 795 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_02780 956 1927 gene locus_tag LOCUS_02790 956 1927 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877364.1 protein_id gnl|my_center|LOCUS_02790 2087 2725 gene locus_tag LOCUS_02800 2087 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2881 3156 gene locus_tag LOCUS_02810 2881 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 3158 3526 gene locus_tag LOCUS_02820 3158 3526 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931752.1 protein_id gnl|my_center|LOCUS_02820 3523 4536 gene locus_tag LOCUS_02830 3523 4536 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_02830 4590 5267 gene locus_tag LOCUS_02840 gene ybeY 4590 5267 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895867.1 protein_id gnl|my_center|LOCUS_02840 5556 5338 gene locus_tag LOCUS_02850 5556 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 5555 6712 gene locus_tag LOCUS_02860 5555 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 6783 7532 gene locus_tag LOCUS_02870 6783 7532 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015010.1 protein_id gnl|my_center|LOCUS_02870 7543 7710 gene locus_tag LOCUS_02880 7543 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 9421 7775 gene locus_tag LOCUS_02890 9421 7775 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056342.1 protein_id gnl|my_center|LOCUS_02890 10287 9490 gene locus_tag LOCUS_02900 10287 9490 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_02900 >Feature sequence026 124 1482 gene locus_tag LOCUS_02910 gene murA 124 1482 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229517.1 protein_id gnl|my_center|LOCUS_02910 1758 2105 gene locus_tag LOCUS_02920 1758 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 2179 2976 gene locus_tag LOCUS_02930 2179 2976 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_02930 3132 3965 gene locus_tag LOCUS_02940 3132 3965 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_02940 3997 4524 gene locus_tag LOCUS_02950 3997 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 5123 5431 gene locus_tag LOCUS_02960 5123 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 6880 5618 gene locus_tag LOCUS_02970 6880 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 7255 8301 gene locus_tag LOCUS_02980 gene hrcA 7255 8301 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_02980 8288 9427 gene locus_tag LOCUS_02990 gene dnaJ 8288 9427 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_02990 9528 10274 gene locus_tag LOCUS_03000 9528 10274 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228402.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence027 616 2400 gene locus_tag LOCUS_03010 616 2400 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964683.1 protein_id gnl|my_center|LOCUS_03010 2519 6454 gene locus_tag LOCUS_03020 gene cobN 2519 6454 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086495.1 protein_id gnl|my_center|LOCUS_03020 6454 8811 gene locus_tag LOCUS_03030 6454 8811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence028 5679 5972 gene locus_tag LOCUS_03040 5679 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 6204 6374 gene locus_tag LOCUS_03050 6204 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 6525 6704 gene locus_tag LOCUS_03060 6525 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 8028 8357 gene locus_tag LOCUS_03070 8028 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 8604 9017 gene locus_tag LOCUS_03080 8604 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence029 47 2716 gene locus_tag LOCUS_03090 gene alaS 47 2716 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014496.1 protein_id gnl|my_center|LOCUS_03090 2706 3161 gene locus_tag LOCUS_03100 2706 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 3264 4376 gene locus_tag LOCUS_03110 3264 4376 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413196.1 protein_id gnl|my_center|LOCUS_03110 4525 5367 gene locus_tag LOCUS_03120 4525 5367 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_03120 5467 6969 gene locus_tag LOCUS_03130 5467 6969 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013343.1 protein_id gnl|my_center|LOCUS_03130 8099 6960 gene locus_tag LOCUS_03140 8099 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 8181 9461 gene locus_tag LOCUS_03150 8181 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 9550 10326 gene locus_tag LOCUS_03160 9550 10326 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895306.1 protein_id gnl|my_center|LOCUS_03160 >Feature sequence030 2222 648 gene locus_tag LOCUS_03170 gene rpsA 2222 648 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014303.1 protein_id gnl|my_center|LOCUS_03170 2663 3040 gene locus_tag LOCUS_03180 2663 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 5700 3052 gene locus_tag LOCUS_03190 5700 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6442 5735 gene locus_tag LOCUS_03200 6442 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 7283 6561 gene locus_tag LOCUS_03210 gene lexA 7283 6561 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_03210 7345 7419 gene locus_tag LOCUS_t00020 7345 7419 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7858 8061 gene locus_tag LOCUS_03220 gene cspA 7858 8061 CDS product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 protein_id gnl|my_center|LOCUS_03220 8095 9054 gene locus_tag LOCUS_03230 8095 9054 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053875.1 protein_id gnl|my_center|LOCUS_03230 9637 9071 gene locus_tag LOCUS_03240 9637 9071 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403826.1 protein_id gnl|my_center|LOCUS_03240 <10298 9696 gene locus_tag LOCUS_03250 <10298 9696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393260.1:threonine--tRNA ligase >Feature sequence031 874 566 gene locus_tag LOCUS_03260 874 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 1114 875 gene locus_tag LOCUS_03270 1114 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 1408 1187 gene locus_tag LOCUS_03280 1408 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 3013 2405 gene locus_tag LOCUS_03290 3013 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3180 3818 gene locus_tag LOCUS_03300 3180 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 3834 4124 gene locus_tag LOCUS_03310 3834 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 4146 5894 gene locus_tag LOCUS_03320 4146 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 5895 6812 gene locus_tag LOCUS_03330 5895 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 6809 8002 gene locus_tag LOCUS_03340 6809 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 >Feature sequence032 1393 506 gene locus_tag LOCUS_03350 1393 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 1284 1293 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1984 2535 gene locus_tag LOCUS_03360 gene ogt 1984 2535 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406857.1 protein_id gnl|my_center|LOCUS_03360 2987 3625 gene locus_tag LOCUS_03370 2987 3625 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_03370 4967 3645 gene locus_tag LOCUS_03380 4967 3645 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_03380 4948 5625 gene locus_tag LOCUS_03390 4948 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 6066 5629 gene locus_tag LOCUS_03400 6066 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 6449 6075 gene locus_tag LOCUS_03410 6449 6075 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_03410 7396 6449 gene locus_tag LOCUS_03420 7396 6449 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013564.1 protein_id gnl|my_center|LOCUS_03420 8578 7406 gene locus_tag LOCUS_03430 8578 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 9451 8627 gene locus_tag LOCUS_03440 9451 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 >Feature sequence033 5251 2975 gene locus_tag LOCUS_03450 5251 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 5509 7683 gene locus_tag LOCUS_03460 5509 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 7883 8143 gene locus_tag LOCUS_03470 7883 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 8630 8109 gene locus_tag LOCUS_03480 8630 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 9198 8659 gene locus_tag LOCUS_03490 9198 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 >Feature sequence034 1749 145 gene locus_tag LOCUS_03500 1749 145 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466576.1 protein_id gnl|my_center|LOCUS_03500 2941 1742 gene locus_tag LOCUS_03510 2941 1742 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085331.1 protein_id gnl|my_center|LOCUS_03510 3382 3161 gene locus_tag LOCUS_03520 3382 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 4365 6320 gene locus_tag LOCUS_03530 4365 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 7442 6381 gene locus_tag LOCUS_03540 gene recA 7442 6381 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence035 470 721 gene locus_tag LOCUS_03550 470 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 1463 2305 gene locus_tag LOCUS_03560 1463 2305 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404626.1 protein_id gnl|my_center|LOCUS_03560 2302 3162 gene locus_tag LOCUS_03570 2302 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 3206 4111 gene locus_tag LOCUS_03580 3206 4111 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_03580 4099 4908 gene locus_tag LOCUS_03590 4099 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 4916 6574 gene locus_tag LOCUS_03600 gene recN 4916 6574 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014346.1 protein_id gnl|my_center|LOCUS_03600 6576 8348 gene locus_tag LOCUS_03610 6576 8348 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence036 188 1402 gene locus_tag LOCUS_03620 188 1402 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_03620 1668 5618 gene locus_tag LOCUS_03630 1668 5618 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775966.1 protein_id gnl|my_center|LOCUS_03630 6059 8023 gene locus_tag LOCUS_03640 6059 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 8013 8621 gene locus_tag LOCUS_03650 8013 8621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence037 <1 1016 gene locus_tag LOCUS_03660 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_061151682.1:thiolase family protein 1029 1982 gene locus_tag LOCUS_03670 1029 1982 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971448.1 protein_id gnl|my_center|LOCUS_03670 1989 2855 gene locus_tag LOCUS_03680 1989 2855 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_03680 2913 4739 gene locus_tag LOCUS_03690 2913 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 4766 5632 gene locus_tag LOCUS_03700 4766 5632 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144155.1 protein_id gnl|my_center|LOCUS_03700 5616 6911 gene locus_tag LOCUS_03710 5616 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 7110 8492 gene locus_tag LOCUS_03720 gene dnaB 7110 8492 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence038 1125 244 gene locus_tag LOCUS_03730 1125 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 1412 1122 gene locus_tag LOCUS_03740 1412 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 2136 1444 gene locus_tag LOCUS_03750 2136 1444 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 protein_id gnl|my_center|LOCUS_03750 2503 6042 gene locus_tag LOCUS_03760 gene metH 2503 6042 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_03760 6136 7602 gene locus_tag LOCUS_03770 gene lpdA 6136 7602 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230317.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence039 934 1371 gene locus_tag LOCUS_03780 934 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 2190 1735 gene locus_tag LOCUS_03790 2190 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 3407 3171 gene locus_tag LOCUS_03800 3407 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 4472 3735 gene locus_tag LOCUS_03810 4472 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 5100 4588 gene locus_tag LOCUS_03820 5100 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 5368 5607 gene locus_tag LOCUS_03830 5368 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 5782 5970 gene locus_tag LOCUS_03840 5782 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 6262 6615 gene locus_tag LOCUS_03850 6262 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 6612 7232 gene locus_tag LOCUS_03860 6612 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 7663 7496 gene locus_tag LOCUS_03870 7663 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence040 586 332 gene locus_tag LOCUS_03880 586 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 8287 710 gene locus_tag LOCUS_03890 8287 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence041 535 1671 gene locus_tag LOCUS_03900 535 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 2602 3900 gene locus_tag LOCUS_03910 2602 3900 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064343.1 protein_id gnl|my_center|LOCUS_03910 3963 5534 gene locus_tag LOCUS_03920 3963 5534 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_03920 5637 6422 gene locus_tag LOCUS_03930 5637 6422 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_03930 6438 6809 gene locus_tag LOCUS_03940 6438 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 8536 6800 gene locus_tag LOCUS_03950 8536 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence042 3346 209 gene locus_tag LOCUS_03960 3346 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 5326 3521 gene locus_tag LOCUS_03970 5326 3521 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_03970 7618 5396 gene locus_tag LOCUS_03980 gene uvrB 7618 5396 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_03980 8281 7670 gene locus_tag LOCUS_03990 gene coaE 8281 7670 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_03990 8619 8278 gene locus_tag LOCUS_04000 8619 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 >Feature sequence043 1217 1513 gene locus_tag LOCUS_04010 1217 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 2721 1540 gene locus_tag LOCUS_04020 2721 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 3673 2777 gene locus_tag LOCUS_04030 3673 2777 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928887.1 protein_id gnl|my_center|LOCUS_04030 5266 3674 gene locus_tag LOCUS_04040 5266 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 6648 5266 gene locus_tag LOCUS_04050 6648 5266 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976340.1 protein_id gnl|my_center|LOCUS_04050 7078 6749 gene locus_tag LOCUS_04060 7078 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 8172 7315 gene locus_tag LOCUS_04070 8172 7315 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892028.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence044 584 658 gene locus_tag LOCUS_t00030 584 658 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1010 1456 gene locus_tag LOCUS_04080 1010 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 1989 1582 gene locus_tag LOCUS_04090 1989 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 1957 2175 gene locus_tag LOCUS_04100 1957 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04100 2318 2740 gene locus_tag LOCUS_04110 2318 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 4492 3629 gene locus_tag LOCUS_04120 4492 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 4897 5076 gene locus_tag LOCUS_04130 4897 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 7343 7110 gene locus_tag LOCUS_04140 7343 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 7815 7408 gene locus_tag LOCUS_04150 7815 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 8105 8284 gene locus_tag LOCUS_04160 8105 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04160 >Feature sequence045 1 321 gene locus_tag LOCUS_04170 1 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 318 653 gene locus_tag LOCUS_04180 318 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 658 2664 gene locus_tag LOCUS_04190 658 2664 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_04190 2793 3557 gene locus_tag LOCUS_04200 2793 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 3741 4478 gene locus_tag LOCUS_04210 3741 4478 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079865.1 protein_id gnl|my_center|LOCUS_04210 4475 6259 gene locus_tag LOCUS_04220 4475 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 6337 7566 gene locus_tag LOCUS_04230 6337 7566 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence046 752 111 gene locus_tag LOCUS_04240 752 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 1557 1484 gene locus_tag LOCUS_t00040 1557 1484 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2515 1646 gene locus_tag LOCUS_04250 2515 1646 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_04250 7092 2581 gene locus_tag LOCUS_04260 7092 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 <8348 7226 gene locus_tag LOCUS_04270 <8348 7226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768344.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence047 <1 811 gene locus_tag LOCUS_04280 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255932.1:HAMP domain-containing protein 811 1338 gene locus_tag LOCUS_04290 811 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 1570 1346 gene locus_tag LOCUS_04300 1570 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 1957 2178 gene locus_tag LOCUS_04310 1957 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 2179 2550 gene locus_tag LOCUS_04320 2179 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2796 3725 gene locus_tag LOCUS_04330 gene ilvE 2796 3725 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_04330 3715 5442 gene locus_tag LOCUS_04340 gene cimA 3715 5442 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_04340 5476 5934 gene locus_tag LOCUS_04350 5476 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 6591 5995 gene locus_tag LOCUS_04360 6591 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 7554 6709 gene locus_tag LOCUS_04370 gene mutM 7554 6709 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_04370 8148 7564 gene locus_tag LOCUS_04380 8148 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence048 <1 1176 gene locus_tag LOCUS_04390 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087110.1:cysteine desulfurase family protein 3246 1213 gene locus_tag LOCUS_04400 gene dxs 3246 1213 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861141.1 protein_id gnl|my_center|LOCUS_04400 3127 3351 gene locus_tag LOCUS_04410 3127 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 3373 4539 gene locus_tag LOCUS_04420 3373 4539 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_04420 5225 4575 gene locus_tag LOCUS_04430 5225 4575 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_04430 7935 5227 gene locus_tag LOCUS_04440 7935 5227 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence049 4911 1150 gene locus_tag LOCUS_04450 gene smc 4911 1150 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068006.1 protein_id gnl|my_center|LOCUS_04450 5290 7224 gene locus_tag LOCUS_04460 5290 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 >Feature sequence050 249 437 gene locus_tag LOCUS_04470 249 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 1933 515 gene locus_tag LOCUS_04480 1933 515 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112031.1 protein_id gnl|my_center|LOCUS_04480 2358 4085 gene locus_tag LOCUS_04490 2358 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 4088 5590 gene locus_tag LOCUS_04500 4088 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5590 6078 gene locus_tag LOCUS_04510 5590 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 6075 6491 gene locus_tag LOCUS_04520 6075 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 6488 7207 gene locus_tag LOCUS_04530 gene atpB 6488 7207 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878188.1 protein_id gnl|my_center|LOCUS_04530 >Feature sequence051 135 1250 gene locus_tag LOCUS_04540 135 1250 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243172.1 protein_id gnl|my_center|LOCUS_04540 1252 2799 gene locus_tag LOCUS_04550 1252 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 2863 3132 gene locus_tag LOCUS_04560 2863 3132 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066611.1 protein_id gnl|my_center|LOCUS_04560 3442 3263 gene locus_tag LOCUS_04570 3442 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 3497 3820 gene locus_tag LOCUS_04580 3497 3820 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230176.1 protein_id gnl|my_center|LOCUS_04580 3813 5522 gene locus_tag LOCUS_04590 3813 5522 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895080.1 protein_id gnl|my_center|LOCUS_04590 5549 6373 gene locus_tag LOCUS_04600 5549 6373 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027662.1 protein_id gnl|my_center|LOCUS_04600 6363 7043 gene locus_tag LOCUS_04610 gene ureG 6363 7043 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230173.1 protein_id gnl|my_center|LOCUS_04610 7040 7843 gene locus_tag LOCUS_04620 7040 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 >Feature sequence052 1479 52 gene locus_tag LOCUS_04630 1479 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 1729 2592 gene locus_tag LOCUS_04640 gene thrB 1729 2592 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816738.1 protein_id gnl|my_center|LOCUS_04640 2941 4359 gene locus_tag LOCUS_04650 2941 4359 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_04650 5589 4639 gene locus_tag LOCUS_04660 5589 4639 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028014.1 protein_id gnl|my_center|LOCUS_04660 6280 5582 gene locus_tag LOCUS_04670 6280 5582 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_04670 6215 6454 gene locus_tag LOCUS_04680 6215 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 7728 6673 gene locus_tag LOCUS_04690 7728 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 >Feature sequence053 4294 3128 gene locus_tag LOCUS_04700 gene nusA 4294 3128 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_04700 4836 4291 gene locus_tag LOCUS_04710 4836 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 5244 5747 gene locus_tag LOCUS_04720 5244 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 5981 6799 gene locus_tag LOCUS_04730 5981 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 >Feature sequence054 71 370 gene locus_tag LOCUS_04740 71 370 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582457.1 protein_id gnl|my_center|LOCUS_04740 2891 1302 gene locus_tag LOCUS_04750 2891 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 4268 3030 gene locus_tag LOCUS_04760 4268 3030 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_04760 7009 4265 gene locus_tag LOCUS_04770 7009 4265 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_04770 7322 7603 gene locus_tag LOCUS_04780 7322 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence055 250 741 gene locus_tag LOCUS_04790 250 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 1618 791 gene locus_tag LOCUS_04800 1618 791 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_04800 1728 2132 gene locus_tag LOCUS_04810 1728 2132 CDS product hypoxia response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 protein_id gnl|my_center|LOCUS_04810 3157 2249 gene locus_tag LOCUS_04820 3157 2249 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112994.1 protein_id gnl|my_center|LOCUS_04820 4332 3286 gene locus_tag LOCUS_04830 4332 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 4624 5340 gene locus_tag LOCUS_04840 4624 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 5704 5444 gene locus_tag LOCUS_04850 5704 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 6134 5940 gene locus_tag LOCUS_04860 6134 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 7713 6448 gene locus_tag LOCUS_04870 7713 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence056 3455 1941 gene locus_tag LOCUS_04880 3455 1941 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389388.1 protein_id gnl|my_center|LOCUS_04880 5680 3452 gene locus_tag LOCUS_04890 5680 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 6346 5708 gene locus_tag LOCUS_04900 6346 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 7101 6427 gene locus_tag LOCUS_04910 7101 6427 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811419.1 protein_id gnl|my_center|LOCUS_04910 7368 7452 gene locus_tag LOCUS_t00050 7368 7452 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence057 2012 924 gene locus_tag LOCUS_04920 2012 924 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080096.1 protein_id gnl|my_center|LOCUS_04920 2620 2009 gene locus_tag LOCUS_04930 gene pth 2620 2009 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730530.1 protein_id gnl|my_center|LOCUS_04930 3279 2623 gene locus_tag LOCUS_04940 3279 2623 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_04940 4275 3301 gene locus_tag LOCUS_04950 4275 3301 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_04950 4678 4499 gene locus_tag LOCUS_04960 4678 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 5146 5373 gene locus_tag LOCUS_04970 5146 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 5380 5838 gene locus_tag LOCUS_04980 5380 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence058 1896 370 gene locus_tag LOCUS_04990 1896 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 2432 1923 gene locus_tag LOCUS_05000 gene sufU 2432 1923 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 protein_id gnl|my_center|LOCUS_05000 3901 2639 gene locus_tag LOCUS_05010 3901 2639 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_05010 4782 3967 gene locus_tag LOCUS_05020 gene sufC 4782 3967 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888738.1 protein_id gnl|my_center|LOCUS_05020 4882 7029 gene locus_tag LOCUS_05030 4882 7029 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence059 199 927 gene locus_tag LOCUS_05040 199 927 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_05040 1125 1361 gene locus_tag LOCUS_05050 1125 1361 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 protein_id gnl|my_center|LOCUS_05050 1381 2340 gene locus_tag LOCUS_05060 1381 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2340 3530 gene locus_tag LOCUS_05070 2340 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3763 4476 gene locus_tag LOCUS_05080 3763 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4492 6129 gene locus_tag LOCUS_05090 4492 6129 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056342.1 protein_id gnl|my_center|LOCUS_05090 6956 6318 gene locus_tag LOCUS_05100 6956 6318 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015010.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence060 1713 532 gene locus_tag LOCUS_05110 gene mshA 1713 532 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_05110 2443 2048 gene locus_tag LOCUS_05120 2443 2048 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029496.1 protein_id gnl|my_center|LOCUS_05120 3049 2453 gene locus_tag LOCUS_05130 3049 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3342 3046 gene locus_tag LOCUS_05140 3342 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 3897 3481 gene locus_tag LOCUS_05150 3897 3481 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531012.1 protein_id gnl|my_center|LOCUS_05150 4263 5381 gene locus_tag LOCUS_05160 4263 5381 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_05160 5683 6159 gene locus_tag LOCUS_05170 5683 6159 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227819.1 protein_id gnl|my_center|LOCUS_05170 6863 6363 gene locus_tag LOCUS_05180 6863 6363 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407695.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence061 1949 1113 gene locus_tag LOCUS_05190 1949 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3024 2074 gene locus_tag LOCUS_05200 3024 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5331 4099 gene locus_tag LOCUS_05210 5331 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 6329 5331 gene locus_tag LOCUS_05220 6329 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence062 30 773 gene locus_tag LOCUS_05230 30 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 1504 902 gene locus_tag LOCUS_05240 1504 902 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530566.1 protein_id gnl|my_center|LOCUS_05240 2159 1677 gene locus_tag LOCUS_05250 2159 1677 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_05250 2823 3563 gene locus_tag LOCUS_05260 2823 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 6778 3560 gene locus_tag LOCUS_05270 6778 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 >Feature sequence063 2087 786 gene locus_tag LOCUS_05280 2087 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 3165 2935 gene locus_tag LOCUS_05290 3165 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 3837 3349 gene locus_tag LOCUS_05300 3837 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence064 1422 748 gene locus_tag LOCUS_05310 1422 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 1733 2656 gene locus_tag LOCUS_05320 1733 2656 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_05320 3776 2637 gene locus_tag LOCUS_05330 3776 2637 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_05330 3970 4392 gene locus_tag LOCUS_05340 3970 4392 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_05340 5234 4464 gene locus_tag LOCUS_05350 5234 4464 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_05350 5414 5920 gene locus_tag LOCUS_05360 gene bpa 5414 5920 CDS product proteasome activator protein Bpa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900754.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence065 1159 533 gene locus_tag LOCUS_05370 1159 533 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 protein_id gnl|my_center|LOCUS_05370 1418 1969 gene locus_tag LOCUS_05380 1418 1969 CDS product CmcI family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001988952.1 protein_id gnl|my_center|LOCUS_05380 1959 2918 gene locus_tag LOCUS_05390 1959 2918 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527598.1 protein_id gnl|my_center|LOCUS_05390 2908 4866 gene locus_tag LOCUS_05400 2908 4866 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194786.1 protein_id gnl|my_center|LOCUS_05400 6234 5110 gene locus_tag LOCUS_05410 6234 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 6736 6221 gene locus_tag LOCUS_05420 6736 6221 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080407.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence066 1901 1044 gene locus_tag LOCUS_05430 1901 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 2450 1905 gene locus_tag LOCUS_05440 gene ruvC 2450 1905 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082392.1 protein_id gnl|my_center|LOCUS_05440 3882 2746 gene locus_tag LOCUS_05450 3882 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05450 4131 3898 gene locus_tag LOCUS_05460 4131 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 4399 5049 gene locus_tag LOCUS_05470 4399 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 5100 6056 gene locus_tag LOCUS_05480 gene nfo 5100 6056 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932008.1 protein_id gnl|my_center|LOCUS_05480 6716 6922 gene locus_tag LOCUS_05490 6716 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 >Feature sequence067 <1 1297 gene locus_tag LOCUS_05500 <1 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257715.1:methylmalonyl-CoA mutase family protein 1407 2453 gene locus_tag LOCUS_05510 1407 2453 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557336.1 protein_id gnl|my_center|LOCUS_05510 3047 2541 gene locus_tag LOCUS_05520 gene purE 3047 2541 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_05520 4773 3265 gene locus_tag LOCUS_05530 4773 3265 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143220.1 protein_id gnl|my_center|LOCUS_05530 4993 6231 gene locus_tag LOCUS_05540 4993 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence068 209 1153 gene locus_tag LOCUS_05550 209 1153 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256233.1 protein_id gnl|my_center|LOCUS_05550 1607 1200 gene locus_tag LOCUS_05560 gene flgC 1607 1200 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196467.1 protein_id gnl|my_center|LOCUS_05560 1810 2091 gene locus_tag LOCUS_05570 1810 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3883 2189 gene locus_tag LOCUS_05580 3883 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 6823 3938 gene locus_tag LOCUS_05590 6823 3938 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence069 815 1834 gene locus_tag LOCUS_05600 815 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 2094 3635 gene locus_tag LOCUS_05610 gene gcvPA 2094 3635 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_05610 3632 5179 gene locus_tag LOCUS_05620 gene gcvPB 3632 5179 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082890.1 protein_id gnl|my_center|LOCUS_05620 <6769 5519 gene locus_tag LOCUS_05630 <6769 5519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028715.1:two-component system sensor histidine kinase MtrB >Feature sequence070 1910 864 gene locus_tag LOCUS_05640 gene pheS 1910 864 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_05640 2712 1900 gene locus_tag LOCUS_05650 2712 1900 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808211.1 protein_id gnl|my_center|LOCUS_05650 3065 2709 gene locus_tag LOCUS_05660 gene rplT 3065 2709 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965656.1 protein_id gnl|my_center|LOCUS_05660 3359 3165 gene locus_tag LOCUS_05670 gene rpmI 3359 3165 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_05670 4797 3433 gene locus_tag LOCUS_05680 4797 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 4757 5014 gene locus_tag LOCUS_05690 4757 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 5015 5275 gene locus_tag LOCUS_05700 5015 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 >Feature sequence071 1054 842 gene locus_tag LOCUS_05710 1054 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 1876 1478 gene locus_tag LOCUS_05720 1876 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 2287 2135 gene locus_tag LOCUS_05730 2287 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2503 2321 gene locus_tag LOCUS_05740 2503 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2848 2558 gene locus_tag LOCUS_05750 2848 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3178 2996 gene locus_tag LOCUS_05760 3178 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 3231 6083 gene locus_tag LOCUS_05770 3231 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 >Feature sequence072 423 139 gene locus_tag LOCUS_05780 423 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 1254 514 gene locus_tag LOCUS_05790 gene sigR 1254 514 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_05790 2823 1432 gene locus_tag LOCUS_05800 gene radA 2823 1432 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_05800 5641 3152 gene locus_tag LOCUS_05810 5641 3152 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_05810 <6589 5999 gene locus_tag LOCUS_05820 <6589 5999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946409.1:acetoacetate decarboxylase >Feature sequence073 2467 32 gene locus_tag LOCUS_05830 2467 32 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728507.1 protein_id gnl|my_center|LOCUS_05830 3005 2748 gene locus_tag LOCUS_05840 gene rpsO 3005 2748 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257912.1 protein_id gnl|my_center|LOCUS_05840 3252 3932 gene locus_tag LOCUS_05850 3252 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 5043 3952 gene locus_tag LOCUS_05860 5043 3952 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121910865.1 protein_id gnl|my_center|LOCUS_05860 6015 5101 gene locus_tag LOCUS_05870 gene truB 6015 5101 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804656.1 protein_id gnl|my_center|LOCUS_05870 6402 6031 gene locus_tag LOCUS_05880 gene rbfA 6402 6031 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475824.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence074 1937 534 gene locus_tag LOCUS_05890 1937 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3238 2120 gene locus_tag LOCUS_05900 3238 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5255 3696 gene locus_tag LOCUS_05910 gene xylB 5255 3696 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141897420.1 protein_id gnl|my_center|LOCUS_05910 6372 5266 gene locus_tag LOCUS_05920 6372 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence075 1833 757 gene locus_tag LOCUS_05930 1833 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 2818 1871 gene locus_tag LOCUS_05940 2818 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 6099 2977 gene locus_tag LOCUS_05950 6099 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 >Feature sequence076 214 1230 gene locus_tag LOCUS_05960 214 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 1227 2072 gene locus_tag LOCUS_05970 1227 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 2401 2228 gene locus_tag LOCUS_05980 2401 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 2599 2447 gene locus_tag LOCUS_05990 2599 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2868 6011 gene locus_tag LOCUS_06000 2868 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence077 1330 815 gene locus_tag LOCUS_06010 1330 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 1446 1907 gene locus_tag LOCUS_06020 1446 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 2098 3369 gene locus_tag LOCUS_06030 2098 3369 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_06030 4269 3379 gene locus_tag LOCUS_06040 4269 3379 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_06040 4734 5234 gene locus_tag LOCUS_06050 4734 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 6003 5515 gene locus_tag LOCUS_06060 6003 5515 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_06060 6151 6236 gene locus_tag LOCUS_t00060 6151 6236 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence078 <1 875 gene locus_tag LOCUS_06070 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230703.1:PfkB family carbohydrate kinase 2079 910 gene locus_tag LOCUS_06080 2079 910 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_06080 2868 2110 gene locus_tag LOCUS_06090 2868 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3522 2926 gene locus_tag LOCUS_06100 3522 2926 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223605.1 protein_id gnl|my_center|LOCUS_06100 4373 3549 gene locus_tag LOCUS_06110 gene dapB 4373 3549 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804662.1 protein_id gnl|my_center|LOCUS_06110 4411 5673 gene locus_tag LOCUS_06120 4411 5673 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence079 1132 86 gene locus_tag LOCUS_06130 gene argF 1132 86 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_06130 2340 1129 gene locus_tag LOCUS_06140 2340 1129 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 protein_id gnl|my_center|LOCUS_06140 3516 2368 gene locus_tag LOCUS_06150 gene argB 3516 2368 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_06150 4715 3513 gene locus_tag LOCUS_06160 gene argJ 4715 3513 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908321.1 protein_id gnl|my_center|LOCUS_06160 5794 4769 gene locus_tag LOCUS_06170 gene argC 5794 4769 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965686.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence080 1017 175 gene locus_tag LOCUS_06180 1017 175 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111769.1 protein_id gnl|my_center|LOCUS_06180 1152 4022 gene locus_tag LOCUS_06190 1152 4022 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_06190 4083 6005 gene locus_tag LOCUS_06200 gene typA 4083 6005 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence081 1651 284 gene locus_tag LOCUS_06210 1651 284 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_06210 3154 1673 gene locus_tag LOCUS_06220 3154 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 4502 3192 gene locus_tag LOCUS_06230 gene lysA 4502 3192 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_06230 <6101 4529 gene locus_tag LOCUS_06240 <6101 4529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393887.1:arginine--tRNA ligase >Feature sequence082 15 1193 gene locus_tag LOCUS_06250 15 1193 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226452.1 protein_id gnl|my_center|LOCUS_06250 1527 1372 gene locus_tag LOCUS_06260 1527 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 2314 1721 gene locus_tag LOCUS_06270 2314 1721 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 protein_id gnl|my_center|LOCUS_06270 2620 4212 gene locus_tag LOCUS_06280 gene serA 2620 4212 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_06280 5052 4306 gene locus_tag LOCUS_06290 5052 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 <6074 5151 gene locus_tag LOCUS_06300 <6074 5151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730228.1:sulfate adenylyltransferase subunit CysN >Feature sequence083 103 30 gene locus_tag LOCUS_t00070 103 30 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1704 166 gene locus_tag LOCUS_06310 1704 166 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 protein_id gnl|my_center|LOCUS_06310 2174 1707 gene locus_tag LOCUS_06320 gene dut 2174 1707 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_06320 2319 2912 gene locus_tag LOCUS_06330 gene orn 2319 2912 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899361.1 protein_id gnl|my_center|LOCUS_06330 2927 3700 gene locus_tag LOCUS_06340 2927 3700 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640373.1 protein_id gnl|my_center|LOCUS_06340 5440 3788 gene locus_tag LOCUS_06350 5440 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence084 875 312 gene locus_tag LOCUS_06360 875 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 2444 1803 gene locus_tag LOCUS_06370 2444 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 2604 2431 gene locus_tag LOCUS_06380 2604 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 4291 2585 gene locus_tag LOCUS_06390 4291 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 5702 4464 gene locus_tag LOCUS_06400 5702 4464 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence085 1016 330 gene locus_tag LOCUS_06410 1016 330 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892123.1 protein_id gnl|my_center|LOCUS_06410 1761 1006 gene locus_tag LOCUS_06420 gene cmk 1761 1006 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_06420 3233 1857 gene locus_tag LOCUS_06430 gene aroA 3233 1857 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093191255.1 protein_id gnl|my_center|LOCUS_06430 3612 3244 gene locus_tag LOCUS_06440 gene aroH 3612 3244 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460212.1 protein_id gnl|my_center|LOCUS_06440 4541 3798 gene locus_tag LOCUS_06450 4541 3798 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_06450 5306 4653 gene locus_tag LOCUS_06460 gene scpB 5306 4653 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_06460 5943 5317 gene locus_tag LOCUS_06470 5943 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence086 1253 3451 gene locus_tag LOCUS_06480 1253 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06480 3501 4478 gene locus_tag LOCUS_06490 gene mshD 3501 4478 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_06490 5456 4539 gene locus_tag LOCUS_06500 5456 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence087 87 509 gene locus_tag LOCUS_06510 87 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 742 1533 gene locus_tag LOCUS_06520 742 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 1802 2085 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq actgtcaaggaattggtatcagcccagttacg 3897 2779 gene locus_tag LOCUS_06530 3897 2779 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103406.1 protein_id gnl|my_center|LOCUS_06530 5022 3973 gene locus_tag LOCUS_06540 5022 3973 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_06540 5162 5019 gene locus_tag LOCUS_06550 5162 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 <5922 5159 gene locus_tag LOCUS_06560 <5922 5159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000037020.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence088 1756 3834 gene locus_tag LOCUS_06570 1756 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 4008 4202 gene locus_tag LOCUS_06580 4008 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 4363 4130 gene locus_tag LOCUS_06590 4363 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 5241 5861 gene locus_tag LOCUS_06600 5241 5861 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence089 1132 413 gene locus_tag LOCUS_06610 1132 413 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_06610 1268 2620 gene locus_tag LOCUS_06620 gene der 1268 2620 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079328.1 protein_id gnl|my_center|LOCUS_06620 2889 3047 gene locus_tag LOCUS_06630 2889 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 3395 3159 gene locus_tag LOCUS_06640 3395 3159 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_06640 3675 5039 gene locus_tag LOCUS_06650 3675 5039 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence090 805 68 gene locus_tag LOCUS_06660 805 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 894 1112 gene locus_tag LOCUS_06670 894 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 1191 1466 gene locus_tag LOCUS_06680 1191 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 1483 1704 gene locus_tag LOCUS_06690 1483 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 1701 2066 gene locus_tag LOCUS_06700 1701 2066 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213210.1 protein_id gnl|my_center|LOCUS_06700 2117 2533 gene locus_tag LOCUS_06710 2117 2533 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728177.1 protein_id gnl|my_center|LOCUS_06710 2650 3192 gene locus_tag LOCUS_06720 gene def 2650 3192 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_06720 3565 3353 gene locus_tag LOCUS_06730 3565 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3761 4456 gene locus_tag LOCUS_06740 gene fmt 3761 4456 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338559.1 protein_id gnl|my_center|LOCUS_06740 4460 4726 gene locus_tag LOCUS_06750 4460 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 4829 5500 gene locus_tag LOCUS_06760 gene rpe 4829 5500 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence091 328 337 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1137 436 gene locus_tag LOCUS_06770 1137 436 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_06770 2098 1127 gene locus_tag LOCUS_06780 2098 1127 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_06780 3519 2095 gene locus_tag LOCUS_06790 3519 2095 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720833.1 protein_id gnl|my_center|LOCUS_06790 4417 3509 gene locus_tag LOCUS_06800 gene rfbD 4417 3509 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_06800 5556 4552 gene locus_tag LOCUS_06810 gene rfbB 5556 4552 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence092 1416 1646 gene locus_tag LOCUS_06820 1416 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3250 2024 gene locus_tag LOCUS_06830 3250 2024 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 protein_id gnl|my_center|LOCUS_06830 4454 3420 gene locus_tag LOCUS_06840 gene egtD 4454 3420 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967207.1 protein_id gnl|my_center|LOCUS_06840 <5736 4451 gene locus_tag LOCUS_06850 <5736 4451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004551490.1:ergothioneine biosynthesis protein EgtB >Feature sequence093 1135 299 gene locus_tag LOCUS_06860 1135 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 1644 1132 gene locus_tag LOCUS_06870 1644 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 3116 1641 gene locus_tag LOCUS_06880 gene fliI 3116 1641 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_06880 4134 3133 gene locus_tag LOCUS_06890 4134 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 4127 4348 gene locus_tag LOCUS_06900 4127 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 5257 4244 gene locus_tag LOCUS_06910 gene fliG 5257 4244 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392293.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence094 <1 541 gene locus_tag LOCUS_06920 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889670.1:hemolysin family protein 890 1501 gene locus_tag LOCUS_06930 890 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2978 1731 gene locus_tag LOCUS_06940 gene larC 2978 1731 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_06940 3204 3288 gene locus_tag LOCUS_t00080 3204 3288 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3856 4794 gene locus_tag LOCUS_06950 3856 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence095 777 166 gene locus_tag LOCUS_06960 gene tmk 777 166 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173647.1 protein_id gnl|my_center|LOCUS_06960 3784 797 gene locus_tag LOCUS_06970 gene topA 3784 797 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731080.1 protein_id gnl|my_center|LOCUS_06970 <5493 3877 gene locus_tag LOCUS_06980 <5493 3877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029076.1:sodium-translocating pyrophosphatase >Feature sequence096 1314 301 gene locus_tag LOCUS_06990 gene gmd 1314 301 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_06990 2074 1271 gene locus_tag LOCUS_07000 2074 1271 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088784.1 protein_id gnl|my_center|LOCUS_07000 2323 3105 gene locus_tag LOCUS_07010 2323 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 <5395 3261 gene locus_tag LOCUS_07020 <5395 3261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054828577.1:helicase-exonuclease AddAB subunit AddA >Feature sequence097 2053 1139 gene locus_tag LOCUS_07030 2053 1139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_07030 3012 2050 gene locus_tag LOCUS_07040 3012 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3416 4159 gene locus_tag LOCUS_07050 3416 4159 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_07050 <5374 4169 gene locus_tag LOCUS_07060 <5374 4169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003901660.1:acyl-CoA synthetase >Feature sequence098 1999 2511 gene locus_tag LOCUS_07070 gene rnhA 1999 2511 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228761.1 protein_id gnl|my_center|LOCUS_07070 2951 4483 gene locus_tag LOCUS_07080 2951 4483 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence099 397 158 gene locus_tag LOCUS_07090 397 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 610 419 gene locus_tag LOCUS_07100 610 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 1105 710 gene locus_tag LOCUS_07110 1105 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 1269 2405 gene locus_tag LOCUS_07120 1269 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2786 2710 gene locus_tag LOCUS_t00090 2786 2710 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3077 3916 gene locus_tag LOCUS_07130 3077 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 4518 4075 gene locus_tag LOCUS_07140 4518 4075 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence100 322 1224 gene locus_tag LOCUS_07150 322 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2882 1221 gene locus_tag LOCUS_07160 2882 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3570 3866 gene locus_tag LOCUS_07170 3570 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3863 4468 gene locus_tag LOCUS_07180 3863 4468 CDS product DUF6036 family nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958464.1 protein_id gnl|my_center|LOCUS_07180 <5264 4527 gene locus_tag LOCUS_07190 <5264 4527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020640552.1:LLM class F420-dependent oxidoreductase >Feature sequence101 169 660 gene locus_tag LOCUS_07200 169 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 668 1654 gene locus_tag LOCUS_07210 668 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 1728 2246 gene locus_tag LOCUS_07220 1728 2246 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_07220 2318 3721 gene locus_tag LOCUS_07230 2318 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 4641 4012 gene locus_tag LOCUS_07240 4641 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 >Feature sequence102 869 66 gene locus_tag LOCUS_07250 869 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 2417 2968 gene locus_tag LOCUS_07260 2417 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 3518 3847 gene locus_tag LOCUS_07270 3518 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 3926 4096 gene locus_tag LOCUS_07280 3926 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 4427 4807 gene locus_tag LOCUS_07290 4427 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence103 258 869 gene locus_tag LOCUS_07300 258 869 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729685.1 protein_id gnl|my_center|LOCUS_07300 1274 1029 gene locus_tag LOCUS_07310 1274 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 1240 1953 gene locus_tag LOCUS_07320 1240 1953 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_07320 1950 2909 gene locus_tag LOCUS_07330 1950 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3380 4465 gene locus_tag LOCUS_07340 3380 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence104 917 456 gene locus_tag LOCUS_07350 917 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 1084 2439 gene locus_tag LOCUS_07360 1084 2439 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285867.1 protein_id gnl|my_center|LOCUS_07360 2626 3975 gene locus_tag LOCUS_07370 2626 3975 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908887.1 protein_id gnl|my_center|LOCUS_07370 4056 5087 gene locus_tag LOCUS_07380 gene hemC 4056 5087 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 protein_id gnl|my_center|LOCUS_07380 >Feature sequence105 959 702 gene locus_tag LOCUS_07390 959 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 1053 1283 gene locus_tag LOCUS_07400 1053 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 1687 1355 gene locus_tag LOCUS_07410 1687 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 2622 1705 gene locus_tag LOCUS_07420 gene hisG 2622 1705 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_07420 3209 2619 gene locus_tag LOCUS_07430 3209 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 4422 3196 gene locus_tag LOCUS_07440 4422 3196 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_07440 <5149 4413 gene locus_tag LOCUS_07450 <5149 4413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976111.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD >Feature sequence106 3540 1858 gene locus_tag LOCUS_07460 3540 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4232 3678 gene locus_tag LOCUS_07470 gene aroQ 4232 3678 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531359.1 protein_id gnl|my_center|LOCUS_07470 <5126 4229 gene locus_tag LOCUS_07480 <5126 4229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052140.1:bifunctional shikimate kinase/3-dehydroquinate synthase >Feature sequence107 1277 450 gene locus_tag LOCUS_07490 1277 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2301 2086 gene locus_tag LOCUS_07500 2301 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3429 3250 gene locus_tag LOCUS_07510 3429 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3645 3481 gene locus_tag LOCUS_07520 3645 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 3599 4969 gene locus_tag LOCUS_07530 3599 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence108 <1 709 gene locus_tag LOCUS_07540 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392489.1:sensor histidine kinase 737 2182 gene locus_tag LOCUS_07550 gene proS 737 2182 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869066.1 protein_id gnl|my_center|LOCUS_07550 3091 2288 gene locus_tag LOCUS_07560 3091 2288 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446672.1 protein_id gnl|my_center|LOCUS_07560 4315 4040 gene locus_tag LOCUS_07570 4315 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 4525 4343 gene locus_tag LOCUS_07580 4525 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence109 1855 629 gene locus_tag LOCUS_07590 1855 629 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_07590 3306 1900 gene locus_tag LOCUS_07600 3306 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 3878 3309 gene locus_tag LOCUS_07610 gene frr 3878 3309 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893897.1 protein_id gnl|my_center|LOCUS_07610 4695 3958 gene locus_tag LOCUS_07620 gene pyrH 4695 3958 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence110 758 1468 gene locus_tag LOCUS_07630 758 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 2471 1743 gene locus_tag LOCUS_07640 2471 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2759 3601 gene locus_tag LOCUS_07650 2759 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4619 3603 gene locus_tag LOCUS_07660 gene adhP 4619 3603 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence111 771 1091 gene locus_tag LOCUS_07670 771 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 1646 1140 gene locus_tag LOCUS_07680 1646 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 2701 1784 gene locus_tag LOCUS_07690 2701 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 4166 2784 gene locus_tag LOCUS_07700 gene flgK 4166 2784 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_07700 4708 4205 gene locus_tag LOCUS_07710 4708 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence112 812 261 gene locus_tag LOCUS_07720 812 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 2509 4245 gene locus_tag LOCUS_07730 2509 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07730 >Feature sequence113 3328 1700 gene locus_tag LOCUS_07740 3328 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence114 <1 1764 gene locus_tag LOCUS_07750 <1 1764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726854.1:biotin carboxylase N-terminal domain-containing protein 1871 3742 gene locus_tag LOCUS_07760 1871 3742 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110557.1 protein_id gnl|my_center|LOCUS_07760 3886 4629 gene locus_tag LOCUS_07770 3886 4629 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089900.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence115 463 167 gene locus_tag LOCUS_07780 463 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 916 782 gene locus_tag LOCUS_07790 916 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 1312 1109 gene locus_tag LOCUS_07800 1312 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 1702 1406 gene locus_tag LOCUS_07810 1702 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 1920 3281 gene locus_tag LOCUS_07820 1920 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 4377 3784 gene locus_tag LOCUS_07830 4377 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence116 2649 1609 gene locus_tag LOCUS_07840 2649 1609 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_07840 2979 4085 gene locus_tag LOCUS_07850 2979 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 4752 4543 gene locus_tag LOCUS_07860 4752 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence117 1216 1545 gene locus_tag LOCUS_07870 1216 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2224 1553 gene locus_tag LOCUS_07880 2224 1553 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_07880 4547 3312 gene locus_tag LOCUS_07890 4547 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence118 2276 1038 gene locus_tag LOCUS_07900 2276 1038 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_07900 4038 2305 gene locus_tag LOCUS_07910 4038 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 <4787 4221 gene locus_tag LOCUS_07920 <4787 4221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546013.1:type IV-A pilus assembly ATPase PilB >Feature sequence119 213 620 gene locus_tag LOCUS_07930 213 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 826 1953 gene locus_tag LOCUS_07940 826 1953 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_07940 1953 2570 gene locus_tag LOCUS_07950 1953 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2567 3280 gene locus_tag LOCUS_07960 gene phoU 2567 3280 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_07960 4406 3387 gene locus_tag LOCUS_07970 4406 3387 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028472.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence120 1992 1852 gene locus_tag LOCUS_07980 1992 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3750 2335 gene locus_tag LOCUS_07990 3750 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4371 4093 gene locus_tag LOCUS_08000 4371 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence121 1124 216 gene locus_tag LOCUS_08010 gene prmC 1124 216 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_08010 2530 1436 gene locus_tag LOCUS_08020 gene prfA 2530 1436 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880532.1 protein_id gnl|my_center|LOCUS_08020 2730 2739 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <4752 2859 gene locus_tag LOCUS_08030 <4752 2859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030205.1:transcription termination factor Rho >Feature sequence122 374 96 gene locus_tag LOCUS_08040 gene rpsS 374 96 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_08040 1224 388 gene locus_tag LOCUS_08050 gene rplB 1224 388 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055646.1 protein_id gnl|my_center|LOCUS_08050 1535 1242 gene locus_tag LOCUS_08060 1535 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 2275 1532 gene locus_tag LOCUS_08070 gene rplD 2275 1532 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_08070 2955 2272 gene locus_tag LOCUS_08080 gene rplC 2955 2272 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403579.1 protein_id gnl|my_center|LOCUS_08080 3505 3188 gene locus_tag LOCUS_08090 gene rpsJ 3505 3188 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_08090 <4714 3535 gene locus_tag LOCUS_08100 <4714 3535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029795.1:elongation factor Tu >Feature sequence123 1357 806 gene locus_tag LOCUS_08110 1357 806 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_08110 2730 1366 gene locus_tag LOCUS_08120 2730 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 3705 2848 gene locus_tag LOCUS_08130 3705 2848 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226289.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence124 541 110 gene locus_tag LOCUS_08140 541 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1934 561 gene locus_tag LOCUS_08150 1934 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 2113 2652 gene locus_tag LOCUS_08160 gene rfbC 2113 2652 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_08160 <4667 2776 gene locus_tag LOCUS_08170 <4667 2776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730837.1:S9 family peptidase >Feature sequence125 1167 205 gene locus_tag LOCUS_08180 1167 205 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896329.1 protein_id gnl|my_center|LOCUS_08180 2806 1286 gene locus_tag LOCUS_08190 gene atpA 2806 1286 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896330.1 protein_id gnl|my_center|LOCUS_08190 4036 3008 gene locus_tag LOCUS_08200 4036 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 4594 4046 gene locus_tag LOCUS_08210 4594 4046 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059844.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence126 1757 261 gene locus_tag LOCUS_08220 1757 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 3311 2076 gene locus_tag LOCUS_08230 3311 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3724 4302 gene locus_tag LOCUS_08240 3724 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence127 4470 1084 gene locus_tag LOCUS_08250 4470 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence128 1887 1150 gene locus_tag LOCUS_08260 1887 1150 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612384.1 protein_id gnl|my_center|LOCUS_08260 2994 1978 gene locus_tag LOCUS_08270 gene rbsC 2994 1978 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001891150.1 protein_id gnl|my_center|LOCUS_08270 3882 2995 gene locus_tag LOCUS_08280 3882 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 <4512 3875 gene locus_tag LOCUS_08290 <4512 3875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532180.1:ribokinase >Feature sequence129 <1 587 gene locus_tag LOCUS_08300 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106518184.1:alpha/beta hydrolase 1622 744 gene locus_tag LOCUS_08310 1622 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 3303 3539 gene locus_tag LOCUS_08320 3303 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 4085 4372 gene locus_tag LOCUS_08330 4085 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence130 2941 785 gene locus_tag LOCUS_08340 gene mrdA 2941 785 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_08340 3624 2938 gene locus_tag LOCUS_08350 3624 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 <4450 3631 gene locus_tag LOCUS_08360 <4450 3631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976189.1:rod shape-determining protein MreC >Feature sequence131 252 28 gene locus_tag LOCUS_08370 252 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1134 445 gene locus_tag LOCUS_08380 1134 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1343 3505 gene locus_tag LOCUS_08390 1343 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 3964 3665 gene locus_tag LOCUS_08400 3964 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence132 857 1444 gene locus_tag LOCUS_08410 857 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 1434 1754 gene locus_tag LOCUS_08420 1434 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2713 1829 gene locus_tag LOCUS_08430 2713 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2698 2826 gene locus_tag LOCUS_08440 2698 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3063 3407 gene locus_tag LOCUS_08450 gene flgB 3063 3407 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463947.1 protein_id gnl|my_center|LOCUS_08450 3404 3811 gene locus_tag LOCUS_08460 gene flgC 3404 3811 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367329.1 protein_id gnl|my_center|LOCUS_08460 3819 4121 gene locus_tag LOCUS_08470 3819 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 4118 4240 gene locus_tag LOCUS_08480 4118 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence133 594 247 gene locus_tag LOCUS_08490 594 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1049 1453 gene locus_tag LOCUS_08500 1049 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1626 1420 gene locus_tag LOCUS_08510 1626 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2237 2082 gene locus_tag LOCUS_08520 2237 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2516 4240 gene locus_tag LOCUS_08530 2516 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence134 <1 2316 gene locus_tag LOCUS_08540 <1 2316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027759.1:mannose-1-phosphate guanyltransferase 3437 2406 gene locus_tag LOCUS_08550 3437 2406 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_08550 <4318 3430 gene locus_tag LOCUS_08560 <4318 3430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_108988152.1:2-oxoacid:acceptor oxidoreductase subunit alpha >Feature sequence135 116 1729 gene locus_tag LOCUS_08570 116 1729 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_08570 2169 1792 gene locus_tag LOCUS_08580 2169 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 3381 2398 gene locus_tag LOCUS_08590 3381 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence136 205 534 gene locus_tag LOCUS_08600 gene trxA 205 534 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_08600 560 1099 gene locus_tag LOCUS_08610 560 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2978 1056 gene locus_tag LOCUS_08620 2978 1056 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950408.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence137 <1 621 gene locus_tag LOCUS_08630 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727819.1:M20 family metallopeptidase 2239 650 gene locus_tag LOCUS_08640 2239 650 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_08640 3652 2420 gene locus_tag LOCUS_08650 gene moeB 3652 2420 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence138 1252 293 gene locus_tag LOCUS_08660 1252 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1353 2192 gene locus_tag LOCUS_08670 1353 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2232 2429 gene locus_tag LOCUS_08680 2232 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2748 2975 gene locus_tag LOCUS_08690 2748 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3039 3182 gene locus_tag LOCUS_08700 3039 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3516 3851 gene locus_tag LOCUS_08710 3516 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3861 4046 gene locus_tag LOCUS_08720 3861 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence139 409 1398 gene locus_tag LOCUS_08730 409 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 1395 2276 gene locus_tag LOCUS_08740 1395 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence140 1589 597 gene locus_tag LOCUS_08750 gene hemE 1589 597 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence141 1914 1729 gene locus_tag LOCUS_08760 1914 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2238 2101 gene locus_tag LOCUS_08770 2238 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2317 3201 gene locus_tag LOCUS_08780 2317 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence142 <1 944 gene locus_tag LOCUS_08790 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846386.1:MFS transporter 1862 1038 gene locus_tag LOCUS_08800 1862 1038 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_08800 2860 1868 gene locus_tag LOCUS_08810 2860 1868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence143 330 1181 gene locus_tag LOCUS_08820 330 1181 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_08820 1178 2278 gene locus_tag LOCUS_08830 1178 2278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence144 2688 1324 gene locus_tag LOCUS_08840 2688 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence145 537 1 gene locus_tag LOCUS_08850 537 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1927 539 gene locus_tag LOCUS_08860 1927 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 3561 2710 gene locus_tag LOCUS_08870 3561 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence146 654 1898 gene locus_tag LOCUS_08880 gene thrC 654 1898 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142060.1 protein_id gnl|my_center|LOCUS_08880 2047 2325 gene locus_tag LOCUS_08890 2047 2325 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence147 208 546 gene locus_tag LOCUS_08900 208 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1642 1914 gene locus_tag LOCUS_08910 1642 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence148 <1 654 gene locus_tag LOCUS_08920 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392311.1:flagellar biosynthesis protein FlhA 1297 1007 gene locus_tag LOCUS_08930 1297 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1371 2561 gene locus_tag LOCUS_08940 1371 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2568 3035 gene locus_tag LOCUS_08950 2568 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence149 1583 294 gene locus_tag LOCUS_08960 gene secY 1583 294 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403723.1 protein_id gnl|my_center|LOCUS_08960 2214 1726 gene locus_tag LOCUS_08970 gene rplO 2214 1726 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776358.1 protein_id gnl|my_center|LOCUS_08970 2549 2211 gene locus_tag LOCUS_08980 2549 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3103 2546 gene locus_tag LOCUS_08990 gene rpsE 3103 2546 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892859.1 protein_id gnl|my_center|LOCUS_08990 3508 3140 gene locus_tag LOCUS_09000 gene rplR 3508 3140 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130474831.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence150 364 519 gene locus_tag LOCUS_09010 364 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 528 911 gene locus_tag LOCUS_09020 528 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1014 1238 gene locus_tag LOCUS_09030 1014 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1645 2349 gene locus_tag LOCUS_09040 1645 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2337 2528 gene locus_tag LOCUS_09050 2337 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2525 2983 gene locus_tag LOCUS_09060 2525 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 2980 3594 gene locus_tag LOCUS_09070 2980 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence151 <1 862 gene locus_tag LOCUS_09080 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000136101.1:glycosyltransferase 1404 1667 gene locus_tag LOCUS_09090 1404 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3008 1794 gene locus_tag LOCUS_09100 3008 1794 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324693.1 protein_id gnl|my_center|LOCUS_09100 3703 3014 gene locus_tag LOCUS_09110 3703 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence152 433 1461 gene locus_tag LOCUS_09120 433 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1498 3270 gene locus_tag LOCUS_09130 1498 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence153 3029 123 gene locus_tag LOCUS_09140 3029 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence154 >Feature sequence155 77 457 gene locus_tag LOCUS_09150 gene rpsM 77 457 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285908.1 protein_id gnl|my_center|LOCUS_09150 465 881 gene locus_tag LOCUS_09160 gene rpsK 465 881 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892910.1 protein_id gnl|my_center|LOCUS_09160 1013 1660 gene locus_tag LOCUS_09170 gene rpsD 1013 1660 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_09170 1906 2841 gene locus_tag LOCUS_09180 1906 2841 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_09180 2852 3208 gene locus_tag LOCUS_09190 2852 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence156 928 89 gene locus_tag LOCUS_09200 928 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1053 1172 gene locus_tag LOCUS_09210 1053 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1377 1541 gene locus_tag LOCUS_09220 1377 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 2299 3159 gene locus_tag LOCUS_09230 2299 3159 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803894.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence157 96 2879 gene locus_tag LOCUS_09240 gene acnA 96 2879 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705737.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence158 <1 998 gene locus_tag LOCUS_09250 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_209484109.1:branched-chain amino acid ABC transporter ATP-binding protein/permease 1138 1896 gene locus_tag LOCUS_09260 1138 1896 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_09260 1896 2678 gene locus_tag LOCUS_09270 1896 2678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583301.1 protein_id gnl|my_center|LOCUS_09270 2917 3078 gene locus_tag LOCUS_09280 2917 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence159 1924 1805 gene locus_tag LOCUS_09290 1924 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2510 2776 gene locus_tag LOCUS_09300 2510 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence160 1329 2729 gene locus_tag LOCUS_09310 1329 2729 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095721.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence161 1454 855 gene locus_tag LOCUS_09320 1454 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1609 1824 gene locus_tag LOCUS_09330 1609 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence162 <1 872 gene locus_tag LOCUS_09340 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975499.1:tryptophan--tRNA ligase 1827 967 gene locus_tag LOCUS_09350 1827 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2843 2049 gene locus_tag LOCUS_09360 2843 2049 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_09360 3177 2827 gene locus_tag LOCUS_09370 3177 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence163 <1 1115 gene locus_tag LOCUS_09380 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839231.1:PD-(D/E)XK nuclease family protein >Feature sequence164 <1 981 gene locus_tag LOCUS_09390 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000025295.1:quinolinate synthase NadA 1059 1430 gene locus_tag LOCUS_09400 1059 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1801 1526 gene locus_tag LOCUS_09410 1801 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2542 1844 gene locus_tag LOCUS_09420 gene recO 2542 1844 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 protein_id gnl|my_center|LOCUS_09420 <3476 2594 gene locus_tag LOCUS_09430 <3476 2594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730116.1:acyl-CoA dehydrogenase family protein >Feature sequence165 1876 1373 gene locus_tag LOCUS_09440 1876 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence166 1076 186 gene locus_tag LOCUS_09450 1076 186 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_09450 2024 1080 gene locus_tag LOCUS_09460 2024 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 2265 3116 gene locus_tag LOCUS_09470 2265 3116 CDS product DUF929 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979644.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence167 <1 2430 gene locus_tag LOCUS_09480 <1 2430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001830785.1:leucine--tRNA ligase <3456 2489 gene locus_tag LOCUS_09490 <3456 2489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726861.1:LLM class F420-dependent oxidoreductase >Feature sequence168 166 288 gene locus_tag LOCUS_09500 166 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 297 1202 gene locus_tag LOCUS_09510 297 1202 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 protein_id gnl|my_center|LOCUS_09510 1527 2720 gene locus_tag LOCUS_09520 gene menC 1527 2720 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228259.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence169 243 2048 gene locus_tag LOCUS_09530 243 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence170 327 575 gene locus_tag LOCUS_09540 327 575 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003059797.1 protein_id gnl|my_center|LOCUS_09540 719 1558 gene locus_tag LOCUS_09550 gene ftcD 719 1558 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_09550 1992 1684 gene locus_tag LOCUS_09560 1992 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence171 138 1139 gene locus_tag LOCUS_09570 138 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1136 2095 gene locus_tag LOCUS_09580 1136 2095 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_09580 2092 2511 gene locus_tag LOCUS_09590 2092 2511 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence172 1584 376 gene locus_tag LOCUS_09600 gene tyrS 1584 376 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_09600 2202 1714 gene locus_tag LOCUS_09610 2202 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2444 2989 gene locus_tag LOCUS_09620 gene infC 2444 2989 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227848.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence173 <1 1596 gene locus_tag LOCUS_09630 <1 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976773.1:anthranilate synthase component I 1875 3095 gene locus_tag LOCUS_09640 1875 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence174 974 792 gene locus_tag LOCUS_09650 974 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence175 195 926 gene locus_tag LOCUS_09660 195 926 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046397.1 protein_id gnl|my_center|LOCUS_09660 1477 1713 gene locus_tag LOCUS_09670 1477 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1734 2693 gene locus_tag LOCUS_09680 1734 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence176 1677 268 gene locus_tag LOCUS_09690 1677 268 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539284.1 protein_id gnl|my_center|LOCUS_09690 <3297 1670 gene locus_tag LOCUS_09700 <3297 1670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878821.1:FGGY-family carbohydrate kinase >Feature sequence177 1248 343 gene locus_tag LOCUS_09710 1248 343 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence178 1747 332 gene locus_tag LOCUS_09720 gene fumC 1747 332 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958006.1 protein_id gnl|my_center|LOCUS_09720 2217 2666 gene locus_tag LOCUS_09730 2217 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2663 2953 gene locus_tag LOCUS_09740 2663 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3076 3150 gene locus_tag LOCUS_t00100 3076 3150 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence179 1485 757 gene locus_tag LOCUS_09750 gene istB 1485 757 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_09750 3041 1479 gene locus_tag LOCUS_09760 gene istA 3041 1479 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence180 1077 880 gene locus_tag LOCUS_09770 1077 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence181 >Feature sequence182 442 1638 gene locus_tag LOCUS_09780 442 1638 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229357.1 protein_id gnl|my_center|LOCUS_09780 1635 3032 gene locus_tag LOCUS_09790 gene argH 1635 3032 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729312.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence183 2618 2028 gene locus_tag LOCUS_09800 2618 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2806 2988 gene locus_tag LOCUS_09810 2806 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence184 2606 2292 gene locus_tag LOCUS_09820 2606 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2847 2644 gene locus_tag LOCUS_09830 2847 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence185 205 1620 gene locus_tag LOCUS_09840 205 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2856 1636 gene locus_tag LOCUS_09850 2856 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09850 >Feature sequence186 359 177 gene locus_tag LOCUS_09860 359 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 635 477 gene locus_tag LOCUS_09870 635 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 770 645 gene locus_tag LOCUS_09880 770 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1181 945 gene locus_tag LOCUS_09890 1181 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1604 1440 gene locus_tag LOCUS_09900 1604 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2021 1809 gene locus_tag LOCUS_09910 2021 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence187 2569 212 gene locus_tag LOCUS_09920 2569 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 <3182 2566 gene locus_tag LOCUS_09930 <3182 2566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227535.1:response regulator transcription factor >Feature sequence188 321 1217 gene locus_tag LOCUS_09940 321 1217 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727626.1 protein_id gnl|my_center|LOCUS_09940 1506 2807 gene locus_tag LOCUS_09950 gene menC 1506 2807 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence189 666 1109 gene locus_tag LOCUS_09960 666 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence190 >Feature sequence191 788 1276 gene locus_tag LOCUS_09970 788 1276 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316616.1 protein_id gnl|my_center|LOCUS_09970 2818 1310 gene locus_tag LOCUS_09980 2818 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence192 1521 352 gene locus_tag LOCUS_09990 1521 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2478 1738 gene locus_tag LOCUS_10000 2478 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence193 417 1778 gene locus_tag LOCUS_10010 417 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1779 2966 gene locus_tag LOCUS_10020 1779 2966 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence194 2122 308 gene locus_tag LOCUS_10030 2122 308 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence195 56 1642 gene locus_tag LOCUS_10040 gene cobA 56 1642 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_10040 1635 2720 gene locus_tag LOCUS_10050 gene hemB 1635 2720 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence196 902 2608 gene locus_tag LOCUS_10060 902 2608 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532864.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence197 56 829 gene locus_tag LOCUS_10070 56 829 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063198.1 protein_id gnl|my_center|LOCUS_10070 835 1866 gene locus_tag LOCUS_10080 835 1866 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 protein_id gnl|my_center|LOCUS_10080 1928 2713 gene locus_tag LOCUS_10090 1928 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence198 1417 1055 gene locus_tag LOCUS_10100 1417 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 2399 1923 gene locus_tag LOCUS_10110 2399 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2697 2569 gene locus_tag LOCUS_10120 2697 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence199 <1 621 gene locus_tag LOCUS_10130 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009993697.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA 692 2212 gene locus_tag LOCUS_10140 gene gatB 692 2212 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence200 1657 1430 gene locus_tag LOCUS_10150 1657 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1710 2600 gene locus_tag LOCUS_10160 1710 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence201 <1 1240 gene locus_tag LOCUS_10170 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223473.1:crotonyl-CoA carboxylase/reductase 1237 1680 gene locus_tag LOCUS_10180 gene mce 1237 1680 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence202 2419 248 gene locus_tag LOCUS_10190 2419 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence203 1110 1805 gene locus_tag LOCUS_10200 1110 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence204 1505 201 gene locus_tag LOCUS_10210 gene nuoF 1505 201 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_10210 2107 1508 gene locus_tag LOCUS_10220 2107 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 <2951 2125 gene locus_tag LOCUS_10230 <2951 2125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222455.1:NADH-quinone oxidoreductase subunit D >Feature sequence205 539 2077 gene locus_tag LOCUS_10240 539 2077 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence206 >Feature sequence207 1382 525 gene locus_tag LOCUS_10250 1382 525 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586168.1 protein_id gnl|my_center|LOCUS_10250 <2895 1839 gene locus_tag LOCUS_10260 <2895 1839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_091628724.1:FkbM family methyltransferase >Feature sequence208 182 1030 gene locus_tag LOCUS_10270 gene racE 182 1030 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774002.1 protein_id gnl|my_center|LOCUS_10270 1174 1854 gene locus_tag LOCUS_10280 1174 1854 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229453.1 protein_id gnl|my_center|LOCUS_10280 2017 2784 gene locus_tag LOCUS_10290 gene rph 2017 2784 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460930.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence209 <1 755 gene locus_tag LOCUS_10300 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210138.1:glutamate synthase small subunit 1129 2058 gene locus_tag LOCUS_10310 1129 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence210 382 158 gene locus_tag LOCUS_10320 382 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 448 621 gene locus_tag LOCUS_10330 448 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 <2869 788 gene locus_tag LOCUS_10340 <2869 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000466031.1:alpha-glucosidase >Feature sequence211 417 265 gene locus_tag LOCUS_10350 417 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1314 982 gene locus_tag LOCUS_10360 1314 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 2325 1327 gene locus_tag LOCUS_10370 2325 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence212 >Feature sequence213 273 1691 gene locus_tag LOCUS_10380 273 1691 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence214 334 771 gene locus_tag LOCUS_10390 334 771 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_10390 786 941 gene locus_tag LOCUS_10400 786 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1184 2704 gene locus_tag LOCUS_10410 1184 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence215 >Feature sequence216 611 1990 gene locus_tag LOCUS_10420 611 1990 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976340.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence217 <2801 500 gene locus_tag LOCUS_10430 <2801 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040055.1:ABC transporter ATP-binding protein >Feature sequence218 279 929 gene locus_tag LOCUS_10440 279 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1659 958 gene locus_tag LOCUS_10450 1659 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1601 1843 gene locus_tag LOCUS_10460 1601 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1853 2071 gene locus_tag LOCUS_10470 1853 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 <2791 2045 gene locus_tag LOCUS_10480 <2791 2045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005086601.1:acyl-CoA dehydrogenase family protein >Feature sequence219 <1 689 gene locus_tag LOCUS_10490 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775698.1:ROK family protein 799 1704 gene locus_tag LOCUS_10500 gene dapA 799 1704 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence220 466 254 gene locus_tag LOCUS_10510 466 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 636 860 gene locus_tag LOCUS_10520 636 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2070 913 gene locus_tag LOCUS_10530 2070 913 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_10530 <2773 2073 gene locus_tag LOCUS_10540 <2773 2073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870949.1:5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH >Feature sequence221 <2765 661 gene locus_tag LOCUS_10550 <2765 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001078432.1:class I SAM-dependent methyltransferase >Feature sequence222 932 1210 gene locus_tag LOCUS_10560 932 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1375 2208 gene locus_tag LOCUS_10570 1375 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 2232 2666 gene locus_tag LOCUS_10580 gene rplK 2232 2666 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222525.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence223 <1 851 gene locus_tag LOCUS_10590 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038537.1:decarboxylating 6-phosphogluconate dehydrogenase 892 2388 gene locus_tag LOCUS_10600 gene zwf 892 2388 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031084.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence224 995 201 gene locus_tag LOCUS_10610 995 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1819 1040 gene locus_tag LOCUS_10620 gene xth 1819 1040 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 protein_id gnl|my_center|LOCUS_10620 2393 1851 gene locus_tag LOCUS_10630 gene fabZ 2393 1851 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence225 649 1680 gene locus_tag LOCUS_10640 649 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1729 2118 gene locus_tag LOCUS_10650 gene rplP 1729 2118 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_10650 2122 2682 gene locus_tag LOCUS_10660 2122 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence226 <1 1183 gene locus_tag LOCUS_10670 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776397.1:pyridoxal phosphate-dependent aminotransferase <2744 1515 gene locus_tag LOCUS_10680 <2744 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404651.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence227 >Feature sequence228 <1 2119 gene locus_tag LOCUS_10690 <1 2119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919812.1:NADH-quinone oxidoreductase subunit NuoG >Feature sequence229 780 487 gene locus_tag LOCUS_10700 780 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1581 1087 gene locus_tag LOCUS_10710 1581 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1821 1681 gene locus_tag LOCUS_10720 1821 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2409 2119 gene locus_tag LOCUS_10730 2409 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence230 2164 938 gene locus_tag LOCUS_10740 2164 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence231 <1 996 gene locus_tag LOCUS_10750 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393782.1:type I glutamate--ammonia ligase note possible pseudo, frameshifted 1883 1245 gene locus_tag LOCUS_10760 gene glnR 1883 1245 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_10760 <2663 1883 gene locus_tag LOCUS_10770 <2663 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223124.1:type I glutamate--ammonia ligase >Feature sequence232 >Feature sequence233 271 774 gene locus_tag LOCUS_10780 gene nrdR 271 774 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057199.1 protein_id gnl|my_center|LOCUS_10780 830 1600 gene locus_tag LOCUS_10790 830 1600 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256262.1 protein_id gnl|my_center|LOCUS_10790 <2656 1663 gene locus_tag LOCUS_10800 <2656 1663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003408063.1:DNA polymerase I >Feature sequence234 363 1748 gene locus_tag LOCUS_10810 363 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence235 495 567 gene locus_tag LOCUS_t00110 495 567 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1446 607 gene locus_tag LOCUS_10820 1446 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2239 1511 gene locus_tag LOCUS_10830 2239 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2436 2509 gene locus_tag LOCUS_t00120 2436 2509 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence236 636 2558 gene locus_tag LOCUS_10840 636 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence237 1227 928 gene locus_tag LOCUS_10850 1227 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence238 499 371 gene locus_tag LOCUS_10860 499 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1088 468 gene locus_tag LOCUS_10870 gene kdpC 1088 468 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391518.1 protein_id gnl|my_center|LOCUS_10870 <2617 1312 gene locus_tag LOCUS_10880 <2617 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973322.1:potassium-transporting ATPase subunit KdpB >Feature sequence239 149 2182 gene locus_tag LOCUS_10890 gene tkt 149 2182 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence240 1228 272 gene locus_tag LOCUS_10900 1228 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1368 1502 gene locus_tag LOCUS_10910 1368 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1542 2177 gene locus_tag LOCUS_10920 1542 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2178 2414 gene locus_tag LOCUS_10930 2178 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence241 <2604 1734 gene locus_tag LOCUS_10940 <2604 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003900204.1:D-xylulose kinase >Feature sequence242 461 1756 gene locus_tag LOCUS_10950 461 1756 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879900.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence243 742 86 gene locus_tag LOCUS_10960 gene npdG 742 86 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_10960 968 1735 gene locus_tag LOCUS_10970 968 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence244 <1 1158 gene locus_tag LOCUS_10980 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775856.1:Rne/Rng family ribonuclease 1429 1884 gene locus_tag LOCUS_10990 1429 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1894 2139 gene locus_tag LOCUS_11000 gene rpmA 1894 2139 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811713.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence245 894 136 gene locus_tag LOCUS_11010 894 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2276 1185 gene locus_tag LOCUS_11020 2276 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2221 2457 gene locus_tag LOCUS_11030 2221 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence246 161 397 gene locus_tag LOCUS_11040 161 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 398 859 gene locus_tag LOCUS_11050 398 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1952 927 gene locus_tag LOCUS_11060 1952 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence247 1204 2418 gene locus_tag LOCUS_11070 1204 2418 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480158.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence248 781 110 gene locus_tag LOCUS_11080 gene purQ 781 110 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666774.1 protein_id gnl|my_center|LOCUS_11080 1187 918 gene locus_tag LOCUS_11090 gene purS 1187 918 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393546.1 protein_id gnl|my_center|LOCUS_11090 2077 1190 gene locus_tag LOCUS_11100 2077 1190 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_11100 2314 2144 gene locus_tag LOCUS_11110 2314 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110